Adapters and methods for multiplexing cell-free DNA

Abstract

This invention pertains in general to adapters for sequencing DNA, particularly cell free DNA (cfDNA), in a sample. The adapters can by ligated to the DNA and used for amplification and sequencing on a suitable next generation sequencing platform. The invention further describes kits comprising adapters and blocker oligonucleotides, methods for preparing a sample comprising cfDNA by ligating the cfDNA to an adapter and methods for treating a cfDNA containing sample with a blocker oligonucleotide.

Description

[0001] Title: Adapters and methods for multiplexing cell-free DNA

[0002] FIELD OF THE INVENTION

[0003]

[0001] This invention pertains in general to adaptors for sequencing DNA, particularly cell free DNA (cfDNA), in a sample. The adaptors can by ligated to the DNA and used for amplification and sequencing on a suitable next generation sequencing platform. The invention further describes kits comprising adaptors and blocker oligonucleotides, methods for preparing a sample comprising cfDNA by ligating the cfDNA to an adaptor and methods for treating a cfDNA containing sample with a blocker oligonucleotide.

[0004] BACKGROUND OF THE INVENTION

[0005]

[0002] The background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.

[0006]

[0003] Cell free DNA (cfDNA), also referred to as circulating free DNA, refers to DNA fragments that circulate within the peripheral blood. These fragments may be small, with an average size of around 166 base pairs depending on their origin. Although not the only source, cfDNA is primarily thought to be released into the bloodstream as a result of cell death, which suggests that the quantification and genetic analysis of cfDNA provides information about cell death in the body. Therefore, cfDNA is emerging as an important diagnostic tool in, for example, the diagnosis of cancer. Because the cfDNA is usually obtained in plasma, which is rich in proteins, analysis of cfDNA by sequencing is challenging. One option is to purify the cfDNA in the plasma by removing proteins. However, this may also remove histones associated to cfDNA, and which may provide valuable diagnostic information and are required for, for example, ChIP (chromatin immunoprecipitation) assays.

[0007]

[0004] Next generation sequencing (NGS), also referred to as massive parallel sequencing, allows for the sequencing of large amounts of DNA. The different NGS platforms generally perform massive parallel sequencing via spatially separated, clonally amplified DNA templates or single DNA molecules in a flow cell. Typically, NGS platforms require ligation of a short nucleic acid sequence (sequencing handle or referred herein as nucleic acid adapter) to the target DNA to allow amplification and barcoding. For example, on the Illumina platform adapters are ligated to both ends of a short double stranded DNA target, which allow binding of the adaptors to the adaptors present in the flow cell, thus enabling bridge amplification and subsequent further amplification of the target DNA. Also, Nanopore sequencing makes use of adapters.

[0008]

[0005] For example, US11519019B2 describes a method and adaptors for analyzing cfDNA using purified cfDNA.

[0009]

[0006] Most next generation sequencing technologies require the ligation of adaptors to the target DNA to introduce a barcode and a promoter for amplification. Such adaptors have been described for example in WO2023227699A1 . Drawback of such adaptors is, among others, the ability to self-ligate and subsequent need to remove adaptor dimers. In addition, double ligation of adaptors to cfDNA (where an adaptor is ligated to each side of the cfDNA fragment) will result in the inability of the handle sequences to be amplified during library preparation and subsequent loss of those sequencing reads.

[0010]

[0007] The ligation of adaptors to a target DNA, such as but not exclusively to cfDNA, may be carried out or promoted through jagged-end ligation, for example by means of base complementarity of overhanging nucleotides in the adaptor and in the target DNA, which can base-pair. Once the molecules have base-paired then the ligation takes place with the appropriate enzymatic tools (i.e., ligase to form the phosphodiester bonds). As an example of this jagged-end ligation (also termed overhang-end ligation), adenosine may be added in a target DNA and a thymidine in the adaptors. Generally, the nitrogen base in the adaptor that has to base-pair with the DNA is left non-phosphorylated to reduce self-ligation with another adapter through that base. This methodology, which is disclosed for example in the documents WO2024112948A1 , US2016362726A1 , WO2022146773A1 , WO2023247658A1 and US2023392141 A1 is impractical for the ligation of the nucleic acid adaptors to the DNA (e.g., cfDNA), directly in plasma-derived samples or directly in any complex biological sample. To prepare the nucleic acid adaptor and the DNA for the base-pairing and further ligation, a series of enzymatic steps are required, each in turn requiring inactivation before proceeding — first to generate blunt ends in the DNA, and then to add nucleotide tails that will base-pair with the adaptor, and finally the ligation. Heat enzyme inactivation after the first step if performed in-situ in a biological sample such as plasma would, for example, cause the plasma to clot. In addition, chemical inactivation (of the enzymes) using inhibitors like EDTA (a classical ion chelator) is incompatible with any subsequent enzymatic step (i.e. , ligation). For this reason, the documents WO2023247658A1 and US2023392141A1 disclose a first cfDNA extraction from plasma prior to proceeding with any step of preparing the DNA for the subsequent ligation step. The need of purification and additional steps to prepare the DNA (and optionally the adaptors) outside of the sample of origin, makes the process longer and complex.

[0011]

[0008] In light of this, new products, compositions, and methods and uses for analyzing cfDNA in plasma samples would be highly desirable but are not yet readily available. In particular, there is a clear need in the art for reliable, efficient, and reproducible products, compositions, methods and uses that allow ligation of sequencing adaptors to cfDNA in plasma samples and subsequent pooling of multiple plasma samples for improved efficiency. Accordingly, the technical problem underlying the present invention can been seen in the provision of such products, compositions, methods and uses for complying with any of the aforementioned needs, or at least providing the public with a useful choice. The technical problem is solved by the embodiments characterized in the claims and herein below.

[0012] SUMMARY OF THE INVENTION

[0013]

[0009] As embodied and broadly described herein, the present invention is directed to the surprising finding that the sequencing adaptors, compositions and method described herein may be efficiently used for ligation of adaptors to cfDNA in plasma and allow for pooling of such plasma samples for subsequent sequencing.

[0014]

[0010] Thus in a first aspect the invention describes a nucleic acid adapter, having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

[0015]

[0011] These nucleic acid adapters, with the indicated end configurations at each strand, surprisingly allow for their ligation to DNA directly in the DNA containing biological sample, without the need of any (prior) extraction or purification of the DNA to be ligated from the biological sample, in particular plasma. The nucleic acid adapters according to the invention are capable to be ligated to blunt-ended DNA without the need to use any jagged-end pairing or base-pairing.

[0016]

[0012] Ligation of the adapters to DNA (e.g. cfDNA) in-situ within complex (biological) samples, such as in plasma, can now for the first time be carried out by means of a simple method. This method according to the invention, may comprise, as will be disclosed in more detail below, a step in which blunt-end generation or any other endrepairing is done in the DNA of the sample, for example in the biological sample, for example plasma. In the same sample, after the said end-repair step, adapters as disclosed herein may be added, directly, and an efficient ligation between the adapters and the DNA is achieved. This is, in part, possible because the end configuration of the adapters prevents self-ligation and will not be affected by any enzyme and / or compound used in any previous step of end-repair or end-modification of the DNA in the sample.

[0017]

[0013] With the adapters as disclosed herein, there is no longer a need for the isolation of the DNA (e.g. cfDNA) from the sample, for example biological sample, in particular plasma. Post-ligation steps for the removal of self-ligated nucleic acid adapters are not needed anymore.

[0018]

[0014] Therefore, herewith provided as an aspect of the invention is the use of nucleic acid adapters in the ligation of cfDNA in a biological sample, preferably in a plasma sample, wherein the nucleic acid adapter has a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

[0019]

[0015] Novel nucleic acid adapters molecules are proposed, which may be used in the ligation to DNA directly in complex biological samples, such as in plasma. / pct

[0020]

[0016] Thus, an aspect of the invention is a nucleic acid adapter having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ -X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’; wherein the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0017] In a second aspect the invention describes a kit of parts or composition comprising: a) a DNA adapter suitable for ligating to cfDNA, and b) a blocker oligonucleotide, wherein the blocker oligonucleotide is an oligonucleotide consisting or comprising of modified nucleotides.

[0021]

[0018] As illustrated in the examples, a blocker oligonucleotide used in combination with DNA adapters allows an enhanced ligation efficiency of the adapter to the target DNA, in comparison to the ligation in absence of the blocker oligonucleotide, especially when the ligation of a DNA adapter to a DNA, such as cfDNA, is performed directly in a biological sample, for example plasma, or any other type of biological sample (e.g. a sample obtained from an organism). The presence of proteins in such biological samples may absorb or sequester any desired target compound (e.g. DNA / cfDNA). Without wishing to be bound by theory, it is hypothesized that by including the blocker oligonucleotide in a ligation reaction prevents the proteins present in a biological sample, in particular plasma from sequestering or absorbing the cfDNA and the nucleic acid adapters, thereby making the cfDNA more available for ligation to the nucleic acid adapter.

[0022]

[0019] In a third aspect the invention describes a method of preparing a cfDNA sample, the method comprising a) proving a sample comprising cfDNA, preferably wherein the sample is a biological sample, b) blunting the cfDNA in the sample to obtain blunt- ended cfDNA, c) introducing the DNA adapter as defined in the first aspect of the invention in the sample, and d) ligating the DNA adapter Z’ 5’ end to the blunt-ended cfDNA to obtain a cfDNA-adapter ligation product, wherein the DNA adapter is a nucleic acid adapter having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

[0023]

[0020] This method allows for the practical ligation of adapters to cfDNA directly in biological samples, in particular biological samples comprising protein, such as in plasma, without the need of a previous isolation of the cfDNA. The DNA adapters as defined, namely comprising a 3’ end of Z that comprises a functional group that prevents self-ligation of the nucleic acid adapter and a 5’ end of Z’ that is phosphorylated, can be added for the ligation in the presence of any enzymatic tools applied for any previous end-repairing or processing step of the cfDNA (e.g., generation of blunt-end cfDNA) without the risk of the said adapters to self- li gate . The ligation of the adapters to cfDNA within the same sample that contains it, preferably plasma, without the need of any extraction / isolation of the said cfDNA required, provides a more practical methodology compared to those in the prior art. Notably moreover, the use of the adapters as defined herein, allows the multiplexing of samples of different origin for subsequent sequencing (e.g., NGS) or amplification, as illustrated in the examples herein.

[0024]

[0021] The method of preparing a cfDNA sample as defined herein may thus be carried out in the absence of isolation or purification of the cfDNA from a sample. Preferably, the method does not comprise isolation or purification of the cfDNA from a sample.

[0025]

[0022] In a fourth aspect the invention relates to a method for treating a cfDNA comprising sample with a blocker oligonucleotide, the method comprising adding the blocker oligonucleotide as defined in the second aspect of the invention to a sample comprising cfDNA, preferably wherein the sample is a biological sample, more preferably comprises plasma.

[0026]

[0023] The treatment with the blocker oligonucleotide allows for the provision of high ligation efficiencies to DNA adapters, in particular in biological samples, for example comprising proteins, such as plasma.

[0027] BRIEF DESCRIPTION OF THE DRAWINGS

[0028]

[0024] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

[0025] Figure 1 : Schematic representation of the nucleic acid adapter. Panel A schematically shows the design of the nucleic acid adaptor as a partially double stranded nucleic acid molecule with a top and a bottom strand. On the left side (5’ side of the top strand, 3’ side of the bottom strand) is a fork structure where the bottom and top strands are substantially not complementary and do not hybridize. The 5’ end of the top strand and the 3’ end of the bottom strand are modified, in this example with Inverted ddT (5’ of top strand) and inverted dT (3’ of bottom strand) The body part comprises in the top strand the optional features of a transcription promoter (in the example a T7 promoter), a sequencing handle (in the example a RA5 - Illumina handle sequence), an UM I and a barcode. The left part (3’ side of the top strand, 5’ side of the bottom strand). The left part (3’end of the top strand and 5’ part of the bottom strand) comprises a modification that prevents ligation in the top strand (in the example a 3’ ddC modification is shown) and the 5’ end of the bottom strand is phosphorylated to allow ligation. Panel B shows the same structure with reference to the claims where following structural elements are defined: X and X’ define the fork part, where X is the 5”forked part of the top strand and X’ is the 3’ forked part of the bottom strand, where X further includes the 5’ modification and X’ the 3’ modification (Inv-ddT and Inv-dT respectively in the example). Y and Y’ define the body part of the adapter comprising the optional elements such as a promoter, sequencing handle, UMI and barcode. Y defines the top strand body part and Y’ the bottom strand body part. Z and Z’ define the right part with the top strand 3’ modification (ddC in the example) and bottom strand 5’ phosphorylation. / AOMB-NLP

[0029]

[0026] Figure 2: DNA nucleic acid adapter design showing exemplary sequences. At the forked side, two types of modifications are included to prevent self-ligation and to protect the adaptors from degradation (3’-lnvdT) and ligation (5’-lnvddT). The adapter includes a T7 promoter, 4 nt UMI (unique molecule identifier) and a 8 nt Barcode (BC) which allows to label-index plasma samples for pooling. In the 3’ end of the top strand, the ddC prevents self-ligation and also only allow the bottom strand to be ligated into the cfDNA.

[0030]

[0027] Figure 3: Procedure to index cfDNA. Individual blood plasma samples are indexed via ligation of a DNA adapter (handle)(a) containing a unique index (b). This enables pooling of many patient samples into a single reaction (c) to perform for example ChIP experiments with a single antibody (d), or combinatorial MAblD with a mix of many different antibodies to obtain genome-wide histone PTM profiles (e).

[0031]

[0028] Figure 4: Ligation of DNA nucleic acid adapters in Plasma. Three ligation mixes were prepared, each containing different amounts of plasma, equal amounts of ligation buffer, and T4 DNA ligase, along with a blunt-end DNA fragment (230 bp) and a DNA nucleic acid adapter (60 bp). The mixes were distributed into four different samples, where the effect of the presence (+) or absence (-) of MgCl2 and EDTA was evaluated in terms of ligation efficiency. Samples were incubated overnight at 16°C and loaded into a 1.5% agarose gel containing EtBr to stain DNA. Ligation of the nucleic acid adapters into the DNA fragment is indicated by the formation of a DNA smear in lanes 2, 5, 6, 9, and 10. Importantly, successful ligation is observed upon the addition of MgCl2 for the samples with the highest plasma content (lane 2).

[0032]

[0029] Figure 5: Pre-treatment the plasma sample with PS-modified DNA oligo. A) Plasma sample was pre-treated with the blocker oligo before the addition of the Adapter and the cfNucleosomes (Epicypher). The *N represents the PS bonds between nucleotides. B) qPCR evaluating ligation efficiency between the adapter and the nucleosomes in plasma. One primer anneals to the nucleic acid adapter and its pair to the nucleosome sequence (Epicypher). Ligation efficiency was calculated by normalizing the amplification signal from the nucleic acid adapter to the nucleosomes against the amplification signal of the total nucleosome content in the reaction, determined using a primer set specific for the nucleosome sequence.

[0033]

[0030] Figure 6: End repair in plasma. A) Illustration of the end-repair process in plasma, where a plasma mix containing repair enzymes is prepared along with HeLa mononucleosomes (EpiCypher). B) DNA bioanalyzer results of a nucleic acid adapter ligation experiment into HeLa nucleosomes not treated with the repair mix. M = marker; Nuc = nucleosomes (150 bp). Ligation of the nucleic acid adapter into nucleosomes is indicated by the formation of a peak around 270 bp (ligation). C) In a samples where HeLa nucleosomes were treated with repair mix, ligation of the nucleic acid adapter is achieved in high efficiency. The ligation events are depicted in the plot and correspond to peaks around 270, 400 and 580 bp, respectively.

[0034]

[0031] Figure 7: In our strategy, single and double Adapter ligation events allow the proper transcript configuration to be amplified for sequencing. Of note: there is a ‘nick’ formed between the 3’- end of the adapter and the 5’end of the cfDNA when there is a ligation blocking modification such as ddC is included in the adapter. This nick prevents transcription extending from one adapter into another in the double adapter ligation event. B) RNA bioanalyzer result of In vitro transcription of HeLa nucleosomes containing ligated nucleic acid adapters as shown in Fig 4A. The main RNA product (arrow head) corresponds to the expected transcripts containing the Illumina RA5, the LIMI-BC and the cfDNA genomic sequence tagged by our nucleic acid adapters. * background RNA signal generated mainly by the presence of free nucleic acid adapter (non-ligated). M= RNA marker.

[0035]

[0032] Figure 8: Poly-adenylation at the 3’- end for Illumina library prep. Left panel, T7-IVT derived hybrid transcripts containing the sample index at the 5’ end (LIMI-BC) are incubated in the presence of ATP and E. coli Poly(A) Polymerase to add A-tails specifically to the 3’-end. Retro-transcription of the 3’- poly(A) transcripts is performed using an oligo(dT) containing UMI and the handle sequence for the incorporation of Illumina P7 during library prep PCR. Subsequently, cDNA is treated with a mix of RNase H- RNase A, bead cleanup, and Illumina PCR library prep for NGS. Right panel: Experimental conditions (1 - 30 min, 37°C) were established to modulate the length of the poly(A) tails. The control sample (-) shows the starting size of the hybrids (200 nt). Upon incubation at 37°C in the presence of ATP and the enzyme, poly(A) tails (-100 nt) are consistently incorporated from 1-10 min of incubation. At 30 min, these tails can reach a length of approximately -500 nt.

[0036]

[0033] Figure 9: Illumina sequencing results of our DNA handle ligation procedure of HeLa mono-nucleosomes spiked into blood plasma. A) Depicted are a 1000 random reads from the sequencing run and nearly a 100% of the reads contain the correct structure. First 4 nucleotides is the unique molecular identifier (UMI) followed by 8 nucleotides sample barcode and 8 nucleotides adapter sequence followed by genomic DNA sequences of the cfDNA nucleosomes. B): Sample complexity is obtained by calculating the percentage of unique sequencing events after removal of duplicated reads using the UMI present in our handles (UMI-BC). C) Read distribution of libraries mapped over a 38 Mb genomic in chromosome 1 (hg19) showing homogenous genome coverage of the sequenced molecules.

[0037]

[0034] Figure 10: Schematic Representation of DNA Barcoding Methodology for Plasma Samples. A-D, all steps and designs involved in our inventions to perform DNA barcoding in plasma samples. DESCRIPTION

[0038] Definitions

[0039]

[0035] A portion of this disclosure contains material that is subject to copyright protection (such as, but not limited to, diagrams, device photographs, or any other aspects of this submission for which copyright protection is or may be available in any jurisdiction.). The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or patent disclosure, as it appears in the Patent Office patent file or records, but otherwise reserves all copyright rights whatsoever.

[0040]

[0036] Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein.

[0037] For purposes of the present invention, the following terms are defined below.

[0041]

[0038] As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, “a method for providing a cell” includes the providing of a plurality of cells (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more cells). For example, “a first antibody- DNA adapter conjugate” includes providing a plurality of such “first antibody-DNA adapter conjugates”.

[0042]

[0039] The terms “about” and “approximately”, when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1% and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0043]

[0040] As used herein, the term “and / or” indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

[0044]

[0041] As used herein, the term "at least" a particular value means that particular value or more. For example, "at least 2" is understood to be the same as "2 or more" i.e. , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, ... , etc. As used herein, the term "at most" a particular value means that particular value or less. For example, "at most 5" is understood to be the same as "5 or less" i.e., 5, 4, 3, ... .-10, -11 , etc.

[0045]

[0042] As used herein, the word “comprise” or variations thereof such as “comprises” or “comprising” will be understood to include a stated element, integer or step, or group of elements, integers or steps, but not to exclude any other element, integer or steps, or groups of elements, integers or steps. The verb “comprising” includes the verbs “essentially consisting of” and “consisting of”.

[0046]

[0043] As used herein, “conventional techniques” or “methods known to the skilled person” refer to a situation wherein the methods of carrying out the conventional techniques used in methods of the invention will be evident to the skilled worker. The practice of conventional techniques in molecular biology, biochemistry, cell culture, genomics, sequencing, medical treatment, pharmacology, immunology and related fields are well-known to those of skill in the art and are discussed, in various handbooks and literature references.

[0047]

[0044] As used herein, "exemplary" or “for example” means "serving as an example, instance, or illustration," and should not be construed as excluding other configurations, including those disclosed herein.

[0048]

[0045] When used herein the term “sample” refers to a source that comprises cfDNA. A sample is preferably obtained from a human or non-human animal test subject but may also include in vitro samples such as but not limited to a cell culture medium or culture supernatant. When obtained from a test subject the sample may refer to a blood sample, a plasma sample, a saliva sample, a stool sample, a urine sample, a cerebrospinal fluid sample, or a tissue derived fluid sample. Preferably the sample is a plasma sample.

[0049]

[0046] When used herein the term “target DNA” refers to a double stranded DNA present in the sample to which the adapter is intended to ligate for subsequent sequencing of the target DNA. Preferably the target DNA is cell free DNA.

[0050]

[0047] When used herein the term “cell free DNA” is used interchangeably with “circulating free DNA” or “cfDNA” and is used to refer to degraded DNA fragments released to body fluids such as blood plasma, urine, cerebrospinal fluid, etc. Typical sizes of cfDNA fragments reflect chromatosome particles (~165bp), as well as multiples of nucleosomes, which protect DNA from digestion by apoptotic nucleases. The term cfDNA can be used to describe various forms of DNA freely circulating in body fluids, including circulating tumor DNA (ctDNA), cell-free mitochondrial DNA (ccf mtDNA), cell-free fetal DNA (cffDNA) and donor-derived cell-free DNA (dd-cfDNA). Elevated levels of cfDNA are observed in cancer, especially in advanced disease. In addition, there is evidence that cfDNA becomes increasingly frequent in circulation with the onset of age. cfDNA has been shown to be a useful biomarker for a multitude of diseases or disorders other than cancer and fetal disorders. This includes but is not limited to trauma, sepsis, aseptic inflammation, myocardial infarction, stroke, transplantation, diabetes, and sickle cell disease. cfDNA is mostly a double-stranded extracellular molecule of DNA.

[0051]

[0048] When used herein the term “substantially not complementary” intends to indicate two sequences of which most bases, if aligned, are not complementary and the two sequences thus do not hybridize under circumstances that would allow completely or substantially complimentary sequences to hybridize. Thus, it allows that a certain small number of bases are complementary. Thus, the term substantially not complementary implies that fewer than 50%, preferably fewer than 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or even fewer than 1% of the bases of the aligned sequences are complementary.

[0052]

[0049] When used herein the term “substantially complementary” intends to indicate two sequences of which most bases, if aligned, are complementary and the two sequences thus hybridized under circumstances that would allow completely complimentary sequences to hybridize. Thus, it allows that a certain small number of bases that are not complementary. Thus, the term substantially complementary implies that fewer than 15%, preferably fewer than 14%, 13%, 12%, 11 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or even fewer than 1 % of the bases of the aligned sequences are not complementary. For instance, it is envisioned that the UMI sequence is not complementary to the UMI’ sequence.

[0053]

[0050] The terms “forward” and “top” when referring to a nucleic acid strand are used interchangeably herein. Herein the top strand or forward strand is defined as the strand comprising a promoter sequence oriented such that it allows transcription of the complementary (opposite) strand ligated to the cfDNA. Thus, the forward or top strand comprises modifications at both the 5’ and 3’ ends that prevent ligation to cfDNA or other adapters. The terms “reverse” and “bottom” when referring to a nucleic acid strand are used interchangeably herein. Herein the bottom strand or reverse strand is defined as the strand that is ligated to the target cfDNA at the 5’ end of the bottom (reverse) strand. Thus, the reverse or bottom strand comprises a modification at the 3’ end only that prevent ligation to cfDNA or other adapters.

[0054]

[0051] When used herein the term “deoxyribonucleoside”, also indicated herein as deoxynucleotide, deoxy-X or dX where X represents a base (A (adenine), C (cytosine), G (guanine), T(thymine)) intend to refer to a derivative of the respective nucleoside, differing from the latter by the replacement of a hydroxyl group by hydrogen at the 2' position of its ribose sugar moiety. For example, deoxy-A or dA thus refers to the nucleoside adenosine, differing from the latter by the replacement of a hydroxyl group by hydrogen at the 2' position of its ribose sugar moiety.

[0055]

[0052] When used herein the term “didoeoxyribonucleoside”, also indicated herein as dideoxynucleotide, dideoxy-X or ddX where X represents a base (A (adenine), C (cytosine), G (guanine), T(thymine)) intend to refer to a derivative of the respective nucleotide wherein both the 2' and 3' positions on the ribose lack hydroxyl groups.

[0056]

[0053] When used herein an inverted nucleotide refers to a nucleotide that is bound 3’ to 3’ or 5’to 5’ to a nucleotide sequence. Although inverted nucleotide sequences may be used to link two nucleotide sequences in opposite direction (3’-3’, or 5’-5’) herein inverted bases are used to prevent exonuclease activity and / or unwanted ligation. In particular, 3’-inverted deoxynucleotides can be used to prevent exonucleases attacking to the site to which the 3’-inverted deoxynucleotide is bound, and can to block the site for being extended from polymerases. 5’ - inverted dideoxynucleotides (e.g. in the top strand) can protect from undesired ligation. When used herein the term complementary intends to refer to a reverse complementary sequence, and the terms complementary and reverse complementary are herein used interchangeably. That is, a sequence A that is (substantially) complementary to a sequence B can form a double stranded (hybridized) sequence of the following structure:

[0057] 5’ A ‘3 3’ B ‘5

[0058] Detailed description

[0059]

[0054] The invention is defined herein, and in particular in the accompanying claims. Subject-matter which is not encompassed by the scope of the claims does not form part of the present claimed invention.

[0055] It is contemplated that any method, use, or composition described herein can be implemented with respect to any other method, use or composition described herein. Embodiments discussed in the context of methods, use and / or compositions of the invention may be employed with respect to any other method, use or composition described herein. Thus, an embodiment pertaining to one method, use or composition may be applied to other methods, uses and compositions of the invention as well.

[0060]

[0056] Any references in the description to methods of treatment refer to the compounds, pharmaceutical compositions, and medicaments of the present invention for use in a method for treatment of the human (or animal) body by therapy.

[0061]

[0057] As embodied and broadly described herein, the present invention is directed to the surprising finding with the described modifications to adaptors, compositions, and methods that ligation efficiency can be increased and ligation can be performed in plasma, allowing the pooling of multiple barcoded plasma samples for a single sequencing run, instead of sequencing each sample separately. The invention herein broadly describes new adapters that allow ligation to a target DNA, preferably cfDNA, in plasma and subsequent amplification and sequencing analysis with reduced self ligation, improved compositions that improve ligation of the adapters to cfDNA in plasma, and improved methods for ligating an adaptor to cfDNA in plasma for subsequent amplification and sequence analysis.

[0062] Nucleic acid adapters

[0063]

[0058] To address the issues presented in the prior art, in a first aspect improved nucleic acid adapters are described herein, which can be directly ligated to target DNA present in complex biological samples, such as cfDNA in plasma. Moreover, new and improved nucleic acid adapters are also provided. Therefore, in a first aspect the invention relates to a nucleic acid adapter having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

[0064]

[0059] These nucleic acid adapters may be efficiently used for ligation of adaptors to target DNA present in biological samples, such as cfDNA in plasma, without the need of any previous step of extraction or purification of the DNA to be ligated; and allow for pooling of such plasma samples for subsequent sequencing (multiplexing). The adapters avoid self-ligation and hence no additional step for the removal of any adapter-adapter complex (dimer) is required.

[0065]

[0060] A schematic representation of the nucleic acid adapter is shown in Figure 1 , the adaptor will be described below referring to Figure 1 for easy understanding of the invention. Specific features depicted in the Figure should not be construed as limiting the invention.

[0066]

[0061] The nucleic acid adapter comprises a top strand and a bottom strand which are partly hybridized, resulting in a forked structure depicted in Figure 1A and 1 B. The left part of the adapter in the Figure, comprising the 5’ part of the top strand and the 3’ part of the bottom strand forms the fork and herein referred to as X for the top strand and X’ for the bottom strand. The fork is formed by sequences that are substantially not complimentary to each other and cannot hybridize. Thus the 5’ sequence of the top strand, herein referred to as X, and the 3’ sequence part of the bottom strand, herein referred as X’ are substantially not complimentary and do not hybridize thus forming a forked structure. The remaining structure parts of the adapter, herein referred to as Y, and Z for the top strand and Y’ and Z’ for the bottom strand are substantially complimentary to each other and hybridize under conditions the normally allow hybridization of complementary polynucleotides.

[0067]

[0062] The nucleic acid adaptor of the invention is herein described in its hybridized form. It is understood that a substantial part of the adaptor top strand, namely Y and Z is substantially complementary to Y’ and Z’ of the bottom strand, and that the adaptor functions as intended as a mostly double stranded, i.e. hybridized, nucleic acid product. It is however understood that the invention should not be limited to the adaptor in its hybridized form and further encompasses compositions comprising the described top and bottom strands in its denatured (non-hybridized, single stranded) form and is further extended to separate compositions of top and bottom strands respectively that are intended to by combined to form the hybridized substantially double stranded nucleic acid adaptor described herein.

[0068]

[0063] The function of the fork part is to prevent self-ligation. By being not hybridized (double stranded) the chance of ligation on the 5’ end of X or the 3’ end of X’ is reduced. The fork part may further comprise functional groups at the 5’ end of X and / or the 3’ end of X’ to further prevent ligation and exonuclease activity, as described herein below in more detail. To reduce ligation (self-ligation or ligation to DNA present in the sample such as the target DNA (e.g. cfDNA)) the length of fork part (i.e. X and X’ respectively) should be at least 4 nucleotides, preferably at least 5 or 6 nucleotides, but may be longer, e.g. 20 or more nucleotides. Preferably X and X’ are individually between 6 and 12 nucleotides long. Since X and X’ are not hybridized their length does not need to be equal. So, for example X may be 6 nucleotides long and X’ may be 8 nucleotides long. Thus, in an embodiment each of X and X’ are independently 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long or longer.

[0069]

[0064] The body part of the adapter is defined by Y and Y’ in Figure 1 and comprises sequences of the forward and reverse strand that can hybridize and are substantially complementary to each other. The body part (Y and Y’) may comprises one or more of the following optional elements: a promoter sequence also indicated as P, the reverse complement of the promoter sequence being indicated as P’; a next generation sequencing handle, in the Figure RA5 - Illumina sequencing handle is used as an example to illustrate; a Unique Molecule Identifier (UMI) sequence, indicated as UMI in the forward strand (“U” in Figure 1) and UMI’ (“U”’ in Figure 1) in the reverse strand; and a barcode sequence, indicated as BC in the forward strand and having a reverse complement BC’ sequence in the reverse strand.

[0070]

[0065] In addition to these option parts the body part serves to form a double stranded (hybridized) structure allowing the ligation and amplification of target DNA such as cfDNA. The adapter should be double stranded when used so as to allow repeated transcription of the target DNA (preferably cfDNA) when ligated to the adapter. As the bulk of the adapter is comprised in the body part (Y and Y’), the sequences Y and Y’ should be mostly reverse complementary to allow hybridization. It is however envisioned that small parts of the sequence are not complementary, for example if an UMI sequence is present the UMI and UMI’ sequences are typically not reverse complementary.

[0071]

[0066] Depicted in Figure 1 as the right side of the adapter are the 3’ end of the top strand and the 5’ end of the bottom strand (Z and Z’ respectively). The 5’ end of Z’ (the bottom strand) is intended to be ligated to the target DNA and therefore is phosphorylated. The 3’ end of Z (the top strand) may comprise a functional group that prevents ligation of the nucleic acid adapter to other nucleic acids such as DNA present in the sample (e.g. cfDNA) or other adapters (self-ligation).

[0072]

[0067] Preferably the combined elements Y and Z have the same lengths as the combined elements Y’ and Z’, which is preferably at least 50 nucleotides and may be up to 150 nucleotides in length. Preferably the combined length of Y+Z or Y’+Z’ is between 55 and 120 nucleotides, more preferably between 60 and 100 or between 63 and 83 nucleotides. Thus for example the combined length of Y+Z or Y’+Z’ is 50, 52, 54, 56, 58, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 102, 104, 106, 108, 110, 1150, 120, 125, 130, 135, 140, 145, or 150 nucleotides long.

[0068] Thus, the adapter is designed such that only the 5’ end of the bottom strand (5’ of Z’) can ligate to another nucleic acid molecule. This essentially prevents self-ligation as it would necessitate 5’-5’ ligation, which is not catalyzed by commonly used ligases. Thus, the adapter can ligate to other nucleic acids present in a sample, such as preferably cfDNA present in a sample, for example a plasma sample.

[0073]

[0069] The inventors herein describe two modifications of the adapter that each individually have beneficial effects in at least preventing undesired ligation, for example self-ligation or ligation of target DNA at the wrong site of the adapter. The first of such modifications is a functional group present at the 3’ end of Z that prevents ligation of the nucleic acid adapter at the 3’ end of Z. The second modification comprises functional groups at both the 5’ end of X and the 3’ end of X’ which prevent ligation and exonuclease activity. In a preferred embodiment both modifications are present.

[0074]

[0070] It is envisioned that a double stranded target DNA (e.g. a cfDNA) is ligated on both ends of the target DNA to a nucleic acid adapter as depicted in Figure 7, allowing forward and reverse transcription of the target DNA from each ligated nucleic acid adapter. As the structure of the adaptor is such that only the 5’ end of the bottom strand can ligate to a target, ligation can occur between the 5’ end of a nucleic acid adaptor and a 3’ end of the forward or a 3’ end of the reverse strand of a target DNA. Thus, when fully ligated (meaning adapters are bound to both ends of the target DNA), the configuration must be always the same, namely a first nucleic acid adaptor bound at the 5’ end of the bottom strand to the 3’ end of the bottom strand of a target DNA, which is subsequently bound with its 3’ end of the top strand to a second adaptor’s 5’ end of it bottom strand. So, the second adaptor is “upside down” with respect to the first adaptor.

[0075]

[0071] Thus in an embodiment the invention describes a nucleic acid adapter that can be used in the ligation of cfDNA in a biological sample, preferably in a plasma sample, the nucleic acid adapter having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated.

[0076]

[0072] In an embodiment the invention describes a nucleic acid adapter, having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

[0073] In an embodiment the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated and wherein the 5’ end of X comprises a functional group that prevents ligation to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation to the 3’ end of X’.

[0077]

[0074] In an embodiment the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide. Preferably the functional group at the 3’ end of Z is a dideoxy (dd) nucleotide, for example ddA, ddC, ddG, or ddT.

[0078]

[0075] In an embodiment the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate. Preferably the functional group at the 5’ end of X is a dideoxy nucleotide, an inverted nucleotide or an inverted dideoxy nucleotide, more preferably an inverted dideoxy nucleotide, for example Inv-ddA, Inv- ddC, Inv-ddG, or Inv-ddT. Preferably the functional group at the 3’ end of X’ is a deoxynucleotide, an inverted nucleotide or an inverted deoxy nucleotide, more preferably an inverted deoxynucleotide, for example Inv-dA, Inv-dC, Inv-dG, or Inv-dT.

[0076] The invention provides novel nucleic acid adapters that are useful in the methods as disclosed herein. Thus, as indicated herein, it is an aspect of the invention to provide a nucleic acid adapter having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’; wherein the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0079]

[0077] In an embodiment, the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

[0080]

[0078] In an embodiment the functional group comprised at the 3’ end of Z is a modified nucleotide selected from an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide; and the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide selected from an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0081]

[0079] In an embodiment the functional group comprised at the 3’ end of Z is a modified nucleotide selected from an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide; and the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each both an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0082]

[0080] In an embodiment the functional group comprised at the 3’ end of Z is a dideoxy (dd) nucleotide, for example ddA, ddC, ddG, or ddT; and the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide selected from an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0083]

[0081] In an embodiment the functional group comprised at the 3’ end of Z is a dideoxy (dd) nucleotide, for example ddA, ddC, ddG, or ddT; and the 5’ end of X is an inverted dideoxy nucleotide, for example Inv-ddA, Inv-ddC, Inv-ddG, or Inv-ddT; and the 3’ end of X’ is an inverted deoxynucleotide, for example Inv-dA, Inv-dC, Inv-dG, or Inv-dT.

[0082] In an embodiment the functional group comprised at the 3’ end of Z is a ddC, ddG, or ddT ; and the 5’ end of X is an Inv-ddT ; and the 3’ end of X’ is an Inv-dT

[0083] It is contemplated that by introducing a modification in the 3’ end of Z creates a nick in the top strand to prevent linear amplification from extending into the DNA nucleic acid adapter ligated at the other end of the cfDNA molecule (5’ end of Z’). Referring to Figure 7, where in black a target DNA is shown which is ligated on both ends to an adapter as described herein. Due to the presence of 3’ end modifications in Z in both adapters, a nick is created at the 5’ends of the target DNA in both the top and bottom strands. This hemi-ligation configuration assures that the transcription from the promoter on the nucleic acid adapter into the cfDNA fragment creates a hybrid transcript that does not extend into the nucleic acid adapter ligated to the other end of the cfDNA molecule. With this design we assure that only the 5’ end of the transcript contains the sequencing handle (e.g. Illumina RA5) and optionally the UM I -Barcode sequence while the 3’ end remains intact for polyadenylation and subsequently the incorporation of a different sequencing handle (e.g. P7-lllumina) during cDNA conversion.

[0084]

[0084] In addition, the functional group introduced at the 3’ end of Z (top strand), e.g. ddC, prevents self-ligations (dimers) of the DNA nucleic acid adapter and only allows bottom strand ligation of the adapter to cfDNA.

[0085]

[0085] It is further contemplated that the functional group introduced at the 5’end of the top strand (X) and the 3’end of the bottom strand (X’) protect the nucleic acid adapter from exonuclease activity. These functional groups can also protect the nucleic acid adapter from spurious ligations.

[0086]

[0086] The adapter is a nucleic acid and is intended to be ligated to a target DNA, particularly a target cfDNA. Thus, the adapter consists of two strands of nucleotides. It is envisioned that the adapter may consist of or comprise of DNA (Deoxyribonucleic acid), RNA (Ribonucleic acid), unnatural or modified nucleotides including modified backbone nucleotides, inverted nucleotides, deoxyribonucleoside or dideoxynucleotides or combinations thereof. It is noted that in any case some of the nucleotides, namely the 5’ and 3’ nucleotide of the top strand and the 3’ nucleotide of the bottom strand are modified or unnatural nucleotides that do not allow ligation of a target DNA or adapter. In a preferred embodiment the adapter is substantially comprised of DNA.

[0087]

[0087] In an embodiment Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, a unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

[0088]

[0088] In an embodiment Y comprises a promoter P. As Y’ is substantially complementary to Y, Y’ consequently comprises a substantially reverse complement sequence P’. Preferably P’ is fully reverse complement to P. The promoter is oriented such that allows transcription of the bottom strand of the first nucleic acid adaptor into the target strand where transcription ends at the nick formed between the target DNA and the second nucleic acid adapter. Thus, the promoter is also oriented such that allows transcription of the bottom strand of the second nucleic acid adaptor into the target strand where transcription ends at the nick formed between the target DNA and the first nucleic acid adapter.

[0089]

[0089] The promoter may be any promoter suitable to allow in vitro transcription of a polynucleotide. Thus, preferably the promoter is recognized by an RNA polymerase. Non-limiting examples that may be used in the invention are a T7 promoter, a T3 promoter, a K11 promoter and a SP6 promoter, such promoters are particularly advantageous as they are very small in size, e.g. around 18 base pairs. The sequences of these promotes are depicted below. Thus, in an embodiment Y comprises a promoter sequence with a sequence selected from SEQ ID Nos 1-4 or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity, to a sequence selected from SEQ ID Nos 1-4.

[0090] SEQ ID NO: 1 - T7 TAATACGACTCACTATAG

[0091] SEQ ID NO: 2 - T3 AATTAACCCTCACTAAAG

[0092] SEQ ID NO: 3 - K11 AATTAGGGCACACTATAG

[0093] SEQ ID NO: 4 - SP6 ATTTACGACACACTATAG

[0094]

[0090] Next Y may comprise a sequencing adapter sequence. For example, when using the Illumina the RA5 sequencing adapter sequence may be used. The sequence is provided below. Y’ consequently comprises a sequence substantially reverse complementary, preferably fully reverse complementary, to the sequencing adapter sequence. Thus in an embodiment Y comprises a sequencing adapter sequence with a sequence selected from SEQ ID Nos 5-11 or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity, to a sequence selected from SEQ ID Nos 5-11 , or the reverse complement of a sequence selected from SEQ ID Nos 5-11 , or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity, to a sequence with the reverse complement of SEQ ID Nos 5-11.

[0095] SEQ ID NO: 5 - RA5 CAGAGTTCTACAGTCCGACGATC

[0096] SEQ ID NO: 6 - RA3 TGGAATTCTCGGGTGCCAAGG

[0097] SEQ ID NO: 7 - P5 AATGATACGGCGACCACCGAGATCTACAC

[0098] SEQ ID NO: 8 - P7 CAAGCAGAAGACGGCATACGAGAT

[0099] SEQ ID NO: 9 - Truseq single index library read 1 TCTTTCCCTACACGACGCTCTTCCGATCT

[0100] SEQ ID NO: 10 - Truseq dual index library read 1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT

[0101] SEQ ID NO: 11 - Truseq dual index library nextera read 1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[0102]

[0091] Thus in an embodiment the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, a Truseq single index library read 1 adapter sequence, Truseq dual index library read 1 adapter sequence, or a Truseq dual index library nextera read 1 adapter sequence.

[0092] It is understood that other sequencing technologies may be used and the sequencing adapter sequences used in the nucleic acid adapter may be chosen accordingly. For example, the described nucleic acid adapters are also suitable for long-read sequencing techniques such as but not limited to Nanopore sequencing.

[0103]

[0093] Further, Y may comprise a Unique Molecular Identifier. UMIs are complex indices added to sequencing libraries before any PCR amplification steps, enabling the accurate bioinformatic identification of PCR duplicates. UMIs are also known as “Molecular Barcodes” or “Random Barcodes”. The UMI is represented in Figure 1 by UMI in Y and UMI’ in Y’. The UMI’ sequence does not need to be reverse complement to the UMI sequence, thus UMI and UMI’ are generally not reverse complement. The UMI and UMI’ sequence are represented by multiple N where for each adapter the combination of UMI and UMI’ is unique, allowing for the identification of unique amplification fragments. UMI and UMI’ have the same length and may be 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides long, preferably between 3 and 8 nucleotides long, such as for example 4 nucleotides long.

[0104]

[0094] Further, Y may comprise a barcode (BC). The barcode differs from the UMI in that the same barcode is used within the same sample but the barcode is unique between samples, thus allowing the pooling of samples. The barcode can than be used to trace back the sequence to a specific sample. The barcode in Y (BC) is reverse complement to the BC’ in Y’. The barcode comprises randomly selected nucleotides. A specific example is provided in Figure 2, however it is understood that any sequence can be used and that the sequence is changed on a per sample basis. BC and BC’ should have the same length and may be 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long, preferably between 6 and 12 nucleotides long.

[0105]

[0095] In an embodiment Y comprises a promoter (P) sequence and one or more selected from a sequencing adapter sequence, a unique molecular identifier (UMI) sequence, and a barcode (BC) sequence. In such case the promoter is located upstream of the other optional elements (sequencing adapter sequence, UMI, BC), meaning that in Y, P is located 5’ with respect to the sequencing adapter sequence, UMI and BC (when present). Consequently, in Y’ P’ is located 3’ from the reverse complement of the sequencing adapter sequence, UMI’ and BC’ (when present). In this way the transcript transcribed from the promoter includes the optional elements if included.

[0096] In an embodiment Y comprises a promoter (P) sequence and a sequencing adapter sequence and one or more selected from, a unique molecular identifier (UMI) sequence, and a barcode (BC) sequence. In such case the promoter is located upstream of the sequencing adapter sequence, which in turn is located upstream of the other optional elements (UMI, BC), meaning that in Y, P is located 5’ with respect to the sequencing adapter sequence, which is located 5’ of UMI and BC (when present). Consequently, in Y’ P’ is located 3’ from the reverse complement of the sequencing adapter sequence, which is located 3’ of UMI’ and BC’ (when present). In this way when the sequencing adapter can be used as a handle sequence for PCR library prep and the entire P5 Illumina is introduced for sequencing. The UMI and BC, if present, are included in the amplification step.

[0106]

[0097] In a preferred embodiment Y comprises a promoter (P) sequence, a sequencing adapter sequence, a unique molecular identifier (UMI) sequence, and a barcode (BC) sequence. In a further preferred embodiment, the order of P, the sequencing adapter sequence, UMI and BC is from 5’to 3’: P - the sequencing adapter sequence - UMI - BC or P - the sequencing adapter sequence - BC- UMI. Consequently, the order in Y’ is from 3’to 5’: P’ - the reverse complement of the sequencing adapter sequence - UMI’ - BC’ or P’ - the reverse complement of the sequencing adapter sequence - BC’ - UMI’.

[0107]

[0098] A non limiting exemplary sequence for the nucleic acid adapter upper and lower strand is provided in Figure 2 and shown herein below with SEQ ID NOs: 12 and 13, wherein the upper and / or lower strand are modified as described herein. Thus in an embodiment the nucleic acid adapter has an upper strand sequence represented with SEQ ID NO: 12 wherein the 5’ end and the 3’ end of the upper strand are modified as described herein, or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with SEQ ID No 12 wherein the 5’ end and the 3’ end of the upper strand are modified as described herein. Thus in an embodiment the nucleic acid adapter has a lower strand sequence represented with SEQ ID NO: 13 wherein the 5’ end and the 3’ end of the lower strand are modified as described herein, or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with SEQ ID No 13 wherein the 5’ end and the 3’ end of the lower strand are modified as described herein. In an embodiment X in the nucleic acid adapter has a sequence GTGAC wherein the nucleotide is modified at the 5’ residue or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with GTGAC wherein the nucleotide is modified at the 5’ residue. In an embodiment X’ in the nucleic acid adapter has a sequence TGTGT wherein the nucleotide is modified at the 3’ residue or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with TGTGT wherein the nucleotide is modified at the 3’ residue. In an embodiment Y in the nucleic acid adapter has a sequence represented with SEQ ID NO: 14 or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with SEQ ID No 14. In an embodiment Y’ in the nucleic acid adapter has a sequence represented with SEQ ID NO: 15 or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with SEQ ID No 15. In an embodiment Z in the nucleic acid adapter has a sequence CAGATGA wherein the nucleotide is modified at the 3’ residue or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with CAGATGA wherein the nucleotide is modified at the 3’ residue. In an embodiment Z’ in the nucleic acid adapter has a sequence GTCATCT wherein the nucleotide is modified at the 5’ residue or a sequence with at least 80% sequence identity, preferably 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity with GTCATCT wherein the nucleotide is modified at the 5’ residue.

[0108] SEQ ID NO: 12 - nucleic acid adapter upper strand GTGACAGGCGGCCGCGAATTTAATACGACTCACTATAGGGAGAGTTCAGAGTTCTACAGTCCG

[0109] ACGAT CNNNNT GAGGCT AC AGAT GA

[0110] SEQ ID NO: 13 - nucleic acid adapter lower strand GTCATCTGTAGCCTCANNNNGATCGTCGGACTGTAGAACTCTGAACTCTCCCTATAGTGAGTC

[0111] GTATTAAATTCGCGGCCGCCTTGTGT

[0112] SEQ ID NO: 14 - Y

[0113] AGGCGGCCGCGAATTTAATACGACTCACTATAGGGAGAGTTCAGAGTTCTACAGTCCGACGAT

[0114] CNNNNTGAGGCTA SEQ ID NO: 15 - Y’

[0115] TAGCCTCANNNNGATCGTCGGACTGTAGAACTCTGAACTCTCCCTATAGTGAGTCGTATTAAA TTCGCGGCCGCCT

[0116] Compositions and kits

[0117]

[0099] The inventors further demonstrate that ligation efficiency of a sequencing adapter (e.g. the nucleic acid adapter described herein) to a target cfDNA in plasma can be greatly improved by introducing a blocker oligo, as shown in Figure 5 and corresponding Example 4.

[0118]

[0100] Therefore, in a second aspect the invention relates to a kit of parts or composition comprising a) a DNA adapter suitable for ligating to cfDNA, and b) a blocker oligonucleotide, wherein the blocker oligonucleotide is an oligonucleotide consisting or comprising of modified nucleotides.

[0119]

[0101] The inventors have found that the use of a blocker oligo greatly increase ligation efficiency of the nucleic acid adaptor to target DNA in plasma. Figure 5 describes the results of adding increasing concentrations of the blocker oligo, where efficiency plateaus at 6.8 pM. Without wishing to be bound by theory, it is hypothesized that by including an abundance of the blocker oligo in the ligation reaction prevents the proteins present in the plasma from sequestering or absorbing the cfDNA and the nucleic acid adapters, thereby making the cfDNA more available for ligation to the nucleic acid adapter. Although any nucleotide may be used, e.g. RNA or DNA, it was found that modified oligonucleotides are more efficient in binding plasma proteins. Therefore, in an embodiment the modified nucleotide comprises or is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide. In an embodiment the modified nucleotide comprises or consists of nucleotides with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’- Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, phosphorodiamidate, or combinations thereof. Further envisioned are oligos linked to other biomolecules such as but not limited to a peptide or a protein.

[0120]

[0102] It is theorized that the length of the blocker oligo is not relevant for its function. Therefore, the blocker oligo may for example be 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 34, 36, 38, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides. Preferably the blocker oligo has a length of 16 - 30 nucleotides. The blocker oligo may further comprise a range of size, meaning that not all oligos present have the same length. Thus, in an embodiment the mean length of the blocker oligo is between 8 and 100 nucleotides, preferably between 16-30 nucleotides.

[0121]

[0103] Further the sequence of the blocker oligo is not pertinent to its function and may be randomly selected. Thus, the blocker oligo is in essence a oligo or mixture of different oligos with an arbitrary size and sequence, which preferably comprise or consist of modified or artificial nucleotides, which are present in excess during ligation of a nucleic acid adapter to a target DNA in a sample rich in proteins, with the aim of preventing sequestering or absorbing of the target DNA and nucleic acid adapters by the proteins in the sample.

[0122]

[0104] In an embodiment the blocker oligo is comprised in a kit of parts. The blocker oligo may be present for example in a concentrated stock solution which can be added directly to a sample, e.g. a plasma sample, or can be combined with a nucleic acid adapter prior to adding to a sample. Alternatively, the blocker oligo may be provided in lyophilized form to be dissolved in a suitable buffer prior to adding to the sample or the nucleic acid adapter. Such buffer may further be included in the kit.

[0123]

[0105] In an embodiment the blocker oligo is comprised in a composition. For example, the composition may be a solution of the blocker oligo and a nucleic acid adapter. The composition may for example be provided with the concentrations of the blocker oligo and nucleic acid adapter taking into account their dilution factors when adding the composition to a sample. Further envisioned are lyophilized compositions of the blocker oligo and a nuclei acid adapter. For example, such lyophilized composition may be provided in a suitable container in which he sample is added for further processing, such as ligation of the adapter to the DNA comprised in the sample and subsequent sequencing.

[0124]

[0106] In an embodiment the DNA adapter is the DNA adapter as defined in in the first aspect of the invention. Thus in an embodiment the invention relates to a kit of parts comprising a) a nucleic acid adapter, having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’, and b) a blocker oligonucleotide, wherein the blocker oligonucleotide is an oligonucleotide consisting or comprising of modified nucleotides. In an embodiment the invention relates to a composition comprising a) a nucleic acid adapter, having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’, and b) a blocker oligonucleotide, wherein the blocker oligonucleotide is an oligonucleotide consisting or comprising of modified nucleotides.

[0125]

[0107] In an embodiment of the kit of parts or composition, in the nucleic acid adapter the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter, the 5’ end of Z’ is phosphorylated, the 5’ end of X comprises a functional group that prevents ligation to the 5’ end of X, and the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation to the 3’ end of X’.

[0126]

[0108] In another embodiment, in the nucleic acid adapter the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0127]

[0109] In another embodiment, in the nucleic acid adapter the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’- Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

[0128]

[0110] In another embodiment of the kit of parts or composition, the nucleic acid adapter is one having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’; wherein the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0129]

[0111] In another embodiment, in the nucleic acid adapter Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, an unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

[0112] In another embodiment, in the nucleic acid adapter the promoter is selected from a T7 promoter, a T3 promoter, a K11 promoter, or a SP6 promoter.

[0130]

[0113] In another embodiment, in the nucleic acid adapter the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, een Truseq single index library read 1 adapter sequence, een Truseq dual index library read 1 adapter sequentie, Truseq dual index library adapter sequence, or a Nextera read 1 adapter sequence.

[0131]

[0114] In an embodiment the kit further comprises DNA polymerase I, preferably DNA Polymerase I, Large (Klenow) Fragment which lacks 5’-3’ exonuclease but retains 3’- 5’ exonuclease activity.. The kit may further comprise suitable buffers for performing the enzymatic reactions, e.g. an end repair buffer and a ligation buffer. The kit may further comprise a suitable ligase, such as for example T4 DNA ligase, E coli ligase, mammalian ligase 1 , 3, or 4, or thermostable ligase. The kit may further comprise a suitable buffer for the provided ligase.

[0132]

[0115] In an embodiment the kit or composition further comprises an enzyme with polynucleotide 5'-hydroxyl-kinase activity (Polynucleotide Kinase; EC 2.7.1.78). Polynucleotide Kinase is an enzyme that catalyzes the chemical reaction

[0133] ATP + 5'-dephospho-DNA ADP + 5'-phospho-DNA

[0134] The enzyme may be used to ensure phosphorylated 5’ ends of the target DNA. An exemplary enzyme is T4 PNK. Additionally, T4 PNK has a 3’-Phos phosphatase activity which catalyze the removal of the Phosphate on the 3’-Phos ends into 3’-OH which is required for proper 5’Phos — 3OH ligation. This is also relevant since cfDNA can contain high fraction of 3’-Phos ends as a generated by Apoptosis (DNAse II). The kit may further comprise a suitable buffer for the Polynucleotide Kinase.

[0135]

[0116] In an embodiment the kit or composition further comprises an enzyme with polynucleotide adenylyl transferase activity (EC 2.7.7.19). Such enzymes are also referred to as poly(A) polymerase and catalyze the reaction add multiple adenosines residues to an RNA molecule. The enzyme may be used to perform poly-adenylation at the 3’- end of the derived transcript (after transcription using the promoter in the adaptor target DNA ligation product).

[0117] In an embodiment the kit of parts further comprises a Magnesium salt stock solution or wherein the composition comprises Magnesium salt. The inventors show that the inclusion of a Magnesium salt when ligating a nucleic acid adapter to a target DNA in the presence of interfering factors such as protein, e.g. in plasma, such efficiency can be increased by including a Magnesium salt such as MgCk. In particular in Figure 4 and Example 3 the inventors show that ligating in up to 50% poses no problem as indicated in by the darker smears in lanes 5, 6, 9, and 10 in Figure 4. However particularly at higher concentrations like 75% plasma ligation is impeded (lane 1) but this can be rescued by including a magnesium salt (lane 2).

[0136]

[0118] It was shown that a concentration of 5 mM achieves the desired effect, although it is hypothesized that slightly lower concentrations such as 2, 3, or 4 mM would achieve the same. Thus, in an embodiment the kit comprises a magnesium salt stock solution in concentrated form. That is that solution is concentrated such that upon adding it to a sample (e.g. plasma) and adding a nucleic acid adapter and optionally other components, the magnesium salt is diluted to reach a concentration of at least 2 mM, preferably 3, 4, 5, 6, 7, 8, 9, 10 mM or more. For example, it may be a 10x stock solution intended to be diluted by a factor 10 and thus having a concentration of 20 mM, preferably 30, 40, 50, 60, 70, 80, 90, 100 mM or more. It is appreciated that the stock solution does not need to be a 10x solution and may for example also be a 2x, 5x 20x, 50x or 100x solution.

[0137]

[0119] In an embodiment the composition has a concentration such that upon ligation a concentration is reached of at least 2 mM, preferably 3, 4, 5, 6, 7, 8, 9, 10 mM or more. Thus, if the composition is a composition comprising the nucleic acid and the magnesium salt and ligase and optionally other components, which is to be added to a sample to a final sample concentration of 75% (thus one part of composition to three parts sample) the concentration of the magnesium salt should thus be 8, 12, 16, 20, 24, 28, 32, 36, or 40 mM or more. In case different dilution factors are envisioned the concentration is calculated accordingly. In case the composition already includes all components including the sample, and thus does not need further dilution, the concentration of the magnesium salt is thus 2 mM, preferably 3, 4, 5, 6, 7, 8, 9, 10 mM or more.

[0138]

[0120] The examples use MgCl2 as a magnesium salt, however it is understood that the presence of Mg2+ions in the ligation reaction are driving the effect, and thus other magnesium salts can be used instead. Therefore, in an embodiment the magnesium salt in the kit or composition is selected from MgCl2, magnesium acetate, MgSC , Magnesium borate, magnesium bromide, magnesium carbonate, magnesium citrate, magnesium fluoride, magnesium hydroxide, magnesium gluconate, magnesium nitrate, magnesium oxalate, or magnesium phosphate, preferably selected from MgCl2, magnesium acetate, MgSC .

[0139] Methods for preparing a DNA sample

[0140]

[0121] The inventors herein show that ligation of the nucleic acid adapter can be further improved, particularly in plasma, be treating the nucleosomes (cfDNA bound to histones) with DNA polymerase I, preferably DNA Polymerase I, Large (Klenow) Fragment as it lacks 5-3 exonuclease but retains 3-5 exonuclease activity, to fill in protruding 5’ single stranded ends and to remove 3’ single stranded ends to create blunt ended cfDNA. This is shown in Figure 6 and Example 5.

[0141] In a third aspect the invention relates to a method of preparing a cfDNA sample, the method comprising proving a sample comprising cfDNA, preferably wherein the sample is a biological sample blunting the cfDNA in the sample to obtain blunt-ended cfDNA, introducing the nucleic acid adapter as defined in the first aspect of the invention in the sample, and ligating the DNA adapter Z’ 5’ end to the blunt-ended cfDNA to obtain a cfDNA-adapter ligation product.

[0142]

[0122] In an embodiment of the method, in the nucleic acid adapter the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated, and wherein the 5’ end of X comprises a functional group that prevents ligation to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation to the 3’ end of X’.

[0143]

[0123] In another embodiment of the method, in the nucleic acid adapter the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3- spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0144]

[0124] In yet another embodiment of the method, in the nucleic acid adapter the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O- methyl, 2’-Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

[0145]

[0125] In another embodiment of the method of preparing a cfDNA sample, the nucleic acid adapter is one having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’; wherein the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0146]

[0126] In another embodiment, in the nucleic acid adapter Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, an unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

[0147]

[0127] In yet another embodiment, in the nucleic acid adapter the promoter is selected from a T7 promoter, a T3 promoter, a K11 promoter, or a SP6 promoter.

[0128] In another embodiment, in the nucleic acid adapter the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, een Truseq single index library read 1 adapter sequence, een Truseq dual index library read 1 adapter sequentie, Truseq dual index library adapter sequence, or a Nextera read 1 adapter sequence.

[0148]

[0129] In an embodiment step d) of the method of preparing a cfDNA is performed in the presence of the blocker oligonucleotide as defined in the second aspect of the invention.

[0149]

[0130] In an embodiment at least 5 mM of a magnesium salt is added before or during step b), step c) or step d), preferably between 5 and 25 mM of a magnesium salt is added. It is understood that the concentration refers to the final concentration in the ligation mixture. In an embodiment the magnesium salt in the kit or composition is selected from MgCl2, magnesium acetate, MgSC , Magnesium borate, magnesium bromide, magnesium carbonate, magnesium citrate, magnesium fluoride, magnesium hydroxide, magnesium gluconate, magnesium nitrate, magnesium oxalate, or magnesium phosphate, preferably selected from MgCl2, magnesium acetate, MgSC .

[0150]

[0131] It is further shown that further addition of a Polynucleotide Kinase, which produces phosphorylated 5’ ends, contributes to ligation efficiency. Without wishing to be bound by theory is thought that adding a Polynucleotide Kinase facilitates ligation into nucleosomes, but also plays a role in protecting the nucleic acid adapters from any enzymatic activity of the end-repair process that likely stays active during the ligation step. This ensures that the nucleic acid adapters remain in the intended condition for efficient ligation into nucleosomes.

[0151]

[0132] Therefore, in an embodiment the method further comprises a step of treating the blunt-ended cfDNA with a polynucleotide kinase to obtain blunt-ended cfDNA with phosphorylated 5’ ends. A non-limiting example of a polynucleotide kinase is T4 PNK.

[0152]

[0133] It may further be beneficial to add protease inhibitors during the method to protect the histones bound to cfDNA from being degraded by proteases. Therefore, in an embodiment the method comprises a step of adding protease inhibitors prior to or during step a), b), c), or d).

[0153]

[0134] The ligated nucleic acid adaptor cfDNA product allows further processing for next generation sequencing techniques. In addition, it allows for sample enrichment based on the attached histones by Chromatin immunoprecipitation or analysis of epigenetic markers or histone modifications by multiplexing Antibodies by barcode Identification (MAblD). MAblD employs antibody-DNA conjugates to integrate barcodes at the genomic location of the epitope, enabling combined incubation of multiple antibodies to reveal the distributions of many epigenetic markers simultaneously, and can be used to profile major chromatin types and multiplexed measurements without loss of individual data quality (see WO 2023 / 085928 and Lochs et al. Nat Methods 21 , 72-82 (2024); both incorporated by reference in its entirety). Thus, in an embodiment the method further comprises the step of performing Chromatin immunoprecipitation (ChIP) or Multiplexing Antibodies by barcode Identification (MAblD) of the cfDNA-adapter ligation product.

[0154]

[0135] In an embodiment the method further comprising a step of transcribing the cfDNA-adapter ligation product to obtain a forward and a reverse transcript. As described in the Examples below the promoter of the ligated adaptor-target DNA product can be used to transcribe the target DNA. It is expected that most target DNA will be ligated to a nucleic acid adapter on both sides, allowing transcription of both the forward and reverse (upper and lower) strand of the target DNA, e.g. the cfDNA. As transcription will terminate at the nick created between the 5’ end of the bottom strand of the target DNA and the 3’ end of the ligated second nucleic acid adapter (see Figure 7), the transcript will typically include any elements included in the first nucleic acid adaptor at the 5’ of the transcript. Such elements may include a sequencing handling sequence, a UMI and a barcode, which all serve for further processing the transcript for sequencing using NGS technology (such as for example Illumina NGS).

[0155]

[0136] In an embodiment the method further comprises performing polyadenylation at the 3’ end of the forward and reverse transcripts. Such step can be performed by contacting the transcripts with a polynucleotide adenylyl transferase. This enzyme possess strong affinity for RNA and high specificity for the polymerization at the 3’- end of the molecules. Once the poly(A) tail is incorporated, it creates a complementary sequence for an oligo(dT) primer used during cDNA conversion and which may contain a sequencing handle, for example Illumina P7. Thus, in a further step the method comprises a reverse transcription step using an oligo-dT primer with a sequencing handle on the polyadenylated transcript to obtain a single stranded DNA reverse transcript which includes a sequencing handle. In an embodiment the sequencing handles in the reverse transcript are used for a library preparation. In an embodiment the prepared library is subjected to next generation sequencing to obtain sequencing reads. Thus, in an embodiment the method comprising a step of determining the sequence of the cfDNA, the forward transcript or the reverse transcript.

[0156]

[0137] As described herein the use of a barcode allows for pooling of multiple samples. Therefore, in an embodiment the method further comprises a step of pooling (also referred to as multiplexing) multiple samples after step d), preferably wherein the ligation reaction is stopped prior to pooling the multiple samples. For example 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 15, 20, 30, 40, 50, 60, 70, 80, 90,100 or more samples may be pooled. When pooling samples a unique barcode is selected for each sample. Thus for each sample nucleic acid adapters are selected such that they have the same but unique (between samples) barcode to distinguish between different samples and many unique UMIs within the same sample to distinguish between different target DNAs. To prevent cross-reacting of non-bound nucleic acid adapters, it is preferred that the ligation reaction is stopped before pooling of samples. The ligation reaction may be stopped be removing unbound nucleic acid adapter or by inactivating the ligase. For example the ligase can be inactivated by addition of EDTA or EGTA in a final concentration of 20 mM, preferably 30 mM or 40 mM or more. Thus, in an embodiment the ligation reaction is stopped by the addition of EDTA or EGTA. Preferably EDTA or EGTA is added to a final concentration of 20 mM or more, preferably 30 mM, or 40 mM or more.

[0157] Methods for treating cfDNA comprising samples

[0158]

[0138] The inventors further found that the blocker oligo described herein may further be useful in protecting cfDNA present in protein rich samples such as plasma and prevent DNA adapters from being sequestered and / or absorbed by the highly abundant proteins, such as plasma proteins.

[0159]

[0139] Therefore, in a fourth aspect the invention relates to a method for treating a cfDNA comprising sample with a blocker oligonucleotide, the method comprising adding the blocker oligonucleotide as defined in the second aspect of the invention to a sample comprising cfDNA, preferably wherein the sample is a biological sample, more preferably comprises plasma.

[0140] In an embodiment the method further comprises ligating a nucleic acid adapter suitable for ligating to cfDNA to the cfDNA in the sample. In an embodiment, the nucleic acid adapter is the adapter as defined in the first aspect of the invention, having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein:

[0160] - X and X’ represent a sequence of nucleotides which are substantially not complementary to each other,

[0161] - Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and

[0162] Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and

[0163] - wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

[0164]

[0141] In an embodiment, in the nucleic acid adapter the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated and wherein the 5’ end of X comprises a functional group that prevents ligation to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation to the 3’ end of X’.

[0165]

[0142] In another embodiment, in the nucleic acid adapter the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0166]

[0143] In yet another embodiment, in the nucleic acid adapter the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’- Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

[0167]

[0144] In another embodiment, the nucleic acid adapter is one having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ -X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’; wherein the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

[0168]

[0145] In another embodiment, in the nucleic acid adapter Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, a unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

[0169]

[0146] In yet another embodiment, in the nucleic acid adapter the promoter is selected from a T7 promoter, a T3 promoter, a K11 promoter, or a SP6 promoter.

[0170]

[0147] In another embodiment, in the nucleic acid adapter the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, een Truseq single index library read 1 adapter sequence, een Truseq dual index library read 1 adapter sequentie.Truseq dual index library adapter sequence, or a Nextera read 1 adapter sequence.

[0171]

[0148] In a preferred method or use according to the invention disclosed herein, the sample comprising the cfDNA is a biological sample, preferably a biological sample obtained from an organism. In a preferred method or use according to the invention disclosed herein, the sample comprising the cfDNA is a biological sample comprising protein. In a preferred method or use according to the invention disclosed herein, the cfDNA is not isolated or extracted from said biological sample. In a particular preferred embodiments, the sample comprising the cfDNA is plasma or blood, preferably plasma. In a in particular preferred embodiments the sample comprising the cfDNA is plasma.

[0172]

[0149] Although exemplified herein using cfDNA, the methods used herein are equally applicable to any DNA and can be performed for the ligation of any DNA present in the biological sample. The skilled person would therefor understand that all these embodiments referring to cfDNA are likewise applicable to any other DNA present in a sample, preferably biological sample, preferably plasma.

[0173]

[0150] Therefor, in an analogous manner as described herein for cfDNA, there is disclosed herein a method of preparing a DNA sample, the method comprising proving a sample comprising DNA, preferably wherein the sample is a biological sample, preferably plasma; blunting the DNA in the sample to obtain blunt-ended cfDNA; introducing the nucleic acid adapter as defined in the first aspect of the invention in the sample; and ligating the DNA adapter Z’ 5’ end to the blunt-ended DNA to obtain a DNA-adapter ligation product.

[0174]

[0151] Therefor, in an analogous manner as described herein for cfDNA, there is disclosed herein a method for treating a DNA comprising sample with a blocker oligonucleotide, the method comprising adding the blocker oligonucleotide as defined in the second aspect of the invention to a sample comprising DNA, preferably wherein the sample is a biological sample, more preferably comprises plasma, preferably further comprising ligating a nucleic acid adapter suitable for ligating to DNA to the DNA in the sample, wherein the adapter in, preferably, the adapter as defined in the first aspect of the invention.

[0175]

[0152] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art (including the contents of the references cited herein), readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein.

[0176]

[0153] All references cited herein, including journal articles or abstracts, published or corresponding patent applications, patents, or any other references, are entirely incorporated by reference herein, including all data, tables, figures, and text presented in the cited references. Additionally, the entire contents of the references cited within the references cited herein are also entirely incorporated by references.

[0177]

[0154] It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein, in combination with the knowledge of one of ordinary skill in the art.

[0178]

[0155] It will be understood that all details, embodiments, and preferences discussed with respect to one aspect of embodiment of the invention is likewise applicable to any other aspect or embodiment of the invention and that there is therefore not need to detail all such details, embodiments, and preferences for all aspect separately.

[0179]

[0156] Having now generally described the invention, the same will be more readily understood through reference to the following examples which is provided by way of illustration and is not intended to be limiting of the present invention. Further aspects and embodiments will be apparent to those skilled in the art.

[0180] EXAMPLES

[0181] Example 1 - Prevent the nucleic acid adapter from ligating to each other (instead of to the cfDNA) and form dimers.

[0182]

[0157] The nucleic acid adapter contains a specific DNA modification at the 3’end in the top strand. In this example the modification is a dideoxycytidine (3’Dideoxy-C; ddC), however it is understood that the modification may also be dideoxyadenosine (3’Dideoxy-A; ddA), dideoxyguanidine (3’Dideoxy-G; ddG) or dideoxythymidine (3’Dideoxy-T; ddT). This modification prevents self-ligations (dimers) of the nucleic acid adapter and only allows bottom strand ligation of the adapter to cfDNA. The adapter design is schematically represented in figure 1. It is further considered that other type of nucleotide modifications or additional molecules attached to the nucleotides that prevent DNA ligation from the 3’-end in the top strand can also be used as part of this invention, such as, but not limited to: 3’ inverted dT (3lnvdT); 3’ C3 Spacer (3SpC3), among others.

[0183] Example 2 - Protecting the nucleic acid adapter from exonuclease activity in the plasma.

[0184]

[0158] To protect the nucleic acid adapter from exonuclease activity a second pair of modifications is used at the forked side of the adapter. In the example the bottom strand has a 3’lnverted dt (3lnvdT) a (Fig. 1). In addition the top strand has a 5’lnverted dideoxy T (5lnvddT). These modifications can protect the nucleic acid adapter from spurious ligations. It is expected that other modification to the nucleotides that constitute the forked part of the adapter may be used. Those modifications include but are not limited to modified backbones such as phosphothioate bonds (PS) in the forked part of the nucleic acid adapters in one or both strands, 3’inverted dA, 3’inverted dC or 3’inverted dG in the bottom strand and / or 5’inverted dideoxy-A, 5’inverted dideoxy- C, or 5’inverted dideoxy-G at the top strand.

[0185] Example 3 - Establishing optimal conditions for ligating DNA molecules in plasma.

[0186]

[0159] We have successfully established conditions for an efficient ligation of nucleic acid adapters into DNA fragments within plasma samples. Initially, we explored the maximum permissible concentration of plasma in combination with ligation buffer and commercial T4 Ligase, identifying that ligation of our nucleic acid adapters in samples containing high plasma concentrations (approximately 75%) was only achievable upon the addition of MgCl2 at a concentration of 5 mM or higher (Fig. 4; lane 2). This may be due to the chelating agent EDTA, present in the plasma collection tubes (VACUETTE EDTA tubes) commonly used for blood collection. The presence of EDTA may inhibit ligation efficiency in the absence of excess Mg2+. Subsequent dilution of the plasma to 50% in the sample mix enabled ligation of the nucleic acid adapters independent of MgCl2 supplementation.

[0187]

[0160] Our discovery of the necessity of MgCl2 supplementation for efficient ligation in plasma-rich samples constitutes a significant advancement. It is anticipated that the addition of any quantity of MgCl2 resulting in improved ligation efficiency, beyond the specific concentration tested herein. Furthermore, it was found that ligation reactions with plasma constituting 50% or less favored nucleic acid adapter ligation even without MgCl2 supplementation. Nevertheless, we have extended the application of MgCl2 (final concentration of 10 mM) to all plasma-containing ligation mixes, ensuring consistent and robust ligation across different sample compositions.

[0188] Example 4 - Prevent the abundance of proteins in plasma from sequestering / absorbing our nucleic acid adapter and thereby preventing ligation to cfDNA.

[0189]

[0161] The DNA adapters are protected from being sequestered / absorbed by the highly abundant plasma proteins. In this example a single DNA oligo is added (in high excess) constituted entirely by nucleotides connected by phosphothioate bonds (PS) to "saturate" the plasma proteins. It is understood that other modifications may be used. We called this ‘blocker oligo’, also referred herein as plasma blocker oligo (Fig. 5A). The blocker oligo is 20 PS-nucleotides long, it was ordered from IDT (Integrated DNA Technologies) and resuspended to 100 pM in 10 mM Tris (pH 7.4).

[0190]

[0162] To establish the potential benefit for the ligation of our nucleic acid adapters into nucleosomes, we pre-treat the ligation mixes containing plasma with different amounts of plasma blocker oligo before the addition of our nucleic acid adapters. The pre-treatment of plasma with the plasma blocker oligo (Fig. 2A) significantly improves ligation of the nucleic acid adapter to blunt-ended cfNucleosomes (Fig. 2B). From <25% ligation efficiency without the blocker to -100% ligation efficiency with 6,8 pMol blocker (and higher concentrations). The use of this PS-modified oligos has been extensively described for oligo anti-sense therapeutics (Gaus H. et al., 2019. NAR. 47(3): 1110-1122; Crooke S. et al., 2020. NAR. 48(10): 5235-5253). The application of PS-modified oligonucleotides to prevent / reduce the affinity of proteins for exogenous DNA adapters in plasma has not been described previously to our knowledge. The use of this types of DNA oligos as a blocker in plasma to favor ligation constitutes our invention. The amounts of oligos used rank from 670 pM to 11.33 pM but any other amount of blocker oligo is expected to improve ligation efficiency therefore should be considered as part of our invention.

[0191]

[0163] It is anticipated that other modifications in the blocker oligos, such as but not limited to 3’-lnvdT (3’ inverted dT), 3’-lnvdA (3’ inverted dA), 3’-lnvdC (3’ inverted dC), or 3’-lnvdG (3’ inverted dG) or other backbone modifications, lead to the same effect. It is hypothesized that the blocking effect of the oligo is primarily sequence- and lengthindependent. Thus, any other sequences and lengths of oligos are anticipated to have the same benefit.

[0192] Example 5 - Create conditions to end repair the cfDNA ends (highly variable) in plasma to create uniform blunt ends.

[0193]

[0164] We perform end-repair of cfDNA (nucleosomes) in plasma since it has been described that cfDNA ends are largely jagged (Jiang P. et al., 2020. Genome Res. 30: 1144-53). We use DNA polymerase I, Large (Klenow) Fragment to fill in protruding 5’ ssDNA ends and to remove extruding 3’- ssDNA ends to create blunt ends (Fig. 6A). We combine this end-repair with a kinase (T4 Polynucleotide Kinase; T4 PNK) to ensure phosphorylated 5’- ends in the cfNucleosomes. We decided to test end-repair by using mononucleosomes from Epicypher, which are derived from MNase A-treated HeLa cells, producing jagged-end mononucleosomes and exhibiting a particular phosphorylated configuration that is non-compatible for ligation (3’-Phos; 5’-OH; Harkins K. et al., 2020. Nucleic Acids Research, Volume 48, Issue 8, Page e47). These type of highly variable DNA ends can be also fixed by the already mentioned repair enzymes.

[0194]

[0165] Importantly, the modifications present in our nucleic acid adapters serve a dual purpose. Not only do they facilitate subsequent ligation into nucleosomes, but they also play a crucial role in protecting the nucleic acid adapters from any enzymatic activity of the end-repair process that likely stays active during the ligation step. This ensures that the nucleic acid adapters remain in the intended condition for efficient ligation into nucleosomes. In our experimental design, the forked side of the nucleic acid adapter is strategically blocked from end-repair processes by the presence of 3’- InvdT modifications. These modifications effectively prevent the enzymatic repair of DNA ends in this region. Additionally, at the blunt end of the nucleic acid adapter, the 3’ end is blocked with ddC to inhibit extension by repair enzyme. This targeted blocking ensures that the nucleic acid adapter remains intact and functional, preserving its ability to ligate into nucleosomes without interference from end-repair processes.

[0195]

[0166] End-repair of cfNucleosomes (HeLa mononucleosomes, Epicypher) is performed by preparing plasma mixes containing plasma, Hela mononucleosomes, end-repair buffer (NEB, B6052S), MgCI2, DNA polymerase I, Large (klenow) Fragment and T4 PNK. The mix is incubated for 20 min at 25 °C. To evaluate the formation of blunt-ends in the cfNucleosomes we performed Nucleic acid adapter ligation in the end-repair mixes as follows: The reaction is complemented with blocker oligo, incubated 5 min at RT and supplemented with Nucleic acid adapters, ligation buffer and T4 DNA ligase (Roche) and incubated 16 hours (or overnight) at 16 °C. DNA is purified from plasma mixes by adding Proteinase K (PK), 0.6 % of SDS, 150 mM NaCI2 for 4-6 h at 56 °C. Samples are mixed with one volume of Phenol / Chloroform, centrifugated and the aqueous phase separated for ethanol precipitation in the presence of Glycogen. DNA is quantified 70 % EtOH washed and loaded in a HS DNA chip for its analysis in 2100 Bioanalyzer.

[0196]

[0167] Figure 6 illustrates that the ligation of our nucleic acid adapter into HeLa nucleosomes shows a substantial improvement when HeLa mononucleosomes were treated with the reaction mix in plasma. In cases where no repair treatment was applied, we observed a detectable ligation of only one nucleic acid adapter per ligated nucleosome, whereas in the repair sample, both single and double ligations of nucleic acid adapters per ligated nucleosome were evident (Figs 6B-C). In the repair samples, we also observed the formation of higher-than-expected ligation products. We interpret these as events of nucleosome-to-nucleosome and nucleic acid adapter ligation (Fig. 6C). Importantly, the efficient ligation of nucleic acid adapters once the nucleosomes are properly blunt-ended confirms that the modifications present in our nucleic acid adapters (Fig. 1 , 2) actively protect them from enzymatic activities in plasma and, notably, from the repair mix. We have implemented a method for repairing DNA jagged ends in plasma for the creations of blunt ends compatible for ligation with our barcoding adapters.

[0197] Example 6 - Design of the nucleic acid adapter to create a nick in the top strand to prevent linear amplification from extending into the nucleic acid adapter ligated at the other end of the cfDNA molecule.

[0198]

[0168] Our adapter is designed in a way that only allows ligation of the 5’-phos end bottom strand of the adapter into the 3’-OH end of the cfDNA (nucleosomes). This leaves a nick in between the 3’-ddC in the adapter and the 5’-Phos end of the cfDNA. This hemi-ligation configuration assures that the transcription from the T7 promoter on the nucleic acid adapter into the cfDNA fragment creates a hybrid transcript that does not extend into the nucleic acid adapter ligated to the other end of the cfDNA molecule (Fig. 7). With this design we assure that only the 5’ end of the transcript contains the Illumina P5 handle (Illumina RA5) and the UMI-Barcode sequence while the 3’ end remains intact for polyadenylation and subsequently the incorporation of the handle for P7-illumina during cDNA conversion.

[0199]

[0169] We conducted an experiment to validate our design by performed end-repair of HeLa nucleosomes followed by nucleic acid adapter ligation (both in plasma) and on the purified material we performed in vitro transcription. The formation of nucleosomes containing single and double nucleic acid adapters was confirm on DNA bioanalyzer (not shown). Figure 7B, demonstrates that the size of the RNA matches the expected length of a hybrid transcript (200 nt = Illumina RA5-UMI-BC-Genome) and confirms that the nicks prevent transcription extension from one nucleic acid adapter to another at the opposite end even in a configuration where the cfNucleosomes had incorporated the Nucleic acid adapters in both ends.

[0200] Example 7 - Poly-adenylation at the 3’- end of the nucleic acid adapter cfDNA hybrid transcript (T7-IVT) for Illumina library prep.

[0201]

[0170] We perform poly-adenylation at the 3’- end of the derived transcript (T7-IVT) using E. coli Poly(A) Polymerase (NEB). This enzyme possess strong affinity for RNA and high specificity for the polymerization at the 3’-end of the molecules. Once the poly(A) tail is incorporated, it creates a complementary sequence for our designed oligo(dT) primer used during cDNA conversion and contains a nucleic acid adapter sequence for Illumina P7 (Fig. 8). We have established experimental conditions where variable amounts of IVT-derived RNA can be efficiently poly-adenylated and the length of the poly(A) tails is modulated by be incubation time (Fig. 8, RNA bioanalyzer- right panel).

[0202]

[0171] After performing Poly(A) tailing of the transcripts, we conducted retro- transcription using RT enzymes such as SuperScript II and IV (Invitrogen), M-MLV (Invitrogen), and Maxima (Thermo Scientific), all yielding similar results. Following the RT reaction, RNA molecules, especially RNA-DNA hybrids, were degraded using a mix of RNase H and RNase A to ensure no free oligo (dT) was carried over to interfere with library prep PCR. After the RNases treatment, bead cleanup was performed and library preparation was carried out using the TruSeq Small RNA library prep kit from Illumina.

[0172] The Illumina sequencing results showed that our strategy yields nearly a 100% correctly ligated nucleic acid adapters to cfDNA in blood plasma (Fig. 9A). We analyzed the levels of sample complexity retained under our entire methodology by calculating the percentage of unique reads (deduplicated) observing that all libraries yielded high percentage of unique genomic events (Fig. 9B). Read distribution of mapped reads shows homogenous coverage over human genome (Fig. 9C).

[0203]

[0173] In conclusion, we have developed a highly efficient method for ligating nucleic acid adapters into DNA fragments in plasma samples. The introduction of these nucleic acid adapters presents an opportunity to incorporate barcode-indexes into the DNA present in plasma, with the intention, among others, of pooling tens to hundreds of samples together into a single reaction for downstream procedures. The entire strategy is summarized in Figure 10.

[0204]

[0174] We have engineered a nucleic acid adapter harboring a series of specific DNA modifications that serve a double function (Fig. 10A): 1) they favor the ligation to the desired DNA molecules present in plasma and prevent their dimerization, and 2) our nucleic acid adapters are 'blocked' from the action of the end-repair enzyme employed in the initial steps of our invention. We have introduced an end-repair step to homogenize the type of ends present in the cfNucleosomes in plasma (Fig. 10B). Furthermore, we have developed a highly efficient ligation reaction in plasma by optimizing the reaction conditions, including increasing MgCI2 concentrations, performing end-repair of cfNucleosomes, and by protecting our nucleic acid adapters with an oligo blocker from being absorbed / sequestered by plasma proteins (Fig. 10C). Finally, we have established an efficient and non-biased method to amplify our barcoded nucleosomes using T7-IVT transcription in a linear manner coupled with a poly(A) tailing reaction to target the 3’ end of the transcripts (Fig. 10D). This strategy allows the use of standard library prep technologies such as (but not limited to) Illumina TruSeq. Overall, our method provides a robust and versatile approach for DNA barcoding in plasma samples, with potential applications in various research and clinical settings.

[0205]

[0175] Having now fully described this invention, it will be appreciated by those skilled in the art that the same can be performed within a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation.

[0176] Reference to known method steps, conventional methods steps, known methods or conventional methods is not in any way an admission that any aspect, description, or embodiment of the present invention is disclosed, taught, or suggested in the relevant art.

Claims

CLAIMS1. A nucleic acid adapter, having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’; wherein the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

2. The nucleic acid adapter according to the preceding claim, wherein the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modifiednucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’- Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

3. The nucleic acid adapter according to any one of the preceding claims wherein Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, an unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

4. The nucleic acid adapter according to claim 3 wherein the promoter is selected from a T7 promoter, a T3 promoter, a K11 promoter, or a SP6 promoter.

5. The nucleic acid adapter according to claim 3 or 4, wherein the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, een Truseq single index library read 1 adapter sequence, een Truseq dual index library read 1 adapter sequentie, Truseq dual index library adapter sequence, or a Nextera read 1 adapter sequence.

6. A kit of parts or composition comprising: a) a nucleic acid adapter suitable for ligating to cfDNA, and b) a blocker oligonucleotide, wherein the blocker oligonucleotide is an oligonucleotide consisting or comprising of modified nucleotides, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or a wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’- Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate, or combinations thereof.

7. Kit of parts or composition according to claim 6 wherein the nucleic acid adapter is a nucleic acid adapter having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein: a) X and X’ represent a sequence of nucleotides which are substantially not complementary to each other, b) Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, and c) Z and Z’ represent a sequence of nucleotides which are substantially complementary to each other, and d) wherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

8. The kit of parts or composition according to any one of the previous claims, wherein in the nucleic acid adapter the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated and wherein the 5’ end of X comprises a functional group that prevents ligation to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation to the 3’ end of X’.

9. The kit of parts or composition according to any one of the previous claims, wherein in the nucleic acid adapter the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide,a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

10. The kit of parts or composition according to any one of the previous claims, wherein in the nucleic acid adapter the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

11. The kit of parts or composition according to any one of the previous claims, wherein in the nucleic acid adapter Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, an unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

12. The kit of parts or composition according to any one of the previous claims, wherein in the nucleic acid adapter the promoter is selected from a T7 promoter, a T3 promoter, a K11 promoter, or a SP6 promoter.

13. The kit of parts or composition according to any one of the previous claims, wherein in the nucleic acid adapter the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, een Truseq single index library read 1 adapter sequence, een Truseq dual index library read 1 adapter sequentie, Truseq dual index library adapter sequence, or a Nextera read 1 adapter sequence14. Kit of parts or composition according to the previous claims further comprising a DNA polymerase I, preferably a polymerase which lacks 5’-3’ exonuclease but retains 3’-5’ exonuclease activity, more preferably Polymerase I Large (Klenow) Fragment.

15. Kit of parts or composition according to any one of the previous claims , wherein the kit of parts further comprises a magnesium salt stock solution or wherein the composition comprises a magnesium salt, preferably wherein the magnesium salt is selected from MgCL, magnesium acetate, MgSO4, Magnesium borate, magnesium bromide, magnesium carbonate, magnesium citrate, magnesium fluoride, magnesium hydroxide, magnesium gluconate, magnesium nitrate, magnesium oxalate, or magnesium phosphate.

16. A method of preparing a cfDNA sample, the method comprising a) proving a sample comprising cfDNA, preferably wherein the sample is a biological sample b) blunting the cfDNA in the sample to obtain blunt-ended cfDNA, c) introducing a nucleic acid adapter in the sample, and d) ligating the DNA adapter Z’ 5’ end to the blunt-ended cfDNA to obtain a cfDNA-adapter ligation product; wherein the nucleic acid adapter is one having a forward and a reverse nucleic acid strand, wherein the forward nucleic acid strand consists of the structure 5’ - X - Y - Z - 3’ and the reverse nucleic acid strand consists of the structure 3’ - X’ - Y’ - Z’ - 5’, wherein:X and X’ represent a sequence of nucleotides which are substantially not complementary to each other,Y and Y’ represent a sequence of nucleotides which are substantially complementary to each other, andZ and Z’ represent a sequence of nucleotides which are substantially complementary to each other, andwherein the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated; and / or wherein the 5’ end of X comprises a functional group that prevents ligation of another nucleic acid to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation of another nucleic acid to the 3’ end of X’.

17. The method according to the previous claim, wherein in the nucleic acid adapter the 3’ end of Z comprises a functional group that prevents self-ligation of the nucleic acid adapter and wherein the 5’ end of Z’ is phosphorylated and wherein the 5’ end of X comprises a functional group that prevents ligation to the 5’ end of X, and wherein the 3’ end of X’ comprises a functional group that prevents exonuclease activity at the 3’ end of X’ and / or ligation to the 3’ end of X’.

18. The method according to any one of the previous claims, wherein in the nucleic acid adapter the functional group comprised at the 3’ end of Z is selected from a modified nucleotide or a 3’ C3-spacer, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide.

19. The method according to any one of the previous claims, wherein in the nucleic acid adapter the functional group comprised at the 5’ end of X and / or the functional group comprised at the 3’ end of X’ are each individually selected from a modified nucleotide, preferably wherein the modified nucleotide is an inverted nucleotide, a deoxynucleotide, a dideoxy nucleotide, an inverted deoxynucleotide or an inverted dideoxy nucleotide, or wherein the modified nucleotide is a nucleotide with a modified backbone, more preferably wherein the modified backbone is selected from phosphorothioate, 2’-O-methyl, 2’-Fluoro, 2’-Amino, 4’-Thio, LNA, TNA, FANA, HNA, boranophosphate, or phosphorodiamidate.

20. The method according to any one of the previous claims, wherein in the nucleic acid adapter Y comprises one or more of a promoter (P) sequence, a sequencing adapter sequence, an unique molecular identifier (UMI) sequence, and / or a barcode (BC) sequence.

21. The method according to any one of the previous claims, wherein in the nucleic acid adapter the promoter is selected from a T7 promoter, a T3 promoter, a K11 promoter, or a SP6 promoter.

22. The method according to any one of the previous claims, wherein in the nucleic acid adapter the sequencing adapter sequence is selected from an Illumina RA5 adapter sequence, an Illumina RA3 adapter sequence, an Illumina P5 adapter sequence, an Illumina P7 adapter sequence, een Truseq single index library read 1 adapter sequence, een Truseq dual index library read 1 adapter sequentie, Truseq dual index library adapter sequence, or a Nextera read 1 adapter sequence.

23. Method according to any of the previous claims, wherein step d) is performed in the presence of the blocker oligonucleotide as defined in claim 6.

24. Method according to any one of the previous claims, wherein at least 5 mM of a magnesium salt is added before or during step b), step c) or step d), preferably between 5 and 25 mM of a magnesium salt is added.

25. Method according to any one of the previous claims, wherein the method further comprises a step of treating the blunt-ended cfDNA with a polynucleotide kinase to obtain blunt-ended cfDNA with phosphorylated 5’ ends.

26. Method according to any one of the previous claims , wherein the method further comprises a step of pooling multiple samples after step d), preferably wherein the ligation reaction is stopped prior to pooling the multiple samples.

27. Method according to any one of the previous claims, wherein the method further comprises the step of performing Chromatin immunoprecipitation (ChIP) or Multiplexing Antibodies by barcode Identification (MAblD) of the cfDNA-adapter ligation product.

28. Method according to any one of the previous claims further comprising a step of transcribing the cfDNA-adapter ligation product to obtain a forward and a reverse transcript.

29. Method according to claim 28 wherein the method further comprises performing polyadenylation at the 3’ end of the forward and reverse transcripts.

30. Method according to any one of the previous claims, further comprising a step of determining the sequence of the cfDNA, the forward transcript or the reverse transcript.

31. Method according to any one of the previous claims, wherein the transcripts of multiple samples are pooled prior to sequence analysis.

32. Method for treating a cfDNA comprising sample with a blocker oligonucleotide, the method comprising adding the blocker oligonucleotide as defined in claim 6 to a sample comprising cfDNA, preferably wherein the sample is a biological sample, more preferably wherein the sample comprises plasma.

33. Method according to claim 32, wherein the method further comprises ligating a nucleic acid adapter suitable for ligating to cfDNA to the cfDNA in thesample, preferably wherein the nucleic acid adapter is the adapter as defined in any one of claims 7 to 13.

Images