Methods and compositions for biomarker-guided bladder cancer therapy

Abstract

The present disclosure provides methods for individuals having bladder cancer comprising intravesically administering to the individual an oncolytic virus, such as cretostimogene grenadenorepvec, optionally in combination with one or more additional therapeutic agents, such as an immune checkpoint modulator or a chemotherapeutic agent. Also provided are pharmaceutical compositions and kits for treating bladder cancer.

Description

METHODS AND COMPOSITIONS FOR BIOMARKER-GUIDED BLADDER CANCER THERAPYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 654,584, filed on May 31, 2024, U.S. Provisional Application No. 63 / 790,586, filed on April 17, 2025, and U.S. Provisional Application No. 63 / 794,976, filed on April 25, 2025, all of which are hereby incorporated by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (744442001540seqlist.xml; Size: 3,810 bytes; and Date of Creation: May 23, 2025) is herein incorporated by reference in its entirety.FIELD

[0003] The present invention relates to methods of treating bladder cancer using an oncolytic virus, such as cretostimogene grenadenorepvec.BACKGROUND

[0004] The American Cancer Society estimated that there will be over 83,000 new cases of bladder cancer diagnosed in 2024 in the United States. Non-muscle invasive bladder cancer (stages Ta, Tl, or carcinoma in situ) accounts for 70-80% of bladder cancer cases, while muscle invasive disease (stage T2 and above) and metastatic disease make up the remaining 20-30%. Bladder cancers are divided into 2 subtypes based on their distinct cellular growth patterns: papillary tumors and flat tumors. Carcinoma in situ (CIS) is a flat tumor confined to the surface layer of the bladder lumen. Compared to papillary tumors of the Ta and Tl stage, bladder CIS is more difficult to diagnose, and has a high risk of progression to muscle invasive bladder cancer.

[0005] Intravesical Bacillus Calmette-Guerin (BCG) is the standard-of-care treatment for non-muscle invasive bladder cancer (NMIBC). Patients typically receive an induction course consisting of weekly intravesical installations of BCG for 6 weeks, followed by monthly maintenance treatments for 6 to 12 months, with each maintenance course typically consisting of weekly intravesical instillations for 3 weeks. However, about 30-40% of patients classify do not respond to the induction course of BCG treatment and are classified as having BCG-resistant NMIBC (Kodera, et al. (2023) "The management of BacillusCalmette-Guerin (BCG) failure in high-risk non-muscle invasive bladder cancer: A review article." Cureus 15.6). Further, recurrence occurs in over 50% of patients who achieve an initial response (Sylvester et al. Eur Urol 2006; 49: 466), and 20-40% of patients are at risk of disease progression (Kamat et al. J Clin Oncol. 2016;34(16): 1935-44; Roumiguie et al. Eur Urol 2022; 82:34-46). For patients with BCG-resistant NMIBC or recurrent NMIBC after BCG therapy, cystectomy, including partial and radical cystectomy, remains the treatment of choice. However, cystectomy is associated with severe side effects and adversely affects patients’ quality of life (Maibom et al. BMJ Open. 2021 Apr 14;l l(4):e043266; Clements et al. Eur Urol. 2021;81(3), 294-304). Moreover, the risk of recurrence after radical cystectomy for clinically localized bladder cancer is high and stage-dependent. See, for example, Bassi P et al. J. Urol. 1999; 161 : 1494-7. In addition to BCG-resistant NMIBC, an ongoing shortage of BCG have left patients having high-risk NMIBC with very few treatment options (Holzbeierlein Jet al. Diagnosis and treatment of non-muscle invasive bladder cancer: AUA / SUO guideline: 2024 amendment. J Urol. 2024). The elderly and patients with renal failure, who are less tolerable to surgery or chemotherapy, pose additional clinical challenges for treatment of high-risk NMIBC.

[0006] Accordingly, there is a need for effective alternatives to BCG therapy for the treatment of bladder cancer, in particular for patients with BCG-resistant disease and patients effected by ongoing BCG shortages.BRIEF SUMMARY

[0007] In some aspects, provided herein are methods of treating bladder cancer comprising administering therapy based on one or more determinations of genomic disease burden (GDB) value(s) and / or Minimal Residual Disease (MRD) values. GDB is a metric that reflects the overall molecular tumor burden in a patient's urine sample, calculated by comparing the total variant allele frequency (VAF) profile of a given sample against a reference cohort of bladder cancer patients. MRD refers to the presence of residual tumor cells that persist after treatment, which can seed recurrence.

[0008] The present disclosure is based, at least in part, on the discovery that changes in GDB, VAF, and / or MRD following treatment provide actionable insights into bladder cancer treatment response and disease trajectory. The inventors have demonstrated that VAF, GDB, and MRD can be used to identify bladder cancer patients as candidates for an escalated therapy, such as escalating from monotherapy to combination therapy, or a de-escalated therapy, such as de-escalating from combination therapy to monotherapy.

[0009] Accordingly, in some aspects, described herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: (i) if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on the difference between the first GDB value and a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein (i) if the second GDB value is greater than the first GDB value, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (i) if the second GDB value is less than the first GDB value, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent.

[0010] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising a) administering an initial therapy based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint; and b) administering a subsequent therapy based on the difference between the first VAF value and a second VAF value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein: (i) if the second VAF value is greater than the first VAF value, the subsequent therapy is an escalated therapy comprising administration of an oncolytic virus and administration of an additional therapeutic agent selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the second VAF value is less than the first VAF value, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent.

[0011] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: (i) if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on a difference between the first risk status and a second risk status of low risk, intermediate risk, or high risk assigned based on a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein (i) if the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the second risk status is lower than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent.

[0012] In some embodiments of the foregoing aspects, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In other embodiments of the foregoing aspects, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In still other embodiments of the foregoing aspects, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapycomprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

[0013] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: (i) if the first risk status is high risk, the initial therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the first risk status is low risk or intermediate risk, the initial therapy does not comprise administration of the additional therapeutic agent. In some embodiments, if the first risk status is intermediate risk, the method further comprises a subsequent therapy comprising intravesically administering to the individual an effective amount of the oncolytic virus, wherein the subsequent therapy is administered based on a determination of a second GDB value in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein the individual is assigned a second risk status of low risk, intermediate risk, or high risk based on the second GDB value, and wherein, (i) if the second risk status is intermediate risk or high risk, the subsequent therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the second risk status is low risk, the subsequent therapy does not comprise administration of one or more additional therapeutic agents.

[0014] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative, wherein the initial MRD status is determined based on a first variant allele frequency (VAF) value in a first urine sample obtained from the individual at a first timepoint, and wherein: i) if the initial MRD status is MRD-positive: 1) the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent,or 2) the initial therapy comprises intravesical administration of an oncolytic virus without the one or more additional therapeutic agents and wherein the individual is optionally subject to a subsequent escalated therapy; or ii) if the initial MRD status is MRD-negative: the initial therapy comprises intravesical administration of the oncolytic virus without administration of the one or more additional therapeutic agents; and b) administering a subsequent therapy based on a determination of an updated MRD status of MRD-positive or MRD-negative, wherein the updated MRD status is determined based on a second VAF value in a second urine sample obtained from the individual at a second timepoint following the initial therapy, and wherein: i) if the updated MRD status is MRD-positive: the subsequent therapy comprises escalated therapy comprising intravesical administration of the oncolytic virus in combination with administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the updated MRD status is MRD-negative: the subsequent therapy comprises de-escalated therapy comprising intravesical administration of the oncolytic virus without administration of one or more additional therapeutic agents.

[0015] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus; and b) administering a subsequent therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint subsequent to the initial therapy, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: i) if the first risk status is intermediate risk or high risk, the subsequent therapy comprises intravesical administration of the oncolytic virus in combination with one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, an immune checkpoint modulator, a targeted therapy agent, or an immunomodulatory agent; or ii) if the first risk status is low risk, the subsequent therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

[0016] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint, wherein the individual is assignedan initial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value, and wherein: a) if the initial MRD status is MRD-positive, i) the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) the initial therapy comprises intravesical administration of an oncolytic virus without the one or more additional therapeutic agents, optionally wherein the method comprises administering to the individual a subsequent escalated therapy comprising administering to the individual the oncolytic virus in combination with one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or b) if the initial MRD status is MRD-negative, the initial therapy does not comprise administration of the additional therapeutic agent.

[0017] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus; and b) administering a subsequent therapy based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint subsequent to the initial therapy, wherein the individual is assigned a minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value, and wherein: (i) if the MRD status is MRD-positive, the subsequent therapy comprises intravesical administration of the oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or (ii) if the MRD status is MRD-negative, the subsequent therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

[0018] In some embodiments of the foregoing aspects, the additional therapeutic agent is administered once every six weeks for at least six months and optionally subsequently administered once every three months. In some embodiments of the foregoing aspects, the additional therapeutic agent is administered systemically. In certain embodiments, the additional therapeutic agent is administered intravenously. In some embodiments of the foregoing aspects, the additional therapeutic agent is administered intratumorally. In some embodiments, the additional therapeutic agent is administered intravesically.

[0019] In some embodiments of the foregoing aspects, the oncolytic virus and the additional therapeutic agent are administered sequentially. In other embodiments of the foregoing aspects, the oncolytic virus and the additional therapeutic agent are administered simultaneously.

[0020] In some aspects, provided herein is a method of identifying an individual having bladder cancer as a candidate for a combination therapy comprising intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the method comprising: determining a first genomic disease burden (GDB) value in a urine sample from the individual; assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; and if the first risk status is high risk, selecting the individual for the combination therapy.

[0021] In some aspects, provided herein is a method of identifying an individual having bladder cancer as a candidate for a therapy comprising intravesical administration of an effective amount of an oncolytic virus without administration a chemotherapeutic agent or an immune checkpoint modulator, the method comprising: determining a first genomic disease burden (GDB) value in a urine sample from the individual; assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the determined GDB value; and, if the first risk status is intermediate or low risk, selecting the individual for the therapy.

[0022] In some aspects, provided herein is a method of identifying an individual having bladder cancer as a candidate for a combination therapy comprising intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the method comprising: determining a first variant allele frequency (VAF) value in a urine sample from the individual; assigning to the individual an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value; and if the initial MRD status is MRD-positive, selecting the individual for the combination therapy.

[0023] In some aspects, provided herein is a method of identifying an individual having bladder cancer as a candidate for a therapy comprising intravesical administration of an effective amount of an oncolytic virus without administration a chemotherapeutic agent or an immune checkpoint modulator, the method comprising: determining a first variant allele frequency (VAF) value in a urine sample from the individual; assigning to the individual aninitial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value; and if the initial MRD status is MRD-negative, selecting the individual for the therapy.

[0024] In some embodiments of any of the foregoing aspects, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5%, 6%, 7%, 8%, 9%, or 10%, optionally wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 8%. In some embodiments of the foregoing aspects, the individual is assigned an MRD status of MRD-positive if the VAF value is at least about 5%, 6%, 7%, 8%, 9%, or 10%, optionally wherein the individual is assigned an MRD status of MRD-positive if the VAF value is at least about 8%.

[0025] In some embodiments of any of the foregoing aspects, the initial therapy is administered based on a determination of the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint; the subsequent therapy is administered based on a determination of the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint; or both. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5%, 6%, 7%, 8%, 9%, or 10% and the GDB value is less than about 40, 41, 42, 43, 44, or 45, optionally wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 8% and the GDB value is less than about 42. In some embodiments, the individual is assigned an MRD status of MRD- positive if the GDB value is at least about 40, 41, 42, 43, 44, or 45 regardless of the VAF value, optionally wherein the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 42 independent of the VAF value.

[0026] In some embodiments of any of the foregoing aspects, the method comprises: assigning to the individual an initial MRD status based on the first VAF value; assigning to the individual an updated MRD status based on the second VAF value; or both. In some embodiments of the foregoing aspects, the method comprises: assigning to the individual an initial MRD status based on the first VAF value and the first GDB value; assigning to the individual an updated MRD status based on the second VAF value and the second GDB value; or both.

[0027] In some embodiments of any of the foregoing aspects, the method comprises: determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the individual; or both. In some embodiments of any of the foregoing aspects, the method comprises: determining the firstGDB value in the first urine sample from the individual; determining the second GDB value in the second urine sample from the individual; or both.

[0028] In some embodiments of any of the foregoing aspects, the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; or both. In some embodiments, the individual is assigned a risk status of low risk if the GDB value is less than about 20. In some embodiments, the individual is assigned a risk status of high risk if the GDB value is greater than about 80. In some embodiments, the individual is assigned a risk status of intermediate risk is the GDB value is between about 20 and about 80.

[0029] In some embodiments of any of the foregoing aspects, determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value, the second GDB value, or both based on the urine nucleic acid sequence data. In some embodiments, calculating the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data; and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In some embodiments, the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples. In some embodiments, the training dataset comprises one or more variant alleles selected from the group consisting of single nucleotide variants (SNVs), insertions, deletions, copy number variations (CNVs), and aneuploidy. In some embodiments, the training dataset comprises: a) SNVs, insertion, and / or deletions in one or more genes selected from the group consisting of TERT, TP53, PLEKHS1, KMT2D, KDM6A, ARID1A, PIK3CA, ERBB3, RXRA, CREBBP, ERBB2, ZFP36L1, RBI, FAT1, STAG2, SPTAN1, TSC1, RHOB, ELF3, KMT2C, and TPTE; b) CNVs in one or more genes selected from the group consisting of SOX4, NITI, and SPAG1; and / or c) aneuploidy. In some embodiments, the sequencing comprises amplicon sequencing, whole genome sequencing, or a combination thereof.

[0030] In some embodiments of any of the foregoing aspects, the method comprises one or more treatment courses each comprising administering the oncolytic virus weekly. In some embodiments, each treatment courses comprises administering the oncolytic virus weekly for about 1 week to about 6 weeks.

[0031] In some embodiments of any of the foregoing aspects, the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual every three or six months. In certain embodiments, the maintenance phase comprises administering the oncolytic virus weekly for three weeks every three or six months. In certain embodiments, the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months. In some embodiments, the individual is administered the oncolytic virus once per week for six weeks on month zero during the induction phase and is reevaluated at month three. In some embodiments, the individual begins the maintenance phase at month three. In certain embodiments, the maintenance phase comprises administering the oncolytic virus once per week for three weeks every three months for nine months and subsequently administering the oncolytic virus once per week for three weeks every six months. In some embodiments, the individual receives a second induction dose of oncolytic virus once per week for six weeks at month three. In certain embodiments, the maintenance phase comprises administering the oncolytic virus once per week for three weeks every three months for six months and subsequently administering the oncolytic virus once per week for three weeks every six months. In some embodiments, the maintenance phase comprises: (i) administering the oncolytic virus once per week for three weeks every three months for six to nine months, and subsequently (ii) administering the oncolytic virus once per week for three weeks every six months.

[0032] In some embodiments of any of the foregoing aspects, the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles. In certain embodiments, the oncolytic virus is administered at a dose of about 1 x 1012viral particles. In some embodiments of any of the foregoing aspects, the oncolytic virus is administered in a volume of between about 50 mL and about 100 mL.

[0033] In some embodiments of any of the foregoing aspects, the method further comprises intravesically administering to the individual a transduction enhancing agent prior to the administration of the oncolytic virus. In some embodiments, the transduction enhancing agent is N-Dodecyl-P-D-maltoside (DDM). In some embodiments, the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic virus. In some embodiments, the oncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In someembodiments, the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus. In certain embodiments, the oncolytic virus is administered directly after the single dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus. In some embodiments, the method comprises intravesically administering a saline wash before administering a first and second dose of DDM to the individual. In certain embodiments, the method comprises intravesically administering a saline wash after administering a first and second dose of DDM to the individual, prior to administering the oncolytic virus. In some embodiments, the DDM is administered at a concentration of about 0.1%. In some embodiments, the DDM is administered at a volume of between about 50 mL and about 100 mL.

[0034] In some aspects, provided herein is a kit for treating bladder cancer in an individual, the kit comprising: a) one or more agents for determining a genomic disease burden (GDB) value or a variant allele frequency (VAF) value in a urine sample from an individual; b) an oncolytic virus; and c) a device for intravesically administering the oncolytic virus. In some embodiments, the kit further comprises instructions for determining a GDB value or the VAF value in the urine sample. In some embodiments, the kit further comprises instructions for determining a risk status or a minimum residual disease (MRD) status for the individual based on the VAF value, the GDB value, or both. In some embodiments, the kit further comprises one or more additional therapeutic agents selected from the group consisting of an immune checkpoint modulator or a chemotherapeutic agent. In certain embodiments, the kit further comprises instructions for administering the additional therapeutic agent based on the determination of the GDB value, determination of the VAF value, the determination of the risk status, and / or determination of the MRD status. In certain embodiments, the kit further comprises a device for administering the additional therapeutic agent.

[0035] In some embodiments of any of the foregoing aspects, the individual has nonmuscle invasive bladder cancer (NMIBC). In some embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has carcinoma in situ. In certain embodiments, the individual has carcinoma in situ and has a concurrent papillary carcinoma of Ta or T1 stage. In certain other embodiments, the individual has carcinoma in situ and does not have a concurrent papillary carcinoma of Ta or T1 stage. In some embodiments, the individual has a papillary carcinoma of Ta or T1 stage. In certain embodiments, the individual has a papillary carcinoma of Ta or T1 stage and does not have concurrent carcinoma in situ.

[0036] In some embodiments of any of the foregoing aspects, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy. In some embodiments, the individual was responsive to BCG therapy. In certain embodiments, wherein the individual experienced reduced bladder cancer symptoms, reduced size or number of bladder tumors, or an absence of bladder tumors after intravesical BCG therapy. In some embodiments, the individual was BCG-unresponsive. In some embodiments, the individual has not received prior intravesical BCG therapy.

[0037] In some embodiments of any of the foregoing aspects, the individual has received transurethral resection of bladder tumor (TURBT) prior to administration of the oncolytic virus. In some embodiments, the bladder cancer has been completely resected by TURBT prior to administration of the oncolytic virus. In some embodiments, the bladder cancer is recurrent after complete resection of one or more prior bladder tumors by TURBT.

[0038] In some embodiments of any of the foregoing aspects, the additional therapeutic agent is an immune checkpoint modulator. In some embodiments, the immune checkpoint modulator comprises an immune checkpoint inhibitor. In some embodiments, the immune checkpoint modulator comprises an inhibitor of an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, CD137, and ligands thereof. In certain embodiments, the immune checkpoint inhibitor is an antibody that binds to an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator is an anti -PD-1 antibody. In certain embodiments, the anti-PD-1 antibody is nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP- 514, STI-All 10, TSR-042, or any combination thereof.

[0039] In some embodiments of any of the foregoing aspects, the additional therapeutic agent is a chemotherapeutic agent. In some embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises: a) gemcitabine and cisplatin; b) dose-dense methotrexate, vinblastine, doxorubicin (Adriamycin), and cisplatin (DDMVAC); or c) gemcitabine and paclitaxel. In certain embodiments, the chemotherapeutic agent is gemcitabine.

[0040] In some embodiments of any of the foregoing aspects, the oncolytic virus is selected from the group consisting of adenovirus, herpes simplex virus, vaccinia virus, mumps virus,Newcastle disease virus, polio virus, measles virus, Seneca valley virus, coxsackie virus, reovirus, vesicular stomatitis virus, maraba and rhabdovirus, and parvovirus.

[0041] In some embodiments of any of the foregoing aspects, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune- related molecule. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell. In certain embodiments, the cancer cell is defective in the Rb pathway. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter. In certain embodiments, the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTap. In certain embodiments, the immune-related molecule is GM-CSF. In some embodiments, the heterologous gene is operably linked to a viral promoter. In some embodiments, the oncolytic virus is an oncolytic adenovirus. In certain embodiments, the oncolytic virus is an oncolytic adenovirus and the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4. In certain embodiments, the oncolytic virus is an oncolytic adenovirus and the heterologous gene is operably linked to an El promoter or an E3 promoter.

[0042] In some embodiments of any of the foregoing aspects, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene.

[0043] In some embodiments of any of the foregoing aspects, the individual is human.BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The present application can be understood by reference to the following description taken in conjunction with the accompanying figures.

[0045] FIG. 1 is a schematic diagram of cretostimogene grenadenorepvec (also referred to as cretostimogene or CG0070) and wild type adenovirus type 5. Cretostimogene is based on adenovirus serotype 5, but the endogenous Ela promoter and E3 19kD coding region have been replaced by the human E2F-1 promoter and a cDNA coding region of human GM-CSF, respectively.

[0046] FIG. 2A depicts a flow chart showing administration of a clinical trial evaluating cretostimogene monotherapy (Mono) and combination therapy with one or more additional therapeutic agents (IO, such as an immune checkpoint modulator or chemotherapeutic agent) based on a determination of urinary genomic disease burden (GDB) and an associated risk status of low, intermediate (int), or high for the individual being treated.

[0047] FIG. 2B depicts a flow chart showing administration of a clinical trial evaluating cretostimogene monotherapy (Mono creto) and combination therapy with one or more additional therapeutic agents (X, such as an immune checkpoint modulator or chemotherapeutic agent) based on a determination of urinary genomic disease burden (GDB) and an associated minimum residutal disease (MRD) status of positive (+) or negative (-) for the individual being treated.

[0048] FIG. 3 depicts a chart showing the criteria for the patient groups of the Phase 2 clinical trial described in Example 3, including BCG-naive, BCG-unresponsive, and BCG- exposed patient groups.

[0049] FIG. 4 depicts a chart summarizing the cohorts evaluated in the Phase 2 clinical trial described in Example 3. The number of patients depicted in each cohort is an estimate of patients to be recruited for the trial.

[0050] FIG. 5A depicts the treatment schedule to be used for Cohort A (all arms), Cohort B (all arms), and Arm 1 of Cohort CX of the Phase 2 clinical trial described in Example 3. Each instillation is represented by a line topped with a circle. In Cohort A and B, each instillation corresponds to an instillation of DDM followed by an instillation of cretostimogene. In Cohort CX, Arm 1, each instillation correspond to an instillation of DDM, followed by an instillation of cretostimogene, followed by an instillation of gemcitabine.

[0051] FIG. 5B depicts the treatment schedule to be used for Arm 2 of Cohort CX of the Phase 2 clinical trial described in Example 3. Instillations of cretostimogene are represented by a line topped with a circle and correspond to an instillation of DDM followed by an instillation of cretostimogene. Instillations of gemcitabine are represented by a line topped with a diamond and correspond to an instillation of gemcitabine only.

[0052] FIGS. 6A-6B depict results from genomic disease burden (GDB) analysis of patients in the BOND-003 trial. FIG. 6A depicts results from patients prior to the first administration of cretostimogene. FIG. 6B depicts results from patients 6-months after the first administration of cretostimogene. Each column in the bar chart corresponds to a single patient. In the bar chart, single-nucleotide variants (SNV) and insertions / deletions (InDei) are collectively shown in blue; copy number variants (CNV) are shown in orange; andaneuploidy is shown in red. Genomic disease burden (GDB) for each patient is shown below the bar chart, with low to high GDB shown in a gradient from black, to purple, to red, to yellow. Minimum residual disease (MRD) status for each patient is shown below GDB, with white indicating MRD-negative and red indicating MRD-positive patients.

[0053] FIGS. 7A-7B depict results from GDB analysis of patients in the CORE-001 trial. FIG. 7A depicts results from patients prior to the first administration of cretostimogene. FIG. 7B depicts results from patients 6-months after the first administration of cretostimogene. Each column in the bar chart corresponds to a single patient. In the bar chart, singlenucleotide variants (SNV) and insertions / deletions (InDei) are collectively shown in blue; copy number variants (CNV) are shown in orange; and aneuploidy is shown in red. Genomic disease burden (GDB) for each patient is shown below the bar chart, with low to high GDB shown in a gradient from black, to purple, to red, to yellow. Minimum residual disease (MRD) status for each patient is shown below GDB, with white indicating MRD-negative and red indicating MRD-positive patients.

[0054] FIG. 8 depicts the fraction of patients with bladder cancer evaluated using Uro Amp® in the BOND-003 and CORE-001 trials that were found to have variants in bladder-cancer-associated genes at baseline prior to the initiation of treatment. Singlenucleotide variants (SNV) and insertions / deletions (InDei) are shown as blue dots; copy number variants (CNV) are shown as orange dots; and aneuploidy is shown as a red dot.

[0055] FIG. 9 depicts a graph showing the probability of high-grade recurrence-free survival (RFS) over time in MRD-negative and MRD-positive patients in the BOND-003 trial who have been treated with cretostimogene and achieved a complete response at or around month 3. The graph represents a 12-month RFS Kaplan-Meier model, predicted based on the UroAmp® molecular signature (MRD profile) obtained at the Week 13 assessment. MRD- negative patients are shown in blue, and MRD-positive patients are shown in red.

[0056] FIG. 10 depicts the maximum variant allele frequency (VAF) analyzed over about 12 months (49 weeks) in patients in the BOND-003 trial that have been stratified according to their response to cretostimogene therapy. “All CR” refers to patients that received a weekly x6 induction course of cretostimogene administration and achieved a complete response (CR) at three months (week 13) and did not receive a second induction course. All patients in the “All CR” group maintained complete response (CR) throughout the 12-month period shown. “NR to CR” refers to patients that initially received a weekly x6 induction course of cretostimogene administration, were not responsive, and subsequently received a second weekly x6 induction course at three months (week 13), and then achieved CR by the six-month (week 25) evaluation. The “NR to CR” group then maintained CR throughout to the 12-month timepoint depicted in the figure. “CR to NR” refers to patients that received a single weekly x6 induction course of cretostimogene administration, achieved CR at three months (week 13), and then experienced disease recurrence within 12 months (by week 49) from the first dose of cretostimogene “All NR” refers to patients that that received at least one weekly x6 induction course of cretostimogene, did not achieve CR at any point in the study, and discontinued the study after three months (week 13).

[0057] FIG. 11 depicts a Kaplan-Meier estimate for high-grade recurrence-free survival based on the first 24 patients evaluated in Cohort P of the BOND-003 trial.DETAILED DESCRIPTION

[0058] The following description is presented to enable a person of ordinary skill in the art to make and use the various embodiments. Descriptions of specific devices, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Thus, the various embodiments are not intended to be limited to the examples described herein and shown, but are to be accorded the scope consistent with the claims.I. Definitions

[0059] Terms are used herein as generally used in the art, unless otherwise defined as follows.

[0060] “Non-muscle invasive bladder cancer (NMIBC)” refers to bladder cancer where the cancer cells / tumors are confined to the bladder wall and are not present muscle surrounding the bladder. NMIBC includes papillary carcinomas of Ta and T1 stage, carcinoma in situ (CIS), and combinations thereof. “High-risk NMIBC” refers to bladder cancer comprising high-grade papillary carcinomas of Ta and T1 stage, carcinoma in situ (CIS), or a combination thereof.

[0061] “Papillary carcinoma” refers to bladder tumors that grow in slender, finger-like projections from the inner surface of the bladder toward the hollow center. Papillary tumors often grow toward the center of the bladder without growing into the deeper bladder layers. These tumors are called non-invasive papillary cancers. Very low-grade (slow growing), non-invasive papillary cancer is sometimes called papillary urothelial neoplasm of low-malignant potential (PUNLMP).

[0062] “Ta” stage papillary carcinoma, also referred to as “Ta disease,” refers to papillary carcinoma that is found on the surface of the inner lining of the bladder. Cancer cells are grouped together and can often be easily removed. The cancer has not invaded the muscle or connective tissue of the bladder wall. Ta papillary carcinoma is also referred to as noninvasive papillary urothelial carcinoma, or Stage 0a bladder cancer.

[0063] “Tl” stage papillary carcinoma, also referred to as “T1 disease,” refers to papillary carcinoma that has grown through the inner lining of the bladder into the lamina propria. It has not spread to the thick layer of muscle in the bladder wall or to lymph nodes or other organs. In some embodiments, the carcinoma has invaded subepithelial connective tissue.

[0064] As used herein, “bladder carcinoma in situ,” “bladder CIS,” and “carcinoma in situ of the bladder” are used interchangeably to refer to the clinical stage of bladder cancer characterized by a flat (i. e. , non-papillary) lesion comprising of cytologically malignant cells which may involve either full or partial thickness of the urothelium.

[0065] As used herein, “low-grade tumor” refers to a well-differentiated tumor, and “ “high-grade tumor” refers to a poorly-differentiated tumor, as determined by a pathologist. A high-grade tumor is often faster-growing, more likely to spread, more likely to recur after treatment, and cells look more abnormal compared to a low-grade tumor. In some embodiments, tumor grading is as described in Humphrey PA, et al. The 2016 WHO Classification of Tumours of the Urinary System and Male Genital Organs-Part B: Prostate and Bladder Tumours. Eur Urol. 2016 Jul;70(l): 106-119.

[0066] As used herein, “treatment” or “treating” is an approach for obtaining beneficial or desired results including clinical results. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms resulting from the bladder cancer, diminishing the extent of the bladder cancer, stabilizing the bladder cancer (e.g., preventing or delaying the worsening of the bladder cancer), preventing or delaying the spread (e.g., metastasis) of the bladder cancer, preventing or delaying the recurrence of the bladder cancer, reducing recurrence rate of the bladder cancer, delay or slowing the progression of the bladder cancer, ameliorating the bladder cancer state, providing a remission (partial or total) of the bladder cancer, decreasing the dose of one or more other medications required to treat the bladder cancer, delaying the progression of the bladder cancer, increasing the quality of life, and / or prolonging survival. Also encompassed by "treatment" is a reduction of pathological consequence of bladdercancer. The methods of the invention contemplate any one or more of these aspects of treatment.

[0067] “Prior therapy” used herein refers to a therapeutic regime that is different from and was instituted prior to the methods described herein comprising intravesical administration of the oncolytic virus.

[0068] As used herein, “BCG-naive” refers to an individual who has not received prior intravesical therapy with Bacillus Calmette-Guerin (BCG) for the treatment of bladder cancer (also known as “completely BCG-naive”), or who has not received prior intravesical BCG therapy within the past 24 months (e.g, within the last 24 months prior to their current pathological diagnosis), or has received a maximum of 1 or 2 doses of BCG therapy within the past 24 months (e.g, within the last 24 months prior to their current pathological diagnosis).

[0069] “Adjuvant setting” refers to a clinical setting in which an individual has had a history of bladder cancer, and generally (but not necessarily) been responsive to therapy, which includes, but is not limited to, surgery (e.g., transurethral resection of bladder tumor (“TURBT”), partial cystectomy, or radical cystectomy), radiotherapy, and chemotherapy. Treatment or administration in the “adjuvant setting” refers to a subsequent mode of treatment.

[0070] “Neoadjuvant setting” refers to a clinical setting in which the method is carried out before the primary / definitive therapy.

[0071] The term “individual,” “subject,” and “patient” are used interchangeably herein to describe a mammal, including humans. An individual includes, but is not limited to, human, bovine, horse, feline, canine, rodent, or primate. In some embodiments, the individual is human. In some embodiments, an individual suffers from bladder cancer. In some embodiments, the individual is in need of treatment.

[0072] As used herein, “delaying” the development of bladder cancer means to defer, hinder, slow, retard, stabilize, and / or postpone development of the bladder cancer. This delay can be of varying lengths of time, depending on the history of the disease and / or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. A method that “delays” development of bladder cancer is a method that reduces probability of disease development in a given time frame and / or reduces the extent of the bladder cancer in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a statistically significant number of subjects. Bladder cancerdevelopment can be detectable using standard methods, including, but not limited to, urinary cytology, urethra-cystoscopy (UCS), computed tomography (CT Scan, e.g., helical spiral CT scan), endoscopic ultrasound (EUS), endoscopic retrograde cholangiopancreatography (ERCP), laparoscopy, or biopsy (e.g., percutaneous needle biopsy or fine needle aspiration). Development may also refer to bladder cancer progression that may be initially undetectable and includes recurrence.

[0073] As used herein, by “combination therapy” is meant that a first agent be administered in conjunction with another agent. “In conjunction with” refers to administration of one treatment modality in addition to another treatment modality. As such, “in conjunction with” refers to administration of one treatment modality before, during, or after delivery of the other treatment modality to the individual.

[0074] As used herein, “monotherapy” refers to administration of a single therapeutic agent, such as the oncolytic virus, which is not in conjunction with another treatment modality, such as an immune checkpoint modulator. A monotherapy with the oncolytic virus can be administered with a pretreatment composition, such as a transduction enhancing agent (e.g., N-Dodecyl-P-D-maltoside [DDM]), which is not considered as a different treatment modality for the purpose of this invention.

[0075] As used herein, "specific", "specificity", or "selective" or "selectivity" as used when describing a compound as an inhibitor, means that the compound preferably interacts with (e.g., binds to, modulates, and inhibits) a particular target (e.g., a protein and an enzyme) than a non-target.

[0076] The term “effective amount” used herein refers to an amount of an agent (such as the oncolytic virus described herein) or composition sufficient to treat a specified disorder, condition or disease such as ameliorate, palliate, lessen, and / or delay one or more of its symptoms. In reference to cancer, an effective amount comprises an amount sufficient to cause a tumor to shrink and / or to decrease the growth rate of the tumor (such as to suppress tumor growth) or to prevent or delay other unwanted cell proliferation in cancer. In some embodiments, an effective amount is an amount sufficient to delay development of bladder cancer. In some embodiments, an effective amount is an amount sufficient to prevent or delay recurrence. In some embodiments, an effective amount is an amount sufficient to reduce recurrence rate in the individual. In some embodiments, the effective amount is an amount sufficient to inhibit tumor metastasis in the individual. An effective amount can be administered in one or more administrations. The effective amount of the agent or composition may: (i) reduce the number of cancer cells; (ii) reduce tumor size; (iii) inhibit,retard, slow to some extent and preferably stop cancer cell infiltration into peripheral organs; (iv) inhibit (i.e. , slow to some extent and preferably stop) tumor metastasis; (v) inhibit tumor growth; (vi) prevent occurrence and / or recurrence of tumor; (vii) delay occurrence and / or recurrence of tumor; (viii) reduce recurrence rate of tumor, and / or (ix) relieve to some extent one or more of the symptoms associated with the cancer. As is understood in the art, an “effective amount” may be in one or more doses, i.e., a single dose or multiple doses may be required to achieve the desired treatment endpoint.

[0077] The term “simultaneous administration,” as used herein, means that a first therapy and second therapy in a combination therapy are administered at the same time. When the first and second therapies are administered simultaneously, the first and second therapies may be contained in the same composition (e.g., a composition comprising both a first and second therapy) or in separate compositions (e.g., a first therapy is contained in one composition and a second therapy is contained in another composition).

[0078] As used herein, the term “sequential administration” or “in sequence” means that the first therapy and second therapy in a combination therapy are administered with a time separation, for example, of more than about 1 minute, such as more than about any of 5, 10, 15, 20, 30, 40, 50, 60, or more minutes. In some cases, the term “sequential administration” means that the first therapy and second therapy in a combination therapy are administered with a time separation of more than about 1 day, such as more than about any of 1 day to 1 week, 2 weeks, 3 weeks, 4 weeks, 8 weeks, 12 weeks, or more weeks. Either the first therapy or the second therapy may be administered first. The first and second therapies are contained in separate compositions, which may be contained in the same or different packages or kits.

[0079] The term “administered immediately prior to” means that the first therapy is administered no more than about 15 minutes, such as no more than about any of 10, 5 or 1 minutes before administration of the second therapy. The term “administered immediately after” means that the first therapy is administered no more than about 15 minutes, such as no more than about any of 15, 10 or 1 minutes after administration of the second therapy.

[0080] As used herein, by “pharmaceutically acceptable” or “pharmacologically compatible” is meant a material that is not biologically or otherwise undesirable, e.g., the material may be incorporated into a pharmaceutical composition administered to a patient without causing any significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. Pharmaceutically acceptable carriers or excipients have preferably met the required standardsof toxicological and manufacturing testing and / or are included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug administration.

[0081] An “adverse event” or “AE” as used herein refers to any untoward medical occurrence in an individual receiving a marketed pharmaceutical product or in an individual who is participating on a clinical trial who is receiving an investigational or non- investigational pharmaceutical agent. The AE does not necessarily have a causal relationship with the individual’s treatment. Therefore, an AE can be any unfavorable and unintended sign, symptom, or disease temporally associated with the use of a medicinal product, whether or not considered to be related to the medicinal product. An AE includes but is not limited to: an exacerbation of a pre-existing illness; an increase in frequency or intensity of a preexisting episodic event or condition; a condition detected or diagnosed after study drug administration even though it may have been present prior to the start of the study; and continuously persistent disease or symptoms that were present at baseline and worsen following the start of the study. An AE generally does not include: medical or surgical procedures (e.g., surgery, endoscopy, tooth extraction, or transfusion); however, the condition that leads to the procedure is an adverse event; pre-existing diseases, conditions, or laboratory abnormalities present or detected at the start of the study that do not worsen; hospitalizations or procedures that are done for elective purposes not related to an untoward medical occurrence (e.g., hospitalizations for cosmetic or elective surgery or social / convenience admissions); the disease being studied or signs / symptoms associated with the disease unless more severe than expected for the individual's condition; and overdose of study drug without any clinical signs or symptoms.

[0082] A “serious adverse event” or (SAE) as used herein refers to any untoward medical occurrence at any dose including, but not limited to, that: a) is fatal; b) is life-threatening (defined as an immediate risk of death from the event as it occurred); c) results in persistent or significant disability or incapacity; d) requires in-patient hospitalization or prolongs an existing hospitalization (exception: Hospitalization for elective treatment of a pre-existing condition that did not worsen during the study is not considered an adverse event. Complications that occur during hospitalization are AEs and if a complication prolongs hospitalization, then the event is serious); e) is a congenital anomaly / birth defect in the offspring of an individual who received medication; or I) conditions not included in the above definitions that may jeopardize the individual or may require intervention to prevent one of the outcomes listed above unless clearly related to the individual’s underlying disease. “Lack of efficacy” (progressive disease) is not considered an AE or SAE. The signs and symptomsor clinical sequelae resulting from lack of efficacy should be reported if they fulfill the AE or SAE definitions.

[0083] The following definitions may be used to evaluate response based on target lesions: “complete response” or “CR” refers to disappearance of all target lesions; “partial response” or “PR” refers to at least a 30% decrease in the sum of the longest diameters (SLD) of target lesions, taking as reference the baseline SLD; “stable disease” or “SD” refers to neither sufficient shrinkage of target lesions to qualify for PR, nor sufficient increase to qualify for PD, taking as reference the nadir SLD since the treatment started; and “progressive disease” or “PD” refers to at least a 20% increase in the SLD of target lesions, taking as reference the nadir SLD recorded since the treatment started, or, the presence of one or more new lesions.

[0084] The following definitions of response assessments may be used to evaluate a nontarget lesion: “complete response” or “CR” refers to disappearance of all non-target lesions; “stable disease” or “SD” refers to the persistence of one or more non-target lesions not qualifying for CR or PD; and “progressive disease” or “PD” refers to the “unequivocal progression” of existing non-target lesion(s) or appearance of one or more new lesion(s) is considered progressive disease (if PD for the individual is to be assessed for a time point based solely on the progression of non-target lesion(s), then additional criteria are required to be fulfilled.

[0085] “Progression free survival” (PFS) indicates the length of time during and after treatment that the cancer does not grow. Progression-free survival includes the amount of time individuals have experienced a complete response or a partial response, as well as the amount of time individuals have experienced stable disease.

[0086] “Cystectomy free survival” (CFS) indicates the length of time during and after treatment that a cystectomy is not required for the patient as determined by the physician.

[0087] “High-grade event-free-survival (HG EFS)” refers to the duration from the first treatment on study during which a patient does not experience high-grade recurrence or persistence of NMIBC, disease progression, radical cystectomy, or death from any cause.

[0088] “Bladder cancer-specific survival” indicates the length of time from the time of first treatment to the time of death due to bladder cancer.

[0089] "Predicting" or "prediction" is used herein to refer to the likelihood that an individual is likely to respond either favorably or unfavorably to a treatment regimen.

[0090] As used herein, "at the time of starting treatment" or "baseline" refers to the time period at or prior to the first exposure to the treatment.

[0091] As used herein, "sample" refers to a composition which contains a molecule which is to be characterized and / or identified, for example, based on physical, biochemical, chemical, physiological, and / or genetic characteristics.

[0092] It is understood that embodiments of the invention described herein include “consisting” and / or “consisting essentially of’ embodiments.

[0093] Reference to "about" a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to "about X" includes description of "X".

[0094] As used herein, reference to "not" a value or parameter generally means and describes "other than" a value or parameter. For example, the method is not used to treat cancer of type X means the method is used to treat cancer of types other than X.

[0095] The term “about X-Y” used herein has the same meaning as “about X to about Y.”

[0096] As used herein and in the appended claims, the singular forms "a," "or," and "the" include plural referents unless the context clearly dictates otherwise.II. Methods of treating Bladder Cancer

[0097] The present disclosure relates to treatment of bladder cancer in an individual (such as human individual) by intravesical administration of an oncolytic virus. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule. In some embodiments, the oncolytic virus is administered in combination with one or more additional therapeutic agents, such as an immune-checkpoint modulator or a chemotherapeutic agent (e.g, gemcitabine).

[0098] One aspect of the present disclosure relates to the use of genomic disease burden (GDB), a measure of tumor mutational burden in bladder cancer, as a biomarker to determine the risk of bladder cancer recurrence or progression in an individual and to select an appropriate method of treatment for the individual based on GDB. For example, patients with a lower risk of recurrence or progression may be treated with an oncolytic virus as a monotherapy, while patients with a higher risk of recurrence or progression may be treated with an oncolytic virus in combination with one or more additional therapeutic agents, such as an immune checkpoint modulator or a chemotherapeutic agent. Accordingly in some embodiments, the methods described herein comprise intravesical administration of theoncolytic virus to an individual, either in combination with administration of one or more additional therapeutic agents or without administration of one or more additional therapeutic agents, based on a determination of a genomic disease burden (GDB) value, a determined variant allele frequency (VAF) value, an assigned minimum residual disease (MRD) status, and / or assigned risk status, in a urine sample from the individual.

[0099] The methods described herein may be useful for treating patients with high-risk NMIBC who have received adequate BCG therapy (e.g, at least 5 of the 6 doses of a standard BCG induction course) but either were unresponsive or had a delayed response, or who were unable to receive adequate BCG therapy or any BCG therapy, for example, due to a shortage of BCG. In some embodiments, provided herein is a method of treating high-risk NMIBC in an individual, wherein the individual a) has not received prior intravesical Bacillus Calmette-Guerin (BCG) therapy or has received at most 2 doses of prior intravesical BCG therapy within the last 24 months, b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months and / or within 24 months after the BCG induction course (e.g., after the final dose of BCG); or c) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months and / or within 24 months after the BCG induction course (e.g, after the final dose of BCG); or ii) recurrence of carcinoma in situ at least 12 months and / or within 24 months after the BCG induction course (e.g, after the final dose of BCG). In some embodiments, the method further comprises intravesically administering the gemcitabine.

[0100] Any of the methods described herein may be useful for inhibiting growth of a bladder tumor, inhibiting metastasis of a bladder tumor, prolonging survival (such as disease- free survival, progression-free survival, recurrence-free survival, cystectomy -free survival, or high-grade event-free survival) of an individual having bladder cancer, causing disease remission in an individual having bladder cancer, preventing disease progression of an individual having bladder cancer, and / or improving quality of life of an individual having bladder cancer. In some embodiments, the method is bladder-preserving or bladder-sparing. In some embodiments, the bladder-preserving or bladder-sparing method is useful for improving the quality of life of the individual.Genomic Disease Burden (GDB) and Related Metrics

[0101] In some aspects, provided herein are methods of treating bladder cancer in an individual comprising intravesically administering to the individual an effective amount of an oncolytic virus and, based on a determined genomic disease burden (GDB) value, a determined VAF value, an assigned minimum residual disease (MRD) status, and / or assigned risk status, in a first urine sample from the individual, administering to the individual one or more additional therapeutic agents.

[0102] As used herein, “genomic disease burden (GDB)” refers to a measure of tumor mutational burden detected in a urine sample of an individual with bladder cancer. Measuring GDB can be helpful for diagnosis and prognosis of bladder cancer, for example, for determining the risk of recurrence in an individual who has been treated for bladder cancer, progression in an individual having bladder cancer, and early detection of bladder cancer. GDB is typically calculated as the percentile of variant allele frequency (VAF) of a sample relative to a training dataset. The training dataset may be any set of VAFs from a plurality of urine samples, for example, VAFs from urine samples from a plurality of individuals who have been diagnosed with bladder cancer, and optionally who have been treated for bladder cancer. The VAF from the urine samples may be determined using methods known in the art to be suitable for detecting variant alleles in a sample, for example, nucleic acid sequencing methods, such as next-generation DNA or RNA sequencing or probe-based detection of mutations. In some embodiments, VAF may be determined using whole-genome sequencing or amplicon sequencing of nucleic acids in the urine sample. The VAF may be calculated for any number of genes, such as for a specific set of genes associated with bladder cancer (e.g, for about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 or more genes). An exemplary method for determining GDB is UroAmp® (Convergent Genomics), which utilizes next-generation DNA sequencing in conjunction with machine learning methods to identify mutations in a specific of genes that are typically associated with bladder cancer. Methods of determining GDB are known in the art, including, for example in Salafi et al. (2023. "Development and Multicenter Case-Control Validation of Urinary Comprehensive Genomic Profiling for Urothelial Carcinoma Diagnosis, Surveillance, and Risk-Prediction." Clinical Cancer Research 29.18: 3668-3680), Bicocca et al. (2022. "Urinary comprehensive genomic profiling correlates urothelial carcinoma mutations with clinical risk and efficacy of intervention. " Journal of Clinical Medicine 11.19: 5827), and Rac et al. (2024. “Urinary comprehensive genomicprofiling predicts urothelial carcinoma recurrence and identifies responders to intravesical therapy.” Mol Oncol. 18(2):291-304).

[0103] Accordingly, in some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising intravesically administering to the individual an effective amount of an oncolytic virus; and, based on a determined GDB value, a determined VAF value, an assigned MRD status, and / or assigned risk status, in a urine sample from the individual, administering one or more additional therapeutic agents to the individual. In some embodiments, the method comprises determining the GDB value, the VAF value, or both. In some embodiments, one or more additional therapeutic agents are selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the additional therapeutic agent is administered based on a determination that the GDB value or VAF value exceeds a predetermined threshold. In some embodiments, the additional therapeutic agent is administered based on an assigned risk status of intermediate risk or high risk. In some embodiments, the additional therapeutic agent is administered based on an assigned MRD status of MRD-positive.

[0104] The GDB value (e.g., as determined by UroAmp®) is a percentile-based metric that quantifies the extent of genomic alterations in a patient's urine-derived DNA, comparing it to a reference population of bladder cancer patients. Higher GDB scores indicate a greater burden of disease and are associated with an increased risk of recurrence and progression in non-muscle invasive bladder cancer (NMIBC). As used herein, GDB values are presented as numerical values corresponding to percentile. For example, a GDB value of 20 corresponds to the 20thpercentile; a GDB value of 42 correspond to the 42ndpercentile; a GDB value of 80 corresponds to the 80thpercentile; and the like. The percentile ranking of GDB scores can be used to stratify patients into “low,” “intermediate,” and “high” risk groups. “Low GDB” or “low risk” patients have GDB scores in the lower percentiles, often associated with minimal genomic alterations and a favorable prognosis. “Intermediate GDB” or “intermediate risk” patients have GDB scores in the mid-range percentiles, indicating a moderate level of genomic alterations and an intermediate risk of disease recurrence or progression. “High GDB” or “High-risk” patient have GDB scores in the upper percentiles, reflecting a significant burden of genomic alterations and a high risk of adverse outcomes. Percentile cutoffs for categorizing GDB scores as low, intermediate, or high may vary depending on the specific study, tumor context, and clinical setting. Any percentile cutoff or range describedherein may be used in the methods described herein to assign a risk status of low, intermediate, or high risk to an individual having bladder cancer.

[0105] Accordingly, in some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of a first genomic disease burden (GDB) value in a first urine sample (e.g. at a first timepoint, e.g., at baseline) from the individual, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value. In some embodiments, if the first risk status is high risk, the initial therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, if the first risk status is low risk or intermediate risk, the initial therapy does not comprise administration of the additional therapeutic agent. In some embodiments, if the first risk status is intermediate risk, the method further comprises: subsequent to the initial therapy, administering a subsequent therapy to the individual, wherein the subsequent therapy is administered based on a determination of a second GDB value in a second urine sample from the individual (e.g., at a second, later timepoint (e.g. 3 months or 6 months) after the initial therapy, the treatment decided by the first GDB value), wherein the individual is assigned a second risk status of low risk, intermediate risk, or high risk based on the second GDB value. In some embodiments, if the second risk status is intermediate risk or high risk, the subsequent therapy comprises intravesical administration of an effective amount of the oncolytic virus and administration of one or more additional therapeutic agents (e.g., one or more additional therapeutic agents that was not administered during the initial therapy). In some embodiments, the method comprises determining the first GDB value, the second GDB value, or both. In some embodiments, the method comprises assigning the first risk status, the second risk status, or both to the individual based on the first GDB value, the second GDB value, or both, respectively. In some embodiments, one or more additional therapeutic agents are selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent.

[0106] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of an initial minimum residual disease(MRD) status of MRD-positive or MRD-negative, wherein the individual is assigned an initial MRD status of MRD-positive or MRD-negative based on a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint. In some embodiments, if the MRD status is MRD-positive, the initial therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, if the initial MRD status is MRD-negative, the initial therapy does not comprise administration of the additional therapeutic agent. In some embodiments, if the initial MRD status is MRD-positive, the method further comprises: subsequent to the initial therapy, administering a subsequent therapy to the individual, wherein the subsequent therapy is administered based on a determination of an updated MRD status in a second urine sample from the individual (e.g., at a second, later timepoint (e.g. 3 months or 6 months) after the initial therapy), wherein the individual is assigned an updated MRD status of MRD-positive or MRD-negative based on the updated MRD status. In some embodiments, if the updated MRD status is MRD-positive, the subsequent therapy comprises intravesical administration of an effective amount of the oncolytic virus and administration of one or more additional therapeutic agents (e.g., one or more additional therapeutic agents that was not administered during the initial therapy). In some embodiments, the method comprises determining the first VAF value, the second VAF value, or both. In some embodiments, the method comprises assigning the initial MRD status, the updated MRD status, or both to the individual based on the first VAF value, the second VAF value, or both, respectively. In some embodiments, the method comprises determining the first genomic disease burden (GDB) value, the second GDB value, or both. In some embodiments, the method comprises assigning the initial MRD status, the updated MRD status, or both to the individual based on the first GDB value, the second GDB value, or both, respectively. In some embodiments, one or more additional therapeutic agents are selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent.

[0107] In some embodiments of the methods described herein, MRD status is assigned to an individual based on a VAF value in a urine sample from the subject. In some embodiments, an MRD status of MRD-negative is assigned to the individual if the VAF value is less than a certain threshold, e.g, less than 20%, less than 15%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%. In certain embodiments, an MRD status ofMRD-negative is assigned to the individual if the VAF is less than 8%. In some embodiments, an MRD status of MRD-positive is assigned to the individual if the VAF is at least a certain threshold, e.g, at least 20%, at least 15%, at least 11%, at least 10%, at least 9%, at least 8%, at least 7%, at least 6%, at least 5%, at least 4%, at least 3%, at least 2%, or at least 1%. In certain embodiments, an MRD status of MRD-positive is assigned to the individual if the VAF is at least 8%.

[0108] In some embodiments of the methods described herein, MRD status is assigned to an individual based on a VAF value and a GDB value in a urine sample from the subject. In some embodiments, an MRD status of MRD-negative is assigned to the individual if the VAF value is less than a certain threshold (e.g, less than 20%, less than 15%, less than 11%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%) and the GDB value is less than a certain threshold (e.g, less than 50, less than 45, less than 44, less than 43, less than 42, less than 41, less than 40, or less than 35). In certain embodiments, an MRD status of MRD-negative is assigned to the individual if the VAF is less than 8% and the GDB is less than 42. In some embodiments, an MRD status of MRD-positive is assigned to the individual if the GDB value is at least a certain threshold (e.g, at least 50, at least 45, at least 44, at least 43, at least 42, at least 41, at least 40, or at least 35). In certain embodiments, an MRD status of MRD-positive is assigned to the individual if the GDB value is at least a certain threshold (e.g, at least 50, at least 45, at least 44, at least 43, at least 42, at least 41, at least 40, or at least 35) independent of the VAF value. In certain embodiments, an MRD status of MRD-positive is assigned to the individual if the GDB value is at least 42, independent of the VAF value.

[0109] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising administering an initial therapy comprising intravesical administration of an oncolytic virus based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and administering a subsequent therapy based on the difference between the first GDB value and a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy. In some embodiments, the subsequent therapy is administered based on the difference between the first GDB value and the second GDB value. For example, in some embodiments, if the second GDB value is higher than the first GDB value, the subsequent therapy comprises an escalated therapy, such as administration of the oncolytic virus in combination with one or more additional therapeutic agents (e.g., one or more immune checkpoint modulators or chemotherapeutic agents). In other embodiments,if the second GDB value is lower than the first GDB value, the subsequent therapy is the same as the initial therapy or is a de-escalated therapy, such as administration of the oncolytic virus without administration of one or more additional therapeutic agents. In some embodiments, the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value. In certain embodiments, if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some variations, the individual is assigned a first risk status of high risk based on a determination that the first GDB value exceeds a predetermined threshold. In some embodiments, the subsequent therapy is administered based on a difference between the first risk status and a second risk status of low risk, intermediate risk, or high risk assigned based on a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy. In certain embodiments, if the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the second risk status is lower than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, if the second GDB value is greater than the first GDB value or the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the second GDB value is less than the first GDB value or the second risk status is higher than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesicaladministration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

[0110] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising administering an initial therapy comprising intravesical administration of an oncolytic virus based on a determination of a first variant allele frequency (VAF) value (e.g, a first maximum VAF value) in a first urine sample from the individual at a first timepoint, and administering a subsequent therapy based on the difference between the first VAF value (e.g, first maximum VAF value) and a second VAF value (e.g, a second maximum VAF value) determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy. In some embodiments, the subsequent therapy is administered based on the difference between the first VAF value and the second VAF value. For example, in some embodiments, if the second VAF value is about the same as or higher than the first VAF value, the subsequent therapy comprises an escalated therapy, such as administration of the oncolytic virus in combination with one or more additional therapeutic agents (e.g., one or more immune checkpoint modulators or chemotherapeutic agents). In other embodiments, if the second VAF value is lower than the first VAF value, the subsequent therapy is the same as the initial therapy or is a de-escalated therapy, such as administration of the oncolytic virus without administration of one or more additional therapeutic agents. In some embodiments, the individual is assigned a first GDB value based on the first VAF value. In some embodiments, the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the for VAF value or the first GDB value. In certain embodiments, if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targetedtherapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some variations, the individual is assigned a first risk status of high risk based on a determination that the first VAF value or the first GDB value exceeds a predetermined threshold. In some embodiments, the individual is assigned a second GDB value based on the second VAF value. In some embodiments, the subsequent therapy is administered based on a difference between the first risk status and a second risk status of low risk, intermediate risk, or high risk assigned based on the second VAF value or the second GDB value. In certain embodiments, if the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the second risk status is lower than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, if the second VAF value is greater than the first VAF value or the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the second VAF value is less than the first VAF value or the second risk status is higher than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targetedtherapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.[OHl] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising administering an initial therapy comprising intravesical administration of an oncolytic virus based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and administering a subsequent therapy based on the difference between the first risk status assigned by the first GDB value and a second risk status assigned by a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy. In some embodiments, the subsequent therapy is administered based on the difference between the first GDB risk status and the second GDB risk status. For example, in some embodiments, if the second GDB risk status is greater of higher than the first GDB risk status, the subsequent therapy comprises an escalated therapy, such as administration of the oncolytic virus in combination with one or more additional therapeutic agents (e.g., one or more immune checkpoint modulators or chemotherapeutic agents). In other embodiments, if the second GDB risk status is lower than the first GDB risk status, the subsequent therapy is the same as the initial therapy or is a de-escalated therapy, such as administration of the oncolytic virus without administration of one or more additional therapeutic agents. In some embodiments, the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value. In certain embodiments, if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some variations, the individual is assigned a first risk status of high risk based on a determination that the first GDB value exceeds a predetermined threshold. In some embodiments, if the second GDB risk status defined by the second GDB value is greater than the first GDB risk status defined by the first GDB value, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of theadditional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the second GDB risk status is less than the first GDB risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

[0112] In some aspects, provided herein is a method of treating bladder cancer in an individual, the method comprising administering an initial therapy comprising intravesical administration of an oncolytic virus based on an assignment of an initial minimum residual disease (MRD) status of MRD-negative or MRD-positive to the individual based on a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint, and administering a subsequent therapy based on the difference between the initial MRD status assigned by the first VAF value and an updated MRD status assigned by a second VAF value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy. In some embodiments, the subsequent therapy is administered based on the difference between the initial MRD status and the updated MRD status. For example, in some embodiments, if the initial MRD status is MRD-negative and the updated MRD-status is MRD-positive, the subsequent therapy comprises an escalated therapy, such as administration of the oncolytic virus in combination with one or more additional therapeutic agents (e.g., one or more immune checkpoint modulators or chemotherapeutic agents). In other embodiments, if the initial MRD status is MRD-positiveand the updated MRD status is MRD-negative, the subsequent therapy is the same as the initial therapy or is a de-escalated therapy, such as administration of the oncolytic virus without administration of one or more additional therapeutic agents. In some embodiments, the individual is assigned an initial MRD status of MRD-negative or MRD-positive based on the first VAF value. In certain embodiments, if the initial MRD status is MRD-positive, the initial therapy comprises intravesical administration of an oncolytic virus and may further include administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, if the initial MRD status is MRD-negative, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some variations, the individual is assigned an initial MRD status of MRD-positive based on a determination that the first VAF value exceeds a predetermined threshold. In some embodiments, if the initial MRD status is MRD-negative and the updated MRD status is MRD-positive, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In other embodiments, if the initial MRD status is MRD-positive and the updated MRD status is MRD-negative, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and / or the updated MRD status is based on the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeuticagent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In certain embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

[0113] In other aspects, provided herein are methods of identifying an individual having bladder cancer as a candidate for either a) combination therapy comprising intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents; or b) therapy comprising intravesical administration of an oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the individual is identified as a candidate for either a) combination therapy comprising intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents; or b) therapy comprising intravesical administration of an oncolytic virus without administration of the additional therapeutic agent, based on a determination of a GDB value, VAF value, MRD status, and / or a risk status assigned based on a GDB value, in a urine sample from the individual. In some embodiments, the method comprises determining the GDB value. In some embodiments, the method comprises assigning to the individual a risk status of low risk, intermediate risk, or high risk based on the determined GDB value. In some embodiments, if the risk status is intermediate or low risk, the individual is identified as a candidate for therapy comprising intravesical administration of an oncolytic virus without administration of the additional therapeutic agent. In some embodiments, if the risk status is high risk, the individual is identified as a candidate for therapy comprising intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents. In some embodiments, one or more additional therapeutic agents are selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent.

[0114] In some embodiments of the methods described herein, determining a GDB value comprises collecting a urine sample from the individual, sequencing nucleic acids (e.g,DNA) from the urine sample to generate urine nucleic acid sequence data, and calculating the GDB value based on the urine nucleic acid sequence data. Methods of sequencing nucleic acids in urine samples are known in the art and include, for example, next generation sequencing (such as Illumina sequencing), single-molecule sequencing (such as PacBio sequencing), shotgun sequencing, and the like. Different modes of sequencing may be used for determining a first GDB value, for example, whole genome sequencing, amplicon sequencing, RNA sequencing (e.g., whole transcriptome sequencing or amplicon RNA sequencing), and the like. For example, in some embodiments, determining a GDB value comprises collecting a urine sample from an individual, extracting DNA from the sample, subjecting the extracted DNA to whole genome sequencing to generate whole genome sequence data, and calculating the GDB value or the second GDB value based on the whole genome sequence data. In other embodiments, determining a GDB value comprises collecting a urine sample from an individual, extracting DNA from the sample, subjecting the extracted DNA to amplicon sequencing targeting a plurality of genes associated with bladder cancer to generate amplicon sequence data, and calculating the GDB value or the second GDB value based on the amplicon sequence data. In certain embodiments, the amplicon sequencing targets at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or more genes associated with bladder cancer. In certain embodiments, the amplicon sequencing targets about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, or about 100 genes associated with bladder cancer. In certain embodiments, the amplicon sequencing targets between about 5 and about 100, between about 10 and about 100, between about 20 and about 100, between about 30 and about 100, between about 40 and about 100, between about 50 and about 100, between about 60 and about 100, between about 70 and about 100, between about 80 and about 100, between about 90 and about 100, between about 5 and about 90, between about 10 and about 90, between about 20 and about 90, between about 30 and about 90, between about 40 and about 90, between about 50 and about 90, between about 60 and about 90, between about 70 and about 90, between about 80 and about 90, between about 5 and about 80, between about 10 and about 80, between about 20 and about 80, between about 30 and about 80, between about 40 and about 80, between about 50 and about 80, between about 60 and about 80, between about 70 and about 80, between about 5 and about 70, between about 10 and about 70, between about 20 and about 70, between about 30 and about 70, between about 40 and about 70, between about 50 and about 70, between about60 and about 70, between about 5 and about 60, between about 10 and about 60, between about 20 and about 60, between about 30 and about 60, between about 40 and about 60, between about 50 and about 60, between about 5 and about 50, between about 10 and about 50, between about 20 and about 50, between about 30 and about 50, between about 40 and about 50, between about 5 and about 40, between about 10 and about 40, between about 20 and about 40, between about 30 and about 40, between about 5 and about 30, between about 10 and about 30, between about 20 and about 30, between about 5 and about 20, between about 10 and about 20, or between about 5 and about 10 genes associated with bladder cancer.

[0115] In some embodiments of the methods disclosed herein, the calculating a GDB comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data and calculating the GDB value as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In some embodiments, the method comprises determining the VAF of each of a set of genes associated with bladder cancer in the urine nucleic acid sequence data and calculating the GDB value as a percentile ranking of the VAF across one or more of the genes associated with bladder cancer. In some embodiments, the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples. In certain embodiments, the training dataset comprises a plurality of VAF of nucleic acid sequence data from a plurality of urine samples from plurality of individuals who have been diagnosed with bladder cancer. In some embodiments, the training set comprises VAF of each of a set of genes associated with bladder cancer in a plurality of individuals diagnosed with bladder cancer. In certain embodiments, the training set comprises VAF of one or more (or each) of the same set of genes that are determined in the individual to be treated or identified for treatment using the methods described herein. In certain embodiments, the method comprises determining the VAF of at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or more genes associated with bladder cancer. In certain embodiments, the method comprises determining the VAF of about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, or about 100 genes associated with bladder cancer. In certain embodiments, the amplicon sequencing targets between about 5 and about 100, between about 10 and about 100, between about 20 and about 100, between about 30 and about 100, between about 40 and about 100, between about 50 and about 100, between about 60 and about 100, between about 70 and about 100, between about 80 andabout 100, between about 90 and about 100, between about 5 and about 90, between about 10 and about 90, between about 20 and about 90, between about 30 and about 90, between about 40 and about 90, between about 50 and about 90, between about 60 and about 90, between about 70 and about 90, between about 80 and about 90, between about 5 and about 80, between about 10 and about 80, between about 20 and about 80, between about 30 and about 80, between about 40 and about 80, between about 50 and about 80, between about 60 and about 80, between about 70 and about 80, between about 5 and about 70, between about 10 and about 70, between about 20 and about 70, between about 30 and about 70, between about 40 and about 70, between about 50 and about 70, between about 60 and about 70, between about 5 and about 60, between about 10 and about 60, between about 20 and about 60, between about 30 and about 60, between about 40 and about 60, between about 50 and about 60, between about 5 and about 50, between about 10 and about 50, between about 20 and about 50, between about 30 and about 50, between about 40 and about 50, between about 5 and about 40, between about 10 and about 40, between about 20 and about 40, between about 30 and about 40, between about 5 and about 30, between about 10 and about 30, between about 20 and about 30, between about 5 and about 20, between about 10 and about 20, or between about 5 and about 10 genes associated with bladder cancer.

[0116] In some embodiments, the methods described herein comprise assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on a GDB value determined in a urine sample from the individual. In some embodiments, the individual is assigned a risk status of intermediate or high risk if the GDB value exceeds a predetermined threshold. In some embodiments, the individual is assigned a risk status of intermediate if the GDB value exceeds a first predetermined threshold and does not exceed a second predetermined threshold. In certain embodiments, the individual is assigned a risk status of high risk if the GDB value exceeds the second predetermined threshold. In some embodiments, the assigned risk status corresponds to a relative risk of progression of bladder cancer despite intravesical administration of the oncolytic virus (e.g, in the absence of additional therapeutic agent, such as a chemotherapeutic agent or an immune checkpoint modulator). In some embodiments, the assigned risk status corresponds to a relative risk of non-response to intravesical administration of the oncolytic virus (e.g, in the absence of additional therapeutic agent, such as a chemotherapeutic agent or an immune checkpoint modulator). In some embodiments, the assigned risk status corresponds to a relative risk of recurrence of bladder cancer after intravesical administration of the oncolytic virus (e.g, inthe absence of additional therapeutic agent, such as a chemotherapeutic agent or an immune checkpoint modulator).

[0117] In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than about 50 (less than about the 50thpercentile). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than about 50, 45, 40, 35, 30, 25, 20, 15, 10, 5, or 1 (less than about the 50th, 45th, 40th, 35th, 30th, 25th, 20th, 15th, 10th, 5thor 1stpercentile). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than about 20 (the 20thpercentile).

[0118] In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than a maximum threshold GDB value between 1 and 50 (between the 1stand 50thpercentiles). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than a maximum threshold GDB value between 10 and 30 (between the 10thand 30thpercentiles). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than a maximum threshold GDB value between 15 and 25 (between the 15thand 25thpercentiles). In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of low risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is less than a maximum threshold GDB value between 1 and 5 (between the 1stand 5thpercentiles), between 1 and 10 (between the 1stand 10thpercentiles), between 1 and 15 (between the 1stand 15thpercentiles), between 1 and 20 (between the 1stand 20thpercentiles), between 1 and 25 (between the 1stand 25thpercentiles), between 1 and 30 (between the 1stand 30thpercentiles), between 1 and 35 (between the 1stand 35thpercentiles), between 1 and 40 (between the 1stand 40thpercentiles), between 1 and 45 (between the 1stand 45thpercentiles), between 1 and 50 (between the 1stand 50thpercentiles), between 5 and 10 (between the 5thand 10thpercentiles), between 5 and 15 (between the 5thand 15thpercentiles), between 5 and 20 (between the 5thand 20thpercentiles), between 5 and 25 (between the 5thand 25thpercentiles), between 5 and 30 (between the 5thand 30thpercentiles), between 5 and 35 (between the 5thand 35thpercentiles), between 5 and 40 (between the 5thand 40thpercentiles), between 5 and 45 (between the 5thand 45thpercentiles), between 5 and 50 (between the 5thand 50thpercentiles), between 10 and 15 (between the 10thand 15thpercentiles), between 10 and 20 (between the 10thand 20thpercentiles), between 10 and 25 (between the 10thand 25thpercentiles), between 10 and 30 (between the 10thand 30thpercentiles), between 10 and 35 (between the 10thand 35thpercentiles), between 10 and 40 (between the 10thand 40thpercentiles), between 10 and 45 (between the 10thand 45thpercentiles), between 10 and 50 (between the 10thand 50thpercentiles), between 15 and 20 (between the 15thand 20thpercentiles), between 15 and 25 (between the 15thand 25thpercentiles), between 15 and 30 (between the 15thand 30thpercentiles), between 15 and 35 (between the 15thand 35thpercentiles), between 15 and 40 (between the 15thand 40thpercentiles), between 15 and 45 (between the 15thand 45thpercentiles), between 15 and 50 (between the 15thand 50thpercentiles), between 20 and 25 (between the 20thand 25thpercentiles), between 20 and 30 (between the 20thand 30thpercentiles), between 20 and 35 (between the 20thand 35thpercentiles), between 20 and 40 (between the 20thand 40thpercentiles), between 20 and 45 (between the 20thand 45thpercentiles), between 20 and 50 (between the 20thand 50thpercentiles), between 25 and 30 (between the 25thand 30thpercentiles), between 25 and 35 (between the 25thand 35thpercentiles), between 25 and 40 (between the 25thand 40thpercentiles), between 25 and 45 (between the 25thand 45thpercentiles), between 25 and 50 (between the 25thand 50thpercentiles), between 30 and 35 (between the 30thand 35thpercentiles), between 30 and 40 (between the 30thand 40thpercentiles), between 30 and 45 (between the 30thand 45thpercentiles), between 30 and 50 (between the 30thand 50thpercentiles), between 35 and 40 (between the 35thand 40thpercentiles), between 35 and 45 (between the 35thand 45thpercentiles), between 35 and 50 (between the 35thand 50thpercentiles), between 40 and 45 (between the 40thand 45thpercentiles), between 40 and 50 (between the 40thand 50thpercentiles), or between 45 and 50 (between the 45thand 50thpercentiles).

[0119] In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than about 50 (greater than about the 50thpercentile). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99 (less than about the 50th, 55th, 60th, 65th, 70th, 75th, 80th, 85th, 90th, 95thor 99thpercentile). Incertain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than about 80 (the 80thpercentile).

[0120] In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than a minimum threshold GDB value between 50 and 99 (between the 50thand 99thpercentiles). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than a minimum threshold GDB value between 70 and 90 (between the 70thand 90thpercentiles). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than a minimum threshold GDB value between 75 and 85 (between the 75thand 85thpercentiles). In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of high risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than a minimum threshold GDB value between 50 and 55 (between the 50thand 55thpercentiles), between 50 and 60 (between the 50thand 60thpercentiles), between 50 and 65 (between the 50thand 65thpercentiles), between 50 and 70 (between the 50thand 70thpercentiles), between 50 and 75 (between the 50thand 75thpercentiles), between 50 and 80 (between the 50thand 80thpercentiles), between 50 and 85 (between the 50thand 85thpercentiles), between 50 and 90 (between the 50thand 90thpercentiles), between 50 and 95 (between the 50thand 95thpercentiles), between 50 and 99 (between the 50thand 99thpercentiles), between 55 and 60 (between the 55thand 60thpercentiles), between 55 and 65 (between the 55thand 65thpercentiles), between 55 and 70 (between the 55thand 70thpercentiles), between 55 and 75 (between the 55thand 75thpercentiles), between 55 and 80 (between the 55thand 80thpercentiles), between 55 and 85 (between the 55thand 85thpercentiles), between 55 and 90 (between the 55thand 90thpercentiles), between 55 and 95 (between the 55thand 95thpercentiles), between 55 and 99 (between the 55thand 99thpercentiles), between 60 and 65 (between the 60thand 65thpercentiles), between 60 and 70 (between the 60thand 70thpercentiles), between 60 and 75 (between the 60thand 75thpercentiles), between 60 and 80 (between the 60thand 80thpercentiles), between 60 and 85 (between the 60thand 85thpercentiles), between 60 and 90 (between the 60thand 90thpercentiles), between 60 and 95 (between the 60thand 95thpercentiles), between 55 and 99 (between the 60thand 99thpercentiles), between 65 and 70 (between the 65thand 70thpercentiles), between 65 and 75 (between the 65thand 75thpercentiles), between 65 and 80 (between the 65thand 80thpercentiles), between 65 and 85 (between the 65thand 85thpercentiles), between 65 and 90 (between the 65thand 90thpercentiles), between 65 and 95 (between the 65thand 95thpercentiles), between 65 and 99 (between the 65thand 99thpercentiles), between 70 and 75 (between the 70thand 75thpercentiles), between 70 and 80 (between the 70thand 80thpercentiles), between 70 and 85 (between the 70thand 85thpercentiles), between 70 and 90 (between the 70thand 90thpercentiles), between 70 and 95 (between the 70thand 95thpercentiles), between 70 and 99 (between the 70thand 99thpercentiles), between 75 and 80 (between the 75thand 80thpercentiles), between 75 and 85 (between the 75thand 85thpercentiles), between 75 and 90 (between the 75thand 90thpercentiles), between 75 and 95 (between the 75thand 95thpercentiles), between 75 and 99 (between the 75thand 99thpercentiles), between 80 and 85 (between the 80thand 85thpercentiles), between 80 and 90 (between the 80thand 90thpercentiles), between 80 and 95 (between the 80thand 95thpercentiles), between 80 and 99 (between the 80thand 99thpercentiles), between 85 and 90 (between the 85thand 90thpercentiles), between 85 and 95 (between the 85thand 95thpercentiles), between 85 and 99 (between the 85thand 99thpercentiles), between 90 and 95 (between the 90thand 95thpercentiles), between 90 and 99 (between the 90thand 99thpercentiles), or between 95 and 99 (between the 95thand 99thpercentiles).

[0121] In some embodiments, the individual is assigned a risk status of intermediate risk if they do not meet the criteria for being assigned a risk status of low risk or high risk. In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of intermediate risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is greater than a maximum threshold GDB value described herein and less than a minimum threshold GDB value described herein. In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of intermediate risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is between 1 and 99 (between the 1stand 99thpercentiles). In certain embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of intermediate risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is between 20 and 80 (between the 20thand 80thpercentiles). In some embodiments, the individual is assigned a risk status (e.g, a first risk status or a second risk status) of intermediate risk if the GDB value (e.g, the first GDB value or the second GDB value, respectively) is between 1 and 5 (between the 1stand 5thpercentiles), between 1 and 10(between the 1stand 10thpercentiles), between 1 and 15 (between the 1stand 15thpercentiles), between 1 and 20 (between the 1stand 20thpercentiles), between 1 and 25 (between the 1stand 25thpercentiles), between 1 and 30 (between the 1stand 30thpercentiles), between 1 and 35 (between the 1stand 35thpercentiles), between 1 and 40 (between the 1stand 40thpercentiles), between 1 and 45 (between the 1stand 45thpercentiles), between 1 and 50 (between the 1stand 50thpercentiles), between 5 and 10 (between the 5thand 10thpercentiles), between 5 and 15 (between the 5thand 15thpercentiles), between 5 and 20 (between the 5thand 20thpercentiles), between 5 and 25 (between the 5thand 25thpercentiles), between 5 and 30 (between the 5thand 30thpercentiles), between 5 and 35 (between the 5thand 35thpercentiles), between 5 and 40 (between the 5thand 40thpercentiles), between 5 and 45 (between the 5thand 45thpercentiles), between 5 and 50 (between the 5thand 50thpercentiles), between 10 and 15 (between the 10thand 15thpercentiles), between 10 and 20 (between the 10thand 20thpercentiles), between 10 and 25 (between the 10thand 25thpercentiles), between 10 and 30 (between the 10thand 30thpercentiles), between 10 and 35 (between the 10thand 35thpercentiles), between 10 and 40 (between the 10thand 40thpercentiles), between 10 and 45 (between the 10thand 45thpercentiles), between 10 and 50 (between the 10thand 50thpercentiles), between 15 and 20 (between the 15thand 20thpercentiles), between 15 and 25 (between the 15thand 25thpercentiles), between 15 and 30 (between the 15thand 30thpercentiles), between 15 and 35 (between the 15thand 35thpercentiles), between 15 and 40 (between the 15thand 40thpercentiles), between 15 and 45 (between the 15thand 45thpercentiles), between 15 and 50 (between the 15thand 50thpercentiles), between 20 and 25 (between the 20thand 25thpercentiles), between 20 and 30 (between the 20thand 30thpercentiles), between 20 and 35 (between the 20thand 35thpercentiles), between 20 and 40 (between the 20thand 40thpercentiles), between 20 and 45 (between the 20thand 45thpercentiles), between 20 and 50 (between the 20thand 50thpercentiles), between 25 and 30 (between the 25thand 30thpercentiles), between 25 and 35 (between the 25thand 35thpercentiles), between 25 and 40 (between the 25thand 40thpercentiles), between 25 and 45 (between the 25thand 45thpercentiles), between 25 and 50 (between the 25thand 50thpercentiles), between 30 and 35 (between the 30thand 35thpercentiles), between 30 and 40 (between the 30thand 40thpercentiles), between 30 and 45 (between the 30thand 45thpercentiles), between 30 and 50 (between the 30thand 50thpercentiles), between 35 and 40 (between the 35thand 40thpercentiles), between 35 and 45 (between the 35thand 45thpercentiles), between 35 and 50 (between the 35thand 50thpercentiles), between 40 and 45 (between the 40thand 45thpercentiles), between 40 and 50 (between the 40thand 50thpercentiles), between 45 and 50 (between the 45thand 50thpercentiles), between 50 and 55 (between the 50thand 55thpercentiles), between 50 and 60 (between the 50thand 60thpercentiles), between 50 and 65 (between the 50thand 65thpercentiles), between 50 and 70 (between the 50thand 70thpercentiles), between 50 and 75 (between the 50thand 75thpercentiles), between 50 and 80 (between the 50thand 80thpercentiles), between 50 and 85 (between the 50thand 85thpercentiles), between 50 and 90 (between the 50thand 90thpercentiles), between 50 and 95 (between the 50thand 95thpercentiles), between 50 and 99 (between the 50thand 99thpercentiles), between 55 and 60 (between the 55thand 60thpercentiles), between 55 and 65 (between the 55thand 65thpercentiles), between 55 and 70 (between the 55thand 70thpercentiles), between 55 and 75 (between the 55thand 75thpercentiles), between 55 and 80 (between the 55thand 80thpercentiles), between 55 and 85 (between the 55thand 85thpercentiles), between 55 and 90 (between the 55thand 90thpercentiles), between 55 and 95 (between the 55thand 95thpercentiles), between 55 and 99 (between the 55thand 99thpercentiles), between 60 and 65 (between the 60thand 65thpercentiles), between 60 and 70 (between the 60thand 70thpercentiles), between 60 and 75 (between the 60thand 75thpercentiles), between 60 and 80 (between the 60thand 80thpercentiles), between 60 and 85 (between the 60thand 85thpercentiles), between 60 and 90 (between the 60thand 90thpercentiles), between 60 and 95 (between the 60thand 95thpercentiles), between 55 and 99 (between the 60thand 99thpercentiles), between 65 and 70 (between the 65thand 70thpercentiles), between 65 and 75 (between the 65thand 75thpercentiles), between 65 and 80 (between the 65thand 80thpercentiles), between 65 and 85 (between the 65thand 85thpercentiles), between 65 and 90 (between the 65thand 90thpercentiles), between 65 and 95 (between the 65thand 95thpercentiles), between 65 and 99 (between the 65thand 99thpercentiles), between 70 and 75 (between the 70thand 75thpercentiles), between 70 and 80 (between the 70thand 80thpercentiles), between 70 and 85 (between the 70thand 85thpercentiles), between 70 and 90 (between the 70thand 90thpercentiles), between 70 and 95 (between the 70thand 95thpercentiles), between 70 and 99 (between the 70thand 99thpercentiles), between 75 and 80 (between the 75thand 80thpercentiles), between 75 and 85 (between the 75thand 85thpercentiles), between 75 and 90 (between the 75thand 90thpercentiles), between 75 and 95 (between the 75thand 95thpercentiles), between 75 and 99 (between the 75thand 99thpercentiles), between 80 and 85 (between the 80thand 85thpercentiles), between 80 and 90 (between the 80thand 90thpercentiles), between 80 and 95 (between the 80thand 95thpercentiles), between 80 and 99 (between the 80thand 99thpercentiles), between 85 and 90 (between the 85thand 90thpercentiles), between 85 and 95 (between the 85thand 95thpercentiles), between 85 and 99 (between the 85thand 99thpercentiles), between 90 and 95 (between the 90thand 95thpercentiles), between 90 and 99 (between the 90thand 99thpercentiles), or between 95 and 99 (between the 95thand 99thpercentiles), between 1 and 55 (between the 1stand 55thpercentiles), between 1 and 60 (between the 1stand 60thpercentiles), between 1 and 65 (between the 1stand 65thpercentiles), between 1 and 70 (between the 1stand 70thpercentiles), between 1 and 75 (between the 1stand 65thpercentiles), between 1 and 80 (between the 1stand 80thpercentiles), between 1 and 85 (between the 1stand 85thpercentiles), between 1 and 90 (between the 1stand 90thpercentiles), between 1 and 95 (between the 1stand 95thpercentiles), between 1 and 99 (between the 1stand 99thpercentiles), between 5 and 55 (between the 5thand 55thpercentiles), between 5 and 60 (between the 5thand 60thpercentiles), between 5 and 65 (between the 5thand 65thpercentiles), between 5 and 70 (between the 5thand 70thpercentiles), between 5 and 75 (between the 5thand 65thpercentiles), between 5 and 80 (between the 5thand 80thpercentiles), between 5 and 85 (between the 5thand 85thpercentiles), between 5 and 90 (between the 5thand 90thpercentiles), between 5 and 95 (between the 5thand 95thpercentiles), between 5 and 99 (between the 5thand 99thpercentiles), between 10 and 55 (between the 10thand 55thpercentiles), between 10 and 60 (between the 10thand 60thpercentiles), between 10 and 65 (between the 10thand 65thpercentiles), between 10 and 70 (between the 10thand 70thpercentiles), between 10 and 75 (between the 10thand 65thpercentiles), between 10 and 80 (between the 10thand 80thpercentiles), between 10 and 85 (between the 10thand 85thpercentiles), between 10 and 90 (between the 10thand 90thpercentiles), between 10 and 95 (between the 10thand 95thpercentiles), between 10 and 99 (between the 10thand 99thpercentiles), between 15 and 55 (between the 15thand 55thpercentiles), between 15 and 60 (between the 15thand 60thpercentiles), between 15 and 65 (between the 15thand 65thpercentiles), between 15 and 70 (between the 15thand 70thpercentiles), between 15 and 75 (between the 15thand 65thpercentiles), between 15 and 80 (between the 15thand 80thpercentiles), between 15 and 85 (between the 15thand 85thpercentiles), between 15 and 90 (between the 15thand 90thpercentiles), between 15 and 95 (between the 15thand 95thpercentiles), between 15 and 99 (between the 15thand 99thpercentiles), between 20 and 55 (between the 20thand 55thpercentiles), between 20 and 60 (between the 20thand 60thpercentiles), between 20 and 65 (between the 20thand 65thpercentiles), between 20 and 70 (between the 20thand 70thpercentiles), between 20 and 75 (between the 20thand 65thpercentiles), between 20 and 80 (between the 20thand 80thpercentiles), between 20 and 85 (between the 20thand 85thpercentiles), between 20 and 90(between the 20thand 90thpercentiles), between 20 and 95 (between the 20thand 95thpercentiles), between 20 and 99 (between the 20thand 99thpercentiles), between 25 and 55 (between the 25thand 55thpercentiles), between 25 and 60 (between the 25thand 60thpercentiles), between 25 and 65 (between the 25thand 65thpercentiles), between 25 and 70 (between the 25thand 70thpercentiles), between 25 and 75 (between the 25thand 65thpercentiles), between 25 and 80 (between the 25thand 80thpercentiles), between 25 and 85 (between the 25thand 85thpercentiles), between 25 and 90 (between the 25thand 90thpercentiles), between 25 and 95 (between the 25thand 95thpercentiles), between 25 and 99 (between the 25thand 99thpercentiles), between 30 and 55 (between the 30thand 55thpercentiles), between 30 and 60 (between the 30thand 60thpercentiles), between 30 and 65 (between the 30thand 65thpercentiles), between 30 and 70 (between the 30thand 70thpercentiles), between 30 and 75 (between the 30thand 65thpercentiles), between 30 and 80 (between the 30thand 80thpercentiles), between 30 and 85 (between the 30thand 85thpercentiles), between 30 and 90 (between the 30thand 90thpercentiles), between 30 and 95 (between the 30thand 95thpercentiles), between 30 and 99 (between the 30thand 99thpercentiles), between 35 and 55 (between the 35thand 55thpercentiles), between 35 and 60 (between the 35thand 60thpercentiles), between 35 and 65 (between the 35thand 65thpercentiles), between 35 and 70 (between the 35thand 70thpercentiles), between 35 and 75 (between the 35thand 65thpercentiles), between 35 and 80 (between the 35thand 80thpercentiles), between 35 and 85 (between the 35thand 85thpercentiles), between 35 and 90 (between the 35thand 90thpercentiles), between 35 and 95 (between the 30thand 95thpercentiles), between 35 and 99 (between the 35thand 99thpercentiles), between 40 and 55 (between the 40thand 55thpercentiles), between 40 and 60 (between the 40thand 60thpercentiles), between 40 and 65 (between the 40thand 65thpercentiles), between 40 and 70 (between the 40thand 70thpercentiles), between 40 and 75 (between the 40thand 65thpercentiles), between 40 and 80 (between the 40thand 80thpercentiles), between 40 and 85 (between the 40thand 85thpercentiles), between 40 and 90 (between the 40thand 90thpercentiles), between 40 and 95 (between the 30thand 95thpercentiles), between 40 and 99 (between the 40thand 99thpercentiles), between 45 and 55 (between the 45thand 55thpercentiles), between 45 and 60 (between the 45thand 60thpercentiles), between 45 and 65 (between the 45thand 65thpercentiles), between 45 and 70 (between the 45thand 70thpercentiles), between 45 and 75 (between the 45thand 65thpercentiles), between 45 and 80 (between the 45thand 80thpercentiles), between 45 and 85 (between the 45thand 85thpercentiles), between 45 and 90 (between the 45thand 90thpercentiles), between 45 and 95(between the 30thand 95thpercentiles), or between 45 and 99 (between the 45thand 99thpercentiles).

[0122] In some embodiments, the methods described herein comprise assigning to the individual an initial minimum residual disease (MRD) status of MRD-positive or MRD- negative based on a VAF value determined in a urine sample from the individual. In some embodiments, the individual is assigned an MRD status of MRD-positive if the VAF value exceeds a predetermined threshold. In some embodiments, the individual is assigned an MRD status of MRD-negative of the VAF value is less than a predetermined threshold. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and / or the updated MRD status is based on the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5- 10% (e.g, less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5- 10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. In some embodiments, the assigned MRD status corresponds to a relative risk of progression of bladder cancer despite intravesical administration of the oncolytic virus (e.g, in the absence of additional therapeutic agent, such as a chemotherapeutic agent or an immune checkpoint modulator). In some embodiments, the assigned MRD status corresponds to a relative risk of non-response to intravesical administration of the oncolytic virus (e.g, in the absence of additional therapeutic agent, such as a chemotherapeutic agent or an immune checkpoint modulator). In some embodiments, the assigned MRD status corresponds to a relative risk of recurrence of bladder cancer after intravesical administration of the oncolytic virus (e.g, in the absence of additional therapeutic agent, such as a chemotherapeutic agent or an immune checkpoint modulator).

[0123] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: determining a first genomic disease burden (GDB) value, a determined variant allele frequency (VAF) value, an assigned minimum residual disease (MRD) status, and / or assigned risk status based on the first GDB value, in a first urine sample from the individual (e.g., at a first timepoint, e.g., at baseline); intravesically administering tothe individual an effective amount of an oncolytic virus; and, based on the GDB value, VAF value, MRD status, and / or assigned risk status based on the GDB value, administering one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the additional therapeutic agent is administered based on a determination that the GDB value exceeds a predetermined threshold. In some embodiments, determining the first GDB value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, withoutadministration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereol). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5- fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0124] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on adetermination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: i) if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on the difference between the first GDB value and a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein: i) if the second GDB value is greater than the first GDB value, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the second GDB value is less than the first GDB value, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the individual is assigned a first risk status of high risk based on a determination that the first GDB value exceeds a predetermined threshold. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the method comprises: determining the first GDB value in thefirst urine sample from the individual; determining the second GDB value in the second urine sample from the indi vidua; or both. In some embodiments, the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; or both. In some embodiments, determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value or the second GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, withoutadministration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5- fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0125] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on adetermination of a first variant allele frequency (VAF) value (e.g, a first maximum VAF value) a first in a first urine sample from the individual at a first timepoint; and b) administering a subsequent therapy based on the difference between the first VAF value (e.g, the first maximum VAF value) and a second VAF value (e.g, a second maximum VAF value) determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein i) if the second VAF value (e.g, the second maximum VAF value) is greater than the first VAF value (e.g, the first maximum VAF value), the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the second VAF value (e.g, the second maximum VAF value) is less than the first VAF value (e.g, the first maximum VAF value), the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the individual is assigned a first risk status of high risk based on a determination that the first VAF value exceeds a predetermined threshold. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the method comprises: determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the individual; or both. In some embodiments, the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first VAF value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the secondVAF value; or both. In some embodiments, determining the first VAF value, the second VAF value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first VAF value or the second VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value, the second VAF value, or both comprises determining the variant allele frequency (VAF) of the urine nucleic acid sequence data at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes. In some embodiments, the first VAF value is a first maximum VAF value; the second VAF value is a second maximum VAF value; or both. In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM- CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK-3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5- fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0126] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: i) if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on a difference between the first risk status and a second risk status of low risk, intermediate risk, or high risk assigned based on a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein i) if the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the second risk status is lower than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, theindividual is assigned a first risk status of high risk based on a determination that the first GDB value exceeds a predetermined threshold. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the method comprises: determining the first GDB value in the first urine sample from the individual; determining the second GDB value in the second urine sample from the individua; or both. In some embodiments, the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; or both. In some embodiments, determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value or the second GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprisinga tumor cell-specific promoter (e.g. , a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune- related molecule (e.g., GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In someembodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0127] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative, wherein the individual is assigned an initial MRD status of MRD-positive or MRD-negative based on a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint, and wherein: i) if the initial MRD status is MRD- positive, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the initial MRD status is MRD- negative, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on a determination of an updated MRD status of MRD-positive or MRD- negative, wherein the individual is assigned an initial MRD status of MRD-positive or MRD- negative based on a second VAF value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein i) if the updated MRD status is MRD-positive, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the initial MRD status is MRD-negative, the subsequent therapy is a de-escalated therapy comprising administration ofthe oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the individual is assigned an initial MRD status of MRD-positive based on a determination that the first VAF value exceeds a predetermined threshold. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the method comprises: determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the indi vidua; or both. In some embodiments, the method comprises: assigning to the individual an initial MRD status of MRD-positive or MRD-negative based on the first VAF value; assigning to the individual an updated MRD status of MRD-positive or MRD- negative based on the second VAF value; or both. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and / or the updated MRD status is based on the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. In some embodiments, determining the first VAF value, the second VAF value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urinenucleic acid sequence data; and calculating the first VAF value or the second VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value, the second VAF value, or both comprises determining the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes. In some embodiments, the additional therapeutic agent is administered systemically (e.g., intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM- CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5- fluorouracil (5-FU), or any combination thereof. In certain embodiments, thechemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0128] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: i) if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on the difference between the first GDB value or the first risk status and a second GDB value or a second risk status determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein: i) if the second GDB value or risk status is greater than the first GDB value or risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the second GDB value or risk status is less than the first GDB value or risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the individual is assigned a first risk status of high risk based on a determination that the first GDB value exceeds a predetermined threshold. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of theadditional therapeutic agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the method comprises: determining the first GDB value in the first urine sample from the individual; determining the second GDB value in the second urine sample from the individua; or both. In some embodiments, the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; or both. In some embodiments, determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value or the second GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E319kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g., without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5- fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did notreceive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0129] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative, wherein the individual is assigned an initial MRD status of MRD-positive or MRD-negative based on a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint, and wherein the initial therapy comprises intravesical administration of an oncolytic virus; and b) administering a subsequent therapy based on an updated MRD status assigned based on a determination of a second VAF value in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein: i) the initial MRD status is MRD-negative and the initial and the subsequent therapy both comprise intravesical administration of the oncolytic virus to the individual; ii) the initial MRD status is MRD-negative, the initial therapy comprises intravesical administration of the oncolytic virus to the individual, the updated MRD status is MRD-positive, and the subsequent therapy is an escalated therapy comprising intravesically administering to the individual the oncolytic virus and further administering to the individual one or more additional therapeutic agents that was not administered as a part of the initial therapy, wherein the additional therapeutic agent is selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; iii) the initial MRD status is MRD-positive, the initial therapy comprises intravesical administration of the oncolytic virus, the updated MRD status is MRD-positive, and the subsequent therapy is an escalated therapy comprising intravesically administering to the individual the oncolytic virus and further administering to the individual one or more additional therapeutic agents that was not administered as a part of the initial therapy, wherein the additional therapeutic agent is selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or iii) the initial MRD status is MRD-positive, the initial therapycomprises intravesical administration of the oncolytic virus to the individual and further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the updated MRD status is MRD- negative, and the subsequent therapy is a de-escalated therapy comprising intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the individual is assigned an initial MRD status of MRD- positive based on a determination that the first VAF value exceeds a predetermined threshold. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, the method comprises: determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the indi vidua; or both. In some embodiments, the method comprises: assigning to the individual an initial MRD status of MRD-positive or MRD-negative based on the first VAF value; assigning to the individual an updated MRD status of MRD-positive or MRD- negative based on the second VAF value; or both. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and / or the updated MRD status is based on the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%) and theGDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. .In some embodiments, determining the first VAF value, the second VAF value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first VAF value or the second VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value, the second VAF value, or both comprises determining the the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes. In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab,pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereol). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0130] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of a first genomic disease burden (GDB) value in a urine sample from the individual (e.g., at a first timepoint), wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: a) if the first risk status is high risk, the initial therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or b) if the first risk status is low risk or intermediate risk, the initial therapy does not comprise administration of the additional therapeutic agent. In some embodiments, if the first risk status is intermediate risk, the method further comprises a subsequent therapy comprising intravesically administering to the individual an effective amount of the oncolytic virus, wherein the subsequent therapy is administered based on a determination of a second GDB value in a second urine sample from the individual (e.g., at a second timepoint following the initial therapy), wherein the individual is assigned a second risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: if the second risk status is intermediate risk or high risk, the subsequent therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the second risk status is low risk, the subsequent therapy does not comprise administration of one ormore additional therapeutic agents. In some embodiments, the method comprises: determining the first GDB value in the first urine sample from the individual; determining the second GDB value in the second urine sample from the individua; or both. In some embodiments, the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; or both. In some embodiments, determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value or the second GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g. , a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune- related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certainembodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In certain embodiments, the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus, wherein the oncolytic virus is administered directly after the second dose of DDM (e.g, without intravesical administration of a saline wash after the second dose of DDM and before administration of the oncolytic virus). In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereol). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0131] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of of an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative, wherein the individual is assigned an initial MRD status of MRD-positive or MRD-negative based on a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint, and wherein: a) if the initial MRD status is MRD-positive, the initial therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or b) if the initial MRD status is MRD- negative, the initial therapy does not comprise administration of the additional therapeutic agent. In some embodiments, if the initial MRD status MRD-positive, the method further comprises a subsequent therapy comprising intravesically administering to the individual an effective amount of the oncolytic virus, wherein the subsequent therapy is administered based on a determination of an updated MRD status of MRD-positive or MRD-negative based on a second VAF value determined in a second urine sample from the individual (e.g., at a second timepoint following the initial therapy), wherein: if the updated MRD status is MRD-positive, the subsequent therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the updated MRD status is MRD-negative, the subsequent therapy does not comprise administration of one or more additional therapeutic agents. In some embodiments, the method comprises: determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the individua; or both. In some embodiments, the method comprises: assigning to the individual an initial MRD status of MRD-positive or MRD-negative based on the first VAF value; assigning to the individual an updated MRD status of MRD-positive or MRD-negative based on the second VAF value; or both. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and / or the updated MRD status is based on the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g., less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. In some embodiments, determining the first VAF value, the second G VAF DB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first VAF value or the second VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value, the second VAF value, or both comprises determining the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes. In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1,PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0132] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus; and b) administering a subsequent therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint subsequent to the initial therapy, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: i) if first the risk status is intermediate risk or high risk, the subsequent therapy comprises intravesical administration of the oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the first risk status is low risk, the subsequent therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, if the first risk status is high risk or intermediate risk, the method further comprises a further subsequent therapy comprising intravesically administering to the individual an effective amount of the oncolytic virus, wherein the subsequent therapy is administered based on a determination of a second risk status of high risk, intermediate risk, or low risk based on a second GDB value determined in a second urine sample from the individual (e.g., at a second timepoint following the initial therapy), wherein: if the second risk status is high risk or intermediate risk, the subsequent therapy further comprisesadministration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the second risk status is low risk, the subsequent therapy does not comprise administration of one or more additional therapeutic agents. In some embodiments, the method comprises determining the first GDB value in the first urine sample from the individual; determining the second GDB value in the second urine sample from the individual; or both. In some embodiments, the method comprises assigning to the individual a first risk status of high risk, intermediate risk, or low risk based on the first GDB value; assigning to the individual a second risk status of high risk, intermediate risk, or low risk based on the second GDB value; or both. In some embodiments, determining the first GDB value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g. , a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune- related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, andintravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0133] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising a) administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus; and b) administering a subsequent therapy based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint subsequent to the initial therapy, wherein the individual is assigned an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value, and wherein: i) if the initial MRD status is MRD-positive, the subsequent therapy comprises intravesical administration of the oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent;or ii) if the initial MRD status is MRD-negative, the subsequent therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, if the initial MRD status MRD-positive, the method further comprises a further subsequent therapy comprising intravesically administering to the individual an effective amount of the oncolytic virus, wherein the subsequent therapy is administered based on a determination of an updated MRD status of MRD-positive or MRD- negative based on a second VAF value determined in a second urine sample from the individual (e.g., at a second timepoint following the initial therapy), wherein: if the updated MRD status is MRD-positive, the subsequent therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the updated MRD status is MRD-negative, the subsequent therapy does not comprise administration of one or more additional therapeutic agents. In some embodiments, the method comprises determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the individual; or both. In some embodiments, the method comprises assigning to the individual a first risk status of high risk, intermediate risk, or low risk based on the first VAF value; assigning to the individual a second risk status of high risk, intermediate risk, or low risk based on the second VAF value; or both. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, and / or the updated MRD status is based on the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint. In some embodiments, the individual is assigned an MRD status of MRD- negative if the VAF value is less than about 5-10% (e.g., less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD- negative if the VAF value is less than about 5-10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. In some embodiments, determining the first VAF value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value comprises determining the VAF at about 10, 20, 30, 40, 50,60, 70, 80, 100, or more genes. In some embodiments, the additional therapeutic agent is administered systemically (e.g., intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM- CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereol). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5- fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treatedintravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0134] In some embodiments, provided herein is a method of treating bladder cancer in an individual, the method comprising: determining a first genomic disease burden (GDB) value in a first urine sample from the individual (e.g., at a first timepoint); assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; and administering an initial therapy to the individual, wherein: if the first risk status is high risk, the initial therapy comprises intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or, if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of an effective amount of the oncolytic virus without administration of the additional therapeutic agent. In some embodiments, if the first risk status is low risk or intermediate risk, the initial therapy does not comprise administration of the additional therapeutic agent. In some embodiments, if the first risk status is intermediate risk, the method further comprises: subsequent to the initial therapy, determining a second GDB value in a second urine sample in the individual (e.g., at a second timepoint following the initial therapy); assigning the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; and, if the second risk status is intermediate risk or high risk, administering a subsequent therapy to the individual comprising intravesical administration of an effective amount of the oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent. In some embodiments, determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g., DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value or the second GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence datarelative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g., urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the additional therapeutic agent is administered systemically (e.g, intravenously). In other embodiments, the additional therapeutic agent is administered intratumorally or intravesically. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the method comprises intravesically administering at least one dose of N-Dodecyl-P-D-maltoside (DDM) to the individual prior to administering the oncolytic virus (e.g., prior to each intravesical instillation of the oncolytic virus). In certain embodiments, the method comprises intravesically administering a first and second dose of DDM to the individual, and intravesically administering a saline wash after administering the first and second dose of DDM to the individual and prior to administering the oncolytic virus. In certain embodiments, the method comprises intravesically administering a single dose of DDM to the individual directly prior to each instillation of the oncolytic virus, without administration of a saline wash between the single dose of DDM and the administration of the oncolytic virus. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprisesgemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0135] In some embodiments, provided herein is a method of selecting or identifying an individual having bladder cancer as a candidate for a combination therapy comprising intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the method comprising: determining a first genomic disease burden (GDB) value in a urine sample from the individual; assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; and if the first risk status is high risk, selecting the individual for the combination therapy. In some embodiments, the individual has received a prior therapy prior to the determination of the first GDB value. In certain embodiments, the prior therapy comprises administration of the oncolytic virus without administration of the chemotherapeutic agent or the immune checkpoint modulator. In other embodiments, the prior therapy comprises administration of the oncolytic virus and administration of the chemotherapeutic agent or the immune checkpoint inhibitor. In some embodiments, determining the first GDB value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or moregenes); and calculating the first GDB value as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g. , a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-Al l 10, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCGinduction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0136] In some embodiments, provided herein is a method of selecting or identifying an individual having bladder cancer as a candidate for a therapy comprising intravesical administration of an effective amount of an oncolytic virus without administration of a chemotherapeutic agent or an immune checkpoint modulator, the method comprising: determining a first genomic disease burden (GDB) value in a urine sample from the individual; assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the determined GDB value; and if the first risk status is intermediate or low risk, selecting the individual for the therapy. In some embodiments, the individual has received a prior therapy prior to the determination of the first GDB value. In certain embodiments, the prior therapy comprises administration of the oncolytic virus without administration of the chemotherapeutic agent or the immune checkpoint modulator. In other embodiments, the prior therapy comprises administration of the oncolytic virus and administration of the chemotherapeutic agent or the immune checkpoint inhibitor. In some embodiments, determining the first GDB value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value based on the urine nucleic acid sequence data. In certain embodiments, determining the first GDB value comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data (e.g, the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes); and calculating the first GDB value as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset. In certain embodiments the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples (e.g, urine samples from plurality of individuals who have been diagnosed with bladder cancer). In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. Incertain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-Al l 10, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In certain embodiments, the individual a) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, did not receive any BCG maintenance courses, and subsequently experienced recurrence of a papillary carcinoma of Ta or T1 stage, carcinoma in situ, or a combination thereof at least 6 months after the BCG induction course; or b) has previously received a BCG induction course, experienced an absence of bladder tumors after the BCG induction course, subsequently received at least one BCG maintenance course, and further subsequently experienced: i) recurrence of a papillary carcinoma of Ta or T1 stage at least 6 months after the BCG induction course; or ii) recurrence of carcinoma in situ at least 12 months after the BCG induction course.

[0137] In some embodiments, provided herein is a method of selecting or identifying an individual having bladder cancer as a candidate for a combination therapy comprising intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the method comprising: determining a first variant allele frequency (VAF) value in a urine sample from the individual; assigning to the individual aninitial MRD status of MRD-positive or MRD-negative based on the first VAF value; and if the first risk status is MRD-positive, selecting the individual for the combination therapy. In some embodiments, the individual has received a prior therapy prior to the determination of the first VAF value. In certain embodiments, the prior therapy comprises administration of the oncolytic virus without administration of the chemotherapeutic agent or the immune checkpoint modulator. In other embodiments, the prior therapy comprises administration of the oncolytic virus and administration of the chemotherapeutic agent or the immune checkpoint inhibitor. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5-10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40-45 (e.g, less than about 42) regardless of the VAF value.. In some embodiments, determining the first VAF value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value comprises determining the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes). In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, theimmune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-A1110, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5-fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0138] In some embodiments, provided herein is a method of selecting or identifying an individual having bladder cancer as a candidate for a therapy comprising intravesical administration of an effective amount of an oncolytic virus without administration of a chemotherapeutic agent or an immune checkpoint modulator, the method comprising: determining a first variant allele frequency (VAF) value in a urine sample from the individual; assigning to the individual an initial MRD status of MRD-positive or MRD- negative based on the determined VAF value; and if the initial MRD status is MRD-negative, selecting the individual for the therapy. In some embodiments, the individual has received a prior therapy prior to the determination of the first VAF value. In certain embodiments, the prior therapy comprises administration of the oncolytic virus without administration of the chemotherapeutic agent or the immune checkpoint modulator. In other embodiments, the prior therapy comprises administration of the oncolytic virus and administration of the chemotherapeutic agent or the immune checkpoint inhibitor. In some embodiments, the initial MRD status is based on the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint. In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5- 10% (e.g., less than about 8%), and / or is assigned an MRD status of MRD-positive if the VAF value is at least about 5-10% (e.g, at least about 8%). In some embodiments, the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5- 10% (e.g, less than about 8%) and the GDB value is less than about 40-45 (e.g, less than about 42), and / or the individual is assigned an MRD status of MRD-positive if the GDBvalue is at least about 40-45 (e.g, less than about 42) regardless of the VAF value. In some embodiments, determining the first VAF value comprises: collecting a urine sample from the individual; sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; and calculating the first VAF value based on the urine nucleic acid sequence data. In certain embodiments, determining the first VAF value comprises determining the VAF at about 10, 20, 30, 40, 50, 60, 70, 80, 100, or more genes. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-Al l 10, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.

[0139] In some embodiments, provided herein is a method of selecting or identifying an individual having bladder cancer as a candidate for a therapy comprising intravesicaladministration of an effective amount of an oncolytic virus, the method comprising determining the presence in the individual of one or more mutations comprising: a) single nucleotide variants (SNVs), insertion, and / or deletion in one or more genes selected from the group consisting of TERT, TP53, PLEKHS1, KMT2D, KDM6A, ARID1A, PIK3CA, ERBB3, RXRA, CREBBP, ERBB2, ZFP36L1, RBI, FAT1, STAG2, SPTAN1, TSC1, RHOB, ELF3, KMT2C, and TPTE; b) copy number variations (CNVs) in one or more genes selected from the group consisting of SOX4, NITI, and SPAG1; and / or c) aneuploidy. In some embodiments, determining the presence of the one or more mutations in the individual comprises: collecting a urine sample from the individual and sequencing nucleic acids (e.g, DNA) from the urine sample to generate urine nucleic acid sequence data; determining the presence of the one or more mutations based on the urine nucleic acid sequence data. In some embodiments, the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter (e.g, a human E2F-1 promoter) operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule (e.g, GM-CSF). In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the therapy comprises one or more additional therapeutic agents. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g., an immune checkpoint inhibitor). In certain embodiments, the immune checkpoint modulator comprises an inhibitor of (e.g., an antibody that binds to) an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof. In certain embodiments, the immune checkpoint modulator comprises an anti-PD-1 antibody (e.g., nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP-514, STI-All 10, TSR-042, or any combination thereof). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In certain embodiments, the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof. In certain embodiments, the chemotherapeutic agent comprises gemcitabine. In some embodiments, the individual has non-muscle invasive bladder cancer (NMIBC). In certain embodiments, the individual has high-risk NMIBC. In some embodiments, the individual hasbeen previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy and either a) was responsive to BCG therapy and subsequently experienced recurrence; or b) was unresponsive to BCG therapy. In some embodiments, the individual has not previously been treated with BCG therapy.Combination Therapy

[0140] In some aspects, provided herein are methods of treating bladder cancer in an individual, comprising intravesical administration of an effective amount of oncolytic virus in combination with administration of an effective amount of additional therapeutic agent. In some embodiments, the additional therapeutic agent comprises a chemotherapeutic agent. In some embodiments, the additional therapeutic agent comprises an immune checkpoint modulator.

[0141] In some embodiments, the oncolytic virus and the additional therapeutic agent are administered sequentially, i.e., the oncolytic virus is administered before or after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered prior to the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered no more than about any of 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, or 24 hours prior to the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered about days or weeks (such as about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or more) prior to the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered no more than about any of 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, or 24 hours after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus is administered about days or weeks (such as about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, or more) after the administration of the additional therapeutic agent. In some embodiments, the oncolytic virus and the additional therapeutic agent are administered with one immediately after another (e.g., within 5 minutes or less between the two administrations). For example, in some embodiments, the oncolytic virus is administered immediately before the administration of the additional therapeutic agent. In someembodiments, the oncolytic virus is administered immediately after the administration of the additional therapeutic agent.

[0142] In some embodiments, the oncolytic virus and the additional therapeutic agent are administered simultaneously. In some embodiments, the oncolytic virus and the additional therapeutic agent are administered simultaneously via separate compositions. In some embodiments, the oncolytic virus and the additional therapeutic agent are administered simultaneously via the same composition. In some embodiments, the oncolytic virus and the additional therapeutic agent are both administered intravesically via the same composition.

[0143] Exemplary routes of administration of additional therapeutic agents (e.g, immune checkpoint modulators and chemotherapeutic agents) include, but are not limited to, intratumoral, intravesical, intramuscular, intraperitoneal, intravenous, intra-arterial, intracranial, intrapleural, subcutaneous, and epidermal routes, or be delivered into lymph glands, body spaces, organs or tissues known to contain such live cancer cells. In some embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered locally to the site of the tumor or to the tissue having the tumor. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered by direct injection of the agent(s) into the tumor. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered by direct injection of the agent(s) to a site close to the tumor cells. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered intravesically. In some embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered systemically. In certain embodiments, the additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent) is administered intravenously.

[0144] In some embodiments, the method comprises administration of a single additional therapeutic agent (e.g, immune checkpoint modulator or chemotherapeutic agent). In some embodiments, the additional therapeutic agent is a chemotherapeutic agent. In some embodiments, the additional therapeutic agent is an immune checkpoint modulator (e.g. an immune checkpoint inhibitor). In some embodiments, the immune checkpoint inhibitor is selected from the immune checkpoint inhibitors listed in Table 1, wherein the immune checkpoint inhibitor is administered with the same route of administration, and / or dose, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1. In some embodiments, the immune checkpoint inhibitor is selected from the immune checkpointinhibitors listed in Table 1, wherein the immune checkpoint inhibitor is administered with the different route of administration, and / or dose, and / or dosing frequency, and / or duration, and / or maintenance schedule as listed in Table 1. In some embodiments, the immune checkpoint inhibitor is not a molecule selected from Table 1.

[0145] In some embodiments, the method comprises administration of at least two (such as any of 2, 3, 4, 5, 6, or more) additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents). In some embodiments, all or part of the at least two additional therapeutic agents are administered simultaneously, such as in a single composition. In some embodiments, all or part of the at least two additional therapeutic agents are administered sequentially. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising an immune checkpoint inhibitor, a chemotherapeutic agent, or both. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising two or more (such as any of 2, 3, 4, 5, 6, or more) immune checkpoint inhibitors. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising two or more (such as any of 2, 3, 4, 5, 6, or more) chemotherapeutic agents. In some embodiments, the method comprises administration of a combination of additional therapeutic agents comprising any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors and any number (such as any of 2, 3, 4, 5, 6, or more) of chemotherapeutic agents. In some embodiments, the at least two additional therapeutic agents comprise one or more immune checkpoint inhibitors selected from Table 1 and / or one or more chemotherapeutic agents described herein. In some embodiments, the at least two additional therapeutic agents are each independently administered systemically (e.g, intravenously) or locally (e.g, intravesically). For example, in some embodiments, the method comprises systemic (e.g, intravenous) administration of an immune checkpoint modulator, local (e.g, intravesical) administration of an immune checkpoint modulator, systemic (e.g, intravenous) administration of a chemotherapeutic agent, local (e.g, intravesical) administration of a chemotherapeutic agent, or any combination thereof. In certain embodiments, the method comprises intravenous administration of an immune checkpoint modulator and intravesical administration of a chemotherapeutic agent. In some embodiments, the at least two additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents) are administered sequentially. In other embodiments, the at least two additional therapeutic agents (e.g, immune checkpoint modulators and / or chemotherapeutic agents) are administered simultaneously. In certainembodiments, the at least two additional therapeutic agents are administered simultaneously via separate compositions. In certain embodiments, the at least two different therapeutic agents are administered simultaneously via the same composition.

[0146] The administration of the additional therapeutic agents (e.g., immune checkpoint modulators and / or chemotherapeutic agents) can be of any sequence, including simultaneous systemic administration of the first additional therapeutic agent and local administration of the second additional therapeutic agent, and sequential administration of the additional therapeutic agents, among which at least one additional therapeutic agent is administered systemically, for example, first administering the second additional therapeutic agent locally (such as intravesically) to the site of the tumor followed by systemic (such as intravenous) administration of the first additional therapeutic agent, or first administering the first additional therapeutic agent systemically (such as intravenously) followed by local (such as intratumoral) administration of the second additional therapeutic agent. Additional therapeutic agents administered simultaneously via the same administration route may be administered as a single composition. For example, the additional therapeutic agents can be admixed prior to (such as immediately prior to, e.g., within less than about 10, 5, or 1 minutes before) the administration of the single composition.

[0147] In some embodiments, provided herein is a method of treating bladder cancer (e.g. , high-risk NMIBC) comprising intravesically administering an oncolytic virus described herein and intravesically administering one or more additional therapeutic agents described herein. In some embodiments, the additional therapeutic agent is administered concurrently with the oncolytic virus. In some embodiments, the additional therapeutic agent and the oncolytic virus are administered sequentially.

[0148] In some embodiments, the method comprises intravesical administration of the oncolytic virus followed by intravesical administration of the additional therapeutic agent on the same day of treatment. In some embodiments, the method comprises intravesical administration of the oncolytic virus followed immediately by intravesical administration of the additional therapeutic agent. In some embodiments, wherein the method comprises at least a first 6-week induction phase comprising administering the oncolytic virus and additional therapeutic agent to the individual on weeks 1, 2, 3, 4, 5, and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic virus and additional therapeutic agent to the individual every three or six months. In certain embodiments, the 3-week treatment comprises administering the oncolytic virus andadditional therapeutic agent weekly on weeks 1, 2, and 3. In certain embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In in some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6-week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In certain the maintenance phase comprises administering the 3 -week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In other embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.

[0149] In some embodiments, the additional therapeutic agent and the oncolytic virus are administered on different days or different weeks of a treatment course. In some embodiments the method comprises at least a first 6-week induction phase comprising: i) administering the oncolytic virus to the individual on weeks 1, 2, 4 and 5; and ii) administering additional therapeutic agent to the individual on weeks 3 and 6. In some embodiments, the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises a 3-week treatment comprising administering the oncolytic virus and additional therapeutic agent to the individual every three or six months. In certain embodiments, the 3-week treatment comprises administering the oncolytic virus weekly on weeks 1 and 2 followed by administering additional therapeutic agent in week 3. In some embodiments, the start of the first 6-week induction phase and the start of the maintenance phase are separated by about three or six months. In some embodiments, the individual is reevaluated at month three or around week 11 following the start of the first 6- week induction phase. In some embodiments, the individual begins the maintenance phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for nine months, followed by administering the 3-week treatment every six months. In other embodiments, the individual receives a second 6-week induction phase at month three or around week 13 following the start of the first 6-week induction phase. In certain embodiments, the maintenance phase comprises administering the 3-week treatment every three months for six months, followed by administering the 3-week treatment every six months.Oncolytic virus

[0150] The methods and compositions described herein are related to oncolytic viruses, for example, oncolytic adenovirus. The oncolytic virus may be a naturally occurring virus, or a genetically modified virus, for example an attenuated virus, and / or a virus with additional favorable features (e.g., preferential replication in cancer cells, or encoding an immune- related molecule).

[0151] Exemplary viruses that are suitable for use in the present invention include, but are not limited to, adenovirus, for example, H101 (ONCOCRINE®), CG-TG-102 (Ad5 / 3-D24- GM-CSF), and cretostimogene grenadenorepvec (also referred to as cretostimogene or CG0070); herpes simplex virus, for example, Talimogene laherparapvec (T-VEC) and HSV- 1716 (SEPREHVIR®); reovirus, for example, REOLYSIN®; vaccinia virus, for example, JX- 594; Seneca valley virus, for example, NTX-010 and SVV-001; Newcastle disease virus, for example, NDV-NS1 and GL-ONC1; polio virus, for example, PVS-RIPO; measles virus, for example, MV-NIS; coxsackie virus, for example, CAVATAK™; vesicular stomatitis virus; maraba and rhabdoviruses; parvovirus and mumps virus.

[0152] In some embodiments, the oncolytic virus is a wild type oncolytic virus. In some embodiments, the oncolytic virus is genetically modified. In some embodiments, the oncolytic virus is attenuated (for example through multiple passages, inactivation or genetic modification). In some embodiments, the oncolytic virus is replication competent. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell, such as a cancer cell defective in the Rb pathway.

[0153] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus. In some embodiments, the tumor-specific promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1 as shown below. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of E1A, E1B, and E4.

[0154] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor-selective promoter operably linked to a viral gene essential for replication of the oncolytic virus. In some embodiments, the tumor-selective promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1 as shown below. In some embodiments, theviral gene essential for replication of the oncolytic virus is selected from the group consisting ofElA, E1B, and E4.

[0155] In some embodiments, the oncolytic virus a viral vector comprising a tumor cellspecific promoter operably linked to a viral gene essential for replication of the oncolytic virus. In some embodiments, the oncolytic virus comprises a tumor-selective promoter. In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the oncolytic virus is cretostimogene. In some embodiments, the tumor selective promoter allows preferential replication of the oncolytic virus in tumor cells. In some embodiments, the oncolytic virus preferentially replicates in a cancer cell, such as a cancer cell defective in the Rb pathway. In some embodiments, the oncolytic virus is selected from the group consisting of adenovirus, herpes simplex virus, vaccinia virus, mumps virus, Newcastle disease virus, polio virus, measles virus, Seneca valley virus, coxsackie virus, reovirus, vesicular stomatitis virus, maraba and rhabdovirus, and parvovirus. In some embodiments, the tumor-specific promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4.

[0156] In some embodiments, the oncolytic virus further comprises an immune-related molecule (such as cytokine, chemokine, or PRRago (i.e., pathogen recognition receptor agonist)). In some embodiments, the immune-related molecule is not an immune checkpoint modulator. In some embodiments, the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL- 12, interferon (such as Type 1, Type 2 or Type 3 interferon, e g., interferon y), CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTa|3. In some embodiments, the immune-related molecule is selected from the group consisting of STING (i.e., stimulator of interferon genes) activators (such as CDN, i.e., cyclic dinucleotides), PRRago (such as CpG, Imiquimod, or Poly I:C), TLR stimulators (such as GS-9620, AED- 1419, CYT-003-QbG10, AVE-0675, or PF-7909), and RLR stimulators (such as RIG-I, Mda5, or LGP2 stimulators). In some embodiments, the immune-related molecule induces dendritic cells, T cells, B cells, and / or T follicular helper cells.

[0157] In some embodiments, the immune-related molecule is expressed by the oncolytic virus. For example, the oncolytic virus may comprise a nucleic acid encoding the immune- related molecule, and the nucleic acid can be in the viral vector or on a separate vector. In some embodiments, the oncolytic virus is a virus comprising a viral vector, and wherein the viral vector comprises the nucleic acid encoding the immune-related molecule. In some embodiments, the nucleic acid encoding the immune-related molecule is operably linked to a viral promoter, such as an El promoter, or an E3 promoter.

[0158] In some embodiments, the immune-related molecule enhances an immune response in the individual. Immune-related molecules may include, but are not limited to, a cytokine, a chemokine, a stem cell growth factor, a lymphotoxin, an hematopoietic factor, a colony stimulating factor (CSF), erythropoietin, thrombopoietin, tumor necrosis factor-alpha (TNF), TNF-beta , granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), interferon-alpha, interferon-beta, interferon-gamma, interferon- lambda, stem cell growth factor designated "SI factor", human growth hormone, N- methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prorelaxin, follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), luteinizing hormone (LH), hepatic growth factor, prostaglandin, fibroblast growth factor, prolactin, placental lactogen, OB protein, mullerian-inhibiting substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular endothelial growth factor, integrin, NGF-beta , platelet-growth factor, TGF-alpha , TGF-beta , insulinlike growth factor-I, insulin-like growth factor-II, macrophage-CSF (M-CSF), IL-1, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL-25, LIF, FLT-3, angiostatin, thrombospondin, endostatin, lymphotoxin, thalidomide, lenalidomide, or pomalidomide.

[0159] In some embodiments, the oncolytic virus is an adenovirus serotype 5. In some embodiments, the endogenous El a promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding human GM-CSF. In some embodiments, a polyadenylation signal (PA) is inserted 5’ of the E2F-1 promoter. In some embodiments, the nucleic acid encoding human GM-CSF is operably linked to the E3 promoter. In some embodiments, the vector backbone of the adenovirus serotype 5 further comprises E2, E4, late protein regions or inverted terminal repeats (ITRs) identical to the wildtype adenovirus serotype 5 genome. In some embodiments, the oncolytic virus has the genomic structure as shown in Figure 1. In some embodiments, the oncolytic virus is conditionally replicating. In some embodiments, the oncolytic virus preferentiallyreplicates in cancer cells. In some embodiments, the cancer cells are Rb pathway-defective cancer cells. In some embodiments, the oncolytic virus is cretostimogene.

[0160] In some embodiments, the oncolytic virus is an oncolytic adenovirus comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic adenovirus, and a heterologous gene encoding an immune-related molecule. In some embodiments, the immune-related molecule is GM-CSF and the heterologous gene encoding the GM-CSF is operably linked to an El promoter or an E3 promoter. In some embodiments, the tumor cell-specific promoter is an E2F-1 promoter (e.g., an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1) and the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of E1A, E1B, and E4. In certain embodiments, the immune-related molecule is GM-CSF and the heterologous gene encoding the GM-CSF is operably linked to an El promoter or an E3 promoter, and the tumor cell-specific promoter is an E2F-1 promoter (e.g, an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1) and the viral gene essential for replication of the oncolytic adenovirus is selected from the group consisting of E1A, E1B, and E4. In some embodiments, the oncolytic adenovirus is an adenovirus serotype 5. In certain embodiments, the endogenous El a promoter of the native adenovirus serotype 5 is replaced by the human E2F-1 promoter. In certain embodiments, the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF. In certain embodiments, the endogenous El a promoter of the native adenovirus serotype 5 is replaced by the human E2F-1 promoter and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF.

[0161] Thus, in some embodiments, there is provided a method of treating bladder cancer in an individual, comprising intravesically administering to the individual an effective amount of an adenovirus serotype 5, wherein the endogenous El a promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine, for example, GM-CSF). In some embodiments, the tumor-specific promoter is a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the method further comprises administering to the individual a transduction enhancing agent (such as DDM) prior to the administration of the adenovirus. In some embodiments, the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic virus. In certain embodiments, theoncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash. In some embodiments, the method comprises intravesically administering a saline wash after only the first DDM wash. In some embodiments, the oncolytic virus is administered directly after the second dose of DDM, without intravesical administration of a saline wash after the second dose of DDM and administration of the oncolytic virus. In some embodiments, the adenovirus is administered at a dose of about 1 x 108to about 1 x 1014viral particles (such as about IxlO12viral particles). In some embodiments, the adenovirus is administered weekly. In some embodiments, the IR- NMIBC comprises a tumor of low-grade Ta stage, wherein the tumor of Ta stage is recurrent within about 12 months of resection of a prior low-grade tumor of Ta stage or high-grade tumor of Ta stage having a diameter of 3 cm or smaller. In some embodiments, the IR- NMIBC comprises a single tumor of low grade Ta stage having a diameter of greater than 3 cm. In some embodiments, the IR-NMIBC comprises two or more low-grade tumors of Ta stage. In some embodiments, the IR-NMIBC comprises a primary and solitary high-grade tumor of Ta stage having a diameter of less than 3 cm. In some embodiments, the IR-NMIBC comprises a low-grade tumor of T1 stage.

[0162] SEQ ID NO: 1 (E2F-1 promoter)

[0163] gggcccaaaattagcaagtgaccacgtggttctgaagccagtggcctaaggaccacccttgcagaaccgtggtctcctt gtcacagtctaggcagcctctggcttagcctctgtttctttcataacctttctcagcgcctgctctgggccagaccagtgttgggaggagt cgctactgagctcctagattggcaggggaggcagatggagaaaaggagtgtgtgtggtcagcattggagcagaggcagcagtggg caatagaggaagtgagtaaatccttgggagggctccctagaagtgatgtgttttctttttttgttttagagacaggatctcgctctgtcgccc aggctggtgtgcagtggcatgatcatagctcactgcagcctcgacttctcgggctcaagcaatcctcccacctcagcctcccaagtagc tgggactacgggcacacgccaccatgcctggctaatttttgtattttttgtagagatgggtcttcaccatgttgatcaggctggtctcgaac tcctgggctcatgcgatccaccccgccagctgattacagggattccggtggtgagccaccgcgcccagacgccacttcatcgtattgt aaacgtctgttacctttctgttcccctgtctactggactgtgagctccttagggccacgaattgaggatggggcacagagcaagctctcc aaacgtttgttgaatgagtgagggaatgaatgagttcaagcagatgctatacgttggctgttggagattttggctaaaatgggacttgcag gaaagcccgacgtccccctcgccatttccaggcaccgctcttcagcttgggctctgggtgagcgggatagggctgggtgcaggatta ggataatgtcatgggtgaggcaagttgaggatggaagaggtggctgatggctgggctgtggaactgatgatcctgaaaagaagagg ggacagtctctggaaatctaagctgaggctgttgggggctacaggttgagggtcacgtgcagaagagaggctctgttctgaacctgca ctatagaaaggtcagtgggatgcgggagcgtcggggcggggcggggcctatgttcccgtgtccccacgcctccagcaggggacgc ccgggctgggggcggggagtcagaccgcgcctggtaccatccggacaaagcctgcgcgcgccccgccccgccattggccgtacc gccccgcgccgccgccccatcccgcccctcgccgccgggtccggcgcgttaaagccaataggaaccgccgccgttgttcccgtca cggacggggcagccaattgtggcggcgctcggcggctcgtggctctttcgcggcaaaaaggatttggcgcgtaaaagtggccgggactttgcaggcagcggcggccgggggcggagcgggatcgagccctcgccgaggcctgccgccatgggcccgcgccgccgccg ccgcctgtcacccgggccgcgcgggccgtgagcgtcatg

[0164] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine) operably linked to a viral promoter. In some embodiments, the tumor-specific promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4. In some embodiments, the viral promoter operably linked to the nucleic acid encoding the immune-related molecule is the E3 promoter. In some embodiments, the immune-related molecule is GM-CSF.

[0165] In some embodiments, the oncolytic virus (such as oncolytic adenovirus) comprises a viral vector comprising a tumor cell-selective promoter operably linked to a viral gene essential for replication of the oncolytic virus and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine) operably linked to a viral promoter. In some embodiments, the tumor-selective promoter is an E2F-1 promoter, such as a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4. In some embodiments, the viral promoter operably linked to the nucleic acid encoding the immune-related molecule is the E3 promoter. In some embodiments, the immune-related molecule is GM-CSF.

[0166] In some embodiments, the oncolytic virus is an adenovirus serotype 5, wherein the endogenous Ela promoter and E3 19kD coding region of a native adenovirus is replaced by the human E2F-1 promoter and a nucleic acid encoding an immune-related molecule (such as cytokine or chemokine, for example, GM-CSF). In some embodiments, the tumor-specific promoter is a human E2F-1 promoter or an E2F-1 promoter comprising the nucleotide sequence set forth in SEQ ID NO: 1.

[0167] In some embodiments, the oncolytic virus is cretostimogene, an exemplary adenovirus serotype 5 which has an E2F promoter at the Ela gene and a GM-CSF expression at the E3 gene.

[0168] Cretostimogene (also known as CG0070 or cretostimogene grenadenorepvec) is a conditionally replicating oncolytic adenovirus (serotype 5) designed to preferentially replicate in and kill Rb pathway-defective cancer cells. This vector is transcriptionallyregulated by a promoter (e.g., E2F-1 promoter) that is up-regulated in Rb-pathway-detective tumor cells. In approximately 85% of all cancers, one or more genes of the Rb pathway, such as the tumor suppressor Rb gene, are mutated. In addition to its restricted propagation, cretostimogene also encodes the human cytokine GM-CSF, which is expressed selectively in the infected tumor cells to stimulate immune responses against uninfected distant (such as metastases) and local tumor foci.

[0169] The genomic structure of the oncolytic adenoviral vector cretostimogene is shown schematically in FIG. 1. Products of the adenoviral early El A gene are essential for efficient expression of other regions of the adenoviral genome. Cretostimogene has been engineered to express the El A gene under control of the human E2F-1 promoter, which provides tumor specificity to the El A gene product. To protect from transcriptional read-through activating El A expression, a poly adenylation signal (PA) was inserted 5' of the E2F-1 promoter. Cretostimogene includes the entire wild type E3 region except for the 19kD-coding region. A direct comparison of E3 -containing to E3-deleted oncolytic adenovirus vectors showed superiority of E3-containing vectors in tumor spread and efficacy. In place of the 19kD gene, cretostimogene carries the cDNA for human GM-CSF under the control of the endogenous E3 promoter (E3P). Since the E3 promoter is in turn activated by El A, both viral replication and GM-CSF expression are ultimately under the control of the E2F-1 promoter. The rest of the viral vector backbone, including the E2, E4, late protein regions and inverted terminal repeats (ITRs), is identical to the wild type Ad5 genome.

[0170] Cretostimogene is manufactured in a human cancer cell line and released from infected cells by detergent lysis. Cretostimogene is purified from the lysate by chromatography, and then formulated in 5% sucrose, 10 mM Tris, 0.05% polysorbate-80, 1 % glycine, 1 mM magnesium chloride, pH 7.8.

[0171] Cretostimogene is supplied as a sterile, slightly opalescent, frozen liquid in stoppered glass vials. The particle concentration per mL (vp / mL) is stated on the Certificate of Analysis for each lot of cretostimogene.

[0172] Cretostimogene has additional potential anti-tumor activity in that it carries the cDNA for human GM-CSF, a key cytokine for generating long-lasting anti -tumor immunity. Thus, cretostimogene is a selectively replicating oncolytic vector with the potential for attacking the tumor by two mechanisms: direct cytotoxicity as a replicating vector and induction of a host immune response. In vitro and in vivo studies have been conducted to characterize the tumor selectivity and anti-tumor activity and safety of cretostimogene. See,for example, U.S. Patent No. 11,596,660, which incorporated herein by reference in its entirety.

[0173] As used herein, the terms “cretostimogene grenadenorepvec,” “cretostimogene,” and “CG0070” are used interchangeably.Immune Checkpoint Modulators

[0174] In some embodiments, the methods described herein comprise administration of an immune checkpoint modulator in combination with intravesical administration of an oncolytic virus. Immune checkpoint modulators of particular interest in the present invention include immune-stimulating agents and immune checkpoint inhibitors. As used herein, the term "immune checkpoint inhibitors," "checkpoint inhibitors," and the like refers to compounds that inhibit the activity of control mechanisms of the immune system. Immune system checkpoints, or immune checkpoints, are inhibitory pathways in the immune system that generally act to maintain self-tolerance or modulate the duration and amplitude of physiological immune responses to minimize collateral tissue damage. Checkpoint inhibitors can inhibit an immune system checkpoint by stimulating the activity of a stimulatory checkpoint molecule, or inhibiting the activity of an inhibitory checkpoint molecule in the pathway. Stimulatory checkpoint molecules are molecules, such as proteins, that stimulate or positively regulate the immune system. Inhibitory checkpoint molecules are molecules, such as proteins, that inhibit or negatively regulate the immune system. Immune system checkpoint molecules include, but are not limited to, cytotoxic T-lymphocyte antigen 4 (CTLA-4), programmed cell death 1 protein (PD-1), programmed cell death 1 ligand 1 (PD- Ll), programmed cell death 1 ligand 2 (PD-L2), lymphocyte activation gene 3 (LAG3), B7-1, B7-H3, B7-H4, T cell membrane protein 3 (TIM3), B- and T-lymphocyte attenuator (BTLA), V-domain immunoglobulin (Ig)-containing suppressor of T-cell activation (VISTA), Killercell immunoglobulin-like receptor (KIR), and A2A adenosine receptor (A2aR). As such, checkpoint inhibitors include antagonists of CTLA-4, PD-1, PD-L1, PD-L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3. For example, antibodies that bind to CTLA-4, PD-1, PD-L1, PD-L2, LAG3, B7-1, B7-H3, B7-H4, BTLA, VISTA, KIR, A2aR, or TIM3 and antagonize their function are checkpoint inhibitors. Moreover, any molecule (e.g., peptide, nucleic acid, small molecule, etc.) that inhibits the inhibitory function of an immune system checkpoint is a checkpoint inhibitor.

[0175] In some embodiments, the immune checkpoint modulator is an immune checkpoint inhibitor. In some embodiments, the immune checkpoint inhibitor is a natural or engineered ligand of an inhibitory immune checkpoint molecule, including, for example, ligands of CTLA-4 (e.g., B7.1, B7.2), ligands of TIM3 (e.g., Galectin-9), ligands of A2a Receptor (e.g., adenosine, Regadenoson), ligands of LAG3 (e.g., MHC class I or MHC class II molecules), ligands of BTLA (e.g., HVEM, B7-H4), ligands of KIR (e.g., MHC class I or MHC class II molecules), ligands of PD-1 (e.g., PD-L1, PD-L2), ligands of IDO (e.g., NKTR-218, Indoximod, NLG919), ligands of CD47 (e.g., SIRP-alpha receptor), ligands of GITR, and ligands of CSF1R. In some embodiments, the immune checkpoint inhibitor is an antibody that targets an inhibitory immune checkpoint protein. In some embodiments, the immune checkpoint inhibitor is an antibody selected from the group consisting of anti-CTLA-4 (e.g., Ipilimumab, Tremelimumab, KAHR-102), anti-TIM3 (e.g., F38-2E2, ENUM005), anti- LAG3 (e.g., BMS-986016, IMP701, IMP321, C9B7W), anti-KIR (e.g., Lirilumab, IPH2101, IPH4102), anti-PD-1 (e.g., Nivolumab, Pidilizumab, Pembrolizumab, BMS-936559, atezolizumab, Lambrolizumab, MK-3475, AMP-224, AMP-514, STI-Al l 10, TSR-042), anti- PD-L1 (e.g., KY-1003 (EP20120194977), MCLA-145, atezolizumab, BMS-936559, MEDI- 4736, MSB0010718C, AUR-012, STI-A1010, PCT / US2001 / 020964, MPDL3280A, AMP- 224, Dapirolizumab pegol (CDP-7657), MEDI-4920), anti-CD73 (e.g., AR-42 (OSU- HDAC42,HDAC-42,AR42,AR 42,OSU-HDAC 42,OSU-HDAC-42,NSC D736012,HDAC- 42,HDAC 42,HDAC42,NSCD736012,NSC-D736012), MEDI-9447), anti-B7-H3 (e.g., MGA271, DS-5573a, 8H9), anti-CD47 (e.g., CC-90002, TTI-621, VLST-007), anti-BTLA, anti-VISTA, anti-A2aR, anti-B7-l, anti-B7-H4, anti-CD52 (such as alemtuzumab), anti-IL- 10, anti-IL-35, anti-TGF-[3 (such as Fresolumimab), anti-CSFIR (e.g., FPA008), anti- NKG2A (e.g., monalizumab), anti-MICA (e.g., IPH43), anti-GITR (e.g., TRX518), and anti- CD39. In some embodiments, the antibody is an antagonistic antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, VHH (nanobody), and other antigen-binding subsequences of the full length antibody. In some embodiments, the antibody is a human, humanized, or chimeric antibody. In some embodiments, the antibody is a bispecific antibody, a multispecific antibody, a single domain antibody, a fusion protein comprising an antibody portion, or any other functional variants or derivatives thereof.

[0176] The immune checkpoint inhibitor can be of any one of the molecular modalities known in the art, including, but not limited to, aptamer, mRNA, siRNA, microRNA, shRNA,peptide, antibody, anticalin, spherical nucleic acid, TALEN, Zinc Finger Nuclease, CRISPR / Cas9, and small molecule.

[0177] The immune checkpoint inhibitors can be used singly or in combination. For example, any number (such as any of 1, 2, 3, 4, 5, 6, or more) of immune checkpoint inhibitors can be used simultaneously or sequentially. Sequential administration of immune checkpoint inhibitors can be separated by hours, days or weeks. The administration route(s) for two or more immune checkpoint inhibitors can be the same or different. For example, one immune checkpoint inhibitors can be administered locally (e.g, intravesically or intratumorally), and a second immune checkpoint inhibitors can be administered systemically (e.g, intravenously); two immune checkpoint inhibitors can both be administered locally (e.g, intravesically or intratumorally); or two immune checkpoint inhibitors can both be administered systemically (e.g, intravenously). In some embodiments, two or more immune checkpoint inhibitors are administered simultaneously in the same composition. In some embodiments, two or more immune checkpoint inhibitors are administered simultaneously in separate compositions.

[0178] Exemplary immune checkpoint molecules and inhibitors thereof are discussed below. It is understood that other suitable immune checkpoint molecules and immune checkpoint inhibitors known in the art are also within the scope of the present application.PD-1

[0179] In some embodiments, the immune checkpoint inhibitor is an inhibitor of PD-1. In some embodiments, the inhibitor of PD-1 is an anti-PD-1 antibody. Any of the anti-PD-1 antibodies known in the art may be used in the present invention, including, but not limited to, nivolumab, pembrolizumab, pidilizumab, BMS-936559, and atezolizumab, lambrolizumab, MK-3475, AMP -224, AMP-514, STI-Al l 10, and TSR-042. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody or a polyclonal antibody. In some embodiments, the anti-PD-1 antibody is an antigen-binding fragment selected from the group consisting of Fab, Fab’, F(ab’)2, Fv, scFv, and other antigen-binding subsequences of the full-length anti-PD-1 antibody. In some embodiments, the anti-PD-1 antibody is a human, humanized, or chimeric an...

Claims

CLAIMSWhat is claimed is:

1. A method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on the difference between the first GDB value and a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein if the second GDB value is greater than the first GDB value, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the second GDB value is less than the first GDB value, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent.

2. A method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint; andb) administering a subsequent therapy based on the difference between the first VAF value and a second VAF value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein if the second VAF value is greater than the first VAF value, the subsequent therapy is an escalated therapy comprising administration of an oncolytic virus and administration of an additional therapeutic agent selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the second VAF value is less than the first VAF value, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent.

3. A method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: if the first risk status is high risk, the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the first risk status is low risk or intermediate risk, the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent; and b) administering a subsequent therapy based on a difference between the first risk status and a second risk status of low risk, intermediate risk, or high risk assigned based on a second GDB value determined in a second urine sample from the individual at a second timepoint subsequent to the initial therapy , wherein if the second risk status is higher than the first risk status, the subsequent therapy is an escalated therapy comprising administration of the oncolytic virus and administration of the additional therapeutic agent, and, optionally, administration of one or more further additional therapeutic agents selected from the group consistingof a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the second risk status is lower than the first risk status, the subsequent therapy is a de-escalated therapy comprising administration of the oncolytic virus without administration of the additional therapeutic agent.

4. The method of any one of claims 1-3, wherein: i) the initial therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent; ii) the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the escalated therapy comprises intravesical administration of the oncolytic virus, the additional therapeutic agent, and one or more further additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or iii) the initial therapy comprises intravesical administration of the oncolytic virus and administration of the additional therapeutic agent, and the de-escalated therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

5. A method of treating bladder cancer in an individual, the method comprising an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: if the first risk status is high risk, the initial therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the first risk status is low risk or intermediate risk, the initial therapy does not comprise administration of the additional therapeutic agent.

6. The method of claim 5, wherein, if the first risk status is intermediate risk, the method further comprises a subsequent therapy comprising intravesically administering to the individual an effective amount of the oncolytic virus, wherein the subsequent therapy is administered based on a determination of a second GDB value in a second urine sample from the individual at a second timepoint subsequent to the initial therapy, wherein the individual is assigned a second risk status of low risk, intermediate risk, or high risk based on the second GDB value, and wherein, if the second risk status is intermediate risk or high risk, the subsequent therapy further comprises administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the second risk status is low risk, the subsequent therapy does not comprise administration of one or more additional therapeutic agents.

7. The method of any one of claims 1-6, wherein the method comprises: assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; assigning to the individual a second risk status of low risk, intermediate risk, or high risk based on the second GDB value; or both.

8. A method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy based on a determination of an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative, wherein the initial MRD status is determined based on a first variant allele frequency (VAF) value in a first urine sample obtained from the individual at a first timepoint, and wherein: i) if the initial MRD status is MRD-positive: 1) the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, or 2) the initial therapy comprises intravesical administration of an oncolytic virus without the one or more additional therapeutic agents and wherein the individual is optionally subject to a subsequent escalated therapy; or ii) if the initial MRD status is MRD-negative: the initial therapy comprises intravesical administration of the oncolytic virus without administration of the one or more additional therapeutic agents; andb) administering a subsequent therapy based on a determination of an updated MRD status of MRD-positive or MRD-negative, wherein the updated MRD status is determined based on a second VAF value in a second urine sample obtained from the individual at a second timepoint following the initial therapy, and wherein: i) if the updated MRD status is MRD-positive: the subsequent therapy comprises escalated therapy comprising intravesical administration of the oncolytic virus in combination with administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) if the updated MRD status is MRD-negative: the subsequent therapy comprises de-escalated therapy comprising intravesical administration of the oncolytic virus without administration of one or more additional therapeutic agents.

9. A method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus; and b) administering a subsequent therapy based on a determination of a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint subsequent to the initial therapy, wherein the individual is assigned a first risk status of low risk, intermediate risk, or high risk based on the first GDB value, and wherein: i) if the first risk status is intermediate risk or high risk, the subsequent therapy comprises intravesical administration of the oncolytic virus in combination with one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, an immune checkpoint modulator, a targeted therapy agent, or an immunomodulatory agent; or ii) if the first risk status is low risk, the subsequent therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

10. A method of treating bladder cancer in an individual, the method comprising an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus, wherein the initial therapy is administered based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint, wherein the individual is assigned an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value, and wherein:a) if the initial MRD status is MRD-positive, i) the initial therapy comprises intravesical administration of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or ii) the initial therapy comprises intravesical administration of an oncolytic virus without the one or more additional therapeutic agents, optionally wherein the method comprises administering to the individual a subsequent escalated therapy comprising administering to the individual the oncolytic virus in combination with one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or b) if the initial MRD status is MRD-negative, the initial therapy does not comprise administration of the additional therapeutic agent.

11. A method of treating bladder cancer in an individual, the method comprising: a) administering an initial therapy comprising intravesically administering to the individual an effective amount of an oncolytic virus; and b) administering a subsequent therapy based on a determination of a first variant allele frequency (VAF) value in a first urine sample from the individual at a first timepoint subsequent to the initial therapy, wherein the individual is assigned a minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value, and wherein: if the MRD status is MRD-positive, the subsequent therapy comprises intravesical administration of the oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent; or if the MRD status is MRD-negative, the subsequent therapy comprises intravesical administration of the oncolytic virus without administration of the additional therapeutic agent.

12. The method of any one of claims 8-11, wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5%, 6%, 7%, 8%, 9%, or 10%,optionally wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 8%.

13. The method of any one of 8-12, wherein the individual is assigned an MRD status of MRD-positive if the VAF value is at least about 5%, 6%, 7%, 8%, 9%, or 10%, optionally wherein the individual is assigned an MRD status of MRD-positive if the VAF value is at least about 8%.

14. The method of any one of claims 8-13, wherein: the initial therapy is administered based on a determination of the first VAF value and a first genomic disease burden (GDB) value in a first urine sample from the individual at a first timepoint; the subsequent therapy is administered based on a determination of the second VAF value and a second GDB value in a second urine sample from the individual at a second timepoint; or both.

15. The method of claim 14, wherein the individual is assigned an MRD status of MRD- negative if the VAF value is less than about 5%, 6%, 7%, 8%, 9%, or 10% and the GDB value is less than about 40, 41, 42, 43, 44, or 45, optionally wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 8% and the GDB value is less than about 42.

16. The method of any one of 14 or 15, wherein the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40, 41, 42, 43, 44, or 45 regardless of the VAF value, optionally wherein the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 42 independent of the VAF value.

17. The method of any one of claims 8-16, wherein the method comprises: assigning to the individual an initial MRD status based on the first VAF value; assigning to the individual an updated MRD status based on the second VAF value; or both.

18. The method of any one of claims 14-17, wherein the method comprises: assigning to the individual an initial MRD status based on the first VAF value and the first GDB value; assigning to the individual an updated MRD status based on the second VAF value and the second GDB value; or both.

19. The method of any one of claims 8-18, wherein the method comprises: determining the first VAF value in the first urine sample from the individual; determining the second VAF value in the second urine sample from the individual; or both.

20. The method of any one of claims 1-19, wherein the method comprises: determining the first GDB value in the first urine sample from the individual; determining the second GDB value in the second urine sample from the individual; or both.

21. The method of any one of claims 1-20, wherein the additional therapeutic agent is administered once every six weeks for at least six months and optionally subsequently administered once every three months.

22. The method of any one of claims 1-21, wherein the additional therapeutic agent is administered systemically, optionally wherein the additional therapeutic agent is administered intravenously.

23. The method of any one of claims 1-21, wherein the additional therapeutic agent is administered intratumorally.

24. The method of any one of claims 1-21, wherein the additional therapeutic agent is administered intravesically.

25. The method of any one of claims 1-24, wherein the oncolytic virus and the additional therapeutic agent are administered sequentially.

26. The method of any one of claims 1-24, wherein the oncolytic virus and the additional therapeutic agent are administered simultaneously.

27. A method of identifying an individual having bladder cancer as a candidate for a combination therapy comprising intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the method comprising: determining a first genomic disease burden (GDB) value in a urine sample from the individual; assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the first GDB value; and if the first risk status is high risk, selecting the individual for the combination therapy.

28. A method of identifying an individual having bladder cancer as a candidate for a therapy comprising intravesical administration of an effective amount of an oncolytic virus without administration a chemotherapeutic agent or an immune checkpoint modulator, the method comprising: determining a first genomic disease burden (GDB) value in a urine sample from the individual; assigning to the individual a first risk status of low risk, intermediate risk, or high risk based on the determined GDB value; andif the first risk status is intermediate or low risk, selecting the individual for the therapy.

29. A method of identifying an individual having bladder cancer as a candidate for a combination therapy comprising intravesical administration of an effective amount of an oncolytic virus and administration of one or more additional therapeutic agents selected from the group consisting of a chemotherapeutic agent, a targeted therapy agent, an immune checkpoint modulator, and an immunomodulatory agent, the method comprising: determining a first variant allele frequency (VAF) value in a urine sample from the individual; assigning to the individual an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value; and if the initial MRD status is MRD-positive, selecting the individual for the combination therapy.

30. A method of identifying an individual having bladder cancer as a candidate for a therapy comprising intravesical administration of an effective amount of an oncolytic virus without administration a chemotherapeutic agent or an immune checkpoint modulator, the method comprising: determining a first variant allele frequency (VAF) value in a urine sample from the individual; assigning to the individual an initial minimum residual disease (MRD) status of MRD-positive or MRD-negative based on the first VAF value; and if the initial MRD status is MRD-negative, selecting the individual for the therapy.

31. The method of claim 29 or 30, wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5%, 6%, 7%, 8%, 9%, or 10%, optionally wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 8%.

32. The method of any one of claims 29-31, wherein the individual is assigned an MRD status of MRD-positive if the VAF value is at least about 5%, 6%, 7%, 8%, 9%, or 10%, optionally wherein the individual is assigned an MRD status of MRD-positive if the VAF value is at least about 8%.

33. The method of claim 29-32, wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 5%, 6%, 7%, 8%, 9%, or 10% and theGDB value is less than about 40, 41, 42, 43, 44, or 45, optionally wherein the individual is assigned an MRD status of MRD-negative if the VAF value is less than about 8% and the GDB value is less than about 42.

34. The method of any one of 29-32, wherein the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 40, 41, 42, 43, 44, or 45 regardless of the VAF value, optionally wherein the individual is assigned an MRD status of MRD-positive if the GDB value is at least about 42 independent of the VAF value.

35. The method of any one of claims 1, 3-9, and 12-28, wherein: a) the individual is assigned a risk status of low risk if the GDB value is less than about 20; b) the individual is assigned a risk status of high risk if the GDB value is greater than about 80; and / or c) the individual is assigned a risk status of intermediate risk is the GDB value is between about 20 and about 80.

36. The method of any one of claims 1-35, wherein determining the first GDB value, the second GDB value, or both comprises: collecting a urine sample from the individual; sequencing nucleic acids from the urine sample to generate urine nucleic acid sequence data; and calculating the first GDB value, the second GDB value, or both based on the urine nucleic acid sequence data.

37. The method of claim 35, wherein calculating the first GDB value, the second GDB value, or both comprises: determining the variant allele frequency (VAF) of the urine nucleic acid sequence data; and calculating the first GDB value, the second GDB value, or both as a percentile ranking of the VAF of the urine nucleic acid sequence data relative to a training dataset.

38. The method of claim 37, wherein the training dataset comprises a plurality of VAFs of urine nucleic acid sequence data from a plurality of urine samples.

39. The method of claim 37 or 38, wherein the training dataset comprises one or more variant alleles selected from the group consisting of single nucleotide variants (SNVs), insertions, deletions, copy number variations (CNVs), and aneuploidy.

40. The method of any one of claims 37-39, wherein the training dataset comprises:a) SNVs, insertion, and / or deletions in one or more genes selected from the group consisting of TERT, TP53, PLEKHS1, KMT2D, KDM6A, ARID1A, PIK3CA, ERBB3, RXRA, CREBBP, ERBB2, ZFP36L1, RBI, FAT1, STAG2, SPTAN1, TSC1, RHOB, ELF3, KMT2C, and TPTE; b) CNVs in one or more genes selected from the group consisting of SOX4, NITI, and SPAG1; and / or c) aneuploidy.

41. The method of any one of claims 36-38, wherein the sequencing comprises amplicon sequencing, whole genome sequencing, or a combination thereof.

42. The method of any one of claims 1-41, wherein the additional therapeutic agent is an immune checkpoint modulator.

43. The method of claim 42, wherein the immune checkpoint modulator comprises an immune checkpoint inhibitor.

44. The method of claim 43, wherein the immune checkpoint modulator comprises an inhibitor of an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, CD137, and ligands thereof.

45. The method of claim 44, wherein the immune checkpoint inhibitor is an antibody that binds to an immune checkpoint molecule selected from the group consisting of CTLA-4, PD- 1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof.

46. The method of claim 45, wherein the immune checkpoint modulator is an anti-PD-1 antibody.

47. The method of claim 46, wherein the anti-PD-1 antibody is nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, lambrolizumab, MK- 3475, AMP -224, AMP- 514, STI-A1110, TSR-042, or any combination thereof.

48. The method of any one of claims 1-47, wherein the additional therapeutic agent is a chemotherapeutic agent.

49. The method of claim 48, wherein the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof.

50. The method of claim 49, wherein the chemotherapeutic agent comprises: a) gemcitabine and cisplatin; b) dose-dense methotrexate, vinblastine, doxorubicin (Adriamycin), and cisplatin (DDMVAC); orc) gemcitabine and paclitaxel.

51. The method of claim 48, wherein the chemotherapeutic agent is gemcitabine.

52. The method of any one of claims 1-51, wherein the individual has non-muscle invasive bladder cancer (NMIBC).

53. The method of claim 52, wherein the individual has high-risk NMIBC.

54. The method of any one of claims 1-53, wherein the individual has been previously treated intravesically with Bacillus Calmette-Guerin (BCG) therapy.

55. The method of claim 54, wherein the individual was responsive to BCG therapy.

56. The method of claim 55, wherein the individual experienced reduced bladder cancer symptoms, reduced size or number of bladder tumors, or an absence of bladder tumors after intravesical BCG therapy.

57. The method of claim 54, wherein the individual was BCG-unresponsive.

58. The method of any one of claims 1-53, wherein the individual has not received prior intravesical BCG therapy.

59. The method of any one of claims 1-26 and 36-58, wherein the method comprises one or more treatment courses each comprising administering the oncolytic virus weekly.

60. The method of claim 59, wherein each treatment courses comprises administering the oncolytic virus weekly for about 1 week to about 6 weeks.

61. The method of any one of claims 1-26 and 36-58, wherein the method comprises an induction phase comprising administering the oncolytic virus to the individual once per week for six weeks.

62. The method of claim 61, wherein the method comprises a maintenance phase subsequent to the induction phase, wherein the maintenance phase comprises administering the oncolytic virus to the individual every three or six months.

63. The method of claim 62, wherein the maintenance phase comprises administering the oncolytic virus weekly for three weeks every three or six months.

64. The method of claim 62 or 63, wherein the start of the induction phase and the start of the maintenance phase are separated by about three months or about six months.

65. The method of any one of claims 61-64, wherein the individual is administered the oncolytic virus once per week for six weeks on month zero during the induction phase and is reevaluated at month three.

66. The method of claim 65, wherein the individual begins the maintenance phase at month three.

67. The method of claim 66, wherein the maintenance phase comprises administering the oncolytic virus once per week for three weeks every three months for nine months and subsequently administering the oncolytic virus once per week for three weeks every six months.

68. The method of claim 65, wherein the individual receives a second induction dose of oncolytic virus once per week for six weeks at month three.

69. The method of claim 68, wherein the maintenance phase comprises administering the oncolytic virus once per week for three weeks every three months for six months and subsequently administering the oncolytic virus once per week for three weeks every six months.

70. The method of any one of claims 62-69, wherein the maintenance phase comprises:(i) administering the oncolytic virus once per week for three weeks every three months for six to nine months, and subsequently(ii) administering the oncolytic virus once per week for three weeks every six months.

71. The method of any one of claims 1-26 and 36-70, wherein the oncolytic virus is administered at a dose of about 1 x 108to about 1 x 1014viral particles.

72. The method of claim 71, wherein the oncolytic virus is administered at a dose of about 1 x 1012viral particles.

73. The method of any one of claims 1-26 and 36-72, wherein the oncolytic virus is administered in a volume of between about 50 mL and about 100 mL.

74. The method of any one of claims 1-26 and 36-73, further comprising intravesically administering to the individual a transduction enhancing agent prior to the administration of the oncolytic virus.

75. The method of claim 74, wherein the transduction enhancing agent is N-Dodecyl-P- D-maltoside (DDM).

76. The method of claim any one of claims 1-26 and 36-75, wherein the method comprises intravesically administering at least one dose of DDM to the individual prior to administering the oncolytic virus.

77. The method of claim 76, wherein the oncolytic virus is administered directly after the at least one dose of DDM, without intravesical administration of a saline wash.

78. The method of claim 76, wherein the method comprises intravesically administering a single dose of DDM to the individual prior to each administration of the oncolytic virus.

79. The method of claim 78, wherein the oncolytic virus is administered directly after the single dose of DDM, without intravesical administration of a saline wash.

80. The method of claim 76, wherein the method comprises administering a first and second dose of DDM to the individual prior to administering the oncolytic virus.

81. The method of claim 76, wherein the method comprises intravesically administering a saline wash before administering a first and second dose of DDM to the individual.

82. The method of claim 80 or 81, wherein the method comprises intravesically administering a saline wash after administering a first and second dose of DDM to the individual, prior to administering the oncolytic virus.

83. The method of any one of claims 75-82, wherein the DDM is administered at a concentration of about 0.1%.

84. The method of any one of claims 75-83, wherein the DDM is administered at a volume of between about 50 mL and about 100 mL.

85. The method of any one of claims 1-84, wherein the individual has carcinoma in situ.

86. The method of claim 85, wherein the individual has a concurrent papillary carcinoma of Ta or T1 stage.

87. The method of claim 85, wherein the individual does not have a concurrent papillary carcinoma of Ta or T1 stage.

88. The method of any one of claims 1-84, wherein the individual has a papillary carcinoma of Ta or T1 stage.

89. The method of claim 88, wherein the individual does not have concurrent carcinoma in situ.

90. The method of any one of claims 1-89, wherein the individual has received transurethral resection of bladder tumor (TURBT) prior to administration of the oncolytic virus.

91. The method of claim 90, wherein the bladder cancer has been completely resected by TURBT prior to administration of the oncolytic virus.

92. The method of claim 90 or 91, wherein the bladder cancer is recurrent after complete resection of one or more prior bladder tumors by TURBT.

93. The method of any one of claims 1-92, wherein the oncolytic virus is selected from the group consisting of adenovirus, herpes simplex virus, vaccinia virus, mumps virus, Newcastle disease virus, polio virus, measles virus, Seneca valley virus, coxsackie virus, reovirus, vesicular stomatitis virus, maraba and rhabdovirus, and parvovirus.

94. The method of any one of claims 1-93, wherein the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential forreplication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule.

95. The method of claim 94, wherein the oncolytic virus preferentially replicates in a cancer cell.

96. The method of claim 95, wherein the cancer cell is defective in the Rb pathway.

97. The method of any one of claims 94-96, wherein the tumor cell-specific promoter is an E2F-1 promoter.

98. The method of claim 97, wherein the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO: 1.

99. The method of any one of claims 94-98, wherein the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTap.

100. The method of claim 99, wherein the immune-related molecule is GM-CSF.

101. The method of any one of claims 94-100, wherein the heterologous gene is operably linked to a viral promoter.

102. The method of claim 101, wherein the oncolytic virus is an oncolytic adenovirus.

103. The method of claim 102, wherein the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4.

104. The method of claim 102 or 103, wherein the heterologous gene is operably linked to an El promoter or an E3 promoter.

105. The method of any one of claims 1-104, wherein the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF.

106. The method of claim 105, wherein the oncolytic virus is cretostimogene.

107. The method of any one of claims 1-106, wherein the individual is human.

108. A kit for treating bladder cancer in an individual, the kit comprising: a) one or more agents for determining a genomic disease burden (GDB) value or a variant allele frequency (VAF) value in a urine sample from an individual; b) an oncolytic virus; and c) a device for intravesically administering the oncolytic virus.

109. The kit of claim 108, wherein the kit further comprises instructions for determining a GDB value or the VAF value in the urine sample.

110. The kit of claim 108 or 109, wherein the kit further comprises instructions for determining a risk status or a minimum residual disease (MRD) status for the individual based on the VAF value, the GDB value, or both.

111. The kit of any one of claims 108-110, wherein the kit further comprises one or more additional therapeutic agents selected from the group consisting of an immune checkpoint modulator or a chemotherapeutic agent.

112. The kit of claim 111, wherein the kit further comprises instructions for administering the additional therapeutic agent based on the determination of the GDB value, determination of the VAF value, the determination of the risk status, and / or determination of the MRD status.

113. The kit of claim 111 or 112, wherein the kit further comprises a device for administering the additional therapeutic agent.

114. The kit of any one of claims 108-113, wherein the oncolytic virus is selected from the group consisting of adenovirus, herpes simplex virus, vaccinia virus, mumps virus, Newcastle disease virus, polio virus, measles virus, Seneca valley virus, coxsackie virus, reovirus, vesicular stomatitis virus, maraba and rhabdovirus, and parvovirus.

115. The kit of any one of claims 108-114, wherein the oncolytic virus comprises a viral vector comprising a tumor cell-specific promoter operably linked to a viral gene essential for replication of the oncolytic virus, and a heterologous gene encoding an immune-related molecule.

116. The kit of claim 115, wherein the oncolytic virus preferentially replicates in a cancer cell.

117. The kit of claim 115, wherein the cancer cell is defective in the Rb pathway.

118. The kit of any one of claims 115-117, wherein the tumor cell-specific promoter is an E2F-1 promoter.

119. The kit of claim 118, wherein the E2F-1 promoter comprises the nucleotide sequence set forth in SEQ ID NO:1.

120. The kit of any one of claims 115-119, wherein the immune-related molecule is selected from the group consisting of GM-CSF, IL-2, IL-12, interferon, CCL4, CCL19, CCL21, CXCL13, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, RIG-I, MDA5, LGP2, and LTap.

121. The kit of claim 120, wherein the immune-related molecule is GM-CSF.

122. The kit of any one of claims 115-121, wherein the heterologous gene is operably linked to a viral promoter.

123. The kit of claim 122, wherein the oncolytic virus is an oncolytic adenovirus.

124. The kit of claim 123, wherein the viral gene essential for replication of the oncolytic virus is selected from the group consisting of El A, E1B, and E4.

125. The kit of claim 122 or 123, wherein the heterologous gene is operably linked to an El promoter or an E3 promoter.

126. The kit of any one of claims 108-125, wherein the oncolytic virus is an adenovirus serotype 5, wherein the endogenous El a promoter of a native adenovirus serotype 5 is replaced by the human E2F-1 promoter, and the endogenous E3 19kD coding region of the native adenovirus serotype 5 is replaced by a nucleic acid encoding human GM-CSF.

127. The kit of claim 126, wherein the oncolytic virus is cretostimogene.

128. The kit of any one of claims 118-127, wherein the additional therapeutic agent is an immune checkpoint modulator.

129. The kit of claim 128, wherein the immune checkpoint modulator comprises an immune checkpoint inhibitor.

130. The kit of claim 129, wherein the immune checkpoint modulator comprises an inhibitor of an immune checkpoint molecule selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof.

131. The kit of claim 130, wherein the immune checkpoint inhibitor is an antibody that binds to an immune checkpoint molecule selected from the group consisting of CTLA-4, PD- 1, PD-L1, PD-L2, TIM3, B7-H3, B7-H4, LAG-3, KIR, and ligands thereof.

132. The kit of claim 131, wherein the immune checkpoint modulator is an anti -PD-1 antibody.

133. The kit of claim 132, wherein the anti-PD-1 antibody is nivolumab, pidilizumab, pembrolizumab, BMS-936559, atezolizumab, Lambrolizumab, MK- 3475, AMP -224, AMP- 514, STI-A1110, TSR-042, or any combination thereof.

134. The kit of any one of claims 108-133, wherein the additional therapeutic agent is a chemotherapeutic agent.

135. The kit of claim 134, wherein the chemotherapeutic agent comprises gemcitabine, cisplatin, carboplatin, paclitaxel, docetaxel, ifosfamide, doxorubicin, methotrexate, vinblastine, mitomycin, 5 -fluorouracil (5-FU), or any combination thereof.

136. The kit of claim 135, wherein the chemotherapeutic agent comprises:a) gemcitabine and cisplatin; b) dose-dense methotrexate, vinblastine, doxorubicin (Adriamycin), and cisplatin (DDMVAC); or c) gemcitabine and paclitaxel.

137. The kit of claim 135, wherein the chemotherapeutic agent is gemcitabine.

138. The kit of any one of claims 108-137, wherein the bladder cancer is non-muscle invasive bladder cancer (NMIBC).

139. The kit of claim 138, wherein the bladder cancer is high-risk NMIBC.

Images