Isothermal single-reaction probe set for on-site detection of gene mutations and use thereof

Abstract

The present invention relates to a method for detecting a target gene and a gene mutation using isothermal single reaction and lateral flow immunoassay. The detection method according to the present invention enables sequence-specific nucleic acid detection and mutation detection at the level of single nucleotide polymorphism (SNP) discrimination, thereby providing a method capable of sensitively distinguishing mutations within a short time. In particular, since sequence-specific nucleic acid detection and single nucleotide polymorphism (SNP) discrimination can be visually confirmed directly through the LFA system, the method has high utility for on-site diagnosis.

Description

Isothermal single-reaction probe set for on-site detection of genetic mutations and use thereof

[0001] The present invention relates to an isothermal single reaction probe set for on-site detection of genetic mutations and its use.

[0002] After the entire human genome was decoded, active research on single nucleotide polymorphisms (SNPs), which are differences in single base pairs that appear based on individual and racial diversity, is being conducted to identify links to disease. While 99.9% of human genes are identical, 0.1-0.5% differences in SNPs and CNVs (copy number variations) can lead to individual and racial genetic characteristics such as constitution, appearance, and disease. It is also known that differences in the efficacy, effectiveness, and response to the same medication across individuals are also due to differences in SNPs and CNVs.

[0003] For example, the genes encoding cytochrome P450 (CYP) enzymes, which are important for drug metabolism in the body, exhibit polymorphism, and the mutant enzymes expressed according to these gene polymorphisms exhibit differences in enzyme activity. This is known to affect drug metabolism, causing differences in toxicity or efficacy for the relevant drug, and causing differences in drug response between individuals. Therefore, when administering drugs that are substrates for CYP enzymes, it is necessary to identify individual SNPs to determine the genotype and accurately determine the drug and drug dosage that are suitable for the individual patient.

[0004] Furthermore, SNPs play a crucial role not only in DNA sequence analysis but also as markers for identifying genes that cause diseases such as cancer, asthma, and diabetes, or for determining associations with specific diseases. Therefore, analyzing SNPs can help determine an individual's susceptibility to certain diseases, potentially contributing to the prevention of congenital diseases caused by variations in base sequence or the treatment of already-onset diseases.

[0005] In response to this need, SNP analysis for individual patients is expanding, and demand for rapid and accurate on-site analysis is growing. However, existing molecular diagnostics face several limitations, including the requirement for specialized equipment and personnel, the need for laboratory setup for sample preprocessing, the potential for secondary contamination during the preprocessing process, and low specificity for genetic mutations, making them insufficient for practical use.

[0006] Accordingly, the present inventors have developed a method for detecting mutations at the single nucleotide polymorphism (SNP) level, capable of being visually distinguished, using isothermal single reaction and lateral flow immunoassay, thereby completing the present invention. The present invention can provide a composition and method for on-site genetic mutation detection, capable of sensitively detecting mutations in a short period of time without requiring expensive equipment or skilled personnel.

[0007] An object of the present invention is to provide a composition for detecting a target nucleic acid, comprising: an isothermal one-pot reaction SENSR probe set for detecting a target nucleic acid, including a first probe and a second probe; a first preparation including a nucleic acid for preventing double-stranded recombination of at least one target gene; and a second preparation including a first detection probe to which a first label is bound; and a second detection probe to which a second label is bound.

[0008] Another object of the present invention is to provide a kit for detecting a target gene, comprising (a) a target nucleic acid signal amplification composition comprising a composition for detecting a target nucleic acid according to the present invention; a ligation agent; a polymerase; and an isothermal single reaction solution; and (b) a lateral flow immunoassay (LFA) substrate in which a sample pad, a conjugation pad, and a test membrane having a test line formed thereon are sequentially arranged.

[0009] Another object of the present invention is to provide a method for detecting a target gene, comprising: (a) a step of separating a double strand of a target gene at a high temperature of 80 to 100°C; (b) a step of cooling the reaction product of (a) to an isothermal temperature of 15 to 50°C, adding a composition for detecting target nucleic acid to perform an isothermal single reaction, and reacting with a detection probe; and (c) a step of confirming fluorescence expression or color development.

[0010] The terminology used herein is for the purpose of description only and should not be construed as limiting. The singular expression includes the plural expression unless the context clearly indicates otherwise. In this specification, the terms "comprises" or "has" and the like are intended to specify the presence of a feature, number, step, operation, component, part, or combination thereof described in the specification, but should be understood to not preclude the presence or addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.

[0011] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments pertain. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and shall not be interpreted in an idealized or overly formal sense unless explicitly defined herein.

[0012] Hereinafter, the present invention will be described in detail.

[0013] The principle of the isothermal single-reaction probe set according to the present invention can be confirmed through the existing RNA detection technology [Sensitive splint-based one-pot isothermal RNA detection (SENSR); hereinafter referred to as SENSR technology; Nat Biomed Eng 4, 1168-1179 (2020)], and this is described in detail as follows.

[0014] The present invention provides an isothermal one-pot reaction SENSR probe set for detecting target nucleic acids, comprising a first probe and a second probe; a first preparation comprising a nucleic acid for preventing double-strand recombination of at least one target gene; and

[0015] A composition for detecting a target nucleic acid, comprising: a first detection probe to which a first label is bound; a second detection probe to which a second label is bound; and a second preparation comprising the same.

[0016] The above first probe is a promoter probe (PP) having a structure of the following general formula I;

[0017] 3'-X- Y-5' (I)

[0018] In the above general formula (I),

[0019] The above X is a stem-loop structure region including a promoter sequence recognizable by RNA polymerase; the above Y is a UHS (Upstream Hybridization Sequence) region having a hybridization sequence complementary to a target nucleic acid sequence; the target nucleic acid sequence is DNA or RNA; the above X and Y are deoxyribonucleotides;

[0020] The second probe is a reporter probe (RP) having a structure of the following general formula II;

[0021] 3'-Y'-Z-5' (II)

[0022] In the above general formula (II),

[0023] The above Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; the above Z is a linear sequence site having the first detection probe and second detection probe sequences; the target nucleic acid sequence is DNA or RNA; the above Y' and Z are deoxyribonucleotides;

[0024] The present invention provides a composition for detecting a target nucleic acid, wherein the nucleic acid for preventing double-stranded recombination of the target gene is a sequence complementary to the target nucleic acid sequence at the 3' terminal position or the 5' terminal position of the complementary binding region of the SENSR probe set.

[0025] The above target nucleic acid may be any nucleic acid of any origin as long as it is a nucleic acid of a gene to be detected, but may be any one selected from the group consisting of genes of viruses, harmful bacteria, and animals including humans.

[0026] At this time, the gene of the animal including the human may be the nucleic acid itself of the gene or a single nucleotide polymorphism (SNP) gene of the animal.

[0027] The principle and schematic diagram of a composition comprising an isothermal single reaction probe set (SENSR probe set) according to the present invention, a nucleic acid for preventing double-stranded recombination of at least one target gene, a first detection probe, and a second detection probe are shown in Fig. 1, and the specific description thereof is as follows.

[0028] The target sequence for detection in the present invention corresponds to a nucleic acid sequence forming a double bond. Any nucleic acid sequence forming a double bond, from any origin, can be used as the target sequence for detection in the present invention.

[0029] For example, according to one embodiment of the present invention, a single-stranded region is created using amplified DNA fragments (PCR amplicons) of a PCR result, and this region is used for the purpose of detecting nucleic acids in a sequence-specific manner and for the purpose of detecting whether a mutation exists in the region.

[0030] The above mutation may be any one selected from genetic mutations of, for example, viruses, harmful bacteria, and animals including humans.

[0031] At this time, the genetic mutation of the animal including the human may be, for example, a single nucleotide polymorphism (SNP) genetic mutation.

[0032] In the present invention, the principle of generating a single-strand region of a double-stranded nucleic acid sequence is as follows.

[0033] In general, nucleic acid sequences (e.g., experimentally, PCR amplicons) tend to form a double-stranded structure, which is a form in which single strands with complementary sequences are joined together. This double-stranded structure is very stable, but when the temperature of the nucleic acid sequence forming the double-stranded structure is raised above 80℃, which is the denaturation temperature, the complementary single strands separate from each other, and can exist in a single-stranded state. If the temperature is lowered again below the melting temperature, the double-stranded structure is reverted to a stable double-stranded structure.

[0034] At this time, if there are single-stranded nucleic acid (DNA / RNA) fragments that are complementary to the single strand but shorter than the nucleic acid sequence forming the double bond within the nucleic acid sequence forming the double bond, when the temperature is lowered, the short single-stranded nucleic acid (DNA / RNA) fragments can hybridize with them and interfere with the double-stranded structure reformation. In other words, the probe hybridization region can be exposed as a single strand using the double-stranded recombination-inhibiting DNA, which can further trigger hybridization between the target DNA and the SENSR probe, thereby increasing the detection efficiency for the target DNA.

[0035] The single-stranded region formation process of the present invention is applicable to nucleic acid sequences forming various types of duplexes. For example, it can be used for nucleic acid sequences forming duplexes isolated from any sample. Furthermore, it can be applied not only to PCR amplicons amplified from DNA, but also to PCR amplicons obtained by converting RNA into DNA through a reverse transcriptase reaction. Furthermore, it can be applied not only to amplicons amplified using a thermocycler, such as a PCR device, but also to various isothermal amplification products, such as isothermal recombinant polymerase amplification (RPA).

[0036] In particular, the present invention discovered that using complementary double-stranded recombination-disrupting DNAs upstream and downstream of the target sequence can more effectively expose the probe hybridization zone. This allows more SENSR probes to hybridize to the probe hybridization zone, and the signal intensity varies more clearly depending on the presence or absence of mutation, thereby enhancing the specificity of the mutation discrimination reaction.

[0037] A composition for detecting a target nucleic acid according to the present invention comprises at least one nucleic acid for preventing double-strand recombination of a target gene.

[0038] As described above, the purpose of the nucleic acid is to provide single-stranded nucleic acid (DNA / RNA) fragments that are complementary to the single strand within the nucleic acid sequence forming the double bond but shorter than the nucleic acid sequence forming the double bond (i.e., nucleic acids for preventing double-strand recombination of at least one target gene) to cause the formation of a single-stranded region of the nucleic acid sequence.

[0039] The nucleic acid for preventing double-stranded recombination of the target gene mentioned above may have any number of base sequences of at least 8, 9, 10, 11, 12, 13, or more, and may have a complementary sequence to the target gene mentioned above. Such sequences are preferably about 60 or fewer. Accordingly, it may have about 8 to 60 nucleic acid sequences, including any integer within the numerical range mentioned above.

[0040] This is because the length of the double-stranded recombination-disrupting nucleic acid of the target gene mentioned above must be at least 8 or more arbitrary base sequences in order to expect a minimal interference effect. Accordingly, as long as the length of the double-stranded recombination-disrupting nucleic acid of the target gene mentioned above has at least 8 or more arbitrary base sequences, there is no limitation on the design of the length, but it is preferable that the number of base sequences (the length of the double-stranded recombination-disrupting nucleic acid) be determined at a level that does not interfere with the complementary binding of the target gene and the SENSR probe set.

[0041] The complementary sequence of the above-mentioned double-stranded recombination-blocking nucleic acid may be located at the 3' end or the 5' end or both (if there are two or more sequences) of the complementary binding region (i.e., hybridization region) of the SENSR probe set. More specifically, a complementary sequence with respect to the target nucleic acid sequence that is located at a distance of a certain number of base sequences or more is preferred. More specifically, with respect to the hybridization region, it is preferred to use a sequence that complementarily binds to the target gene at a location at a distance of about 0 to 24 base sequences, more specifically 5 to 12 base sequences, from the complementary binding region of the SENSR probe set. Any number of sequences within the above categories are included.

[0042] That is, the above-mentioned double-strand recombination-disrupting nucleic acid inhibits the re-formation of a complementary sequence at the 3'-terminal position (several to several dozen base sequences from the terminal position) or the 5'-terminal position (several to several dozen base sequences from the terminal position) of the sequence where the SENSR probe set operates, thereby opening a sequence region where the SENSR probe set can perform hybridization.

[0043] This allows for greater efficiency in isothermal reactions.

[0044] More specifically, in the present invention, one, two or more nucleic acids for preventing double-stranded recombination may be used depending on the location of the mutation to be detected.

[0045] If the sequence to be detected is excessively biased towards the 3' or 5' end of the target gene amplicon, the double-stranded recombination-blocking nucleic acid at the 3' or 5' end cannot be used because it overlaps with the SENSR probe hybridization region. Therefore, in this case, the double-stranded recombination-blocking nucleic acid is determined as a single complementary sequence at the opposite position (3' or 5' end) to the region (5' or 3' end) where the SENSR probe set operates.

[0046] If the sequence to be detected is not biased towards one end of the target gene amplicon, any sequence near the 5' or 3' end of the sequence on which the SENSR probe set operates can be used.

[0047] Meanwhile, the “SENSR technology” according to the present invention is a molecular diagnostic technology using an isothermal single reaction, which is a technology capable of determining the presence or absence of a target sequence in a reactant. The SENSR reactant is composed of two probes capable of hybridizing to a single-stranded target sequence. The T7 initiator sequence is positioned at the top of the upstream probe among each probe, and the sequences of the first detection probe and the second detection probe are positioned at the bottom of the downstream probe.

[0048] The composition according to the present invention may further comprise a ligation agent; a polymerase; and an isothermal single reaction solution.

[0049] The two probes described above are positioned in close proximity to each other and hybridize with the target sequence only when the target sequence is present. When a ligation reaction proceeds between the two probes in close proximity, the two probes are linked into a single probe strand. When a transcription reaction proceeds on the linked probes by T7 RNA polymerase, an RNA strand to which the first detection probe and the second detection probe can specifically bind is generated as a result, and the first detection probe and the second detection probe bind to this RNA strand, thereby generating a hybrid (DP-RNA hybrid) of the first detection probe, an RNA transcript, and the second detection probe. The presence of the target sequence in the reaction product can be detected by confirming this hybrid through fluorescence expression or a colorimetric reaction.

[0050] This structure enables the probe set of the present invention to be a probe that exhibits a high detection effect in a short time under isothermal single reaction conditions in a unified step.

[0051] More specifically, the probe design of the present invention comprises two single-stranded DNA probes designed to expose their target recognition sequences, thereby enabling hybridization of the probe set with the target RNA / DNA at an isothermal temperature (e.g., at a temperature at which an enzyme can act). The hybridization sequence is designed to maximize hybridization to the target RNA / DNA while minimizing the formation of any other structures. The efficient hybridization process between the probe and the target RNA / DNA ensures high sensitivity during the isothermal reaction.

[0052] The promoter probe is designed to form a stem-loop structure, and the stem portion forms a double-stranded RNA polymerase promoter sequence, thereby initiating transcription using RNA polymerase. Because the double-stranded RNA polymerase promoter portion is physically connected by the loop sequence, the probability of forming a functional double-stranded promoter is higher than when the loop sequence is not connected. Therefore, the self-assembled promoter sequence forming a hairpin structure in the promoter probe can effectively promote hybridization and subsequent transcription.

[0053] The reporter probe is designed to contain the same sequence as the sequences of the first detection probe and the second detection probe. Accordingly, when the target sequence is present, the first detection probe and the second detection probe generate hybrids (DP-RNA hybrids) for transcripts that complementarily bind to the reporter probe. The presence of the target sequence in the reaction can be confirmed using a lateral flow immunoassay kit that specifically detects the substance labeled by the first detection probe and the second detection probe.

[0054] After hybridization, the first probe and the second probe hybridized to the target nucleic acid sequence are ligated. That is, after the first probe and the second probe of the present invention are hybridized to the target nucleic acid sequence, a ligation agent is used to ligate the nick formed between the two probes.

[0055] According to a preferred embodiment of the present invention, when the first probe and the second probe hybridize with the target nucleic acid sequence, the first probe and the second probe are positioned immediately adjacent to each other. This is because the positioning at an adjacent position is necessary for the ligation reaction between the two probes. The term “adjacent” used herein when referring to the hybridization positions of the first probe and the second probe means that the 3’-end of one probe and the 5’-end of the other probe are sufficiently adjacent to each other so that the ends of the two probes can be linked to each other.

[0056] Since enzymatic ligation is the preferred method for covalently linking the first and second probes, the term "ligation" is used throughout this specification. However, the term "ligation" is a general term and is understood to encompass any method for covalently linking two probes.

[0057] The ligation reaction of the present invention can be carried out using a wide variety of ligation agents, including enzymatic ligation agents and non-enzymatic ligation agents (e.g., chemical agents and photoligation agents).

[0058] Chemical ligating agents include, but are not limited to, activators, condensing agents and reducing agents such as carbodiimides, BrCN (cyanogen bromide), N-cyanoimidazole, imidazole, 1-methylimidazole / carbodiimide / cystamine, dithiothreitol (DTT) and ultraviolet light.

[0059] Additionally, autoligation, i.e., spontaneous ligation in the absence of a ligating agent, is also included within the scope of the present invention.

[0060] Photoligation using light of a wavelength suitable as a ligation agent is also encompassed by the present invention. In an embodiment of the present invention, the photoligation comprises a probe comprising a nucleotide analog, including but not limited to s4T (4-thiothymidine), 5-vinyluracil, and analogs thereof, or combinations thereof.

[0061] According to a preferred embodiment of the present invention, the ligation reaction is carried out using an enzymatic ligation agent, wherein the ligation agent is at least one selected from the group consisting of SplintR ligase, bacteriophage T4 ligase, E. coli ligase, Afu ligase, Taq ligase, Tfl ligase, Mth ligase, Tth ligase, Tth HB8 ligase, Thermus species AK16D ligase, Ape ligase, LigTk ligase, Aae ligase, Rm ligase, Pfu ligase, ribozyme, and variants thereof.

[0062] Internucleotide linkages formed by ligation include phosphodiester bonds and other linkages. For example, ligation using ligase typically forms phosphodiester bonds.

[0063] Non-enzymatic methods for ligation can form other internucleotide linkages. Other internucleotide linkages include, but are not limited to, covalent bonds between suitable reactive groups, such as thiophosphorylacetylamino groups formed between an α-haloacyl group and a phosphothioate group, 5'-phosphorothioesters formed between a phosphothioate group and a tosylate or iodide group, and pyrophosphate linkages.

[0064] After the ligation reaction, the resulting ligation product contains the first detection probe and the second detection probe sequences and becomes a single-stranded DNA as a template for amplifying the target RNA / DNA.

[0065] Subsequently, when the transcription process is initiated by RNA polymerase, an RNA strand containing a sequence complementary to the target RNA / DNA sequence and the sequences of the first and second detection probes is generated, and the first and second detection probes bind to this, thereby generating a hybrid (DP-RNA hybrid) of the first detection probe, an RNA transcript, and the second detection probe. The presence of the target sequence in the reaction product can be detected by detecting this hybrid through fluorescence or colorimetric reaction.

[0066] If the first probe and the second probe are not performed as described above, hybrids (DP-RNA hybrids) of the first detection probe, RNA transcript, and second detection probe are not ultimately generated, and therefore detection of the target nucleic acid sequence is not achieved.

[0067] The RNA polymerase of the present invention may use any type of RNA polymerase as long as it can recognize a promoter region to initiate transcription as a desired effect.

[0068] Preferably, the RNA polymerase may be at least one selected from the group consisting of bacteriophage T7 RNA polymerase, bacteriophage T3 polymerase, bacteriophage RNA polymerase, bacteriophage ΦII polymerase, Salmonella bacteriophage sp6 polymerase, Pseudomonas bacteriophage gh-1 polymerase, E. coli RNA polymerase holoenzyme, E. coli RNA polymerase core enzyme, human RNA polymerase I, human RNA polymerase II, human RNA polymerase III, human mitochondrial RNA polymerase, and variants thereof.

[0069] Likewise, as long as transcription can be initiated by RNA polymerase, the promoter region within the first probe of the present invention recognized by RNA polymerase can utilize any promoter sequence known in the art.

[0070] To optimize the isothermal single reaction of the present invention, the ligation agent and the polymerization enzyme can be appropriately adjusted, and preferably, they can be included in a single reaction solution at a ratio of 1:1 to 1:5 units, more preferably 1:4 units, and most preferably 1:2 units.

[0071] The isothermal single reaction of the present invention is performed simultaneously and unified at a designated temperature within the range of 15°C to 50°C without a separate amplification reaction. The temperature within the range of 15°C to 50°C is a temperature known in the art at which enzymes function, and is not limited thereto as long as the desired effect of the present invention can be achieved. Preferably, the designated temperature is 37°C.

[0072] In addition, the above isothermal single reaction is performed simultaneously in a single reaction solution containing at least one selected from the group consisting of Tris-HCl, MgCl2, NTPs, NaCl, and ET-SSB (Extreme Thermostable Single-Stranded DNA Binding Protein).

[0073] In the present invention, the single reaction solution preferably comprises 1 to 500 mM Tris-HCl; 1 to 200 mM MgCl2; 0.1 to 50 mM NTPs; and 1 to 800 ng ET-SSB, more preferably 100 to 400 mM Tris-HCl; 50 to 150 mM MgCl2; 10 to 40 mM NTPs; and 100 to 600 ng ET-SSB, and most preferably 350 mM Tris-HCl; 100 mM MgCl2; 25 mM NTPs; and 500 ng ET-SSB.

[0074] The present invention is characterized in that the amplification process is automatically performed in a process in which an additional separate amplification process (e.g., PCR) is not required, and an isothermal single reaction occurs.

[0075] The reason why an isothermal single reaction including such an amplification process is possible is because (i) the design of the second probe, which is designed to include the first detection probe and the second detection probe sequences that are located downstream of the first probe, which includes a double-stranded promoter sequence having a hairpin structure, and the ligation reaction must occur; and (ii) when the ligated product is transcribed through transcription initiation, the amplification process occurs naturally within the reaction without a separate amplification process by utilizing the target sequence (i.e., the splint) that can be used.

[0076] That is, when the ligation product of the ligation reaction between the first probe and the second probe forms a hairpin structure, transcription is initiated from the RNA polymerase promoter sequence of the first probe to produce a transcript, and since the transcript contains the same sequence as the target RNA sequence, it can be used as the target RNA.

[0077] Accordingly, the composition utilizing the probe set of the present invention is designed to allow ligation and transcription reactions to occur simultaneously, and is an isothermal single reaction that includes an amplification process using the transcript in which the ligated product has undergone transcription reaction as a scaffold RNA.

[0078] As described above, since the transcript of the ligated product contains sequences complementary to the sequences of the first detection probe and the second detection probe, a hybrid (DP-RNA hybrid) of the first detection probe, RNA transcript, and second detection probe can be generated by reacting with the first detection probe and the second detection probe.

[0079] That is, in the present invention, the first detection probe and the second detection lobe may complementarily bind to RNA generated by an isothermal single reaction.

[0080] The first detection probe and the second detection probe of the present invention can be designed as follows to improve detection efficiency.

[0081] In the present invention, both the first detection probe and the second detection probe may have a linear structure. Since the first detection probe and the second detection probe have high binding affinity when the secondary structure is linear, detection sensitivity and signal intensity can be increased by designing both the first detection probe and the second detection probe to have a linear structure.

[0082] In the present invention, the first detection probe and the second detection probe may not bind to each other. Since binding of the first detection probe and the second detection probe to each other may increase the background signal, by designing the first detection probe and the second detection probe to not bind to each other, the background signal can be suppressed and the detection sensitivity and signal intensity can be increased.

[0083] In the present invention, the first detection probe and the second detection probe may not bind to the target nucleic acid.

[0084] Additionally, in the present invention, the first detection probe and the second detection probe may not bind to the first probe.

[0085] Additionally, in the present invention, the first detection probe and the second detection probe may not bind to the double-stranded recombination-preventing nucleic acid of the target gene.

[0086] Since the background signal may increase when the first detection probe and the second detection probe bind to other components such as the target nucleic acid, the first probe, or the nucleic acid for preventing double-stranded recombination of the target gene, the first detection probe and the second detection probe are designed so as not to bind to the target nucleic acid, the first probe, or the nucleic acid for preventing double-stranded recombination of the target gene, the background signal can be suppressed and the detection sensitivity and signal intensity can be increased.

[0087] In the present invention, the first detection probe and the second detection probe may have a base sequence number of 10 to 25. For example, the first detection probe and the second detection probe may have a base sequence number of 12 to 24, 14 to 23, 16 to 22, or 16 to 20.

[0088] If the length of the first detection probe and the second detection probe are too short, they may bind to other components, increasing the background signal, and the melting temperature (Tm) may be lower than the reaction temperature, for example, 37°C, which may significantly reduce the reaction efficiency. In addition, if the length is too long, there is a disadvantage in that the binding efficiency may be reduced, resulting in a decrease in signal intensity. Accordingly, in order to improve the detection efficiency, the first detection probe and the second detection probe preferably have a sequence number of 10 to 25 bases.

[0089] In the present invention, the first detection probe and the second detection probe may each include a first labeling substance and a second labeling substance.

[0090] Any type of marker substance may be used as long as it can generate a detectable signal as the intended effect. Specifically, the first labeling material and the second labeling material may be any one different selected from the group consisting of biotin, fluorescein amidite (FAM), digoxigenin (DIG), fluorescein isothiocyanate (FITC), Texas red, fluorescein, 2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein (HEX), rhodamine green, rhodamine red, tetramethyl rhodamine, Oregon green, alexa fluor, 6-Carboxyl-XRhodamine (ROX), tertramethylrodamine isothiocyanate (TRITC), 6-carboxytetramethyl-rhodamine (TAMRA), and cyanine series dyes.

[0091] According to one embodiment of the present invention, the first labeling substance may be biotin or DIG.

[0092] According to one embodiment of the present invention, the second labeling material may be FAM.

[0093] According to one embodiment of the present invention, the first label may be biotin or DIG, and the second label may be FAM.

[0094] In addition, the present invention provides a kit for detecting a target gene, comprising (a) a target nucleic acid signal amplification composition comprising the above-described target gene detection composition; a ligation agent; a polymerase; and an isothermal single reaction solution; and (b) a lateral flow immunoassay (LFA) substrate in which a sample pad, a conjugation pad, and a test membrane having a test line formed thereon are sequentially arranged.

[0095] This kit can visually detect the presence of a target gene in a sample by detecting the presence or absence of color development at the test line of the lateral flow assay substrate.

[0096] In the above (b), the sample pad refers to a pad that can accommodate a sample to be analyzed and allows for diffusion flow, and is composed of a material having sufficient porosity to accommodate and contain the sample to be analyzed. Such porous materials may include, but are not limited to, fibrous paper, microporous membranes made of cellulose materials, cellulose, cellulose derivatives such as cellulose acetate, nitrocellulose, glass fibers, cotton, nylon, or porous gels.

[0097] In the above (b), the conjugation pad accommodates a sample that diffuses and moves from the sample pad, and is composed of a material that allows for the diffusion flow of the sample (flow by capillary action) in the same manner as the sample pad.

[0098] In addition, the conjugation pad of (b) above includes a conjugate of a reactive substance and a chromogenic particle that specifically binds to the second labeling substance.

[0099] In the above (b), the test line may be a reactive substance that specifically binds to the first labeling substance and is immobilized.

[0100] The above inspection line may be formed on the reaction film in one or more forms, and if there are two or more inspection lines, they may be fixed with different reactants.

[0101] The above reaction membrane can be made of various materials through which the sample can pass. For example, it can be selected from the group consisting of polysaccharides (cellulose materials, paper, cellulose derivatives such as cellulose acetate and nitrocellulose), polyethylene, nylon, and porous gels (silica gel, agarose, dextran, gelatin), with nitrocellulose being preferred.

[0102] The reactive substance that specifically binds to the first or second labeling substance may be used in various ways depending on the type of the first or second labeling substance. For example, it may be any one different selected from the group consisting of streptavidin, neutravidin, avidin, anti-FAM antibody, anti-DIG antibody, anti-FITC antibody, anti-Texas red antibody, anti-fluorescein antibody, anti-HEX antibody, anti-rhodamine green antibody, anti-rhodamine red antibody, anti-tetramethyl rhodamine antibody, anti-Oregon green antibody, anti-Alexa Fluoro antibody, anti-TRITC antibody, anti-TAMRA antibody, and anti-cyanine series (Cy3, Cy5), but is not limited thereto.

[0103] According to one embodiment of the present invention, the reactive substance that specifically binds to the first labeling substance may be streptavidin, neutravidin, avidin, or an anti-DIG antibody.

[0104] According to one embodiment of the present invention, the reactive substance that specifically binds to the second labeling substance may be an anti-FAM antibody.

[0105] The above-mentioned color-developing particles can form a conjugate with a reactant that specifically binds to a second labeling substance through electrostatic adsorption, adsorption by biological affinity, and chemical adsorption. The above-mentioned color-developing particle refers to a particle that acts as a detectable label, and may be, for example, at least one selected from the group consisting of metal nanoparticles, polymer nanoparticles, latex beads, magnetic nanoparticles, quantum dot nanoparticles, and carbon nanoparticles. Specifically, the metal nanoparticles are selected from the group consisting of gold (Au), silver (Ag), platinum (Pt), palladium (Pd), europium (Eu), iridium (Ir), rhodium (Rh), ruthenium (Ru), titanium (Ti), zirconium (Zr), hafnium (Hf), vanadium (V), niobium (Nb), tantalum (Ta), chromium (Cr), molybdenum (Mo), tungsten (W), ruthenium (Ru), osmium (Os), iron (Fe), nickel (Ni), cobalt (Co), magnesium oxide (MgO), titanium dioxide (TiO2), vanadium pentoxide (V2O5), and It may be one or more nanoparticles selected from the group consisting of zinc oxide (ZnO). Preferably, it may be gold nanoparticles.

[0106] Additionally, the polymer nanoparticles may be nanoparticles made of polystyrene and / or polyethylene glycol (PEG).

[0107] In the above (b), the substrate may be formed of any material suitable for supporting and transporting the sample pad, conjugation pad, and reaction membrane having the inspection line formed thereon, but is generally preferably liquid-impermeable so that the fluid of the sample diffusing through the membrane does not leak through the substrate. Examples thereof include, but are not limited to, glass, polymeric materials (polystyrene, polypropylene, polyester, polybutadiene, polyvinyl chloride, polyamide, polycarbonate, epoxide, methacrylate, and polymelamine).

[0108] The reaction in the kit for detecting target genes according to the present invention is described in detail as follows.

[0109] When a target nucleic acid is contained in a sample, a hybrid (DP-RNA hybrid) of a first detection probe, an RNA transcript, and a second detection probe is generated by the target nucleic acid signal amplification composition of (a). When this is applied to the lateral flow immunoassay substrate of (b), the conjugate of the reactant and the chromogenic particle contained in the conjugation pad specifically binds to the second labeling substance contained in the hybrid, and also the reactant fixed to the test line specifically binds to the first labeling substance contained in the hybrid. That is, the hybrid bound to the chromogenic particle can be collected at the test line position and exhibit coloration of the test line. At this time, the chromogenic particle can be a metal nanoparticle, and depending on the type of particle, the coloration of the test line can be detected with the naked eye.

[0110] On the other hand, when the target nucleic acid is not contained in the sample, hybrids (DP-RNA hybrids) of the first detection probe, RNA, and second detection probe are not generated by the target nucleic acid signal amplification composition of (a). When this is applied to the lateral flow immunoassay substrate of (b), no color is produced on the test line as the chromogenic particles leave the substrate.

[0111] Since the kit of the present invention is manufactured to detect a target nucleic acid sequence using the probe set of the present invention described above, redundant descriptions are omitted to avoid complexity of this specification.

[0112] The kit of the present invention described above may additionally include various polynucleotide molecules, enzymes, various buffers, and reagents. Furthermore, the kit of the present invention may include reagents essential for conducting positive and negative control reactions. The optimal amount of reagents used in any particular reaction can be readily determined by those skilled in the art, having learned the disclosure herein.

[0113] Typically, the kit of the present invention is manufactured in separate packages or compartments containing the aforementioned components.

[0114] In addition, the present invention provides a method for detecting a target gene, comprising: (a) a step of separating a double strand of a target gene at a high temperature of 80 to 100°C; (b) a step of cooling the reaction product of (a) to an isothermal temperature of 15 to 50°C, adding a composition according to any one of claims 1 to 18 to perform an isothermal single reaction, and reacting with a detection probe; and (c) a step of confirming fluorescence expression or color development.

[0115] In the above step (b), the isothermal single reaction may be performed simultaneously in a single vessel at a designated temperature within the range of 15°C to 50°C without a separate amplification reaction. Preferably, the designated temperature may be 37°C.

[0116] In the above step (b), the isothermal single reaction is Tris-HCl, MgCl 2, It is performed simultaneously as a single reaction solution containing NTPs and ET-SSB (Extreme Thermostable Single-Stranded DNA Binding Protein).

[0117] In the above step (b), the efficiency of the single isothermal reaction as described above can be further increased by using a nucleic acid for preventing double-strand recombination of the target gene of the present invention.

[0118] In the above step (c), confirming fluorescence expression or color development may be performed through a lateral flow immunoassay (LFA).

[0119] The above lateral flow immunoassay can detect a target gene by confirming the fluorescence expression or color development of a test line using a chromogenic particle, and the color development of the test line can be detected with the naked eye depending on the type of chromogenic particle.

[0120] In the present invention, the sequence of the DNA probe is not limited to the sequence described in the examples of the present invention, and can be applied to all target gene sequences, as long as the intended effect is achieved.

[0121] The detection method according to the present invention can specifically detect a target gene and genetic mutation using an isothermal single reaction and a lateral flow immunoassay. The target gene may be a single nucleotide polymorphism (SNP) gene. If the target gene is present in a sample, a hybrid (e.g., RNA hybrid) of a first detection probe, an RNA transcript, and a second detection probe can be generated through an isothermal single reaction. This hybrid can be detected visually using a lateral flow immunoassay.

[0122] That is, the detection method according to the present invention can detect mutations at the single nucleotide polymorphism (SNP) level with the naked eye, and can be used for on-site gene and genetic mutation detection that can detect mutations sensitively in a short period of time without securing expensive equipment and skilled personnel.

[0123] Since the detection method of the present invention includes the probe set of the present invention described above, redundant descriptions are omitted to avoid excessive complexity of the present specification.

[0124] The detection method according to the present invention enables sequence-specific nucleic acid detection and mutation detection at the level of single nucleotide polymorphism (SNP) discrimination, and can provide a method for quickly and sensitively distinguishing mutations. In particular, the LFA system enables direct, visual detection of targeted sequence-specific nucleic acids and SNP discrimination, making it highly valuable for field diagnostics.

[0125] Figure 1 is a schematic diagram briefly outlining the entire process of a target gene detection method using SENSR reaction and lateral flow immunoassay.

[0126] Figure 2 shows an image of the color band of the test line on the diagnostic strip visually confirmed according to the presence or absence of the target nucleic acid, and a graph showing the intensity of each detection quantified using the Image J analysis program.

[0127] Figure 3 is a schematic diagram briefly outlining the principle of distinguishing between the original and mutant forms of a target gene in a method of detecting a target gene using a SENSR reaction and a lateral flow immunoassay.

[0128] Figure 4 is a graph showing the results of detecting SARS-CoV-2 and its variants using a SENSR reaction and lateral flow immunoassay-based detection method after rRT-PCR amplification (A: L452 and L452R, B: E484 and E484A, C: N501 and N501Y, D: D614 and D614G).

[0129] Figure 5 is a graph showing the results of detecting CYP genes and their variants using a SENSR reaction and lateral flow immunoassay-based detection method after rRT-PCR amplification (A: CYP2C191 and CYP2C192, B: CYP2C191 and CYP2C193).

[0130] Figure 6 is a graph showing the results of detecting CYP genes and their variants using a SENSR reaction and lateral flow immunoassay-based detection method after RPA amplification (A: CYP2C191 and CYP2C192, B: CYP2C191 and CYP2C193).

[0131] Figure 7 is a schematic diagram briefly outlining the principle of distinguishing between the original and variant forms of a target gene using a simultaneous multiple detection method based on SENSR reaction and lateral flow immunoassay.

[0132] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0133] Experimental materials

[0134] T7 RNA polymerase, used to synthesize RNA in this experiment, was purchased from New England Biolabs (NEB, Ipswich, MA, USA), and dithiothreitol (DTT) was purchased from Thermo Fisher Scientific (Waltham, MA, USA). In addition, Tris-HCl (pH 7.4) and 1 M MgCl2, which are the reaction buffer materials required for this reaction, were purchased from Bioneer, Inc. (Daejeon, Republic of Korea). In addition, SplintR ligase, ET-SSB (Extreme Thermostable Single-stranded DNA binding protein), DNase I, and ribonucleotide solution mix were purchased from New England Biolabs (NEB, Ipswich, MA, USA).

[0135] Additionally, ATP was purchased from Thermo Fisher Scientific (Waltham, MA, USA), and Recombinant RNase Inhibitor (RRI) was purchased from Takara (Kyoto, Japan). All single-stranded DNA probes were custom-manufactured through Bioneer.

[0136] In addition, oligonucleotides for template DNA and double-strand recombination-inhibiting DNAs required for RNA synthesis were synthesized by Cosmogenetech, Inc. (Seoul, Republic of Korea). TOPreal qPCR 2X PreMIX (SYBR Green with high ROX) for real-time PCR amplicons was purchased from Enzynomics, Inc. (Daejeon, Republic of Korea), and the GCDia™ COVID-19 Fast Detection Kit for performing the rRT-PCR process was provided by Genes Laboratories (Seongnam, Republic of Korea). The TwistAmp® Basic product from Twistdx was purchased as an amplification kit for RPA amplicons. Kits for PCR purification and RNA purification were all purchased from GeneAll Biotechonology (Seoul, Republic of Korea). The Hybridetect 1 kit for lateral flow immunoassay was purchased from TwistDx.

[0137] Example 1. Lateral flow immunoassay-based detection of SENSR reactants

[0138] Detection of SARS-CoV-2 omicron variants from purified PCR amplicons was performed using a detection method combining a previously developed RNA detection technology [Sensitive splint-based one-pot isothermal RNA detection (SENSR); hereinafter referred to as SENSR technology; Nat Biomed Eng 4, 1168-1179 (2020)] and lateral flow immunoassay.

[0139] To this end, we designed a probe set for detecting omicron mutations and double-stranded recombination-disrupting DNA located below (backward) and above (forward) the hybridization zone. Furthermore, information such as detection probes for lateral flow immunoassay-based detection, primer information for synthesizing PCR amplicons, and target sequences is presented in Table 1.

[0140] Sequence typeSequence information (5' → 3')Promoter probeSequence number 1:[Phosphate]CAACACCATTACAAGGTGTGCTACCCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probeSequence number 2:TACATCACACTCACTACACCGCAACTAAACTCAACTAAGGAAAGTAACAATTAAAACCTTDetection probe 1 (Biotin)Sequence number 3:TACATCACACTCACTACADetection probe 2 (FAM)Sequence number 4:CCGCAACTAAACTCAACTDownstream targeting intruder DNASequence number 5:ACAATCATATGGTTTCCAACCCACTTATGGTGTTGGTTACCAACCATACAGAGTAGTUpstream targeting intruder DNASequence number 6:CGGCCTGATAGATTTCAGTTGAAATATCTCTCTCAAOmicron target sequenceSequence number 7:TTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAACAAACCTTGTAATGGTGTTGCAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTOmicron PCR primer 1 SEQ ID NO: 8:TTGAGAGAGATATTTCAACTGOmicron PCR primer 2 SEQ ID NO: 9:ACTACTCTGTATGGTTGGTAAC

[0141] In the sequences in the table above, the italicized notation indicates the stem-loop sequence, the bold notation indicates the UHS and DHS sequences that bind to the target sequence, and the underlined notation indicates the detection probe and its corresponding sequence. [Phosphate] indicates that a phosphate group is located at the 5-terminal.

[0142] First, as in the conventional single-strand generation method, the purified PCR amplicons shown in Table 2 were mixed with the elements required for detection and reacted at 98°C for 5 minutes to denature double-stranded DNA. The reaction mixture was then cooled to 4°C to hybridize the DNA probe to the reaction site.

[0143] Afterwards, the SENSR reactants shown in Table 3 were added and reacted at 37°C for 15 minutes. The reactants in Table 3 contain two short DNA strands that specifically bind to the 3' end of RNA produced after the SENSR reaction, and these DNAs, which are essential for the detection method, are designated as the first detection probe and the second detection probe, respectively. Each of the two detection probes is labeled with a specific substance, so that it can be detected using any commercially available lateral flow immunoassay kit that targets it. In this example, the two detection probes were labeled with Biotin and FAM (Fluorescein amidite), respectively, but any substance that can label any DNA and has an antibody against it can be utilized. The Hybridetect 1 kit provided by TwistDx was used as the lateral flow immunoassay kit, and this kit can detect any substance labeled with FAM and Biotin as a target. The entire process of Example 1 is summarized in Fig. 1.

[0144] Specifically, the Split-based ligation step is where two types of probes are linked when a target is present; the Transcription step is where transcription occurs from the linked probes; and finally, the Detection step is where a complementary detection probe binds to the RNA generated by the transcription reaction. All of these steps can be performed under single isothermal conditions.

[0145] ReagentConcentrationAmountPurified PCR sample1μM1㎕Downstream targeting intruder DNA20 μM1.5㎕Upstream targeting intruder DNA20 μM1.5㎕Promoter probe (PP)10 μM0.3㎕Reporter probe (RP)10 μM0.66㎕SENSR buffer10X0.54㎕RNase-free water3.5㎕Total 9㎕

[0146] ReagentConcentrationAmountSample (Table 2)300nM9㎕SENSR buffer10 polymerase50U / ㎕1.5㎕Detection probe 1 (Biotin)1 μM0.75㎕Detection probe 2 (FAM)1 μM0.75㎕RNase-free waterUp to 30㎕Total30㎕

[0147] To measure the results of the above reaction, 30 μL of the reactant was dispensed onto the sample pad of the Hybridetect 1 kit, and the detection result was confirmed after 10 minutes. The detection result was visually confirmed by the presence of a band on the test line of the diagnostic strip. In addition, the diagnostic strip was imaged with a printer scanner, and the band intensity of the test line was quantified using the ImageJ analysis program. As a result, as shown in Fig. 2, it was confirmed that a detection band appeared on the test line of the Hybridetect 1 kit when the target nucleic acid (SARS-CoV-2 omicron variant) was present, and if not, no band appeared.

[0148] Through this, it was confirmed that the detection method using the SENSR reaction and lateral flow immunoassay of the present invention is capable of specific detection of target nucleic acids, and in particular, detection is possible with the naked eye.

[0149] Example 2. Detection of SARS-CoV-2 and variants based on lateral flow immunoassay using SENSR reactants.

[0150] In Example 1, the lateral flow immunoassay-based sequence-specific DNA detection method for the SENSR reactant was applied to distinguish between SARS-CoV-2 and its variants, such as delta or omicron variants. Variants arise due to base changes in the S gene encoding the Spike protein information of SARS-CoV-2, and in this example, the original and delta or omicron variants were distinguished and detected according to mutations in a total of four regions. Information on the original and variant viruses is shown in Table 4 below, and the rRT-PCR primer sequences, double-strand recombination-interfering DNA sequences (upper and lower) used in this method, and the SENSR probe sequences for detecting SARS-CoV-2 and delta and omicron variants in each region are shown in Tables 5 to 8 below.

[0151] Amino acid mutation base mutation virus type L452RG > TL452: circular / L452R: delta E484AA > CE484: circular / E484A: Omicron N501YA > TN501: circular / N501Y: Omicron D614GA > GD614: circular / D614G: Omicron

[0152] L452R mutation detection SENSR probe sequence Sequence type Sequence information (5' → 3') Promoter probe Sequence number 10: [Phosphate] GGTAATTATAATTACCACCAACCCCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probe (circular) Sequence number 11: TACATCACACTCACTACACCGCAACTAAACTCAACTTTAGACTTCCTAAACAATCTATACaReporter probe (Delta) Sequence number 12: TACATCACACTCACTACACCGCAACTAAACTCAACTTTAGACTTCCTAAACAATCTATACcDetection probe 1 (Biotin) Sequence number 13: CCTTCCTCCTCCTACCCTDetection probe 2 (FAM) Sequence number 3: TACATCACACTCACTACADownstream targeting intruder DNASequence number 14:CTACCGGCCTGATAGATTTCAGTTGAAATATCTCTCTCAAAAGGTTTGAGAUpstream targeting intruder DNA SEQ ID NO: 15:TAGAATCAAGATTGTTAGAATTCCAAGCTATAACGCAGCCTGTAAAATCASARS-CoV-2 target sequence SEQ ID NO: 16:TGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCtGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGDelta target sequence SEQ ID NO: 17:TGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCgGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGDelta PCR primer1. Sequence number 18: TGATTTTACAGGCTGCGTTATAGDelta PCR primer 2. Sequence number 19: CTACCGGCCTGATAGATTTC

[0153] E484A mutation detection SENSR probe sequence Sequence type Sequence information (5' → 3') Promoter probe Sequence number 1: [Phosphate]CAACACCATTACAAGGTGTGCTACCCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probe (circular) Sequence number 2: TACATCACACTCACTACACCGCAACTAAACTCAACTAAGGAAAGTAACAATTAAAACCTtReporter probe (Omicron) Sequence number 20: TACATCACACTCACTACACCGCAACTAAACTCAACTAAGGAAAGTAACAATTAAAACCTgDetection probe 1 (Biotin) Sequence number 4: CCGCAACTAAACTCAACTDetection probe 2 (FAM) Sequence number 3: TACATCACACTCACTACADownstream targeting intruder DNASequence number 21:ACTACTCTGTATGGTTGGTGACCAACACCATAAGTGGGTCGGAAACTATATGATCGTUpstream targeting intruder DNA SEQ ID NO: 6:CGGCCTGATAGATTTCAGTTGAAATATCTCTCTCAASARS-CoV-2 target sequence SEQ ID NO: 22:TTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAACAAACCTTGTAATGGTGTTGaAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTOmicron target sequence SEQ ID NO: 7:TTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAACAAACCTTGTAATGGTGTTGcAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTOmicron PCR primer 1 SEQ ID NO:8:TTGAGAGAGATATTTCAACTGOmicron PCR primer 2Sequence number 9:ACTACTCTGTATGGTTGGTAAC

[0154] N501Y mutation detection SENSR probe sequence Sequence type Sequence information (5' → 3') Promoter probe SEQ ID NO: 23: [Phosphate] AGTGGGTTGGAAACCATATGATTGCCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probe (circular) SEQ ID NO: 24: TACATCACACTCACTACAAAGACGATCCAGAATATATGTATGGTTGGTAACCAACACCATtReporter probe (Omicron) SEQ ID NO: 25: TACATCACACTCACTACAAAGACGATCCAGAATATATGTATGGTTGGTAACCAACACCATaDetection probe 1 (Biotin) SEQ ID NO: 26: AAGACGATCCAGAATATADetection probe 2 (FAM) SEQ ID NO: 3: TACATCACACTCACTACADownstream targeting intruder DNA SEQ ID NO: 27:GGTGCATGTAGAAGTTCAAAAGAAAGTACTACTACTCUpstream targeting intruder DNA sequence number 28:TAAAGGAAAGTAACAATTAAAACCTTCAACACCATTACAAGGSARS-CoV-2 target sequence SEQ ID NO. 29:CCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTaATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCOmicron target sequenceSEQ ID NO. 30:CCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTtATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCOmicron PCR primer 1 SEQ ID NO: 31:CCTTGTAATGGTGTTGAAGGOmicron PCR primer 2nd sequence number32:CTGGTGCATGTAGAAGTTCA

[0155] D614G mutation detection SENSR probe sequence Sequence type Sequence information (5' → 3') Promoter probe SEQ ID NO: 33: [Phosphate]CCTGATAAAGAACAGCAACCTGGTCCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probe (circular) SEQ ID NO: 34: TACATCACACTCACTACATTATCGTCCTGGTTATATACAGGGACTTCTGTGCAGTTAACAtReporter probe (Omicron) SEQ ID NO: 35: TACATCACACTCACTACATTATCGTCCTGGTTATATACAGGGACTTCTGTGCAGTTAACAcDetection probe 1 (Biotin) SEQ ID NO: 36: TTATCCGTCCTGGTTATATDetection probe 2 (FAM) SEQ ID NO: 3: TACATCACACTCACTACADownstream targeting intruder DNA SEQ ID NO: 37:AGGAGTAAGTTGATCTGCATGAATAGCAUpstream targeting intruder DNA SEQ ID NO. 38:TTAGAAGTATTTGTTCCTGGTGTTATAACACTGACACCACCAAAAGAACATGGSARS-CoV-2 target sequence SEQ ID NO. 39:CCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGaTGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTOmicron target sequenceSEQ ID NO. 40:CCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGgTGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTOmicron PCR primer 1 SEQ ID NO: 41:CCATGTTCTTTTGGTGGTGTCOmicron PCR primer 2nd sequence number42:AGGAGTAAGTTGATCTGCATGAA

[0156] As shown in Table 1 above, in the sequences of Tables 5 to 8 above, the general italicized notation is the stem-loop sequence, the bold notation is the UHS, DHS sequence that binds to the target sequence, and the underlined notation is the detection probe and its corresponding sequence. [Phosphate] indicates that a phosphate group is located at the 5-terminal. In addition, the lowercase notation included in sequence numbers 2, 7, 11, 12, 16, 17, 20, 22, 24, 25, 29, 30, 34, 35, 39, and 40 indicates the SNP mutation in the corresponding sequence region.

[0157] All transcribed RNAs were adjusted to 10 pg and the reaction was performed, and the components required for the rRT-PCR reaction were mixed as shown in Table 9 below and reacted under the conditions of Table 10 below to obtain the reaction products. Thereafter, the rRT-PCR reaction products were mixed with double-stranded recombination-inhibiting DNA and SENSR probe sets as shown in Table 11 or Table 12, and the reaction products were reacted at 98°C for 5 minutes to denature double-stranded DNA and then cooled to 37°C. Here, the SENSR reaction products shown in Table 13 or Table 14 were added and reacted at 37°C for 15 minutes.

[0158] To measure the results of the above reaction, 20 μl of the reactant was dispensed onto the sample pad of the Hybridetect 1 kit, and 10 μl of RNase-free water was additionally dispensed, and the detection result was confirmed after 10 minutes. The detection result was visually confirmed by the presence of a test line band on the diagnostic strip, and the diagnostic strip was imaged using a printer scanner and the band intensity of the test line was quantified using the ImageJ analysis program. The process of Example 2 is summarized in Fig. 3.

[0159] rRT-PCR Reagent ComponentsReagentConcentrationAmountPrimers (forward, reverse)10 pmolTemplate RNAVariable10pgAccuPower®GreenStar™ RT-qPCR PreMix2

[0160] rRT-PCR reaction conditions PCR stepTmDurationCycleReverse Transcription50℃15 min1Pre-Heating95℃5 min1Amplification95℃10 sec4050-60℃20 sec72℃30 secAnnealing72℃3 min1Holding4℃(Storing temperature)10-30 min1

[0161] Probe set for circular detection Reagent Concentration Amount RT-PCR or RPA resultant Variable 1 ㎕ Downstream targeting intruder DNA 20 µM 1.5 ㎕ Upstream targeting intruder DNA 20 µM 1.5 ㎕ Promoter probe (PP) 10 µM 0.3 ㎕ Reporter probe (RP, circular virus) 10 µM 0.66 ㎕ SENSR buffer 10X 0.54 ㎕ RNase-free water 3.5 ㎕ Total 9 ㎕

[0162] Probe set for variant detection Reagent Concentration Amount RT-PCR or RPA resultant Variable 1 ㎕ Downstream targeting intruder DNA 20 µM 1.5 ㎕ Upstream targeting intruder DNA 20 µM 1.5 ㎕ Promoter probe (PP) 10 µM 0.3 ㎕ Reporter probe (RP, variant) 10 µM 0.66 ㎕ SENSR buffer 10X 0.54 ㎕ RNase-free water 3.5 ㎕ Total 9 ㎕

[0163] SENSR reaction components for circular detection Reagent Concentration Amount Sample (Table 11) 300 nM 9 μL SENSR buffer 10 X 3 μL NTPs 25 mM each 3 μL ATP 1 M 0.3 μL ET-SSB 500 ng / μL 1 μL RNase Inhibitor 40 U / μL 1 μL SplintR ligase 25 U / μL 1.5 μL T7 RNA polymerase 50 U / μL 1.5 μL Detect probe 1-1 (Biotin, circular virus) 1 μM 0.75 μL Detect probe 2 (FAM) 1 μM 0.75 μL RNase-free water Up to 30 μL Total 30 μL

[0164] SENSR reaction components for variant detection Reagent Concentration Amount Sample (Table 12) 300 nM 9 μL SENSR buffer 10 X 3 μL NTPs 25 mM each 3 μL ATP 1 M 0.3 μL ET-SSB 500 ng / μL 1 μL RNase Inhibitor 40 U / μL 1 μL SplintR ligase 25 U / μL 1.5 μL T7 RNA polymerase 50 U / μL 1.5 μL Detect probe 1-2 (Biotin, variant) 1 μM 0.75 μL Detect probe 2 (FAM) 1 μM 0.75 μL RNase-free water Up to 30 μL Total 30 μL

[0165] As a result, as shown in Fig. 4, when the SARS-CoV-2 prototype (L452, E484, N501, or D614) target was used, it was confirmed that the band intensity when the probe set for the SARS-CoV-2 prototype was used was significantly higher than the band intensity when the probe set for each SARS-CoV-2 variant (L452R, E484A, N501Y, or D614G) was used.

[0166] Additionally, when the SARS-CoV-2 variant (L452R, E484A, N501Y, or D614G) target was used, it was confirmed that the band intensity when using the probe set for the SARS-CoV-2 variant (L452R, E484A, N501Y, or D614G) was significantly higher than the band intensity when using the probe set for each SARS-CoV-2 prototype (L452, E484, N501, or D614).

[0167] Through this, it was confirmed that the detection method using the SENSR reaction and lateral flow immunoassay of the present invention can distinguish and detect SARS-CoV-2 and its variants from unpurified rRT-PCR amplicons, and in particular, can detect them with the naked eye.

[0168] Example 3. Detection of CYP genes and variants based on lateral flow immunoassay of SENSR reactants.

[0169] Example 3-1. Detection of CYP genes and variants using rRT-PCR results.

[0170] In a similar manner to Example 2, we attempted to distinguish between CYP genes (CYP2C191) and their variants (CYP2C192, CYP2C193). Sequence information on CYP genes and variants, primer sequences for rRT-PCR, double-strand recombination inhibitor DNA sequences (upper and lower), and SENSR probe sequences for detecting CYP genes and each variant are shown in Tables 15 and 16 below.

[0171] CYP2C192 mutation detection SENSR probe sequence Sequence type Sequence information (5' → 3') Promoter probe Sequence number 43: [Phosphate]GGGAAATAATCAATGATAGTGGGACCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probe (CYP2C191) Sequence number 44: TACATCACACTCACTACATTATCGTCCTGGTTATATTTAAGTAATTTGTTATGGGTTCCcReporter probe (CYP2C192) Sequence number 45: TACATCACACTCACTACATTATCGTCCTGGTTATATTTAAGTAATTTGTTATGGGTTCCtDetection probe 1 (Biotin) Sequence number 36: TTATCCGTCCTGGTTATATDetection probe 2 (FAM) Sequence number 3:TACATCACACTCACTACADownstream targeting intruder DNA sequence number 46:TCCATCGATTCTTGGTGTTCTTTTACTTTCTCCAAAATATCACTTTCCATAAAAGCAAGGTTTUpstream targeting intruder DNA sequence number 47:AAATTATTGCATATCTAAGAGAAAACAATAACYP2C191 target sequence SEQ ID NO 48:TTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCgGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGCYP2C192 target sequence SEQ ID NO 49:TTATTGTTTTCTCTTAGATATGCAATAATTTTCCCACTATCATTGATTATTTCCCaGGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGCYP2C192 PCR primer SEQ ID NO. 150:TTATTGTTTTCTCTTAGATATGCCYP2C192 PCR primer 2 SEQ ID NO: 51:CCATCGATTCTTGGTGTTC

[0172] CYP2C193 mutation detection SENSR probe sequence Sequence type Sequence information (5' → 3') Promoter probe Sequence number 52: [Phosphate]CAGGGGGTGCTTACAATCCTGATGCCCTATAGTGAGTCGTATTAATTTCGCGACAACACGCGAAATTAATACGACTCACTATAGGGReporter probe (CYP2C191) Sequence number 53: TACATCACACTCACTACATTATCGTCCTGGTTATATAAAAAACTTGGCCTTACCTGGATcReporter probe (CYP2C193) Sequence number 54: TACATCACACTCACTACATTATCGTCCTGGTTATATAAAAAACTTGGCCTTACCTGGATtDetection probe 1 (Biotin) Sequence number 36: TTATCGTCCTGGTTATATDetection probe 2 (FAM) Sequence number 3:TACATCACACTCACTACADownstream targeting intruder DNASEQ ID NO: 55:GCTTGGTCAATATAGAATTTTGGATTTCCCAGAAAAAAAGACTGTAAGTGGTTTCTCAGGAAGCUpstream targeting intruder DNASEQ ID NO: 56:TTTTCATTCAATTTTTCCATCAAGTTAAGAAATTGCTCYP2C191 target sequenceSEQ ID NO: 57:AGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGgATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATTGACCAAGCCYP2C193 target sequenceSEQ ID NO:58:AGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGaATCCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATTGACCAAGCCYP2C193 PCR primer 1 SEQ ID NO: 59:AGCAATTTCTTAACTTGATGGCYP2C193 PCR primer 2 SEQ ID NO: 60:GCTTGGTCAATATAGAATTTTGG

[0173] As shown in Table 1 above, in the sequences of Tables 15 and 16 above, the general italicized notation is the stem-loop sequence, the bold notation is the UHS, DHS sequence that binds to the target sequence, and the underlined notation is the detection probe and its corresponding sequence. [Phosphate] indicates that a phosphate group is located at the 5-terminal. In addition, the lowercase notation included in sequence numbers 44, 45, 48, 49, 53, 54, 57, and 58 indicates the SNP mutation in the corresponding sequence region.

[0174] Except for specific sequences of primers, probes, etc. for detecting CYP genes and their variants shown in Tables 15 and 16 above, the components, reaction conditions, detection methods, etc. required for rRT-PCR and SENSR reactions were performed in the same manner as in Example 2.

[0175] As a result, as shown in Fig. 5, when the CYP gene prototype (CYP2C191) target was used, it was confirmed that the band intensity when the probe set for the CYP gene prototype (CYP2C191) was used was significantly higher than the band intensity when the probe set for each CYP gene variant (CYP2C192 or CYP2C193) was used.

[0176] In addition, when CYP gene variants (CYP2C192 or CYP2C193) were used as targets, it was confirmed that the band intensity when using the probe set for each CYP gene variant (CYP2C192 or CYP2C193) was significantly higher than the band intensity when using the probe set for the CYP gene prototype (CYP2C191).

[0177] Through this, it was confirmed that the detection method using the SENSR reaction and lateral flow immunoassay of the present invention can distinguish and detect CYP genes and their variants from unpurified rRT-PCR amplicons, and in particular, can detect them with the naked eye.

[0178] Example 3-2. Detection of CYP genes and variants using RPA results

[0179] Similar to Example 3-1, the aim was to distinguish CYP genes (CYP2C191) and their variants (CYP2C192, CYP2C193) from RPA amplicons rather than rRT-PCR. The components required for the RPA reaction are shown in Table 17 below, and the RPA reaction product containing these components was reacted at 37°C for 20 minutes to obtain the reaction product. Except for amplifying the target through RPA reaction rather than rRT-PCR, the remaining experimental procedures and conditions were the same as in Example 3-1, and the materials used were also the same as those used in Example 3-1.

[0180] RPA reaction compositionReagentConcentrationAmountPurified PCR productVariable10㎕RPA forward primer10㎕RPA reverse primer10㎕2.4㎕Rehydration buffer29.5㎕RNase-free water 3.2㎕MgOAc280mM2.5㎕Total 50㎕

[0181] As a result, as shown in Fig. 6, when the CYP gene prototype (CYP2C191) target was used, it was confirmed that the band intensity when the probe set for the CYP gene prototype (CYP2C191) was used was significantly higher than the band intensity when the probe set for each CYP gene variant (CYP2C192 or CYP2C193) was used.

[0182] In addition, when CYP gene variants (CYP2C192 or CYP2C193) were used as targets, it was confirmed that the band intensity when using the probe set for each CYP gene variant (CYP2C192 or CYP2C193) was significantly higher than the band intensity when using the probe set for the CYP gene prototype (CYP2C191).

[0183] Through this, it was confirmed that the detection method using the SENSR reaction and lateral flow immunoassay of the present invention can distinguish and detect CYP genes and their variants from unpurified RPA amplicons, and in particular, can detect them with the naked eye.

[0184] Example 4. Simultaneous multiple detection of SENSR reactants based on lateral flow immunoassay.

[0185] By applying the sequence-specific DNA detection method based on lateral flow immunoassay using the RPA amplicon confirmed in Example 3-2 above, we attempted to simultaneously multiplex detection of two types of targets having different sequences.

[0186] First, a strip with two test lines was created to enable simultaneous multiple detection and to allow for simultaneous confirmation of results. The first test line was designed to detect biotin-labeled targets, and the second test line to detect DIG-labeled targets. Simultaneous multiple detection allows for the simultaneous reaction of multiple SENSR probes to a target, thereby obtaining detection results for multiple targets in a single test. The entire process for this simultaneous multiple detection method is summarized in Figure 7.

[0187] Using a strip for simultaneous multiple detection, for example, wild type targets and mutant targets of CYP genes can be detected simultaneously. Specifically, the components required for the RPA reaction shown in Table 17 can be mixed in the same manner as in Example 3-2, and the mixture can be reacted at 37°C for 20 minutes to obtain an amplification product. Thereafter, as shown in Table 18, the RPA reaction product can be mixed with double-stranded recombination inhibitor DNA and a SENSR probe set, and the reaction product can be reacted at 98°C for 5 minutes to denature double-stranded DNA, and then cooled to 37°C. Then, the Dual SENSR reaction product shown in Table 19 can be added thereto and reacted at 37°C for 15 minutes, thereby performing a simultaneous multiple detection reaction.

[0188] To measure the results of the above simultaneous multiple detection reaction, 20 μl of the reactants are dispensed onto the sample pad of the Hybridetect 1 kit, and 10 μl of RNase-free water is additionally dispensed. The detection results can be confirmed visually by checking whether there is a band on the test line of the diagnostic strip, and the band intensity of the test line can be quantified using the ImageJ analysis program after imaging the diagnostic strip with a printer scanner.

[0189] Dual reaction probe set Reagent Concentration Amount RT-PCR or RPA resultant Variable 1 ㎕ Downstream targeting intruder DNA 20 µM 1.5 ㎕ Upstream targeting intruder DNA 20 µM 1.5 ㎕ Promoter probe (PP) 10 µM 0.3 ㎕ Reporter probe (RP, prototype virus) 10 µM 0.33 ㎕ Reporter probe (RP, variant) 10 µM 0.33 ㎕ SENSR buffer 10X 0.54 ㎕ RNase-free water 2.5 ㎕ Total 9 ㎕

[0190] Dual reaction SENSR components Reagent Concentration Amount Sample (Table 18) 300 nM 9 μL SENSR buffer 10 X 3 μL NTPs 25 mM each 3 μL ATP 1 M 0.3 μL ET-SSB 500 ng / μL 1 μL RNase Inhibitor 40 U / μL 1 μL SplintR ligase 25 U / μL 1.5 μL T7 RNA polymerase 50 U / μL 1.5 μL Detect probe 1-1 (Biotin) 1 μM 0.75 μL Detect probe 1-2 (DIG, mutant) 1 μM 0.75 μL Detect probe 2 (FAM, original virus) 1 μM 0.75 μL RNase-free water Up to 30 μL Total 30 μL

[0191] When performing simultaneous multiple detection as above, if the sample is a wild type homozygous target, a band is expected to appear only in the first test line (biotin), if the sample is a mutant type homozygous target, a band is expected to appear only in the second test line (DIG), and if the sample is a heterozygous target with both genotypes, a band is expected to appear in both test lines.

[0192] That is, it is expected that by using the simultaneous multiple detection method according to the present invention, detection results for multiple targets can be visually confirmed with a single test.

Claims

1. An isothermal one-pot reaction SENSR probe set for detecting target nucleic acids, comprising a first probe and a second probe; a first preparation comprising a nucleic acid for preventing double-strand recombination of at least one target gene; and A composition for detecting a target nucleic acid, comprising: a first detection probe to which a first label is bound; a second detection probe to which a second label is bound; and a second preparation comprising the same. The above first probe is a promoter probe (PP) having a structure of the following general formula I; 3'-X- Y-5' (I) In the above general formula (I), The above X is a stem-loop structure region including a promoter sequence recognizable by RNA polymerase; the above Y is a UHS (Upstream Hybridization Sequence) region having a hybridization sequence complementary to a target nucleic acid sequence; the target nucleic acid sequence is DNA or RNA; the above X and Y are deoxyribonucleotides; The second probe is a reporter probe (RP) having a structure of the following general formula II; 3'-Y'-Z-5' (II) In the above general formula (II), The above Y' is a DHS (Downstream Hybridization Sequence) site having a hybridization sequence complementary to the target nucleic acid sequence; the above Z is a linear sequence site having the first detection probe and second detection probe sequences; the target nucleic acid sequence is DNA or RNA; the above Y' and Z are deoxyribonucleotides; A composition for detecting a target nucleic acid, wherein the nucleic acid for preventing double-strand recombination of the target gene is a sequence complementary to the target nucleic acid sequence at the 3' terminal position or the 5' terminal position of the complementary binding region of the SENSR probe set.

2. A composition according to claim 1, wherein the target nucleic acid is any one selected from the group consisting of genes of viruses, harmful bacteria, and animals including humans.

3. In the first paragraph, the composition comprises one or two nucleic acids for preventing double-strand recombination of the target gene.

4. In the first paragraph, when there are two nucleic acids for preventing double-strand recombination of the target gene, the composition has a nucleic acid sequence complementary to the target nucleic acid sequence at each of the 3' terminal position and the 5' terminal position.

5. A composition according to claim 1, wherein the nucleic acid for preventing double-strand recombination of the target gene is a sequence that complementarily binds to the target gene at a position that is 0 to 24 base sequences away from the complementary binding region of the SENSR probe set.

6. A composition according to claim 1, wherein the nucleic acid for preventing double-stranded recombination of the target gene has a sequence number of 8 or more bases.

7. A composition according to claim 1, wherein the first detection probe and the second detection probe complementarily bind to RNA produced by an isothermal single reaction.

8. A composition according to claim 1, wherein both the first detection probe and the second detection probe have a linear structure.

9. A composition according to claim 1, wherein the first detection probe and the second detection probe do not bind to each other.

10. A composition according to claim 1, wherein the first detection probe and the second detection probe do not bind to the target nucleic acid.

11. A composition according to claim 1, wherein the first detection probe and the second detection probe do not bind to the first probe.

12. A composition according to claim 1, wherein the first detection probe and the second detection probe do not bind to the nucleic acid for preventing double-strand recombination of the target gene.

13. A composition according to claim 1, wherein the first detection probe and the second detection probe have a base sequence number of 10 to 25.

14. In the first paragraph, the first labeling material and the second labeling material are any one different selected from the group consisting of biotin, fluorescein amidite (FAM), digoxigenin (DIG), fluorescein isothiocyanate (FITC), Texas red, fluorescein, 2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein (HEX), rhodamine green, rhodamine red, tetramethyl rhodamine, Oregon green, alexa fluor, 6-Carboxyl-XRhodamine (ROX), tertramethylrodamine isothiocyanate (TRITC), 6-carboxytetramethyl-rhodamine (TAMRA), and cyanine series dyes.

15. A composition according to claim 1, wherein the first labeling substance is biotin or DIG.

16. A composition according to claim 1, wherein the second labeling substance is FAM.

17. A composition according to claim 1, wherein the first labeling substance is biotin or DIG, and the second labeling substance is FAM.

18. A composition according to claim 1, wherein the isothermal single reaction is simultaneously performed in one vessel at a designated temperature within a range of 15°C to 50°C without a separate amplification reaction. 19.(a) A target nucleic acid signal amplification composition comprising a composition according to any one of claims 1 to 18; a ligation agent; a polymerase; and an isothermal single reaction solution; and (b) A kit for detecting a target gene, comprising a lateral flow immunoassay (LFA) substrate in which a sample pad, a conjugation pad, and a test membrane having a test line formed thereon are sequentially arranged.

20. A kit according to claim 19, wherein the ligation agent of (a) is at least one selected from the group consisting of SplintR ligase, bacteriophage T4 ligase, E. coli ligase, Afu ligase, Taq ligase, Tfl ligase, Mth ligase, Tth ligase, Tth HB8 ligase, Thermus species AK16D ligase, Ape ligase, LigTk ligase, Aae ligase, Rm ligase, Pfu ligase, ribozyme, and variants thereof.

21. In the 19th paragraph, the polymerase of (a) is at least one selected from the group consisting of bacteriophage T7 RNA polymerase, bacteriophage T3 polymerase, bacteriophage RNA polymerase, bacteriophage ΦII polymerase, Salmonella bacteriophage sp6 polymerase, Pseudomonas bacteriophage gh-1 polymerase, E. coli RNA polymerase, holoenzyme, E. coli RNA polymerase, core enzyme, human RNA polymerase I, human RNA polymerase II, human RNA polymerase III, human mitochondrial RNA polymerase, and variants thereof.

22. A kit according to claim 19, wherein the isothermal single reaction solution of (a) comprises at least one selected from the group consisting of Tris-HCl, MgCl2, NTPs, NaCl, and ET-SSB (Extreme Thermostable Single-Stranded DNA Binding Protein).

23. A kit according to claim 19, wherein the conjugation pad of (b) comprises a conjugate of a reactive substance that specifically binds to the second labeling substance and a color-developing particle.

24. In the 19th paragraph, the test line of (b) is a kit in which a reactive substance that specifically binds to the first labeling substance is immobilized.

25. A kit according to claim 23 or 24, wherein the reagent that specifically binds to the first label or the second label is any one different selected from the group consisting of streptavidin, neutravidin, avidin, anti-FAM antibody, anti-DIG antibody, anti-FITC antibody, anti-Texas Red antibody, anti-fluorescein antibody, anti-HEX antibody, anti-rhodamine green antibody, anti-rhodamine red antibody, anti-tetramethyl rhodamine antibody, anti-Oregon green antibody, anti-Alexa Fluoro antibody, anti-TRITC antibody, anti-TAMRA antibody, and anti-cyanine series (Cy3, Cy5).

26. A kit according to claim 25, wherein the reactive substance that specifically binds to the first labeling substance is streptavidin, neutravidin, avidin, or an anti-DIG antibody.

27. A kit according to claim 25, wherein the reactive substance that specifically binds to the second labeling substance is an anti-FAM antibody.

28. A kit according to claim 23, wherein the color-developing particles are at least one selected from the group consisting of metal nanoparticles, polymer nanoparticles, latex beads, magnetic nanoparticles, quantum dot nanoparticles, and carbon nanoparticles.

29. In the 28th paragraph, the metal nanoparticle is a kit, wherein the metal nanoparticle is at least one nanoparticle selected from the group consisting of gold (Au), silver (Ag), platinum (Pt), palladium (Pd), europium (Eu), iridium (Ir), rhodium (Rh), ruthenium (Ru), titanium (Ti), zirconium (Zr), hafnium (Hf), vanadium (V), niobium (Nb), tantalum (Ta), chromium (Cr), molybdenum (Mo), tungsten (W), ruthenium (Ru), osmium (Os), iron (Fe), nickel (Ni), cobalt (Co), magnesium oxide (MgO), titanium dioxide (TiO2), vanadium pentoxide (V2O5), and zinc oxide (ZnO).

30. A kit according to claim 28, wherein the polymer nanoparticles are at least one nanoparticle selected from the group consisting of polystyrene and polyethylene glycol (PEG). 31.(a) A step of separating the double strand of the target gene at a high temperature of 80 to 100°C; (b) a step of cooling the reactant of (a) to an isothermal temperature of 15 to 50°C, adding a composition according to any one of claims 1 to 18, and performing an isothermal single reaction and reacting with a detection probe; and (c) A method for detecting a target gene, comprising a step of confirming fluorescence expression or color development.

32. In the 31st paragraph, the isothermal single reaction of (b) is performed simultaneously in one vessel by unifying at any one designated temperature in the range of 15°C to 50°C without a separate amplification reaction.

33. A detection method in claim 31, wherein the fluorescence expression or color development of (c) is confirmed through a lateral flow immunoassay (LFA).

Images