Anti-DLL3 constructs and uses thereof

Abstract

Provided is an engineered immune cell (e.g., engineered T cell) comprising: (i) a first nucleic acid encoding a chimeric receptor (e.g., a chimeric antigen receptor (CAR)), wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (ii) a second nucleic acid encoding a multispecific antigen binding protein ("MSAP" ). Also provided are DLL3 and B7H3 MSAPS, methods of making thereof, and methods of treatment thereof.

Description

ANTI-DLL3 CONSTRUCTS AND USES THEREOFCROSS REFERENCE TO RELATED APPLICATIONSThis application claims benefit of priority of International Patent Application No. PCT / CN2024 / 103690 filed on July 4, 2024, the content of which is incorporated herein by reference in its entirety.SUBMISSION OF SEQUENCE LISTING ON XML FILEThe content of the following submission on XML file is incorporated herein by reference in its entirety: a computer readable form (CRF) of the Sequence Listing (file name: IEC250294PCT SEQUENCE LISTING. XML, date recorded: July 3, 2025, size: 57, 312 KB) .FIELD OF INVENTION

[0001] The present disclosure relates to an engineered immune cell (e.g., engineered T cell) comprising (a) a first nucleic acid encoding a chimeric receptor (such as a chimeric antigen receptor (CAR) ) , wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) . Also provided are anti-DLL3 and anti-B7H3 MSAPS, methods of making thereof, and methods of treatment thereof.BACKGROUND

[0002] DLL3 (Delta-like ligand 3) is a non-canonical Notch ligand, functioning in a cell autonomous manner to inhibit Notch signaling, thus blocking cell to cell interactions and internalization of Notch in the target cell. DLL3 is a neuroendocrine lineage marker that is highly expressed in small cell lung cancer ( “SCLC” ) and other neuroendocrine tumors but is minimally expressed in normal tissues. Notch signaling is downregulated during neuroendocrine tumor growth and is inhibited by DLL3 expression. Other indications wherein DLL3 is implicated may include, e.g., melanoma, low-grade gliomas, glioblastoma, medullary thyroid cancer, dispersed neuroendocrine tumors in the pancreas, bladder and prostate, testicular cancer, and lung adenocarcinomas with neuroendocrine features.

[0003] Currently, only one treatment for advanced or metastatic SCLC that targets DLL3 has been granted accelerated approval by the FDA, i.e., tarlatamab.

[0004] The disclosure of all publications, patents, patent applications and published patent applications referred to herein are hereby incorporated by reference in their entirety. BRIEF SUMMARY OF THE INVENTION

[0005] The present disclosure in one aspect provides an engineered immune cell comprising: (i) a first nucleic acid encoding a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (ii) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) . In some embodiments, the MSAP is secreted by the engineered immune cell.

[0006] In some embodiments, the engineered immune cells described above comprise a chimeric receptor, wherein the antigen binding domain of the chimeric receptor is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, a single chain Fv (scFv) , a single domain antibody (sdAb) , and a peptide ligand specifically binding to DLL3. In some embodiments, the antigen binding domain of the chimeric receptor is an sdAb ( “anti-DLL3 sdAb” ) . In some embodiments, the anti-DLL3 sdAb is a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains. In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13; (iv) a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14; (v) a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14 and / or (vi) a tandem anti-DLL3 sdAb comprising an amino acid sequence of SEQ ID NO: 9.

[0007] In some embodiments according to any of the engineered immune cells described above, the chimeric receptor is a chimeric antigen receptor (CAR) , and wherein the chimeric receptor further comprises a transmembrane domain and an intracellular signaling domain. In some embodiments, transmembrane domain is derived from the group consisting of CD8α, CD4, CD28, 4-1BB, CD80, CD86, CD152, and PD-1. In some embodiments, the transmembrane domain is derived from CD8α. In some embodiments, the intracellular signaling domain is derived from the group consisting of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In some embodiments, the intracellular signaling domain is derived from CD3ζ. In some embodiments, the chimeric receptor further comprises an intracellular co-stimulatory signaling domain. In some embodiments, the intracellular co-stimulatory signaling domain is derived from a co-stimulatory molecule selected from the group consisting of CD27, CD28, CD137, OX40, CD40, PD-1, LFA-1, ICOS, CD2, CD7, LIGHT, NKG2C, B7-H3, TNFRSF9, TNFRSF4, TNFRSF8, CD40LG, ITGB2, KLRC2, TNFRSF18, TNFRSF14, HAVCR1, LGALS9, DAP10, DAP12, CD83, ligands of CD83, and any combination thereof. In some embodiments, the intracellular co-stimulatory signaling domain is derived from a cytoplasmic domain of CD137. In some embodiments, the chimeric receptor further comprises a hinge domain located between the antigen binding domain and the transmembrane domain; optionally wherein the hinge domain is derived from CD8α. In some embodiments, the chimeric receptor comprises the amino acid sequence of SEQ ID NO: 10.

[0008] In some embodiments according to any of the engineered immune cells described above, the first nucleic acid further encodes a chimeric receptor signal peptide N-terminal to the chimeric receptor.

[0009] In some embodiments according to any of the engineered immune cells described above, the MSAP comprises: (i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the immune cell is a T cell.

[0010] In some embodiments according to any of the engineered immune cells described above, the second moiety specifically binds to an epitope of a T cell-specific protein selected from the group consisting of CD3, CD4, CD8, TCRα, TCRβ, TCRγ, and TCRδ. In some embodiments, the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) . In some embodiments, the anti-CD3 antigen binding moiety is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, an scFv, and an sdAb. In some embodiments, the anti-CD3 antigen binding moiety comprises: (i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30; (ii) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31; and / or (iii) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32.

[0011] In some embodiments according to any of the engineered immune cells described above, the first moiety specifically binds to B7H3 ( “anti-B7H3 molecule” ) . In some embodiments, the anti-B7H3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-B7H3 molecule comprises: (i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21; (ii) a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22; and / or (iii) anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23.

[0012] In some embodiments according to any of the engineered immune cells described above, the MSAP comprises an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23, and an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32.

[0013] In some embodiments according to any of the engineered immune cells described above, the first moiety specifically binds to DLL3 ( “anti-DLL3 molecule” ) . In some embodiments, the anti-DLL3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-DLL3 molecule comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13; (iv) a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14; and / or (v) an anti-DLL3 sdAb comprising an amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14.

[0014] In some embodiments according to any of the engineered immune cells described above, the MSAP comprises an anti-DLL3 sdAb comprising the amino acid sequence of SEQ ID NO: 14, and an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32.

[0015] In some embodiments according to any of the engineered immune cells described above, the MSAP comprises a peptide linker between the first moiety and the second moiety. In some embodiments, the MSAP comprises the amino acid sequence of SEQ ID NO: 33 or SEQ ID NO: 34.

[0016] In some embodiments according to any of the engineered immune cells described above, the second nucleic acid further encodes a signal peptide N-terminal to the MSAP. In some embodiments, the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid encoding a cleavable linker. In some embodiments, the cleavable linker is a 2A peptide.

[0017] In some embodiments according to any of the engineered immune cells described above, the engineered immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the engineered immune cell is a T cell. In some embodiments, the T cell is engineered to not express or express a reduced level of endogenous TCR.

[0018] The present disclosure in another aspect provides a multispecific antigen binding protein ( “MSAP” ) comprising: (i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) , wherein the anti-CD3 antigen binding moiety comprises: (i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30; (ii) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31; and / or (iii) an anti-CD3 scFv comprises the amino acid sequence of SEQ ID NO: 32.

[0019] In some embodiments according to any of the MSAPs described above, the first moiety specifically binds to B7H3 ( “anti-B7H3 molecule” ) . In some embodiments, the anti-B7H3 molecule comprises: (i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21; (ii) a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22; and / or (iii) an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23.

[0020] In some embodiments according to any of the MSAPs described above, the first moiety specifically binds to DLL3 ( “anti-DLL3 molecule” ) . In some embodiments, the anti-DLL3 molecule comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13; (iv) a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14; and / or (v) an anti-DLL3 sdAb comprising an amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14.

[0021] In some embodiments according to any of the MSAPs described above, the MSAP comprises the amino acid sequence of SEQ ID NO: 33 or SEQ ID NO: 34.

[0022] Also provided is an engineered immune cell comprising: (i) a first nucleic acid encoding a chimeric receptor; and (ii) a second nucleic acid encoding any of the MSAPs described above or an isolated nucleic acid or vector encoding thereof. In some embodiments, the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3. In some embodiments, the chimeric receptor is a CAR.

[0023] The present disclosure in another aspect provides methods of treating a cancer in an individual in need thereof, comprising administering to the individual an effective amount of any of the engineered immune cells described above (or a pharmaceutical composition thereof) . In some embodiments, the cancer is selected from the group consisting of small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer. In some embodiments, the cancer is small cell lung cancer.

[0024] The present disclosure in another aspect provides methods of treating a cancer in an individual in need thereof, comprising administering an effective amount of a combination of a DLL3 antagonist and a B7H3 antagonist, or an antagonist of DLL3 and B7H3 to the individual; optionally wherein the cancer is DLL3 positive and / or B7H3 positive. In some embodiments, the antagonist of DLL3 and B7H3 is an engineered immune cell comprising (i) a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3 and (ii) an MSAP comprising a first moiety that specifically binds to B7H3 and a second moiety that specifically binds to CD3. In some embodiments, the combination of the DLL3 antagonist and the B7H3 antagonist comprises (i) an engineered immune cell comprising a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3 and (ii) an MSAP comprising a first moiety that specifically binds to B7H3 and a second moiety that specifically binds to CD3.

[0025] The present disclosure in another aspect provides an isolated nucleic acid encoding any of the MSAPs described above (e.g., DLL3 or B7H3 MSAPs described herein) . In some embodiments, the isolated nucleic acid further comprises a second nucleic acid sequence encoding a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3. In some embodiments, the chimeric receptor is a chimeric antigen receptor (CAR) , optionally wherein the CAR comprises the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the nucleic acid sequence encoding the chimeric receptor is upstream or downstream to the nucleic acid sequences encoding the MSAP, the chimeric receptor nucleic acid sequence and the MSAP nucleic acid sequence are separated by a third nucleic acid sequence encoding a cleavable linker. In some embodiments, the isolated nucleic acid comprises a nucleic acid sequence encoding a polypeptide having an amino acid sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 45.

[0026] Also provided are vectors encoding the nucleic acids described herein; host cells comprising said nucleic acids or vectors; and pharmaceutical compositions comprising any of the engineered immune cells described herein and a pharmaceutically acceptable excipient. Further provided are methods of making any of the engineered immune cells described herein, comprising: (i) providing a population of immune cells (e.g., T cells) ; and (ii) introducing into the population of immune cells a first nucleic acid encoding the chimeric receptor and a second nucleic acid encoding the MSAP.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] FIGs. 1A-1B show the schematic overview of an engineered cell that expresses an anti-DLL3 CAR and either an anti-DLL3 T cell engager (FIG. 1A) or an anti-B7H3 T cell engager (FIG. 1B) . The anti-DLL3 T cell engager or the anti-B7H3 T cell engager molecules are secreted from the engineered cell.

[0028] FIGs. 2A-2B show the specific cytotoxicity of anti-DLL3 CAR T cells at 3: 1, 1: 1, and 1:3 effector-to-target cell ( “E: T” ) ratios targeting SHP-77 tumor cells that express DLL3 (FIG. 2A) and SHP-77 tumors cells with DLL3 knocked out ( “DLL3 KO” ; FIG. 2B) . Both SHP-77 tumor cells and SHP-77 DLL3 KO tumor cells were engineered to express the firefly luciferase reporter gene. D3598, anti-DLL3 CAR T cell; UD3661, anti-DLL3 CAR T cell that secretes an anti-DLL3 T cell engager molecule; UNT, untransduced T cells.

[0029] FIG. 3 shows the level of IFN-γ released from effector T cells co-cultured with SHP-77 tumor cells that express DLL3. D3598, anti-DLL3 CAR T cell; UD3661, anti-DLL3 CAR T cell that secretes an anti-DLL3 T cell engager molecule; UNT, untransduced T cells.

[0030] FIGs. 4A-4B show the cytotoxic activity of bystander T cells that are co-cultured with effector T cells (i.e., D3598, UD3661, or UNT) and SHP-77 tumor cells that express DLL3 at effector-to target-to bystander cell ( “E: T: B” ) ratios of 3: 1: 5, 1: 1: 5, and 0.33: 1: 5. In FIG. 4A, bystander T cells are UNT cells, and in FIG. 4B, the bystander T cells are untransduced γδ T cells ( “UNgdT cells” ) . D3598, anti-DLL3 CAR T cell; UD3661, anti-DLL3 CAR T cell that secretes an anti-DLL3 T cell engager molecule; UNT, untransduced T cells.

[0031] FIGs. 5A-5B show the persistence (FIG. 5A) and fold-increase (FIG. 5B) of anti-DLL3 CAR T cells over successive rounds of stimulation by co-cultured DLL3-expressing SHP-77 tumor cells. D3598, anti-DLL3 CAR T cell; UD3661, anti-DLL3 CAR T cell that secretes an anti-DLL3 T cell engager molecule; R0-4, rounds 0-4 antigen stimulation by DLL-3 expressing SHP-77 tumor cells.

[0032] FIGs. 6A-6D show the percent of T cells that are activated over successive rounds of stimulation by co-cultured DLL3-expressing SHP-77 tumor cells. FIG. 6A shows the percent of CAR-negative ( “CAR-” ) T cells (i.e., bystander cells) that are CD25-positive as a readout of activation. FIG. 6B shows the percent of CAR-negative ( “CAR-” ) T cells (i.e., bystander cells) that are CD69-positive as a readout of activation. FIG. 6C shows the percent of anti-DLL3 CAR-positive ( “CAR+” ) T cells (i.e., effector cells) that are CD25-positive as a readout of activation. FIG. 6D shows the percent of anti-DLL3 CAR-positive ( “CAR+” ) T cells (i.e., effector cells) that are CD69-positive as a readout of activation. D3598, anti-DLL3 CAR T cell; UD3661, anti-DLL3 CAR T cell that secretes an anti-DLL3 T cell engager molecule; R0-4, rounds 0-4 antigen stimulation by DLL-3 expressing SHP-77 tumor cells.

[0033] FIGs. 7A-7F show the percent of T cells that are exhausted over successive rounds of stimulation by co-cultured DLL3-expressing SHP-77 tumor cells. FIG. 7A shows the percent of CAR-negative ( “CAR-” ) T cells (i.e., bystander cells) that are TIM-3-positive as a readout of T cell exhaustion. FIG. 7B shows the percent of CAR-negative ( “CAR-” ) T cells (i.e., bystander cells) that are LAG-3-positive as a readout of T cell exhaustion. FIG. 7C shows the percent of CAR-negative ( “CAR-” ) T cells (i.e., bystander cells) that are PD-1-positive as a readout of T cell exhaustion. FIG. 7D shows the percent of anti-DLL3 CAR-positive ( “CAR+” ) T cells (i.e., effector cells) that are TIM-3-positive as a readout of T cell exhaustion. FIG. 7E shows the percent of anti-DLL3 CAR-positive ( “CAR+” ) T cells (i.e., effector cells) that are LAG-3-positive as a readout of T cell exhaustion. FIG. 7F shows the percent of anti-DLL3 CAR-positive ( “CAR+” ) T cells (i.e., effector cells) that are PD-1-positive as a readout of T cell exhaustion. D3598, anti-DLL3 CAR T cell; UD3661, anti-DLL3 CAR T cell that secretes an anti-DLL3 T cell engager molecule; R0-4, rounds 0-4 antigen stimulation by DLL-3 expressing SHP-77 tumor cells.

[0034] FIG. 8 shows the protein levels of B7H3 (i.e., “CD276” ) and DLL3 in tumor cells of three different small cell lung cancer (SCLC) cell lines as analyzed via SCLC CellMiner Cross Database (https:  / / discover. nci. nih. gov / rsconnect / SclcCellMinerCDB / ) .

[0035] FIG. 9 shows the cross sections of SCLC tumors stained by immunohistochemistry (IHC) for DLL3 (top row) or B7H3 (bottom row) and accompanying Histo-scores ( “H-score” or “H” ) .

[0036] FIG. 10 shows the percentage of T cells that were transduced to express the anti-DLL3 CAR that are positive for expression of the anti-DLL3 CAR upon harvest on Day 14. M3085, anti-DLL3 CAR T cell; M3118, anti-DLL3 CAR T cell that secretes an anti-B7H3 T cell engager molecule; allo-M3118, anti-DLL3 CAR T cell with knocked-out endogenous TCRs and that secretes an anti-B7H3 T cell engager molecule.

[0037] FIGs. 11A-11B show the lysis efficiency (i.e., specific cytotoxicity) of anti-DLL3 CAR T cells over 20 hours at 3: 1, 1.5: 1, 1: 1.3, 1: 2.6, and 1: 5.2 E: T ratios targeting SHP-77 tumor cells that express DLL3 and B7H3 (FIG. 11A) and SHP-77 tumors cells with DLL3 knocked out ( “DLL3 KO” or “DLL3KO” ; FIG. 11B) . Both SHP-77 tumor cells and SHP-77 DLL3 KO tumor cells were engineered to express the firefly luciferase reporter gene and displayed high levels of B7H3. M3085, anti-DLL3 CAR T cell; M3118, anti-DLL3 CAR T cell that secretes an anti-B7H3 T cell engager molecule; UNT, untransduced T cells.

[0038] FIGs. 12A-12C show the specific cytotoxicity of CD8+ or γδ bystander T cells co-cultured with SHP-77 DLL3 KO tumor cells and anti-DLL3 CAR T cells at effector-to target-to bystander cell ( “E: T: B” ) ratios of 5: 1: 10 (FIG. 12A) , 10: 1: 5 (FIG. 12B) , and 10: 1: 10 (FIG. 12C) . M3085, anti-DLL3 CAR T cell; M3118, anti-DLL3 CAR T cell that secretes an anti-B7H3 T cell engager molecule; Blank, untransduced T cells.

[0039] FIGs. 13A-13C show the total number of CD5+ T cells (FIG. 13A) , percentage of CAR T cell persistence (FIG. 13B) , and CAR T cell fold-increase (FIG. 13C) of anti-DLL3 CAR T cells over successive rounds of stimulation by co-cultured DLL3-and B7H3-expressing H82 tumor cells at a 1: 2 E: T ratio. H82 cells were previously engineered to express the firefly luciferase reporter gene. M3118, anti-DLL3 CAR T cell that secretes an anti-B7H3 T cell engager molecule; allo-M3118, anti-DLL3 CAR T cell with knocked-out endogenous TCRs and that secretes an anti-B7H3 T cell engager molecule; UNT, untransduced T cells; R0-3, rounds 0-3 antigen stimulation by H82 tumor cells.

[0040] FIGs. 14A-14B show the percentage of T cells that are positive for CD25 and / or CD69 as a readout for T cell activation (FIG. 14A) and the percentage of T cells that are positive for PD-1, TIM-3, and / or LAG-3 as a readout of T cell exhaustion (FIG. 14B) after 3 rounds of stimulation by H82 tumor cells. M3118, anti-DLL3 CAR T cell that secretes an anti-B7H3 T cell engager molecule; allo-M3118, anti-DLL3 CAR T cell with knocked-out endogenous TCRs and that secretes an anti-B7H3 T cell engager molecule; R3, round 3 of antigen stimulation by H82 tumor cells.DETAILED DESCRIPTION

[0041] The present disclosure in one aspect provides engineered immune cells, wherein the engineered immune cells comprise (a) a first nucleic acid encoding a chimeric receptor (e.g., “DLL3-targeted chimeric receptor” ; such as a CAR, hereinafter also referred to as “anti-DLL3 CAR” ) that specifically binds to DLL3; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) . In some embodiments, the MSAP is secreted by the engineered immune cell that expresses the chimeric receptor. Pharmaceutical compositions comprising thereof and methods of making thereof are also provided.

[0042] The present disclosure in another aspect provides multispecific antigen binding proteins ( “MSAPs” ; e.g., DLL3 or B7H3 MSAPs described herein) wherein the MSAP comprises a first moiety that specifically binds to a tumor antigen (e.g., DLL3, B7H3) and a second moiety that specifically binds to a target epitope (e.g., CD3) on an immune cell (e.g., a T cell) . In some embodiments, the immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the immune cell is a T cell. Thus, in some embodiments, the MSAPs provided herein can also be known as a “T cell engager” ( “TCE” ) .

[0043] Also provided herein are methods making the engineered immune cells and / or MSAPs provided herein and methods of treating cancer using the engineered immune cells and / or MSAPs provided herein.

[0044] Small cell lung cancer (SCLC) intratumoral heterogeneity has been found to increase between cellular subpopulations following treatment-resistance, including heterogeneous expression of therapeutic targets and potential resistance pathways, such as epithelial-to-mesenchymal transition ( “EMT” ) (see, e.g., Stewart et al. (2020) Nat Cancer 1: 423-436) . In order to overcome intratumoral heterogeneity and accompanying treatment resistance, inventors of the present disclosure identified an effective combination therapy for cancers such as SCLC (including treatment- or treatment-resistant SCLC tumors) to overcome resistance mechanisms. Particularly, when engineered immune cells (e.g., engineered T cells) expressing DLL3-targeted chimeric receptors (e.g., anti-DLL3 CAR) are used in combination with a multispecific antigen binding protein ( “MSAP” ; e.g., an anti-B7H3 MSAP) , the cytotoxicity against tumor cells increase compared to engineered immune cells comprising an anti-DLL3 CAR only. Notably, the engineered immune cells are still able to lyse tumor cells that do not express DLL3, thereby demonstrating cytotoxicity against tumor cells (i.e., SCLC) with intratumoral heterogeneity of tumor-associated antigens (TAAs) and tumor-specific antigens (TSAs) . Furthermore, secretion of the MSAP by the engineered immune cell is able to recruit bystander immune cells (e.g., T cells) to engage in tumor cell lysis as well. Surprisingly, the cytotoxicity against tumor cells is paired with protection against exhaustion when the immune cells are further engineered to reduce or eliminate endogenous TCR expression. This co-expression approach may also improve safety, as the secreted MSAPs remained localized to the tumor, protecting healthy cells from off-target bystander T cell-mediated cytolysis, which could potentially avoid toxicities associated with systemic MSAP administration. I. Definitions

[0045] Techniques and procedures described or referenced herein include those that are generally well understood and / or commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3d ed. 2001) ; Current Protocols in Molecular Biology (Ausubel et al. eds., 2003) ; Therapeutic Monoclonal Antibodies: From Bench to Clinic (An ed. 2009) ; Monoclonal Antibodies: Methods and Protocols (Albitar ed. 2010) ; and Antibody Engineering Vols 1 and 2 (Kontermann and Dübel eds., 2d ed. 2010) . Unless otherwise defined herein, technical and scientific terms used in the present description have the meanings that are commonly understood by those of ordinary skill in the art. For purposes of interpreting this specification, the following description of terms will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any description of a term set forth conflicts with any document incorporated herein by reference, the description of the term set forth below shall control.

[0046] The term “antibody, ” “immunoglobulin, ” or “Ig” is used interchangeably herein, and is used in the broadest sense and specifically covers, for example, monoclonal antibodies (including agonist, antagonist, neutralizing antibodies, full length or intact monoclonal antibodies) , antibody compositions with polyepitopic or monoepitopic specificity, polyclonal or monovalent antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired biological activity) , formed from at least two intact antibodies, single chain antibodies, and fragments thereof (e.g., domain antibodies) , as described below. An antibody can be human, humanized, chimeric and / or affinity matured, as well as an antibody from other species, for example, mouse, rabbit, llama, etc. The term “antibody” is intended to include a polypeptide product of B cells within the immunoglobulin class of polypeptides that is able to bind to a specific molecular antigen and is composed of two identical pairs of polypeptide chains, wherein each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa) , each amino-terminal portion of each chain includes a variable region of about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain includes a constant region. See, e.g., Antibody Engineering (Borrebaeck ed., 2d ed. 1995) ; and Kuby, Immunology (3d ed. 1997) . Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, antibodies including from Camelidae species (e.g., llama or alpaca) or their humanized variants, intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments (e.g., antigen binding fragments) of any of the above, which refers to a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment was derived. Non-limiting examples of functional fragments (e.g., antigen binding fragments) include single-chain Fvs (scFv) (e.g., including monospecific, bispecific, etc. ) , Fab fragments, F (ab’ ) fragments, F (ab) 2 fragments, F (ab’) 2 fragments, disulfide-linked Fvs (dsFv) , Fd fragments, Fv fragments, sdAb, diabody, triabody, tetrabody, and minibody. In particular, antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, for example, antigen-binding domains or molecules that contain an antigen-binding site that binds to an antigen (e.g., one or more CDRs of an antibody) . Such antibody fragments can be found in, for example, Harlow and Lane, Antibodies: A Laboratory Manual (1989) ; Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995) ; Huston et al., 1993, Cell Biophysics 22: 189-224; Plückthun and Skerra, 1989, Meth. Enzymol. 178: 497-515; and Day, Advanced Immunochemistry (2d ed. 1990) . The antibodies provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) of immunoglobulin molecule. Antibodies may be agonistic antibodies or antagonistic antibodies. Antibodies may be neither agonistic nor antagonistic.

[0047] An “antigen” is a structure to which an antibody can selectively bind. A target antigen may be a polypeptide, carbohydrate, nucleic acid, lipid, hapten, or other naturally occurring or synthetic compound. The target antigen can be a polypeptide. An antigen may be associated with a cell, for example, is present on or in a cell.

[0048] An “intact” antibody is one comprising an antigen-binding site as well as a CL and at least heavy chain constant regions, CH1, CH2 and CH3. The constant regions may include human constant regions or amino acid sequence variants thereof. An intact antibody may have one or more effector functions.

[0049] “Single-chain Fv” also abbreviated as “sFv” or “scFv” are antibody fragments that comprise the VH and VL antibody domains connected into a single polypeptide chain. The scFv polypeptide may further comprise a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding. For a review of the scFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994) .

[0050] The term “heavy chain-only antibody” or “HCAb” refers to a functional antibody, which comprises heavy chains, but lacks the light chains usually found in 4-chain antibodies. For example, camelid animals (such as camels, llamas, or alpacas) are known to produce HCAbs.

[0051] “Single domain antibody” or “sdAb” as used herein refers to a single monomeric variable antibody domain and which is capable of antigen binding. Single domain antibodies include VHH domains as described herein. Examples of single domain antibodies include, but are not limited to, antibodies naturally devoid of light chains such as those from Camelidae species (e.g., llama) , single domain antibodies derived from conventional 4-chain antibodies, engineered antibodies and single domain scaffolds other than those derived from antibodies. Single domain antibodies (e.g., VHH domains) may be derived from any species including, but not limited to mouse, human, camel, llama, goat, rabbit, and bovine. For example, a single domain antibody can be derived from antibodies raised in Camelidae species, for example in camel, llama, dromedary, alpaca, and guanaco, as described herein. Other species besides Camelidae may produce heavy chain antibodies naturally devoid of light chain; VHHs derived from such other species are within the scope of the disclosure. The single domain antibody (e.g., VHH domain) provided herein has a structure of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Single domain antibodies may be genetically fused or chemically conjugated to another molecule (e.g., an agent) as described herein. Single domain antibodies may be part of a bigger binding molecule (e.g., a multispecific antibody or a chimeric antigen receptor) .

[0052] The terms “binds” or “binding” refer to an interaction between molecules including, for example, to form a complex. Interactions can be, for example, non-covalent interactions including hydrogen bonds, ionic bonds, hydrophobic interactions, and / or van der Waals interactions. A complex can also include the binding of two or more molecules held together by covalent or non-covalent bonds, interactions, or forces. The strength of the total non-covalent interactions between a single antigen-binding site on a binding molecule and a single epitope of a target molecule, such as an antigen, is the affinity of the binding molecule or functional fragment for that epitope. The ratio of dissociation rate (koff) to association rate (kon) of a binding molecule (e.g., an antibody) to a monovalent antigen (koff / kon) is the dissociation constant KD, which is inversely related to affinity. The lower the KD value, the higher the affinity of the molecule. The value of KD varies for different complexes of binding molecule and its target antigen and depends on both kon and koff. The dissociation constant KD for a binding molecule against its target provided herein can be determined using any method provided herein or any other method well known to those skilled in the art. The affinity at one binding site does not always reflect the true strength of the interaction between a binding molecule and a target antigen. When complex antigens containing multiple, repeating antigenic determinants, such as a polyvalent antigen, come in contact with antibodies containing multiple binding sites, the interaction of antibody with antigen at one site will increase the probability of a reaction at a second site. The strength of such multiple interactions between a multivalent antibody and antigen is called the avidity.

[0053] In connection with the binding molecules described herein terms such as “bind to, ” “that specifically bind to, ” and analogous terms are also used interchangeably herein and refer to binding molecules of antigen binding domains that specifically bind to an antigen, such as a polypeptide. A binding molecule or antigen binding domain that binds to or specifically binds to an antigen can be identified, for example, by immunoassays,  or other techniques known to those of skill in the art. A binding molecule or antigen binding domain may bind to or specifically bind to an antigen when it binds to an antigen with higher affinity than to any cross-reactive antigen as determined using experimental techniques, such as radioimmunoassay (RIA) and enzyme linked immunosorbent assay (ELISA) . Typically, a specific or selective reaction will be at least twice background signal or noise and may be more than 10 times background. See, e.g., Fundamental Immunology 332-36 (Paul ed., 2d ed. 1989) for a discussion regarding binding specificity. The extent of binding of a binding molecule or antigen binding domain to a “non-target” protein may be less than about 10%of the binding of the binding molecule or antigen binding domain to its particular target antigen, for example, as determined by fluorescence activated cell sorting (FACS) analysis or RIA. A binding molecule or antigen binding domain that binds to an antigen includes one that is capable of binding the antigen with sufficient affinity such that the binding molecule is useful, for example, as a therapeutic and / or diagnostic agent in targeting the antigen. A binding molecule or antigen binding domain that binds to an antigen may have a dissociation constant (KD) of less than or equal to 1μM, 800 nM, 600 nM, 550 nM, 500 nM, 300 nM, 250 nM, 100 nM, 50 nM, 10 nM, 5 nM, 4 nM, 3 nM, 2 nM, 1 nM, 0.9 nM, 0.8 nM, 0.7 nM, 0.6 nM, 0.5 nM, 0.4 nM, 0.3 nM, 0.2 nM, or 0.1 nM. In certain embodiments, a binding molecule or antigen binding domain binds to an epitope of an antigen that is conserved among the antigen from different species.

[0054] The binding molecules or antigen binding domains can comprise “chimeric” sequences in which a portion of the heavy and / or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see U.S. Pat. No. 4,816,567; and Morrison et al., 1984, Proc. Natl. Acad. Sci. USA 81: 6851-55) . Chimeric sequences may include humanized sequences.

[0055] In certain embodiments, the binding molecules or antigen binding domains can comprise portions of “humanized” forms of nonhuman (e.g., camelid, murine, non-human primate) antibodies that include sequences from human immunoglobulins (e.g., recipient antibody) in which the native CDR residues are replaced by residues from the corresponding CDR of a nonhuman species (e.g., donor antibody) such as camelid, mouse, rat, rabbit, or nonhuman primate having the desired specificity, affinity, and capacity. In some instances, one or more FR region residues of the human immunoglobulin sequences are replaced by corresponding nonhuman residues. Furthermore, humanized antibodies can comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. A humanized antibody heavy or light chain can comprise substantially all of at least one or more variable regions, in which all or substantially all of the CDRs correspond to those of a nonhuman immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody may comprise at least a portion of an immunoglobulin constant region (Fc) , typically that of a human immunoglobulin. For further details, see, Jones et al., Nature 321: 522-25 (1986) ; Riechmann et al., Nature 332: 323-29 (1988) ; Presta, Curr. Op. Struct. Biol. 2: 593-96 (1992) ; Carter et al., Proc. Natl. Acad. Sci. USA 89: 4285-89 (1992) ; U.S. Pat. Nos: 6,800,738; 6,719,971; 6,639,055; 6,407,213; and 6,054,297.

[0056] The binding molecules or antigen binding domains can comprise portions of a “fully human antibody” or “human antibody, ” wherein the terms are used interchangeably herein and refer to an antibody that comprises a human variable region and, for example, a human constant region. The binding molecules may comprise an antibody sequence. In specific embodiments, the terms refer to an antibody that comprises a variable region and constant region of human origin. “Fully human” antibodies, in certain embodiments, can also encompass antibodies which bind polypeptides and are encoded by nucleic acid sequences which are naturally occurring somatic variants of human germline immunoglobulin nucleic acid sequence. The term “fully human antibody” includes antibodies having variable and constant regions corresponding to human germline immunoglobulin sequences as described by Kabat et al. (See Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242) . A “human antibody” is one that possesses an amino acid sequence which corresponds to that of an antibody produced by a human and / or has been made using any of the techniques for making human antibodies. This definition of a human antibody specifically excludes a humanized antibody comprising non-human antigen-binding residues. Human antibodies can be produced using various techniques known in the art, including phage-display libraries (Hoogenboom and Winter, J. Mol. Biol. 227: 381 (1991) ; Marks et al., J. Mol. Biol. 222: 581 (1991) ) and yeast display libraries (Chao et al., Nature Protocols 1: 755-68 (2006) ) . Also available for the preparation of human monoclonal antibodies are methods described in Cole et al., Monoclonal Antibodies and Cancer Therapy 77 (1985) ; Boerner et al., J. Immunol. 147 (1) : 86-95 (1991) ; and van Dijk and van de Winkel, Curr. Opin. Pharmacol. 5: 368-74 (2001) . Human antibodies can be prepared by administering the antigen to a transgenic animal that has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled, e.g., mice (see, e.g., Jakobovits, Curr. Opin. Biotechnol. 6 (5) : 561-66 (1995) ; Brüggemann and Taussing, Curr. Opin. Biotechnol. 8 (4) : 455-58 (1997) ; and U.S. Pat. Nos. 6,075,181 and 6,150,584 regarding XENOMOUSETM technology) . See also, for example, Li et al., Proc. Natl. Acad. Sci. USA 103: 3557-62 (2006) regarding human antibodies generated via a human B-cell hybridoma technology.

[0057] The binding molecules or antigen binding domains can comprise portions of a “recombinant human antibody, ” wherein the phrase includes human antibodies that are prepared, expressed, created, or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into a host cell, antibodies isolated from a recombinant, combinatorial human antibody library, antibodies isolated from an animal (e.g., a mouse or cow) that is transgenic and / or transchromosomal for human immunoglobulin genes (see, e.g., Taylor, L. D. et al., Nucl. Acids Res. 20: 6287-6295 (1992) ) or antibodies prepared, expressed, created or isolated by any other means that involves splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies can have variable and constant regions derived from human germline immunoglobulin sequences (See Kabat, E. A. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242) . In certain embodiments, however, such recombinant human antibodies are subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.

[0058] In certain embodiments, the binding molecules or antigen binding domains can comprise a portion of a “monoclonal antibody, ” wherein the term as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, e.g., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts or well-known post-translational modifications such as amino acid isomerization or deamidation, methionine oxidation or asparagine or glutamine deamidation, each monoclonal antibody will typically recognize a single epitope on the antigen. In specific embodiments, a “monoclonal antibody, ” as used herein, is an antibody produced by a single hybridoma or other cell. The term “monoclonal” is not limited to any particular method for making the antibody. For example, the monoclonal antibodies useful in the present disclosure may be prepared by the hybridoma methodology first described by Kohler et al., Nature 256: 495 (1975) , or may be made using recombinant DNA methods in bacterial or eukaryotic animal or plant cells (see, e.g., U.S. Pat. No. 4,816,567) . The “monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature 352: 624-28 (1991) and Marks et al., J. Mol. Biol. 222: 581-97 (1991) , for example. Other methods for the preparation of clonal cell lines and of monoclonal antibodies expressed thereby are well known in the art. See, e.g., Short Protocols in Molecular Biology (Ausubel et al. eds., 5th ed. 2002) .

[0059] A typical 4-chain antibody unit is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. In the case of IgGs, the 4-chain unit is generally about 150,000 daltons. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each H chain has at the N-terminus, a variable domain (VH) followed by three constant domains (CH) for each of the α and γ chains and four CH domains for μ and ε isotypes. Each L chain has at the N-terminus, a variable domain (VL) followed by a constant domain (CL) at its other end. The VL is aligned with the VH, and the CL is aligned with the first constant domain of the heavy chain (CH1) . Particular amino acid residues are believed to form an interface between the light chain and heavy chain variable domains. The pairing of a VH and VL together forms a single antigen-binding site. For the structure and properties of the different classes of antibodies, see, for example, Basic and Clinical Immunology 71 (Stites et al. eds., 8th ed.1994) ; and Immunobiology (Janeway et al. eds., 5th ed. 2001) .

[0060] The term “Fab” or “Fab region” refers to an antibody region that binds to antigens. A conventional IgG usually comprises two Fab regions, each residing on one of the two arms of the Y-shaped IgG structure. Each Fab region is typically composed of one variable region and one constant region of each of the heavy and the light chain. More specifically, the variable region and the constant region of the heavy chain in a Fab region are VH and CH1 regions, and the variable region and the constant region of the light chain in a Fab region are VL and CL regions. The VH, CH1, VL, and CL in a Fab region can be arranged in various ways to confer an antigen binding capability according to the present disclosure. For example, VH and CH1 regions can be on one polypeptide, and VL and CL regions can be on a separate polypeptide, similarly to a Fab region of a conventional IgG. Alternatively, VH, CH1, VL and CL regions can all be on the same polypeptide and oriented in different orders as described in more detail the sections below.

[0061] The term “variable region, ” “variable domain, ” “V region, ” or “V domain” refers to a portion of the light or heavy chains of an antibody that is generally located at the amino-terminal of the light or heavy chain and has a length of about 120 to 130 amino acids in the heavy chain and about 100 to 110 amino acids in the light chain, and are used in the binding and specificity of each particular antibody for its particular antigen. The variable region of the heavy chain may be referred to as “VH” . The variable region of the light chain may be referred to as “VL” . The term “variable” refers to the fact that certain segments of the variable regions differ extensively in sequence among antibodies. The V region mediates antigen binding and defines specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed across the 110-amino acid span of the variable regions. Instead, the V regions consist of less variable (e.g., relatively invariant) stretches called framework regions (FRs) of about 15-30 amino acids separated by shorter regions of greater variability (e.g., extreme variability) called “hypervariable regions” that are each about 9-12 amino acids long. The variable regions of heavy and light chains each comprise four FRs, largely adopting a β sheet configuration, connected by three hypervariable regions, which form loops connecting, and in some cases form part of, the βsheet structure. The hypervariable regions in each chain are held together in close proximity by the FRs and, with the hypervariable regions from the other chain, contribute to the formation of the antigen-binding site of antibodies (see, e.g., Kabat et al., Sequences of Proteins of Immunological Interest (5th ed. 1991) ) . The constant regions are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody dependent cellular cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) . The variable regions differ extensively in sequence between different antibodies. The variable region may be a human variable region.

[0062] The term “variable region residue numbering according to Kabat” or “amino acid position numbering as in Kabat” , and variations thereof, refer to the numbering system used for heavy chain variable regions or light chain variable regions of the compilation of antibodies in Kabat et al., supra. Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to a shortening of, or insertion into, an FR or CDR of the variable domain. For example, a heavy chain variable domain may include a single amino acid insert (residue 52a according to Kabat) after residue 52 and three inserted residues (e.g., residues 82a, 82b, and 82c, etc. according to Kabat) after residue 82. The Kabat numbering of residues may be determined for a given antibody by alignment at regions of homology of the sequence of the antibody with a “standard” Kabat numbered sequence. The Kabat numbering system is generally used when referring to a residue in the variable domain (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain) (e.g., Kabat et al., supra) . The “EU numbering system” or “EU index” is generally used when referring to a residue in an immunoglobulin heavy chain constant region (e.g., the EU index reported in Kabat et al., supra) . The “EU index as in Kabat” refers to the residue numbering of the human IgG 1 EU antibody. Other numbering systems have been described, for example, by AbM, Chothia, Contact, IMGT, and AHon.

[0063] The term “heavy chain” when used in reference to an antibody refers to a polypeptide chain of about 50-70 kDa, wherein the amino-terminal portion includes a variable region of about 120 to 130 or more amino acids, and a carboxy-terminal portion includes a constant region. The constant region can be one of five distinct types, (e.g., isotypes) referred to as alpha (α) , delta (δ) , epsilon (ε) , gamma (γ) , and mu (μ) , based on the amino acid sequence of the heavy chain constant region. The distinct heavy chains differ in size: α, δ, and γ contain approximately 450 amino acids, while μ and ε contain approximately 550 amino acids. When combined with a light chain, these distinct types of heavy chains give rise to five well known classes (e.g., isotypes) of antibodies, IgA, IgD, IgE, IgG, and IgM, respectively, including four subclasses of IgG, namely IgG1, IgG2, IgG3, and IgG4.

[0064] The term “light chain” when used in reference to an antibody refers to a polypeptide chain of about 25 kDa, wherein the amino-terminal portion includes a variable region of about 100 to about 110 or more amino acids, and a carboxy-terminal portion includes a constant region. The approximate length of a light chain is 211 to 217 amino acids. There are two distinct types, referred to as kappa (κ) or lambda (λ) based on the amino acid sequence of the constant domains.

[0065] As used herein, the terms “hypervariable region, ” “HVR, ” “Complementarity Determining Region, ” and “CDR” are used interchangeably. A “CDR” refers to one of three hypervariable regions (H1, H2 or H3) within the non-framework region of the immunoglobulin (Ig or antibody) VH β-sheet framework, or one of three hypervariable regions (L1, L2 or L3) within the non-framework region of the antibody VL β-sheet framework. CDR1, CDR2 and CDR3 in VH domain are also referred to as HCDR1, HCDR2 and HCDR3, respectively. CDR1, CDR2 and CDR3 in VL domain are also referred to as LCDR1, LCDR2 and LCDR3, respectively. Accordingly, CDRs are variable region sequences interspersed within the framework region sequences.

[0066] CDR regions are well known to those skilled in the art and have been defined by well-known numbering systems. For example, the Kabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (see, e.g., Kabat et al., supra; Nick Deschacht et al., J Immunol 2010; 184: 5696-5704) . Chothia refers instead to the location of the structural loops (see, e.g., Chothia and Lesk, J. Mol. Biol. 196: 901-17 (1987) ) . The end of the Chothia CDR-H1 loop when numbered using the Kabat numbering convention varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places the insertions at H35A and H35B; if neither 35A nor 35B is present, the loop ends at 32; if only 35A is present, the loop ends at 33; if both 35A and 35B are present, the loop ends at 34) . The AbM hypervariable regions represent a compromise between the Kabat CDRs and Chothia structural loops, and are used by Oxford Molecular’s AbM antibody modeling software (see, e.g., Antibody Engineering Vol. 2 (Kontermann and Dübel eds., 2d ed. 2010) ) . The “contact” hypervariable regions are based on an analysis of the available complex crystal structures. Another universal numbering system that has been developed and widely adopted is ImMunoGeneTics (IMGT) Information  (Lafranc et al., Dev. Comp. Immunol. 27 (1) : 55-77 (2003) ) . IMGT is an integrated information system specializing in immunoglobulins (IG) , T-cell receptors (TCR) , and major histocompatibility complex (MHC) of human and other vertebrates. Herein, the CDRs are referred to in terms of both the amino acid sequence and the location within the light or heavy chain. As the “location” of the CDRs within the structure of the immunoglobulin variable domain is conserved between species and present in structures called loops, by using numbering systems that align variable domain sequences according to structural features, CDR and framework residues are readily identified. This information can be used in grafting and replacement of CDR residues from immunoglobulins of one species into an acceptor framework from, typically, a human antibody. An additional numbering system (AHon) has been developed by Honegger and Plückthun, J. Mol. Biol. 309: 657-70 (2001) . Correspondence between the numbering system, including, for example, the Kabat numbering and the IMGT unique numbering system, is well known to one skilled in the art (see, e.g., Kabat, supra; Chothia and Lesk, supra; Martin, supra; Lefranc et al., supra) . The residues from each of these hypervariable regions or CDRs are exemplified in Table 1 below. Table 1. Exemplary CDRs According to Various Numbering Systems

[0067] The boundaries of a given CDR may vary depending on the scheme used for identification. Thus, unless otherwise specified, the terms “CDR” and “complementary determining region” of a given antibody or region thereof, such as a variable region, as well as individual CDRs (e.g., CDR-H1, CDR-H2) of the antibody or region thereof, should be understood to encompass the complementary determining region as defined by any of the known schemes described herein above. In some instances, the scheme for identification of a particular CDR or CDRs is specified, such as the CDR as defined by the IMGT, Kabat, Chothia, or Contact method. In other cases, the particular amino acid sequence of a CDR is given. It should be noted CDR regions may also be defined by any combination of various numbering systems, e.g., a combination of Kabat and Chothia numbering systems, a combination of Kabat and AbM numbering systems, or a combination of Kabat and IMGT numbering systems. Therefore, the term such as “a CDR1 as set forth in a specific VH” includes any CDR1 as defined by the exemplary CDR numbering systems described above, but is not limited thereby. Once a variable region (e.g., a VH or VL) is given, those skilled in the art would understand that CDRs within the region can be defined by different numbering systems or combinations thereof.

[0068] Hypervariable regions may comprise “extended hypervariable regions” as follows: 24-36 or 24-34 (L1) , 46-56 or 50-56 (L2) , and 89-97 or 89-96 (L3) in the VL, and 26-35 or 26-35A (H1) , 50-65 or 49-65 (H2) , and 93-102, 94-102, or 95-102 (H3) in the VH.

[0069] The term “constant region” or “constant domain” refers to a carboxy terminal portion of the light and heavy chain which is not directly involved in binding of the antibody to antigen but exhibits various effector function, such as interaction with the Fc receptor. The term refers to the portion of an immunoglobulin molecule having a more conserved amino acid sequence relative to the other portion of the immunoglobulin, the variable region, which contains the antigen binding site. The constant region may contain the CH1, CH2, and CH3 regions of the heavy chain and the CL region of the light chain.

[0070] The term “framework” or “FR” refers to those variable region residues flanking the CDRs. FR residues are present, for example, in chimeric, humanized, human, domain antibodies, diabodies, linear antibodies, and bispecific antibodies. FR residues are those variable domain residues other than the hypervariable region residues or CDR residues.

[0071] The term “Fc region” herein is used to define a C-terminal region of an immunoglobulin heavy chain, including, for example, native sequence Fc regions, recombinant Fc regions, and variant Fc regions. Although the boundaries of the Fc region of an immunoglobulin heavy chain might vary, the human IgG heavy chain Fc region is often defined to stretch from an amino acid residue at position Cys226, or from Pro230, to the carboxyl-terminus thereof. The C-terminal lysine (residue 447 according to the EU numbering system) of the Fc region may be removed, for example, during production or purification of the antibody, or by recombinantly engineering the nucleic acid encoding a heavy chain of the antibody. Accordingly, a composition of intact antibodies may comprise antibody populations with all K447 residues removed, antibody populations with no K447 residues removed, and antibody populations having a mixture of antibodies with and without the K447 residue. A “functional Fc region” possesses an “effector function” of a native sequence Fc region. Exemplary “effector functions” include C1q binding; CDC; Fc receptor binding; ADCC; phagocytosis; downregulation of cell surface receptors (e.g., B cell receptor) , etc. Such effector functions generally require the Fc region to be combined with a binding region or binding domain (e.g., an antibody variable region or domain) and can be assessed using various assays known to those skilled in the art. A “variant Fc region” comprises an amino acid sequence which differs from that of a native sequence Fc region by virtue of at least one amino acid modification (e.g., substituting, addition, or deletion) . In certain embodiments, the variant Fc region has at least one amino acid substitution compared to a native sequence Fc region or to the Fc region of a parent polypeptide, for example, from about one to about ten amino acid substitutions, or from about one to about five amino acid substitutions in a native sequence Fc region or in the Fc region of a parent polypeptide. The variant Fc region herein can possess at least about 80%homology with a native sequence Fc region and / or with an Fc region of a parent polypeptide, or at least about 90%homology therewith, for example, at least about 95%homology therewith.

[0072] As used herein, an “epitope” is a term in the art and refers to a localized region of an antigen to which a binding molecule (e.g., an antibody) can specifically bind. An epitope can be a linear epitope or a conformational, non-linear, or discontinuous epitope. In the case of a polypeptide antigen, for example, an epitope can be contiguous amino acids of the polypeptide (a“linear” epitope) or an epitope can comprise amino acids from two or more non-contiguous regions of the polypeptide (a “conformational, ” “non-linear” or “discontinuous” epitope) . It will be appreciated by one of skill in the art that, in general, a linear epitope may or may not be dependent on secondary, tertiary, or quaternary structure. For example, a binding molecule may bind to a group of amino acids regardless of whether they are folded in a natural three dimensional protein structure. A binding molecule may require amino acid residues making up the epitope to exhibit a particular conformation (e.g., bend, twist, turn or fold) in order to recognize and bind the epitope.

[0073] “Percent (%) amino acid sequence identity” and “homology” with respect to a peptide, polypeptide or antibody sequence are defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific peptide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or MEGALIGNTM (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0074] The term “specificity” refers to selective recognition of an antigen binding protein (such as a CAR or an antibody) for a particular epitope of an antigen. Natural antibodies, for example, are monospecific. The term “multispecific” as used herein denotes that an antigen binding protein has two or more antigen-binding sites of which at least two bind different epitopes. “Bispecific” as used herein denotes that an antigen binding protein has two different antigen-binding specificities. The term “monospecific” as used herein denotes an antigen binding protein that has one or more binding sites each of which bind the same epitope.

[0075] The term “valent” as used herein denotes the presence of a specified number of binding sites in an antigen binding protein (such as a CAR or an antibody) . A natural antibody for example or a full-length antibody has two binding sites and is bivalent. As such, the terms “trivalent” , “tetravalent” , “pentavalent” and “hexavalent” denote the presence of two binding site, three binding sites, four binding sites, five binding sites, and six binding sites, respectively, in an antigen binding protein.

[0076] As used herein, a first antibody or fragment thereof “competes” for binding to a target antigen / epitope with a second antibody or fragment thereof when the first antibody or fragment thereof inhibits the target antigen / epitope binding of the second antibody of fragment thereof by at least about 50% (such as at least about any one of 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%or 99%) in the presence of an equimolar concentration of the first antibody or fragment thereof, or vice versa. A high throughput process for “binning” antibodies based upon their cross-competition is described in PCT Publication No. WO 03 / 48731.

[0077] “Chimeric antigen receptor” or “CAR” as used herein refers to genetically engineered receptors, which can be used to graft one or more antigen specificity onto immune effector cells, such as T cells. Some CARs are also known as “artificial T-cell receptors, ” “chimeric T cell receptors, ” or “chimeric immune receptors. ” The CAR may comprise an extracellular antigen binding domain specific for one or more antigens (such as tumor antigens) , a transmembrane domain, and an intracellular signaling domain of a T cell and / or other receptors. “CAR-T cell” refers to a T cell that expresses a CAR.

[0078] The terms “polypeptide” and “peptide” and “protein” are used interchangeably herein and refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid, including but not limited to, unnatural amino acids, as well as other modifications known in the art. It is understood that, because the polypeptides of this disclosure may be based upon antibodies or other members of the immunoglobulin superfamily, a “polypeptide” can occur as a single chain or as two or more associated chains.

[0079] “Polynucleotide” or “nucleic acid, ” as used interchangeably herein, refers to polymers of nucleotides of any length and includes DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. “Oligonucleotide, ” as used herein, refers to short, generally single-stranded, synthetic polynucleotides that are generally, but not necessarily, fewer than about 200 nucleotides in length. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides. A cell that produces a binding molecule of the present disclosure may include a parent hybridoma cell, as well as bacterial and eukaryotic host cells into which nucleic acids encoding the antibodies have been introduced. Unless specified otherwise, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5′ end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5′ direction. The direction of 5′ to 3′ addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 5′ to the 5′ end of the RNA transcript are referred to as “upstream sequences” ; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 3′ to the 3′ end of the RNA transcript are referred to as “downstream sequences. ”

[0080] An “isolated nucleic acid” is a nucleic acid, for example, an RNA, DNA, or a mix of nucleic acids, which is substantially separated from other genome DNA sequences as well as proteins or complexes such as ribosomes and polymerases, which naturally accompany a native sequence. An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, one or more nucleic acid molecules encoding an antibody as described herein are isolated or purified. The term embraces nucleic acid sequences that have been removed from their naturally occurring environment and includes recombinant or cloned DNA isolates and chemically synthesized analogues or analogues biologically synthesized by heterologous systems. A substantially pure molecule may include isolated forms of the molecule. Specifically, an “isolated” nucleic acid molecule encoding a CAR or an antibody described herein is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the environment in which it was produced.

[0081] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some versions contain an intron (s) .

[0082] The term “control sequences” refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

[0083] As used herein, the term “operatively linked, ” and similar phrases (e.g., genetically fused) , when used in reference to nucleic acids or amino acids, refer to the operational linkage of nucleic acid sequences or amino acid sequence, respectively, placed in functional relationships with each other. For example, an operatively linked promoter, enhancer elements, open reading frame, 5′ and 3′ UTR, and terminator sequences result in the accurate production of a nucleic acid molecule (e.g., RNA) . In some embodiments, operatively linked nucleic acid elements result in the transcription of an open reading frame and ultimately the production of a polypeptide (i.e., expression of the open reading frame) . As another example, an operatively linked peptide is one in which the functional domains are placed with appropriate distance from each other to impart the intended function of each domain.

[0084] The term “vector” refers to a substance that is used to carry or include a nucleic acid sequence, including for example, a nucleic acid sequence encoding a binding molecule (e.g., an antibody) as described herein, in order to introduce a nucleic acid sequence into a host cell. Vectors applicable for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include selection sequences or markers operable for stable integration into a host cell’s chromosome. Additionally, the vectors can include one or more selectable marker genes and appropriate expression control sequences. Selectable marker genes that can be included, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Expression control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art. When two or more nucleic acid molecules are to be co-expressed (e.g., both an antibody heavy and light chain or an antibody VH and VL) , both nucleic acid molecules can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector expression, the encoding nucleic acids can be operationally linked to one common expression control sequence or linked to different expression control sequences, such as one inducible promoter and one constitutive promoter. The introduction of nucleic acid molecules into a host cell can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that the nucleic acid molecules are expressed in a sufficient amount to produce a desired product and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.

[0085] The term “host” as used herein refers to an animal, such as a mammal (e.g., a human) .

[0086] The term “host cell” as used herein refers to a particular subject cell that may be transfected with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny of such a cell may not be identical to the parent cell transfected with the nucleic acid molecule due to mutations or environmental influences that may occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome.

[0087] As used herein, the term “autologous” is meant to refer to any material derived from the same individual to whom it is later to be re-introduced into the individual.

[0088] “Allogeneic” refers to a graft derived from a different individual of the same species.

[0089] The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0090] The term “pharmaceutically acceptable” as used herein means being approved by a regulatory agency of the Federal or a state government, or listed in United States Pharmacopeia, European Pharmacopeia, or other generally recognized Pharmacopeia for use in animals, and more particularly in humans.

[0091] The term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of an engineered immune cell provided herein, a multispecific antigen binding protein ( “MSAP” ; e.g., DLL3 or B7H3 MSAP) provided herein, a pharmaceutical composition provided herein, or combination thereof which is sufficient to result in the desired outcome.

[0092] The terms “subject, ” “individual, ” and “patient” may be used interchangeably. As used herein, in certain embodiments, a subject or an individual is a mammal, such as a non-primate or a primate (e.g., human) . In specific embodiments, the individual is a human. In one embodiment, the individual is a mammal, e.g., a human, diagnosed with a disease or disorder, or at risk of developing a disease or disorder.

[0093] As used herein, the terms “treat, ” “treatment” and “treating” refer to the reduction or amelioration of the progression, severity, and / or duration of a disease or condition resulting from the administration of one or more therapies. Treating may be determined by assessing whether there has been a decrease, alleviation, and / or mitigation of one or more symptoms associated with the underlying disorder such that an improvement is observed with the patient, despite that the patient may still be afflicted with the underlying disorder. The term “treating” includes both managing and ameliorating the disease. The terms “manage, ” “managing, ” and “management” refer to the beneficial effects that a subject derives from a therapy which does not necessarily result in a cure of the disease.

[0094] The terms “prevent, ” “preventing, ” and “prevention” refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptom (s) (e.g., a cancer) .

[0095] As used herein, “delaying” the development of cancer means to defer, hinder, slow, retard, stabilize, and / or postpone development of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. A method that “delays” development of cancer is a method that reduces probability of disease development in a given time frame and / or reduces the extent of the disease in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a statistically significant number of individuals. Cancer development can be detectable using standard methods, including, but not limited to, computerized axial tomography (CAT Scan) , Magnetic Resonance Imaging (MRI) , abdominal ultrasound, clotting tests, arteriography, or biopsy. Development may also refer to cancer progression that may be initially undetectable and includes occurrence, recurrence, and onset.

[0096] The terms “about” and “approximately” mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, or less of a given value or range.

[0097] As used in the present disclosure and claims, the singular forms “a” , “an” and “the” include plural forms unless the context clearly dictates otherwise.

[0098] It is understood that wherever embodiments are described herein with the term “comprising” otherwise analogous embodiments described in terms of “consisting of” and / or “consisting essentially of” are also provided. It is also understood that wherever embodiments are described herein with the phrase “consisting essentially of” otherwise analogous embodiments described in terms of “consisting of” are also provided.

[0099] The term “between” as used in a phrase as such “between A and B” or “between A-B” refers to a range including both A and B.

[0100] The term “and / or” as used in a phrase such as “A and / or B” herein is intended to include both A and B; A or B; A (alone) ; and B (alone) . Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone) ; B (alone) ; and C (alone) . II. Engineered Immune Cells

[0101] In one aspect, there is provided an engineered immune cell (e.g., engineered T cell) comprising: (a) a chimeric receptor (e.g., any of the DLL3-targeted chimeric receptors described herein, such as an anti-DLL3 CAR) , wherein the chimeric receptor comprises an antigen binding domain (e.g., sdAb, Fab, or scFv) that specifically binds to DLL3; and (b) a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3 or anti-B7H3 MSAP) . In one aspect, there is provided an engineered immune cell (e.g., engineered T cell) comprising: (a) a first nucleic acid encoding a chimeric receptor (e.g., any of the DLL3-targeted chimeric receptors described herein, such as an anti-DLL3 CAR) , wherein the chimeric receptor comprises an antigen binding domain (e.g., sdAb, Fab, or scFv) that specifically binds to DLL3; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3 or anti-B7H3 MSAP) . The DLL3-targeted chimeric receptor may be a DLL3 engineered TCR. In some embodiments, the DLL3-targeted chimeric receptor is a DLL3-targeted cTCR. In some embodiments, the DLL3-targeted chimeric receptor is an anti-DLL3 CAR, such as any of the anti-DLL3 CARs described herein. In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR.

[0102] In some embodiments, the DLL3-targeted chimeric receptor is an anti-DLL3 CAR, such as an anti-DLL3 sdAb CAR. Hence in some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) expressing an anti-DLL3 CAR or comprising a nucleic acid encoding said anti-DLL3 CAR, wherein the anti-DLL3 CAR comprises: (i) an antigen binding domain (e.g., sdAb, scFv, or Fab) specifically recognizing DLL3; (ii) an optional hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) . The intracellular co-stimulatory signaling domain can be at the N-terminus or the C-terminus of the intracellular signaling domain. In some embodiments, the antigen binding domain of the chimeric receptor is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, a single chain Fv (scFv) , a single domain antibody (sdAb) , and a peptide ligand specifically binding to DLL3. In some embodiments, the antigen binding domain is an sdAb ( “anti-DLL3 sdAb” ) . In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) expressing an anti-DLL3 CAR or comprising a nucleic acid encoding the anti-DLL3 CAR, wherein the anti-DLL3 CAR comprises from N’ to C’ : (i) an anti-DLL3 sdAb (e.g., any of the anti-DLL3 sdAbs provided herein) ; (ii) a hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) . In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; or (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb is a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains. In some embodiments, the anti-DLL3 CAR comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the nucleic acid encoding the anti-DLL3 CAR further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the CAR. Thus, in some embodiments, there is provided an engineered immune cell comprising an anti-DLL3 CAR comprising the amino acid sequence of SEQ ID NO: 10 or 40. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR.

[0103] In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) (a) expressing an anti-DLL3 CAR or comprising a first nucleic acid encoding said anti-DLL3 CAR, wherein the anti-DLL3 CAR comprises: (i) an antigen binding domain (e.g., sdAb, scFv, or Fab) specifically recognizing DLL3; (ii) an optional hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) ; and (b) expressing a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3 or anti-B7H3 MSAP) or comprises a second nucleic acid encoding said MSAP. The intracellular co-stimulatory signaling domain can be at the N-terminus or the C-terminus of the intracellular signaling domain. In some embodiments, the antigen binding domain of the chimeric receptor is selected from the group consisting of a Fab, a Fab’ , a (Fab’ ) 2, an Fv, a single chain Fv (scFv) , a single domain antibody (sdAb) , and a peptide ligand specifically binding to DLL3. In some embodiments, the antigen binding domain is an sdAb ( “anti-DLL3 sdAb” ) . In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) (a) expressing an anti-DLL3 CAR or comprising a first nucleic acid encoding the anti-DLL3 CAR, wherein the anti-DLL3 CAR comprises from N’ to C’ : (i) an anti-DLL3 sdAb (e.g., any of the anti-DLL3 sdAbs provided herein) ; (ii) a hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) ; and (b) expressing a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3 or anti-B7H3 MSAP) or comprising a second nucleic acid encoding said MSAP. In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; and / or (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb is a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 CAR comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the nucleic acid encoding the anti-DLL3 CAR further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the anti-DLL3 CAR. Thus, in some embodiments, there is provided an engineered immune cell comprising: (a) a first nucleic acid encoding an anti-DLL3 CAR comprising the amino acid sequence of SEQ ID NO: 10 or 40; and (b) a second nucleic acid encoding an MSAP (e.g., an anti-DLL3 or anti-B7H3 MSAP) . In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR.

[0104] In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) comprising (a) a first nucleic acid encoding chimeric receptor (e.g., an anti-DLL3 chimeric receptor) , wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) expressing a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3 or anti-B7H3 MSAP) or comprises a second nucleic acid encoding said MSAP; wherein the MSAP comprises: (i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ; e.g., anti-DLL3 molecule or anti-B7H3 molecule) , wherein the first moiety comprises: (a) an anti-DLL3 molecule (e.g., sdAb) comprising an H-CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, an H-CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, and an H-CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13; and / or (b) an anti-B7H3 molecule (e.g., scFv or Fab) comprising an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21; and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the anti-DLL3 molecule (e.g., sdAb) comprises a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, anti-B7H3 molecule (e.g., scFv or Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the anti-B7H3 molecule is an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23. In some embodiments, the second moiety specifically binds to a target epitope on an immune cell selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the immune cell is a T cell. In some embodiments, the second moiety specifically binds to an epitope of a T cell-specific protein selected from the group consisting of CD3, CD4, CD8, TCRα, TCRβ, TCRγ, and TCRδ. In some embodiments, the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) . In some embodiments, the anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the anti-CD3 antigen binding moiety comprises a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31. In some embodiments, the anti-CD3 antigen binding moiety is an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises (a) an anti-DLL3 sdAb comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14, and / or an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23; and (b) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises (a) an anti-DLL3 sdAb comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14; and (b) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises (a) an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23; and (b) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises the amino acid sequence of SEQ ID NO: 33 or 34. In some embodiments, the nucleic acid encoding the MSAP further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35 or 46) N-terminal to the MSAP (e.g., N-terminal to the scFv, and / or N-terminal to the sdAb) . In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) comprising a nucleic acid encoding a polypeptide sequence of SEQ ID NO: 44 or 45. In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR.

[0105] In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) comprising: (a) a first nucleic acid encoding a chimeric receptor (e.g., any of the DLL3-targeted chimeric receptors described herein, such as an anti-DLL3 CAR) , wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 or anti-B7H3 MSAP) . The DLL3-targeted chimeric receptor can be an anti-DLL3 engineered TCR, DLL3-targeted cTCR, or anti-DLL3 CAR. In some embodiments, the first nucleic acid and the second nucleic acid are on different vectors. In some embodiments, the first nucleic acid and the second nucleic acid are on the same vector, such as under the control of separate promoters, or under the control of the same promoter. In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) comprising: (a) a first nucleic acid encoding a chimeric receptor (e.g., any of the DLL3-targeted chimeric receptors described herein, such as an anti-DLL3 CAR) , wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 or anti-B7H3 MSAP) , wherein the first nucleic acid and the second nucleic acid are on the same vector and under the control of the same promoter, and wherein the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid (e.g., IRES, or encoding a cleavable linker such as 2A peptide) . In some embodiments, the first nucleic acid is upstream of the second nucleic acid. In some embodiments, the linking nucleic acid encodes a P2A comprising the amino acid sequence of SEQ ID NO: 43. In some embodiments, the first nucleic acid further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the chimeric receptor. In some embodiments, the second nucleic acid further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35 or 46) N-terminal to the MSAP (e.g., N-terminal to the scFv, and / or N-terminal to the sdAb) . In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR.

[0106] In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) comprising: a) a first nucleic acid encoding an anti-DLL3 CAR (e.g., any of the anti-DLL3 CARs described herein) , wherein the anti-DLL3 CAR comprises: (i) an antigen binding domain (e.g., sdAb, scFv, or Fab) that specifically binds to DLL3; (ii) an optional hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) ; and (b) a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 or anti-B7H3 MSAP) . In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) comprising: (a) a first nucleic acid encoding an anti-DLL3 CAR (e.g., any of the anti-DLL3 CARs described herein) , wherein the anti-DLL3 CAR comprises: (i) an antigen binding domain (e.g., sdAb, scFv, or Fab) that specifically binds to DLL3; (ii) an optional hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) ; and (b) a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 or anti-B7H3 MSAP) ; wherein the first nucleic acid and the second nucleic acid are on the same vector and under the control of the same promoter, and wherein the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid (e.g., IRES, or encoding a cleavable linker such as 2A peptide) . In some embodiments, the first nucleic acid is upstream of the second nucleic acid. In some embodiments, there is provide an engineered immune cell (e.g., engineered T cell) comprising a vector (e.g., viral vector, such as lentiviral vector) , wherein the vector comprises from 5'to 3': a promoter (e.g., hEF1α promoter) -a first nucleic acid encoding an anti-DLL3 CAR (e.g., any of the anti-DLL3 CARs described herein) -a linking nucleic acid (e.g., encoding P2A or T2A) -a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 or anti-B7H3 MSAP) ; and wherein the anti-DLL3 CAR comprises: (a) an antigen binding domain (e.g., sdAb, scFv, or Fab) that specifically binds to DLL3; (b) an optional hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; (d) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (e) an intracellular signaling domain (e.g., derived from CD3ζ) . In some embodiments, the linking nucleic acid encodes a P2A comprising the amino acid sequence of SEQ ID NO: 43. The intracellular co-stimulatory signaling domain can be at the N-terminus or the C-terminus of the intracellular signaling domain. In some embodiments, the anti-DLL3 CAR comprises from N’ to C’: (a) an anti-DLL3 sdAb (e.g., any of the anti-DLL3 sdAbs provided herein, such as the anti-DLL3 sdAbs comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, or 14) ; (b) a hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; (d) an intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (e) an intracellular signaling domain (e.g., derived from CD3ζ) . In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; and / or (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-DLL3 sdAb comprises at least one VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb is a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 CAR comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the first nucleic acid further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the anti-DLL3 CAR. In some embodiments, the MSAP comprises: (i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ; e.g., an anti-DLL3 molecule or anti-B7H3 molecule) ; and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the MSAP comprises: (a) an anti-DLL3 molecule (e.g., sdAb) comprising a CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, a CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, and a CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13; and / or (b) an anti-B7H3 molecule (e.g., scFv or Fab) comprising an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21. In some embodiments, the anti-DLL3 molecule (e.g., sdAb) comprises a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, anti-B7H3 molecule (e.g., scFv or Fab) comprises a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the anti-B7H3 molecule is an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23. In some embodiments, the second moiety specifically binds to a target epitope on an immune cell selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the immune cell is a T cell. In some embodiments, the second moiety specifically binds to an epitope of a T cell-specific protein selected from the group consisting of CD3, CD4, CD8, TCRα, TCRβ, TCRγ, and TCRδ. In some embodiments, the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) . In some embodiments, the anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the anti-CD3 antigen binding moiety comprises a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31. In some embodiments, the anti-CD3 antigen binding moiety is an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises (a) an anti-DLL3 sdAb comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14, and / or an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23; and (b) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises: (a) an anti-DLL3 molecule (e.g., sdAb) comprising a CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, a CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, and a CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13; and (b) an anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the MSAP comprises: (a) an anti-B7H3 molecule (e.g., scFv or Fab) comprising an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21; and (b) an anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the MSAP comprises (a) an anti-DLL3 sdAb comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14; and (b) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises (a) an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23; and (b) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises the amino acid sequence of SEQ ID NO: 33 or 34. In some embodiments, the nucleic acid encoding the MSAP further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35 or 46) N-terminal to the MSAP (e.g., N-terminal to the scFv, and / or N-terminal to the sdAb) . In some embodiments, there is provided an engineered immune cell (e.g., engineered T cell) co-expressing an anti-DLL3 CAR and an MSAP, or comprising a vector (e.g., viral vector, such as lentiviral vector) encoding the anti-DLL3 CAR and the MSAP, wherein the vector encodes a polypeptide sequence of SEQ ID NO: 44 or 45. In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR. A. Chimeric receptors

[0107] The engineered immune cells described herein comprise a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically recognizes DLL3. The DLL3-targeted chimeric receptor can be any chimeric receptor that specifically recognizes DLL3 and is capable of activating the engineered immune cell (e.g., inducing cytokine secretion, and / or inducing DLL3-mediated immune cell cytotoxicity) . In some embodiments, the chimeric receptor is an engineered T cell receptor (TCR) , a chimeric TCR (cTCR) , or a chimeric antigen receptor (CAR) .

[0108] In some embodiments, the chimeric receptor is a CAR (hereinafter also referred to as “anti-DLL3 CAR” ) . The CAR may comprise from N-terminus to C-terminus: (a) an antigen binding domain specifically recognizing DLL3 (e.g., any of the anti-DLL3 sdAbs provided herein) ; (b) an optional hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; (d) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (e) an intracellular signaling domain (e.g., derived from CD3ζ) . The CAR may comprise from N-terminus to C-terminus: (a) an antigen binding domain specifically recognizing DLL3 (e.g., any of the anti-DLL3 sdAbs provided herein) ; (b) an optional hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; (d) an intracellular signaling domain (e.g., derived from CD3ζ) ; and (e) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) . The antigen binding domain of the anti-DLL3 CAR may be selected from the group consisting of a Fab, a Fab’ , a (Fab’ ) 2, an Fv, a single chain Fv (scFv) , and a single domain antibody (sdAb) specifically binding to DLL3. In some embodiments, the antigen binding domain of the CAR is an anti-DLL3 sdAb. In some embodiments, the antigen binding domain comprises two or more antigen-binding fragments (e.g., scFv or sdAb) specifically recognizing DLL3, such as connected in tandem. The two or more antigen-binding fragments can be the same or different. The two or more antigen-binding fragments can recognize the same epitope or different epitopes of DLL3. In some embodiments, the CAR comprises from N-terminus to C-terminus: (a) an anti-DLL3 sdAb (e.g., any of the anti-DLL3 sdAbs provided herein) ; (b) a hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; (d) an intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (e) an intracellular signaling domain (e.g., derived from CD3ζ) . In some embodiments, the transmembrane domain is derived from CD8α, such as comprising the amino acid sequence of SEQ ID NO: 37. In some embodiments, the intracellular signaling domain is derived from CD3ζ, such as comprising the amino acid sequence of SEQ ID NO: 39. In some embodiments, the intracellular co-stimulatory signaling domain is derived from a cytoplasmic domain of CD137, such as comprising the amino acid sequence of SEQ ID NO: 38. In some embodiments, the hinge domain is derived from CD8α, such as comprising the amino acid sequence of SEQ ID NO: 36. In some embodiments, the CAR further comprises a chimeric receptor signal peptide N-terminal to the antigen binding domain specifically recognizing DLL3. In some embodiments, the chimeric receptor signal peptide is derived from a CD8α propeptide, such as comprising the amino acid sequence of SEQ ID NO: 35.

[0109] In some embodiments, the anti-DLL3 CAR comprises from N’ to C’ : (a) an anti-DLL3 sdAb; (b) an optional hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; and (d) an intracellular signaling domain (e.g., derived from CD3ζ) ; wherein the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; and / or (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, anti-DLL3 sdAb is a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains comprising the amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the tandem anti-DLL3 sdAb comprises the amino acid sequence of SEQ ID NO: 9. Hence in some embodiments, the anti-DLL3 CAR comprises from N’ to C’ : (a) an anti-DLL3 sdAb; (b) an optional hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; and (d) an intracellular signaling domain (e.g., derived from CD3ζ) ; wherein the anti-DLL3 sdAb comprises a tandem anti-DLL3 sdAb comprising the amino acid sequence of SEQ ID NO: 9. In some embodiments, the CAR further comprises an intracellular co-stimulatory signaling domain, such as an intracellular co-stimulatory signaling domain comprising a cytoplasmic domain of CD137. In some embodiments, the intracellular co-stimulatory signaling domain is at the C-terminus of the intracellular signaling domain. In some embodiments, the intracellular co-stimulatory signaling domain is at the N-terminus of the intracellular signaling domain. Hence in some embodiments, the anti-DLL3 CAR comprises from N’ to C’ : (a) an anti-DLL3 sdAb; (b) a hinge domain (e.g., derived from CD8α) ; (c) a transmembrane domain (e.g., derived from CD8α) ; (d) an intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (e) an intracellular signaling domain (e.g., derived from CD3ζ) ; wherein the anti-DLL3 sdAb comprises a tandem anti-DLL3 sdAb comprising the amino acid sequence of SEQ ID NO: 9. In some embodiments, the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 37. In some embodiments, the intracellular signaling domain comprises the amino acid sequence of SEQ ID NO: 39. In some embodiments, the hinge domain comprises the amino acid sequence of SEQ ID NO: 36. In some embodiments, the intracellular co-stimulatory signaling domain comprises the amino acid sequence of SEQ ID NO: 38. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the CAR further comprises a chimeric receptor signal peptide N-terminal to the anti-DLL3 sdAb. In some embodiments, the chimeric receptor signal peptide comprises the amino acid sequence of SEQ ID NO: 35. In some embodiments, the CAR comprising the chimeric receptor signal peptide comprises the amino acid sequence of SEQ ID NO: 40.

[0110] In some embodiments, the chimeric receptor is an engineered TCR (hereinafter also referred to as “anti-DLL3 engineered TCR” ) . The engineered TCR may comprise i) an antigen binding domain that comprises a Vα and a Vβ (or a Vδ and a Vγ) derived from a wildtype TCR together specifically recognizing DLL3, wherein the Vα, the Vβ, or both (or the Vδ, the Vγ, or both) , comprise one or more mutations (e.g., insertions, deletions, or substitutions, such as conservative substitutions) in one or more CDRs relative to the wild type TCR; and ii) a transmembrane domain (TM) derived from a TCR molecule (e.g., TCRα / TCRβ, or TCRδ / TCRγ) . The engineered TCR can be a single chain TCR (scTCR) or a dimeric TCR (dTCR) . For example, the engineered TCR may comprise: i) a first polypeptide chain comprising from N’ to C’: Vα (e.g., Vα variant) –Cα –TMα –optional TCRα cytoplasmic domain (cytoTCRα) , and ii) a second polypeptide chain comprising from N’ to C’ : Vβ (e.g., Vβ variant) –Cβ –TMβ –optional cytoTCRβ; wherein the Vα and the Vβ form an antigen binding domain that specifically recognizes DLL3. The engineered TCR may comprise: i) a first polypeptide chain comprising from N’ to C’ : Vγ (e.g., Vγ variant) –Cγ –TMγ –optional cytoTCRγ, and ii) a second polypeptide chain comprising from N’ to C’ : Vδ (e.g., Vδ variant) –Cδ –TMδ –optional cytoTCRδ; wherein the Vγ and the Vδ form an antigen binding domain that specifically recognizes DLL3. The engineered TCR may bind to the same cognate peptide-MHC bound by the wildtype TCR. The engineered TCR may bind to the same cognate peptide-MHC with higher affinity compared to that bound by the wildtype TCR. The engineered TCR may bind to the same cognate peptide-MHC with lower affinity compared to that bound by the wildtype TCR. The engineered TCR may bind to a non-cognate peptide-MHC not bound by the wildtype TCR. The engineered TCR may not comprise an intracellular signaling domain. The engineered TCR may further comprise a hinge domain (or a connecting domain) between the TCR Ig-like constant domain and the TCR transmembrane domain, such as a hinge domain derived from TCRα / TCRβ or TCRδ / TCRγ.

[0111] In some embodiments, the chimeric receptor is a chimeric T cell receptor (cTCR; hereinafter also referred to as “DLL3-targeted cTCR” ) . The cTCR may comprise: i) an antigen binding domain comprising an antibody or antigen-binding fragment thereof (e.g., scFv, Fab, or sdAb) that specifically recognizes DLL3 (e.g., any of the anti-DLL3 sdAbs provided herein) , and ii) a full-length TCR subunit, wherein the TCR subunit is selected from the group consisting of TCRα, TCRβ, TCRγ, TCRδ, CD3γ, CD3ε, and CD3δ; wherein the antigen binding domain is fused (directly or indirectly) to the N-terminus of the full-length TCR subunit. For example, the cTCR may comprise from N’ to C’ : i) an antigen binding domain comprising an antibody or antigen-binding fragment thereof (e.g., scFv, Fab, or sdAb) that specifically recognizes DLL3 (e.g., any of the anti-DLL3 sdAbs provided herein) , ii) an optional extracellular domain (ECD) or portion thereof derived from a first TCR subunit, and iii) a transmembrane domain derived from a second TCR subunit; wherein the first TCR subunit and the second TCR subunit are independently selected from the group consisting of TCRα, TCRβ, TCRγ, TCRδ, CD3γ, CD3ε, and CD3δ. The cTCR can be incorporated into a functional TCR complex along with other endogenous TCR subunits and confer antigen specificity to the TCR complex. The antigen binding domain of the anti-DLL3 cTCR may be selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, an scFv, and an sdAb. The cTCR antigen binding domain may be fused to the N-terminus of the full-length or a portion thereof of CD3ε, CD3γ, or CD3δ. The cTCR antigen binding domain may be fused to the N-terminus of a TCRα molecule (with or without the Vα domain) , and / or the N-terminus of a TCRβ molecule (with or without the Vβ domain) . The cTCR antigen binding domain may be fused to the N-terminus of a TCRγ molecule (with or without the Vγ domain) , and / or the N-terminus of a TCRδ molecule (with or without the Vδdomain) . The cTCR may not comprise an intracellular signaling domain. The cTCR may comprise an intracellular signaling domain, such as the intracellular signaling domain of CD3γ, CD3ε, or CD3δ. The cTCR intracellular signaling domain and the cTCR transmembrane domain can be derived from the same TCR subunit, e.g., both from CD3ε, both from CD3ε, or both from CD3δ. The cTCR antigen binding domain and the first TCR subunit (full-length or an ECD portion thereof) can be fused via a linker (such as a GS linker) . In some embodiments, the cTCR antigen binding domain is fused to the N-terminus of the transmembrane domain via an optional linker or hinge domain. The cTCR may further comprise a hinge domain between the ECD portion derived from the first TCR subunit and the transmembrane domain derived from the second TCR subunit. In some embodiments, the cTCR comprises from N-terminus to C-terminus: (a) an antigen binding domain comprising an antibody or antigen-binding fragment thereof (e.g., scFv, Fab, or sdAb) that specifically recognizes DLL3 (e.g., any of anti-DLL3 sdAbs provided herein) ; (b) an optional linker, (c) an optional extracellular domain of a first TCR subunit (e.g., CD3ε) or a portion thereof, (d) an optional hinge domain, (e) a transmembrane domain derived from a second TCR subunit (e.g., CD3ε) , and (f) an optional cytoplasmic domain (e.g., optional intracellular signaling domain) ; wherein the first and second TCR subunits are independently selected from the group consisting of TCRα, TCRβ, TCRγ, TCRδ, CD3ε, CD3γ, and CD3δ. The first and second TCR subunits can be the same or different. In some embodiments, the cTCR comprises from N-terminus to C-terminus: (a) an anti-DLL3 scFv or sdAb (e.g., any of the anti-DLL3 sdAbs described herein) ; (b) an optional linker, and (c) a full-length CD3ε, CD3γ, or CD3δ.

[0112] Each component of chimeric receptors and optionally additional regions are described in more detail below.Antigen binding domain specifically recognizing DLL3

[0113] In some embodiments, the DLL3-targeted chimeric receptor or the antigen binding domain comprises a means for specifically recognizing DLL3. In some embodiments, the antigen binding domain of the chimeric receptor (e.g., cTCR or CAR) is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, an scFv, an sdAb, and a peptide ligand specifically binding to DLL3. In some embodiments, the antigen binding domain is an anti-DLL3 scFv or an anti-DLL3 Fab. In some embodiments, the antigen binding domain is an anti-DLL3 sdAb. In some embodiments, the antigen binding domain is monospecific and monovalent. In some embodiments, the antigen binding domain is monospecific (e.g., specifically binding to the same DLL3 epitope) and multivalent. In some embodiments, the antigen binding domain is multispecific (e.g., specifically binding to different DLL3 epitopes) and multivalent.

[0114] The chimeric receptor antigen binding domain can specifically recognize DLL3 of any source. In some embodiments, the DLL3 is a human DLL3. In some embodiments, the DLL3 is from any of mice, rats, hamsters, guinea pigs, rabbits, chinchillas, cats, dogs, horses, donkeys, cows, goats, sheep, deer, monkeys, apes, etc. In some embodiments, the chimeric receptor antigen binding domain specifically recognizes human DLL3. In some embodiments, the chimeric receptor antigen binding domain does not cross-react with DLL3 from a non-human species. In some embodiments, the chimeric receptor antigen binding domain cross-reacts with DLL3 from a non-human species, such as mouse, rat, or monkey (e.g., cynomolgus monkey) DLL3. Using chimeric receptor antigen binding domain that cross-reacts with DLL3 from a non-human species can help extrapolate animal study data to human clinical trials. DLL3 recognized by the chimeric receptor antigen binding domain can be wildtype DLL3 or mutant DLL3.

[0115] Any antibodies or antigen-binding fragments specifically recognizing DLL3 can be used in the chimeric receptor antigen binding domains described herein. Exemplary anti-DLL3 antibodies or antigen-binding fragments include but are not limited to, antibody moiety contained in tarlatamab (AMG 757; e.g., AMGEN) , rovalpituzumab tesirine (e.g., Stemcentrx, AbbVie) , MAB4315 (e.g., BioTechne) , 7B7 (e.g., Invitrogen) , 7H24L4 (e.g., Invitrogen) , 11H27L9 (e.g., Invitrogen) , E3J5R (e.g., Cell Signaling Technology) , HA710326 (e.g., HUABIO) , EPR22592-18 (e.g., AbCam) , or those described in PCT / US2019 / 053017, PCT / US2015 / 017171, US10294300, US11673953, US9127071, etc., the contents of each of which are incorporated herein by reference in their entirety. Anti-DLL3 single domain antibody (sdAb)

[0116] In some embodiments, the antigen binding domain of the chimeric receptor (e.g., cTCR or CAR) comprises (or consists of, or consists essentially of) one or more anti-DLL3 sdAbs, such as connected in tandem. In some embodiments, the antigen binding domain of the chimeric receptor (e.g., cTCR or CAR) comprises (or consists of, or consists essentially of) an anti-DLL3 sdAb.

[0117] In some embodiments, the anti-DLL3 sdAb binds to human DLL3. DLL3 (UniProtKB: Q9NYJ7) is a protein that functions in axial skeletal development during embryonic development by inhibiting the activity of Notch1. DLL3 expression has also been identified in neuroendocrine cells (e.g., within the gastrointestinal tract) in healthy adults. Endogenous DLL3 localizes in the Golgi apparatus and emerges on the cell surface when overexpressed. DLL3 does not bind to Notch receptors, and it inactivates Notch signaling in cis. Additionally, DLL3 prevents the localization of Notch and DLL1 (Notch activating ligand) to the cell surface via intracellular retainment. (Matsuo et al. (2019) Cancer Sci 110 (10) : 3122-3131) . In tumor samples, DLL3 expression is largely associated with various neuroendocrine tumors and small cell lung cancers (SCLCs) . DLL3 is expressed in the majority of SCLCs.

[0118] In some embodiments, the anti-DLL3 sdAb modulates one or more DLL3 activities. In some embodiments, the anti-DLL3 sdAb is an antagonist antibody.

[0119] In some embodiments, the anti-DLL3 sdAb binds to DLL3 (e.g., human DLL3) with a dissociation constant (KD) of ≤ 1μM, ≤ 100 nM, ≤ 10 nM, ≤ 1 nM, ≤ 0.1 nM, ≤ 0.01 nM, or ≤ 0.001 nM (e.g., about 10-8 M or less, such as any of from about 10-8 M to about 10-13 M, from about 10-9 M to about 10-13 M, from about 10-10 M to about 10-13 M, or from about 10-11 M to about 10-13 M) . A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present disclosure, including by RIA, for example, performed with the an antibody of interest and its antigen (Chen et al., 1999, J. Mol Biol 293: 865-81) ; by biolayer interferometry (BLI) or surface plasmon resonance (SPR) assays by  using, for example, an Red96 system, or by using, for example, a  TM-2000 or a TM-3000. An “on-rate” or “rate of association” or “association rate” or “kon” may also be determined with the same BLI or SPR techniques described above using, for example, the Red96, the TM-2000, or the TM-3000 system.

[0120] In some embodiments, the anti-DLL3 sdAb comprises a VNAR domain. In some embodiments, the anti-DLL3 sdAb comprises a VHH domain. In some embodiments, the anti-DLL3 sdAb comprises from N’ to C’: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0121] In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, and / or (ii) a CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, and / or (iii) a CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13. In some embodiments, the anti-DLL3 sdAb comprises (i) a CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; (ii) a CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; and (iii) a CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) . In some embodiments, the anti-DLL3 sdAb comprises (i) a CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; (ii) a CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; and (iii) a CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13. In some embodiments, the anti-DLL3 sdAb comprises a CDR1 comprising the amino acid sequence of any one of SEQ ID NOs: 1, 5, and 11, a CDR2 comprising the amino acid sequence of any one of SEQ ID NOs: 2, 6, and 12, and a CDR3 comprising the amino acid sequence of any one of SEQ ID NOs: 3, 7, and 13. In some embodiments, the anti-DLL3 sdAb comprises one, two, or all three CDRs of a VHH of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb comprises CDR1, CDR2, and CDR3 of a VHH of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb is camelid. In some embodiments, the anti-DLL3 sdAb is humanized. In some embodiments, the anti-DLL3 sdAb comprises an acceptor human framework, e.g., a human immunoglobulin framework or a human consensus framework. CDR sequences can be determined according to well-known numbering systems / schemes, such as any of IMGT, Kabat, AbM, Chothia, and Contact numbering scheme, or a combination thereof. In some embodiments, the CDRs are determined according to Kabat numbering scheme. In some embodiments, the CDRs are determined according to AbM numbering scheme.

[0122] In some embodiments, the anti-DLL3 sdAb comprises one, two, three, or all four framework regions of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb comprises one, two, three, or all four framework regions derived from a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb comprises all four framework regions derived from a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb is camelid. In some embodiments, the anti-DLL3 sdAb is humanized. In some embodiments, the anti-DLL3 sdAb comprises an acceptor human framework, e.g., a human immunoglobulin framework or a human consensus framework.

[0123] In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; (ii) a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; and (iii) a CDR3 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) . In some embodiments, the anti-DLL3 sdAb comprises: a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3. In some embodiments, the anti-DLL3 sdAb is camelid. In some embodiments, the anti-DLL3 sdAb is humanized. In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising the amino acid sequence of SEQ ID NO: 4, or a variant thereof having at least about 85% (e.g., at least about any of 90%, 95%, 96%, 96%, 98%, 99%, or more) sequence identity to SEQ ID NO: 4.

[0124] In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; (ii) a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; and (iii) a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) . In some embodiments, the anti-DLL3 sdAb comprises: a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and (iii) a CDR3 comprising the amino acid sequence of SEQ ID NO: 7. In some embodiments, the anti-DLL3 sdAb is camelid. In some embodiments, the anti-DLL3 sdAb is humanized. In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising the amino acid sequence of SEQ ID NO: 8, or a variant thereof having at least about 85% (e.g., at least about any of 90%, 95%, 96%, 96%, 98%, 99%, or more) sequence identity to SEQ ID NO: 8.

[0125] In some embodiments, the anti-DLL3 sdAb comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; (ii) a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) ; and (iii) a CDR3 comprising the amino acid sequence of SEQ ID NO: 13, or a variant thereof comprising up to 5 (e.g., 5, 4, 3, 2, or 1) amino acid variations (e.g., insertion, deletion, or substitution, such as conservative substitution) . In some embodiments, the anti-DLL3 sdAb comprises: a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-DLL3 sdAb is camelid. In some embodiments, the anti-DLL3 sdAb is humanized. In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising the amino acid sequence of SEQ ID NO: 14, or a variant thereof having at least about 85% (e.g., at least about any of 90%, 95%, 96%, 96%, 98%, 99%, or more) sequence identity to SEQ ID NO: 14.

[0126] In some embodiments, the anti-DLL3 sdAb comprises a VHH having at least about any one of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to an amino acid sequence selected from SEQ ID NOs: 4, 8, and 14. In some embodiments, the VHH with sequence variation contains substitutions (e.g., conservative substitutions) , insertions, and / or deletions relative to the reference sequence, but the anti-DLL3 sdAb comprising that variant sequence retains the ability to bind to DLL3. In some embodiments, a total of 1 to 10 amino acids have been substituted, inserted and / or deleted in an amino acid sequence selected from any of SEQ ID NOs: 4, 8, and 14. In some embodiments, substitutions, insertions, and / or deletions occur in regions outside the CDRs (i.e., in the FRs) . In some embodiments, the anti-DLL3 sdAb comprises a VHH comprising the amino acid sequence of any of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb comprises a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains. In some embodiments, the at least two anti-DLL3 VHH domains are selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-DLL3 sdAb comprises a tandem anti-DLL3 sdAb comprising two anti-DLL3 VHH domains, wherein the first anti-DLL3 VHH domain comprises the amino acid sequence of SEQ ID NO: 4, and wherein the second anti-DLL3 VHH domain comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the tandem anti-DLL3 sdAb comprises the amino acid sequence of SEQ ID NO: 9. In some embodiments, the anti-DLL3 sdAb contains post-translational modifications of that sequence.

[0127] The CDR sequences described herein can be determined according to well-known numbering schemes. In some embodiments, the CDRs may be determined according to the IMGT numbering scheme, the Kabat numbering scheme, the AbM numbering scheme, the Chothia numbering scheme, the Contact numbering scheme, or a combination thereof. In some embodiments, the CDRs may be determined according to the AbM numbering scheme.

[0128] Functional epitopes can be mapped, e.g., by combinatorial alanine scanning, to identify amino acids in the DLL3 protein that are necessary for interaction with anti-DLL3 sdAbs provided herein. Conformational and crystal structure of anti-DLL3 sdAb bound to DLL3 may be employed to identify the epitopes. In some embodiments, the anti-DLL3 sdAb specifically binds to the same DLL3 epitope as any of the anti-DLL3 sdAbs provided herein. In some embodiments, the anti-DLL3 sdAb specifically binds to the same DLL3 epitope as an anti-DLL3 sdAb comprising a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14.

[0129] In some embodiments, the anti-DLL3 sdAb specifically binds to DLL3 competitively with any one of the anti-DLL3 sdAbs described herein. In some embodiments, the anti-DLL3 sdAb specifically binds to DLL3 competitively with an anti-DLL3 sdAb comprising a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, competitive binding may be determined using an ELISA assay.Transmembrane domain

[0130] The chimeric receptors of the present disclosure comprise a transmembrane domain that can be directly or indirectly fused to the extracellular antigen binding domain. Any protein structure that is thermodynamically stable in a cell membrane, such as a eukaryotic cell membrane, can be used as the transmembrane domain herein. The transmembrane domain may be derived either from a natural or from a synthetic source. For example, it can be a synthetic, non-naturally occurring protein segment, e.g., a hydrophobic protein segment that is thermodynamically stable in a cell membrane. The transmembrane domain can be derived from a wildtype protein, or contains one or more mutations (e.g., insertion, deletion, and / or substitution, such as conservative substitution) . A transmembrane domain containing one or more mutations can be employed to avoid mispairing with endogenous protein, e.g., endogenous TCR complex component (s) , in order to enhance correct chimeric receptor assembly and / or expression level.

[0131] In some embodiments, the chimeric receptor is an anti-DLL3 CAR. In some embodiments, the transmembrane domain of the CAR is derived from a Type I single-pass membrane protein. In some embodiments, transmembrane domains from multi-pass membrane proteins may also be compatible for use in the CARs described herein. Multi-pass membrane proteins may comprise a complex of (at least 2, 3, 4, 5, 6, 7 or more) alpha helices or a beta sheet structure. In some embodiments, the N-terminus and the C-terminus of a multi-pass membrane protein are present on opposing sides of the lipid bilayer, e.g., the N-terminus of the protein is present on the cytoplasmic side of the lipid bilayer and the C-terminus of the protein is present on the extracellular side.

[0132] In some embodiments, the transmembrane domain of the CAR is derived from a molecule selected from the group consisting of: an α, β or ζ chain of a TCR, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, 4-1BB (CD137) , CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18) , ICOS (CD278) , 4-1BB (CD137) , GITR, CD40, BAFFR, HVEM (LIGHTR) , SLAMF7, NKp80 (KLRF1) , CD160, Claudin-6, IL-2Rβ, IL-2Rγ, IL-7Ra, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226) , SLAMF4 (CD244, 2B4) , CD84, CD96 (Tactile) , CEACAM1, CRT AM, Ly9 (CD229) , CD160 (BY55) , PSGL1, CDIOO (SEMA4D) , SLAMF6 (NTB-A, Ly108) , SLAM (SLAMF1, CD150, IPO-3) , BLAME (SLAMF8) , SELPLG (CD162) , LTBR, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, and NKG2C. In some embodiments, the transmembrane domain is derived from a molecule selected from the group consisting of CD8α, CD4, CD28, CD137, CD80, CD86, CD152, and PD-1.

[0133] In some specific embodiments, the transmembrane domain of the CAR is derived from CD8α. In some embodiments, the transmembrane domain comprises the amino acid sequence of SEQ ID NO: 37.Hinge domain

[0134] The chimeric receptors of the present disclosure (e.g., engineered TCR, cTCR, or CAR) may comprise a hinge domain that is located between the extracellular antigen binding domain and the transmembrane domain. A hinge domain is an amino acid segment that is generally found between two domains of a protein and may allow for flexibility of the protein and movement of one or both of the domains relative to one another. Any amino acid sequence that provides such flexibility and movement of the extracellular antigen binding domain relative to the transmembrane domain of the effector molecule can be used. A peptide linker (e.g., any of those described in the “Peptide Linker” subsection below) can be used as a hinge domain. The hinge domain may confer stability to a multi-chain chimeric receptor, such as by forming disulfide-bond between two polypeptide chains of a chimeric receptor (e.g., a CH1-CL pair hinge domain, or an antibody hinge region pair) .

[0135] The hinge domain may contain about 10-100 amino acids, e.g., about any one of 15-75 amino acids, 20-50 amino acids, or 30-60 amino acids. In some embodiments, the hinge domain may be at least about any one of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 amino acids in length.

[0136] The hinge domain can be a hinge domain of a naturally occurring protein. Hinge domains of any protein known in the art to comprise a hinge domain are compatible for use in the chimeric receptors described herein. In some embodiments, the hinge domain is at least a portion of a hinge domain of a naturally occurring protein and confers flexibility to the chimeric receptor. In some embodiments, the hinge domain is derived from CD8α. In some embodiments, the hinge domain is a portion of the hinge domain of CD8α, e.g., a fragment containing at least 15 (e.g., 20, 25, 30, 35, or 40) consecutive amino acids of the hinge domain of CD8α. In some embodiments, the hinge domain derived from CD8α comprises the amino acid sequence of SEQ ID NO: 36.

[0137] Non-naturally occurring peptides may also be used as hinge domains for the chimeric receptors described herein. In some embodiments, the hinge domain between the C-terminus of the extracellular antigen binding domain and the N-terminus of the transmembrane domain is a peptide linker, such as a (GGGGS) n linker (e.g., SEQ ID NO: 48) , wherein n can be an integer of at least 1, e.g., 1, 2, 3, 4, or more; or a (GxS) n linker, wherein x and n, independently can be an integer of at least 1, such as between 3 and 12, including 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. In some embodiments, the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 41, 42, and 48.Intracellular signaling domain

[0138] The intracellular signaling domain is responsible for activation of at least one of the normal effector functions of the immune effector cell expressing the chimeric receptors (e.g., CAR or cTCR) . The term “effector function” refers to a specialized function of a cell, such as in the killing of diseased cells such as tumor cells, or in the inhibition of tumor growth and / or inhibition of tumor development, including inhibition of tumor dissemination and metastasis. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. Thus, the term “intracellular signaling domain” refers to the portion of a protein which transduces the effector function signal and directs the cell to perform a specialized function. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The term intracellular signaling domain is thus meant to include any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.

[0139] In some embodiments, the intracellular signaling domain comprises (or consists essentially of, or consists of) a primary intracellular signaling domain of an immune effector cell. In some embodiments, the chimeric receptor comprises an intracellular signaling domain consisting essentially of a primary intracellular signaling domain of an immune effector cell. “Primary intracellular signaling domain” refers to intracellular signaling sequence that acts in a stimulatory manner to induce immune effector functions. In some embodiments, the primary intracellular signaling domain contains a signaling motif known as immunoreceptor tyrosine-based activation motif, or ITAM. An “ITAM, ” as used herein, is a conserved protein motif that is generally present in the tail portion of signaling molecules expressed in many immune cells. ITAMs within signaling molecules are important for signal transduction within the cell, which is mediated at least in part by phosphorylation of tyrosine residues in the ITAM following activation of the signaling molecule. ITAMs may also function as docking sites for other proteins involved in signaling pathways. Exemplary ITAM-containing primary intracellular signaling sequences include those derived from CD3ζ, FcεRIβ, FcεRIγ, CD3γ, CD3δ, CD3ε, DAP12, CNAIP / NFAM1, STAM-1, STAM-2, Moesin, CD5, CD22, CD79a, CD79b, and CD66d (CEACAM3) .

[0140] In some embodiments, the CAR of the present disclosure comprises an intracellular signaling domain, e.g., comprises an ITAM-containing primary intracellular signaling domain, or a functional primary intracellular signaling domain. In some embodiments, the CAR comprises (or consists essentially of, or consists of) an intracellular signaling domain (e.g., a primary intracellular signaling domain) derived from CD3ζ. In some embodiments, the intracellular signaling domain (e.g., the primary intracellular signaling domain) derived from CD3ζ comprises the amino acid sequence of SEQ ID NO: 39.Intracellular co-stimulatory signaling domain

[0141] Many immune effector cells require co-stimulation, in addition to stimulation of an antigen-specific signal (e.g., the primary signal) , to promote cell proliferation, differentiation and survival, as well as to activate effector functions of the cell. In some embodiments, the chimeric receptor of the present disclosure (e.g., CAR) comprises at least one co-stimulatory signaling domain. The term “co-stimulatory signaling domain, ” as used herein, refers to at least a portion of a protein that mediates a secondary or co-stimulatory signal transduction within a cell to induce an immune response such as an effector function. The intracellular co-stimulatory signaling domain can act in an antigen-independent manner to provide a secondary or co-stimulatory signal to immune cells. The co-stimulatory signaling domain of the chimeric receptor described herein can be an intracellular signaling domain from a co-stimulatory protein, which transduces a secondary or co-stimulatory signal and modulates responses mediated by immune cells, such as T cells, NK cells, macrophages, neutrophils, or eosinophils. The term "co-stimulatory molecule" refers to a cognate binding partner on an immune cell (such as T cell) that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the immune cell, such as, but not limited to, proliferation and survival. In some embodiments, the co-stimulatory molecule selected from the group consisting of CD27, CD28, CD137, OX40, CD40, PD-1, LFA-1, ICOS, CD2, CD7, LIGHT, NKG2C, B7-H3, TNFRSF9, TNFRSF4, TNFRSF8, CD40LG, ITGB2, KLRC2, TNFRSF18, TNFRSF14, HAVCR1, LGALS9, DAP10, DAP12, CD83, and ligands of CD83.

[0142] In some embodiments, the chimeric receptor comprises (or consists essentially of, or consists of) a single intracellular co-stimulatory signaling domain. In some embodiments, the chimeric receptor comprises (or consists essentially of, or consists of) two or more (such as about any of 2, 3, 4, or more) intracellular co-stimulatory signaling domains. In some embodiments, the chimeric receptor comprises two or more of the same co-stimulatory signaling domains. In some embodiments, the chimeric receptor comprises two or more co-stimulatory signaling domains from different co-stimulatory proteins, such as any two or more co-stimulatory proteins described herein. In some embodiments, the chimeric receptor (e.g., cTCR) lacks a functional primary intracellular signaling domain, but comprises one or more intracellular co-stimulatory signaling domains. In some embodiments, the chimeric receptor (e.g., cTCR) lacks any primary intracellular signaling domain, but comprises one or more intracellular co-stimulatory signaling domains. In some embodiments, the chimeric receptor (e.g., CAR) comprises an intracellular signaling domain (e.g., derived from CD3ζ) and one or more intracellular co-stimulatory signaling domains. In some embodiments, the one or more intracellular co-stimulatory signaling domains and the primary intracellular signaling domain (such as intracellular signaling domain of CD3ζ) are fused to each other via optional peptide linkers. The primary intracellular signaling domain and the one or more intracellular co-stimulatory signaling domains may be arranged in any suitable order. In some embodiments, the one or more intracellular co-stimulatory signaling domains are located between the transmembrane domain and the primary intracellular signaling domain (such as intracellular signaling domain of CD3ζ) . In some embodiments, the one or more intracellular co-stimulatory signaling domains are located at the C-terminus of the primary intracellular signaling domain (e.g., derived from CD3ζ) . In some embodiments, the primary intracellular signaling domain (e.g., derived from CD3ζ) is located in between two intracellular co-stimulatory signaling domains. Multiple co-stimulatory signaling domains may provide additive or synergistic stimulatory effects.

[0143] In some embodiments, the one or more intracellular co-stimulatory signaling domains are derived from a co-stimulatory molecule selected from the group consisting of CD27, CD28, CD137, OX40, CD40, PD-1, LFA-1, ICOS, CD2, CD7, LIGHT, NKG2C, B7-H3, TNFRSF9, TNFRSF4, TNFRSF8, CD40LG, ITGB2, KLRC2, TNFRSF18, TNFRSF14, HAVCR1, LGALS9, DAP10, DAP12, CD83, ligands of CD83, and variants or combinations thereof.

[0144] In some embodiments, the chimeric receptor of the present disclosure (e.g., CAR) further comprises an intracellular co-stimulatory signaling domain derived from the cytoplasmic domain of CD137 (i.e., 4-1BB) . In some embodiments, the chimeric receptor (e.g., CAR) comprises an intracellular co-stimulatory signaling domain comprising the amino acid sequence of SEQ ID NO: 38. In some embodiments, the CAR comprises an intracellular signaling domain of CD3ζand an intracellular co-stimulatory signaling domain of CD137.

[0145] Also within the scope of the present disclosure are variants of any of the intracellular co-stimulatory signaling domains described herein, such that the variant intracellular co-stimulatory signaling domain is capable of modulating the immune response of the immune cell. The intracellular co-stimulatory signaling domain may comprise up to 10 amino acid residue variations (e.g., 1, 2, 3, 4, 5, or 8) as compared to a wild-type counterpart. Mutation of amino acid residues of the intracellular co-stimulatory signaling domain may result in i) an increase in signaling transduction and enhanced stimulation of immune responses relative to intracellular co-stimulatory signaling domains that do not comprise the mutation; or ii) a decrease in signaling transduction and reduced stimulation of immune responses relative to intracellular co-stimulatory signaling domains that do not comprise the mutation.Signal Peptide

[0146] The chimeric receptors of the present disclosure may comprise a signal peptide (also known as a signal sequence) at the N-terminus of the polypeptide. In general, signal peptides are peptide sequences that target a polypeptide to the desired site in a cell. In some embodiments, the signal peptide targets the chimeric receptor to the secretory pathway of the cell and will allow for integration and anchoring of the chimeric receptor into the lipid bilayer. Signal peptides including signal sequences of naturally occurring proteins or synthetic, non-naturally occurring signal sequences, which are compatible for use in the chimeric receptors described herein, will be evident to one of skill in the art. In some embodiments, the signal peptide is derived from a molecule selected from the group consisting of CD8α, GM-CSF receptor α, and IgG1 heavy chain. In some embodiments, the signal peptide is derived from a CD8α propeptide, e.g., human CD8α. In some embodiments, the signal peptide derived from CD8α comprises the amino acid sequence of SEQ ID NO: 35. In some embodiments, the signal peptide is derived from an immunoglobulin propeptide, such as mouse IgG heavy chain (mIgG) . In some embodiments, the signal peptide derived from immunoglobulin propeptide comprises the amino acid sequence of SEQ ID NO: 46.Peptide Linker

[0147] The chimeric receptor of the present disclosure may comprise one or more peptide linkers, such as between different components of the chimeric receptor (e.g., between two or more intracellular co-stimulatory signaling domains, between intracellular co-stimulatory signaling domain and primary intracellular signaling domain, or between the antigen binding domain and the transmembrane domain) , and / or within one chimeric receptor component (e.g., antigen binding domain, such as within an scFv, or for connecting two or more antibody moieties in tandem) .

[0148] Each peptide linker in a chimeric receptor may have the same or different length and / or sequence depending on the structural and / or functional features of the antibody moieties and / or the various domains. Each peptide linker may be selected and optimized independently. The length, the degree of flexibility and / or other properties of the peptide linker (s) used in the chimeric receptors may have some influence on properties, including but not limited to the affinity, specificity or avidity for one or more particular antigens or epitopes. For example, longer peptide linkers may be selected to ensure that two adjacent domains do not sterically interfere with one another. A short peptide linker may be disposed between the transmembrane domain and the primary intracellular signaling domain of a chimeric receptor (e.g., CAR) , or between the transmembrane domain and the intracellular co-stimulatory signaling domain of a chimeric receptor (e.g., CAR) . In some embodiment, the peptide linker comprises flexible residues (such as glycine and serine) so that the adjacent domains are free to move relative to each other. For example, a glycine-serine doublet can be a suitable peptide linker.

[0149] The peptide linker can be of any suitable length. The peptide linker may be at least about any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 75, 100 or more amino acids (aa) long. The peptide linker may be no more than about any of 100, 75, 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 or fewer aa long. In some embodiments, the length of the peptide linker is any of about 1 aa to about 10 aa, about 1 aa to about 20 aa, about 1 aa to about 30 aa, about 5 aa to about 15 aa, about 10 aa to about 25 aa, about 5 aa to about 30 aa, about 10 aa to about 30 aa, about 30 aa to about 50 aa, about 50 aa to about 100 aa, or about 1 aa to about 100 aa. In some embodiments, the peptide linker is about 10 aa to about 20 aa, such as about 15 aa.

[0150] The peptide linker may have a naturally occurring sequence, or a non-naturally occurring sequence. For example, a sequence derived from the hinge region of heavy chain only antibodies may be used as the linker. See, for example, WO1996 / 34103. In some embodiments, the peptide linker is a flexible linker. Exemplary flexible linkers include but not limited to glycine polymers (G)n, glycine-serine polymers, glycine-alanine polymers, alanine-serine polymers, threonine-serine, and other flexible linkers known in the art. Other linkers known in the art, for example, as described in WO2016014789, WO2015158671, WO2016102965, US20150299317, WO2018067992, US7741465, Colcher et al., J. Nat. Cancer Inst. 82: 1191-1197 (1990) , and Bird et al., Science 242: 423-426 (1988) may also be included in the chimeric receptors provided herein, the disclosure of each of which is incorporated herein by reference in their entirety.

[0151] In some embodiments, the peptide linker is (GGGGS) n (SEQ ID NO: 48) , wherein n is an integer of at least 1 (e.g., 1, 2, 3, 4, or more) . In some embodiments, the peptide linker is (GxS) n, wherein x and n independently can be an integer of at least 1, such as between 3 and 12 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) . In some specific embodiments, the peptide linker comprises the amino acid sequence of any one of SEQ ID NOs: 41, 42, and 48. B. Nucleic acids and vectors encoding the chimeric receptor and / or multispecific  antigen binding protein

[0152] In one aspect, the present disclosure provides nucleic acids and vectors for cloning and expressing any one of the DLL3-targeted chimeric receptors (e.g., anti-DLL3 CAR) and / or MSAPs (e.g., anti-DLL3 MSAP or anti-B7H3 MSAP) described herein. In some embodiments, the chimeric receptors and / or MSAPs described herein are expressed by introducing the nucleic acid or the vector comprising a sequence encoding the chimeric receptors and / or MSAPs into a cell in vivo (in vivo cell therapy) or in vitro (including autologous cell therapy and allogeneic cell therapy) . In some embodiments, the vector is suitable for replication and integration in eukaryotic cells, such as mammalian cells. In some embodiments, the vector is a viral vector. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus (AAV) vectors, lentiviral vector, retroviral vectors, vaccinia vector, herpes simplex viral vector, and derivatives thereof. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) , and in other virology and molecular biology manuals. In some embodiments, the vector is a non-viral vector (e.g., lipid nanoparticle (LNP) ) . In some embodiments, the vector is a virus-like particle (VLP) , or enveloped delivery vehicle (EDV) .

[0153] A number of viral based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The heterologous nucleic acid can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to the engineered mammalian cell in vitro or ex vivo. A number of retroviral systems are known in the art. In some embodiments, adenovirus vectors are used. A number of adenovirus vectors are known in the art. In some embodiments, lentivirus vectors are used. In some embodiments, self-inactivating lentiviral vectors are used. The lentiviral vectors can be used to transduce a mammalian cell (such as primary human T cells) using methods known in the art. Vectors derived from retroviruses such as lentivirus are suitable tools to achieve long-term gene transfer, because they allow long-term, stable integration of a transgene and its propagation in progeny cells. Lentiviral vectors also have low immunogenicity, and can transduce non-proliferating cells. In some embodiments, the vector encoding the chimeric receptor and / or the MSAP is a lentiviral vector.

[0154] Any viral vectors described herein can be introduced into a cell in vivo using any suitable techniques known in the art. The viral based systems can be engineered to target (i.e. infect) a range of cells, target a narrow subset of cells, or target a specific type of cell. In general, the envelope protein chosen for the viral based systems will determine the viral tropism. In some embodiments, the virus used in the viral based systems can be pseudotyped to target a specific cell type of interest. For example, the envelope protein on the viral vectors can be modified to have reduced binding affinity to its natural receptor on host cells and the viral vectors can be modified to display a ligand (e.g., antibody or fragment thereof) that specifically binds to a cell surface marker. In some embodiments, the cell is an immune cell. Exemplary envelope proteins include, but are not limited to, VSV-G (vesicular stomatitis virus glycoprotein) , COCAL-G (cocal virus glycoprotein) and their known mutants that have a reduced binding affinity with low-density lipoprotein receptor (LDL-R) . Accordingly, one skilled in the art can select the appropriate tropism, pseudotype, and / or envelope protein that are well known for targeting a desired cell type.

[0155] A number of non-viral vectors have also been developed for gene transfer into mammalian cells. The non-viral vectors include but are not limited to, lipid nanoparticles (LNPs) , and stimuli-responsive polymer / inorganic nanoparticles. Any non-viral vectors described herein can be introduced into a cell in vivo using any suitable techniques known in the art. In some embodiments, LNPs are used. In some embodiments, LNPs are conjugated to a ligand (e.g., antibody or fragment thereof) that specifically binds to a cell surface marker. In some embodiments, the cell is an immune cell.

[0156] In some embodiments, the immune cell described above is a T cell (e.g., αβT, γδT, NKT) . In some embodiments, the immune cell described above is a NK cell. In some embodiments, the cell surface marker described above is CD2, CD3, CD4, CD5, CD7, TCR (e.g., TCRα, TCRβ) , CD8, CD56, CD16, and / or NKG2D. In some embodiments, the ligand described above is an antibody or fragment thereof (e.g., scFv, VHHs) .

[0157] In some embodiments, there is provided a vector comprising any one of the nucleic acids encoding a DLL3-targeted chimeric receptor and / or an MSAP described herein (such as any of the anti-DLL3 and / or anti-B7H3 MSAP described herein) . The nucleic acid can be cloned into the vector using any known molecular cloning methods in the art, including, for example, using restriction endonuclease sites and one or more selectable markers.

[0158] In some embodiments, the DLL3-targeted chimeric receptor (e.g., anti-DLL3 CAR) is encoded by a first nucleic acid and the MSAP is encoded by a second nucleic acid. In some embodiments, the first nucleic acid and the second nucleic acid are on the same vector. In some embodiments, the first nucleic acid and the second nucleic acid are each on a different vector. In some embodiments, the first nucleic acid further encodes a chimeric receptor signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the chimeric receptor. In some embodiments, the first nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 10 or 40. In some embodiments, the second nucleic acid further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35 or 46) N-terminal to the MSAP. In some embodiments, the second nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 33 or 34. In some embodiments, the DLL3-targeted chimeric receptor (e.g., multi-chain chimeric receptor) is encoded by a first set of two or more nucleic acids. In some embodiments, the MSAP (e.g., multi-chain MSAP) is encoded by a second set of two or more nucleic acids. For example, in some embodiments, the MSAP is a bispecific antibody, comprising at least one heavy chain and one light chain, wherein the heavy chain and the light chain are encoded by separate nucleic acids (e.g., either on the same vector or on different vectors, under the control of the same promoter or different promoters) . When the chimeric receptor or the MSAP contains two or more polypeptide chains to be expressed, each polypeptide chain may comprise a signal peptide fused to the N-terminus. When the two or more polypeptide chains are to be expressed from the same vector and under the same promoter control, the nucleic acids encoding the two or more polypeptide chains may be connected via a linking nucleic acid encoding a cleavable linker (e.g., 2A peptide) or a linking nucleic acid of Internal Ribosome Entry Sites (IRES) sequence. In some embodiment, the nucleic acids described herein can be introduced into a cell in vivo using any suitable techniques known in the art. In some embodiments, the cell is an immune cell. In some embodiments, the nucleic acids can be modified to make it suitable for in vivo gene therapy.

[0159] In some embodiments, the MSAP is a bispecific antibody, and the bispecific antibody is encoded by a single nucleic acid under the control of one promoter. Hence in some embodiments, there is provided an isolated nucleic acid encoding a bispecific antibody (e.g., anti-DLL3×anti-CD3 bispecific antibody or anti-B7H3×anti-CD3 bispecific antibody) , wherein the isolated nucleic acid encodes i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the first moiety specifically binds to DLL3 ( “anti-DLL3 molecule” ) , and the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) . In other embodiments, the first moiety specifically binds to B7H3 ( “anti-B7H3 molecule” ) , and the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) . In some embodiments, the anti-DLL3 molecule is a VHH comprising the amino acid sequence of SEQ ID NO: 14, and the anti-CD3 antigen binding moiety is an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In other embodiments, the anti-B7H3 molecule is an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23, and the anti-CD3 antigen binding moiety is an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, there is provided an isolated first nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 33 or 34. In some embodiments, the isolated first nucleic acid further comprises a second nucleic acid sequence encoding a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3. In some embodiments, the chimeric receptor is a chimeric antigen receptor (CAR) comprising the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the second nucleic acid sequence encoding the chimeric receptor is upstream or downstream to the isolated first nucleic acid sequence encoding the MSAP, and wherein the second nucleic acid sequence and the isolated first nucleic acid sequence are separated by a third nucleic acid sequence encoding a cleavable linker. In some embodiments, the isolated first nucleic acid, second nucleic acid sequence, and third nucleic acid sequence are operably linked to comprise an isolated nucleic acid sequence encoding a polypeptide having an amino acid sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 45.

[0160] In some embodiments, the nucleic acid encoding the DLL3-targeted chimeric receptor and / or the MSAP is operably linked to a promoter. Varieties of promoters have been explored for gene expression in mammalian cells, and any of the promoters known in the art may be used in the present disclosure. Promoters may be roughly categorized as constitutive promoters or regulated promoters, such as inducible promoters.

[0161] In some embodiments, there is provide a vector (e.g., viral vector, such as lentiviral vector) comprising: a first nucleic acid encoding a DLL3-targeted chimeric receptor (e.g., any of the chimeric receptors described herein, such as anti-DLL3 CAR) , and a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 and / or anti-B7H3 MSAP) . In some embodiments, the first nucleic acid and the second nucleic acid are under the control of the same promoter. In some embodiments, the first nucleic acid and second nucleic acid are under the control of different promoters.

[0162] In some embodiments, there is provide a vector (e.g., viral vector, such as lentiviral vector) comprising: a first nucleic acid encoding a DLL3-targeted chimeric receptor (e.g., any of the chimeric receptors described herein, such as anti-DLL3 CAR) , and a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 and / or anti-B7H3 MSAP) , wherein the first nucleic acid and the second nucleic acid are under the control of the same promoter. In some embodiments, the first nucleic acid is upstream of the second nucleic acid. In some embodiments, the first nucleic acid is downstream of the second nucleic acid. In some embodiments, the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid encoding a cleavable linker, such as a 2A peptide. In some embodiments, the 2A peptide is P2A, T2A, E2A, or F2A. In some embodiments, the 2A peptide is P2A comprising the amino acid sequence of SEQ ID NO: 43. In some embodiments, the 2A peptide is T2A. In some embodiments, the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid of IRES sequence. In some embodiments, the chimeric receptor comprises the amino acid sequence of SEQ ID NO: 10 or 40. In some embodiments, the MSAP is an anti-DLL3×anti-CD3 bispecific antibody, e.g., comprising the amino acid sequence of SEQ ID NO: 33. In other embodiments, the MSAP is an anti-B7H3×anti-CD3 bispecific antibody, e.g., comprising the amino acid sequence of SEQ ID NO: 34.

[0163] In some embodiments, there is provide a vector (e.g., viral vector, such as lentiviral vector) comprising from 5'to 3': a promoter (e.g., hEF1α promoter) -a first nucleic acid encoding a DLL3-targeted chimeric receptor (e.g., any of the chimeric receptors described herein, such as anti-DLL3 CAR) -a linking nucleic acid (e.g., encoding P2A) -a second nucleic acid encoding an MSAP (e.g., any of the MSAPs described herein, such as an anti-DLL3 and / or anti-B7H3 MSAP) . In some embodiments, the chimeric receptor comprises the amino acid sequence of SEQ ID NO: 10 or 40. In some embodiments, the MSAP is an anti-DLL3×anti-CD3 bispecific antibody, e.g., comprising the amino acid sequence of SEQ ID NO: 33. In other embodiments, the MSAP is an anti-B7H3×anti-CD3 bispecific antibody, e.g., comprising the amino acid sequence of SEQ ID NO: 34. In some embodiments, the first nucleic acid further encodes a chimeric receptor signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the chimeric receptor. In some embodiments, the first nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 10 or 40. In some embodiments, the second nucleic acid further encodes a signal peptide (e.g., comprising the amino acid sequence of SEQ ID NO: 35) N-terminal to the MSAP. In some embodiments, the second nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 33 or 34. In some embodiments, the vector encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 44 or 45.

[0164] In some embodiments, the vector further contains a selectable marker gene or a reporter gene to select cells expressing the chimeric receptor and / or the MSAP from the population of host cells transfected with the nucleic acid (s) or the vector (s) (e.g., lentiviral vector) . Both selectable markers and reporter genes may be flanked by appropriate regulatory sequences to enable expression in the host cells. For example, the vector may contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the nucleic acid sequences.

[0165] In some embodiments, the vector further encodes a His-tag sequence. In some embodiments, the His-tag sequence is at the C-terminus of the chimeric receptor and / or the MSAP. C. Immune Cells

[0166] Any immune cells can be used herein to make the engineered immune cells. See “VI. Methods of Making Engineered Immune Cells and MSAPs” section below for generation methods. The present disclosure provides engineered immune cells that comprise any of the chimeric receptors, any of the MSAPs, any of the nucleic acids, and / or any of the vectors described herein. Also provided are any of the MSAPs described herein.

[0167] One aspect of the present disclosure provides an engineered immune cell comprising (a) a first nucleic acid encoding a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) a second nucleic acid encoding multispecific antigen binding protein ( “MSAP” ; e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs described herein) .

[0168] The engineered immune cell may comprise (a) a chimeric receptor (e.g., any of the chimeric receptors described herein, such as anti-DLL3 CAR) ; and (b) an MSAP (e.g., any of the MSAPs described herein, such as anti-DLL3×anti-CD3 MSAP or anti-B7H3×anti-CD3 MSAP) , wherein the chimeric receptor (e.g., any of the chimeric receptors described herein, such as anti-DLL3 CAR) described herein and an MSAP (e.g., any of the MSAPs described herein, such as anti-DLL3×anti-CD3 MSAP or anti-B7H3×anti-CD3 MSAP) are linked to each other via a 2A cleavable linker.

[0169] In some embodiments, the engineered immune cell comprises a polypeptide encoding a chimeric receptor (e.g., any of the chimeric receptors described herein, such as anti-DLL3 CAR) and / or a polypeptide encoding an MSAP (e.g., any of the MSAPs described herein, such as anti-DLL3×anti-CD3 MSAP or anti-B7H3×anti-CD3 MSAP) . In some embodiments, the chimeric receptor comprises the amino acid sequence of SEQ ID NO: 10 or 40. In some embodiments, the MSAP is an anti-DLL3×anti-CD3 MSAP or an anti-B7H3×anti-CD3 MSAP, e.g., comprising the amino acid sequence of SEQ ID NO: 33 or 34. In some embodiments, the engineered immune cell comprises a polypeptide comprising the amino acid sequence of SEQ ID NO: 44 or 45. The engineered immune cell may comprise a polypeptide comprising an amino acid sequence of SEQ ID NO: 44 or 45, or a functional variant having at least about 90%sequence identity thereto.

[0170] The engineered immune cells can also be further genetically modified to enhance their function. In some embodiments, the engineered immune cells are genetically modified to reduce or delete endogenous TCR (i.e., to not express or to express a reduced level of endogenous TCR) .

[0171] In some embodiments, the immune cell is selected from the group consisting of a monocyte, a dendritic cell, a macrophage, a B cell, a killer T cell (Tc, cytotoxic T lymphocyte, or CTL) , a helper T cell (Th) , a regulatory T cell (Treg) , an αβ T cell, a γδ T cell, a natural killer T (NKT) cell, a natural killer (NK) cell, and a combination thereof. In some embodiments, the immune cell is an immune effector cell that can exhibit immune effector functions. For example, immune effector cells comprise T cells (cytotoxic T cells, helper T cells, tumor infiltrating T cells) , B cells, NK cells, neutrophils, macrophages, and dendritic cells. The immune effector cell may express FcγRIII and perform ADCC effector function. Examples of immune effector cells which mediate ADCC include peripheral blood mononuclear cells (PBMC) , NK cells, monocytes, cytotoxic T cells, neutrophils, and eosinophils.

[0172] In some embodiments, the engineered immune cell is generated from PBMC. In some embodiments, the engineered immune cell is a T cell. The engineered T cells may be αβ T cells, or γδ T cells. In some embodiments, the engineered T cells are CD4+ / CD8-, CD4- / CD8+, CD4+ / CD8+, or CD4- / CD8-. In some embodiments, the engineered T cells produce IL-2, IFN-γ, and / or TNF-α upon expressing the chimeric receptor and binding to the target cells, such as DLL3-positive tumor cells. In some embodiments, the engineered T cells lyse antigen-specific target cells upon expressing the chimeric receptor and binding to the target cells.

[0173] In some embodiments, the engineered immune cell is an NK cell. In other embodiments, the engineered immune cell is made from established cell lines, for example, NK-92 cells.

[0174] In some embodiments, the engineered immune cell is derived from a stem cell. In some embodiments, the stem cell is a hematopoietic stem cell, pluripotent stem cell, induced pluripotent stem cell, or embryonic stem cell.

[0175] Immune cells for making the engineered immune cells described herein can be from any sources, such as derived from related (e.g., an individual having a cancer (e.g., DLL3-positive cancer) to be treated) or unrelated (e.g., healthy individual) humans, non-human animals, cell lines or cultures. In some embodiments, the engineered immune cell is allogeneic (e.g., derived from a healthy individual) . In some embodiments, the engineered immune cell is autologous (e.g., derived from the individual having a cancer (e.g., DLL3-positive cancer) to be treated) .

[0176] In some embodiments, the engineered immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the engineered immune cell is an engineered T cell. III. Multispecific Antigen Binding Proteins

[0177] The engineered immune cells described herein can comprise a nucleic acid encoding a multispecific antigen binding protein (MSAP) . The present disclosure also provides novel MSAPs. Any of the MSAPs described herein can either be included in the engineered immune cells or be provided separately. In some embodiments, the MSAP comprises: (i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof. In some embodiments, the immune cell is a T cell. In some embodiments, the second moiety specifically binds to an epitope of a T cell-specific protein selected from the group consisting of CD3, CD4, CD8, TCRα, TCRβ, TCRγ, and TCRδ. In some embodiments, the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) .

[0178] In some embodiments, there is provided a multispecific antigen binding protein ( “MSAP” ) comprising: (i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and (ii) a second moiety that specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) . In some embodiments, the anti-CD3 antigen binding moiety is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, an scFv, and an sdAb. In some embodiments, the anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the anti-CD3 binding moiety comprises a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31. In some embodiments, the anti-CD3 binding moiety is an scFv ( “anti-CD3 scFv” ) , wherein the anti-CD3 scFv comprises the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP or a nucleic acid encoding thereof or vector encoding the nucleic acid thereof is expressed by an engineered immune cell (e.g., any of the engineered immune cells described herein, such as an engineered T cell) . In some embodiments, the MSAP is secreted by the engineered immune cell. The CDR sequences described herein can be determined according to well-known numbering schemes. In some embodiments, the CDRs may be determined according to the IMGT numbering scheme, the Kabat numbering scheme, the AbM numbering scheme, the Chothia numbering scheme, the Contact numbering scheme, or a combination thereof. In some embodiments, the CDRs may be determined according to the Kabat numbering scheme.

[0179] In some embodiments, there is provided a multispecific antigen binding protein ( “MSAP” ) comprising: (i) a first moiety that specifically binds to DLL3 ( “anti-DLL3 molecule” ) ; and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the anti-DLL3 molecule comprises a Fab, Fab’ , (Fab’ ) 2, Fv, scFv, or sdAb. In some embodiments, the anti-DLL3 molecule comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; or (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-DLL3 molecule comprises a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14. In some embodiments, the anti-DLL3 molecule is an sdAb ( “anti-DLL3 sdAb” ) , wherein the anti-DLL3 sdAb comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the MSAP comprises an anti-DLL3 sdAb comprising the amino acid sequence of SEQ ID NO: 14. In some embodiments, the MSAP or a nucleic acid encoding thereof or vector encoding the nucleic acid thereof is expressed by an engineered immune cell (e.g., any of the engineered immune cells described herein, such as an engineered T cell) . In some embodiments, the MSAP is secreted by the engineered immune cell. The CDR sequences described herein can be determined according to well-known numbering schemes. In some embodiments, the CDRs may be determined according to the IMGT numbering scheme, the Kabat numbering scheme, the AbM numbering scheme, the Chothia numbering scheme, the Contact numbering scheme, or a combination thereof. In some embodiments, the CDRs may be determined according to the AbM numbering scheme.

[0180] In some embodiments, there is provided a multispecific antigen binding protein ( “MSAP” ) comprising: (i) a first moiety that specifically binds to B7H3 ( “anti-B7H3 molecule” ) ; and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the anti-B7H3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-B7H3 molecule comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21. In some embodiments, the anti-B7H3 molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the anti-B7H3 molecule is an scFv ( “anti-B7H3 scFv) , wherein the anti-B7H3 scFv comprises the amino acid sequence of SEQ ID NO: 23. In some embodiments, the MSAP or a nucleic acid encoding thereof or vector encoding the nucleic acid thereof is expressed by an engineered immune cell (e.g., any of the engineered immune cells described herein, such as an engineered T cell) . In some embodiments, the MSAP is secreted by the engineered immune cell. The CDR sequences described herein can be determined according to well-known numbering schemes. In some embodiments, the CDRs may be determined according to the IMGT numbering scheme, the Kabat numbering scheme, the AbM numbering scheme, the Chothia numbering scheme, the Contact numbering scheme, or a combination thereof. In some embodiments, the CDRs may be determined according to the Kabat numbering scheme.

[0181] In some embodiments, there is provided a multispecific antigen binding protein ( “MSAP” ) comprising: (i) a first moiety that specifically binds to DLL3 ( “anti-DLL3 molecule” ) ; and (ii) a second moiety that specifically binds to a target epitope on an immune cell; wherein the immune cell is a T cell; and wherein the target epitope is CD3 ( “anti-CD3 binding moiety” ) . In some embodiments, the anti-DLL3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-CD3 antigen binding moiety is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, an scFv, and an sdAb. In some embodiments, the anti-DLL3 molecule comprises: (i) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3; (ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7; or (iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13. In some embodiments, the anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the anti-DLL3 molecule comprises a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14. In some embodiments, the anti-CD3 binding moiety comprises a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31. In some embodiments, the anti-DLL3 molecule is an sdAb ( “anti-DLL3 sdAb” ) , wherein the anti-DLL3 sdAb comprising an amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14. In some embodiments, the anti-CD3 binding moiety is an scFv ( “anti-CD3 scFv” ) , wherein the anti-CD3 scFv comprises the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises an anti-DLL3 sdAb comprising the amino acid sequence of SEQ ID NO: 14 and an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises the amino acid sequence of SEQ ID NO: 33. In some embodiments, the MSAP or a nucleic acid encoding thereof or vector encoding the nucleic acid thereof is expressed by an engineered immune cell (e.g., any of the engineered immune cells described herein, such as an engineered T cell) . In some embodiments, the MSAP is secreted by the engineered immune cell.

[0182] In some embodiments, there is provided a multispecific antigen binding protein ( “MSAP” ) comprising: (i) a first moiety that specifically binds to B7H3 ( “anti-B7H3 molecule” ) ; and (ii) a second moiety that specifically binds to a target epitope on an immune cell; wherein the immune cell is a T cell; and wherein the target epitope is CD3 ( “anti-CD3 binding moiety” ) . In some embodiments, the anti-B7H3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-CD3 antigen binding moiety is selected from the group consisting of a Fab, a Fab’ , a (Fab’ ) 2, an Fv, an scFv, and an sdAb. In some embodiments, the anti-B7H3 molecule comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21. In some embodiments, the anti-CD3 antigen binding moiety comprises an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30. In some embodiments, the anti-B7H3 molecule comprises a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the anti-CD3 binding moiety comprises a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31. In some embodiments, the anti-B7H3 molecule is an scFv ( “anti-B7H3 scFv) , wherein the anti-B7H3 scFv comprises the amino acid sequence of SEQ ID NO: 23. In some embodiments, the anti-CD3 binding moiety is an scFv ( “anti-CD3 scFv” ) , wherein the anti-CD3 scFv comprises the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23 and an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32. In some embodiments, the MSAP comprises the amino acid sequence of SEQ ID NO: 34. In some embodiments, the MSAP or a nucleic acid encoding thereof or vector encoding the nucleic acid thereof is expressed by an engineered immune cell (e.g., any of the engineered immune cells described herein, such as an engineered T cell) . In some embodiments, the MSAP is secreted by the engineered immune cell.Anti-DLL3 antibody or antigen-binding fragment thereof

[0183] In some embodiments, the MSAP comprising (i) a first moiety that specifically binds to DLL3 ( “anti-DLL3 molecule” ) , and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the anti-DLL3 molecule is an anti-DLL3 antibody or antigen-binding fragment thereof. The anti-DLL3 antibody or antigen-binding fragment thereof can bind DLL3 derived from any organism, including but not limited to, dogs, cats, pigs, cows, sheep, goats, horses, rats, rabbits, hamsters, guinea pigs, monkeys, mice, and humans. In some embodiments, the anti-DLL3 antibody or antigen-binding fragment thereof binds human DLL3. Any anti-DLL3 antibodies or antigen-binding fragments thereof available can be used here, including but are not limited to, tarlatamab (AMG 757; e.g., AMGEN) , rovalpituzumab tesirine (e.g., Stemcentrx, AbbVie) , MAB4315 (e.g., BioTechne) , 7B7 (e.g., Invitrogen) , 7H24L4 (e.g., Invitrogen) , 11H27L9 (e.g., Invitrogen) , E3J5R (e.g., Cell Signaling Technology) , HA710326 (e.g., HUABIO) , EPR22592-18 (e.g., AbCam) , or those described in PCT / US2019 / 053017, PCT / US2015 / 017171, US10294300, US11673953, US9127071, etc., the contents of each of which are incorporated herein by reference in their entirety.

[0184] In some embodiments, the anti-DLL3 antibody or antigen-binding fragment thereof is selected from the group consisting of a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-DLL3 antibody or antigen-binding fragment thereof comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) , wherein the VH comprises H-CDR1, H-CDR2, and H-CDR3, and the VL comprises L-CDR1, L-CDR2, and L-CDR3. In some embodiments, the anti-DLL3 antibody or antigen-binding fragment thereof comprises a single domain (i.e., VHH) , wherein the single domain comprises a CDR1, CDR2, and CDR3. In some embodiments, the CDR positions are determined according to Kabat or AbM numbering scheme.

[0185] In some embodiments, the anti-DLL3 antibody or antigen-binding fragment thereof comprises: (i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 1, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 2, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 3, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; (ii) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 5, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 6, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 7, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; or (iii) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 11, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 12, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 13, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) . In some embodiments, the affinity of such anti-DLL3 antibody or antigen-binding fragment for DLL3 (e.g., human DLL3) is comparable (e.g., within about 2-fold difference) to that of a reference antibody comprising a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. In some embodiments, the affinity of such anti-DLL3 antibody or antigen-binding fragment for DLL3 (e.g., human DLL3) is at least about 2-fold (e.g., at least about any of 5, 10, 50, 100, 1000, or more folds) of that of a reference antibody comprising a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14.

[0186] In some embodiments, the anti-DLL3 antibody or antigen-binding fragment thereof comprises a VHH comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14, or a variant thereof having at least about 80% (e.g., at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) amino acid sequence homology to an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14. One or more amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) can be in one or more of the CDRs. One or more amino acid variations can be in one or more of the framework regions (FRs) . Two or more amino acid variations may be in both CDRs and FRs.

[0187] In some embodiments, the antibody or antigen-binding fragment thereof specifically recognizing DLL3 is a full-length antibody ( “anti-DLL3 full-length antibody” ) . In some embodiments, the anti-DLL3 full-length antibody comprises an Fc region, such as a human Fc region. In some embodiments, the Fc region is derived from an IgG molecule, such as any one of the IgG1, IgG2, IgG3, or IgG4 subclass.

[0188] In some embodiments, the antibody or antigen-binding fragment thereof specifically recognizing DLL3 is an scFv ( “anti-DLL3 scFv” ) . In some embodiments, the VH and VL of the anti-DLL3 scFv are connected via a peptide linker, e.g., a peptide linker comprising the amino acid sequence of SEQ ID NO: 41, 42, or 48.

[0189] In some embodiments, the antibody or antigen-binding fragment thereof specifically recognizing DLL3 is an sdAb ( “anti-DLL3 sdAb” ) . In some embodiments, the anti-DLL3 sdAb comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14, or a variant thereof having at least about 80% (e.g., at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%or more) amino acid sequence homology to an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 8, and 14.Anti-B7H3 antibody or antigen-binding fragment thereof

[0190] In some embodiments, the MSAP comprising (i) a first moiety that specifically binds to B7H3 ( “anti-B7H3 molecule” ) , and (ii) a second moiety that specifically binds to a target epitope on an immune cell. In some embodiments, the anti-B7H3 molecule is an anti-B7H3 antibody or antigen-binding fragment thereof. The anti-B7H3 antibody or antigen-binding fragment thereof can bind B7H3 derived from any organism, including but not limited to, dogs, cats, pigs, cows, sheep, goats, horses, rats, rabbits, hamsters, guinea pigs, monkeys, mice, and humans. In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof binds human B7H3. Any anti-B7H3 antibodies or antigen-binding fragments thereof available can be used here, including but are not limited to, A20079E (e.g., BioLegend, Inc. ) , W5C4 (e.g., BioLegend, Inc. ) , DCN. 70 (e.g., BioLegend, Inc. ) , MIH42 (e.g., BioLegend, Inc. ) , 6A1 (e.g., Invitrogen) , D9M2L (e.g., Cell Signaling Technology) , or those described in US11851498, US11512138, US10316093, US9963509, etc., the contents of each of which are incorporated herein by reference in their entirety.

[0191] B7H3 or CD276 (UniProtKB: Q5ZPR3) is a protein that functions by stimulating the expansion and destruction of T cells and may selectively stimulate signal receptors on T cells. B7H3 has been identified to act as a checkpoint inhibitor. B7H3 also is highly expressed on osteoblasts during embryogenesis and is crucial for osteoblastic differentiation and bone mineralization. In healthy tissues, B7H3 mRNA is expressed in many tissues but has limited protein expression due to posttranslational modification by various microRNAs (miRNAs) . Furthermore, B7H3 has been identified to be a tumor-associated antigen (TAA) that plays an important role in tumor progression and metastasis. See Kontos et al. (2021) Clin Cancer Res 27 (5) : 1227-1235.

[0192] In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof modulates one or more B7H3 activities. In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof is an antagonist antibody.

[0193] In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof binds to B7H3 (e.g., human B7H3) with a dissociation constant (KD) of ≤ 1μM, ≤ 100 nM, ≤ 10 nM, ≤1 nM, ≤ 0.1 nM, ≤ 0.01 nM, or ≤ 0.001 nM (e.g., about 10-8 M or less, such as any of from about 10-8 M to about 10-13 M, from about 10-9 M to about 10-13 M, from about 10-10 M to about 10-13 M, or from about 10-11 M to about 10-13 M) . A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of the present disclosure, including by RIA, for example, performed with the an antibody of interest and its antigen (Chen et al., 1999, J. Mol Biol 293: 865-81) ; by biolayer interferometry (BLI) or surface plasmon resonance (SPR) assays by using, for example, an Red96 system, or by using, for example, a TM-2000 or a TM-3000. An “on-rate” or “rate of association” or “association rate” or “kon” may also be determined with the same BLI or SPR techniques described above using, for example, the Red96, the TM-2000, or the  TM-3000 system.

[0194] In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof is selected from the group consisting of a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb. In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) , wherein the VH comprises H-CDR1, H-CDR2, and H-CDR3, and the VL comprises L-CDR1, L-CDR2, and L-CDR3. In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof comprises a single domain (i.e., VHH) , wherein the single domain comprises a CDR1, CDR2, and CDR3. In some embodiments, the CDR positions are determined according to Kabat or AbM numbering scheme.

[0195] In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof comprises: an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an L-CDR1 comprising the amino acid sequence of SEQ ID NO:19, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) ; an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21, or a variant thereof comprising up to 3 (e.g., 3, 2, or 1) amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions. In some embodiments, the affinity of such anti-B7H3 antibody or antigen-binding fragment for B7H3 (e.g., human B7H3) is comparable (e.g., within about 2-fold difference) to that of a reference antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 18 and a VL comprising the amino acid sequence of SEQ ID NO: 22. In some embodiments, the affinity of such anti-B7H3 antibody or antigen-binding fragment for B7H3 (e.g., human B7H3) is at least about 2-fold (e.g., at least about any of 5, 10, 50, 100, 1000, or more folds) of that of a reference antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22.

[0196] In some embodiments, the anti-B7H3 antibody or antigen-binding fragment thereof comprises: a VH comprising the amino acid sequence of SEQ ID NO: 18, or a variant thereof having at least about 80% (e.g., at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) amino acid sequence homology to the amino acid sequence of SEQ ID NO: 18; and a VL comprising the amino acid sequence of SEQ ID NO: 22, or a variant thereof having at least about 80%(e.g., at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more) amino acid sequence homology to the amino acid sequence of SEQ ID NO: 22. One or more amino acid variations (e.g., insertions, deletions, and / or substitutions, such as conserved substitutions) can be in one or more of the CDRs. One or more amino acid variations can be in one or more of the framework regions (FRs) . Two or more amino acid variations may be in both CDRs and FRs.

[0197] In some embodiments, the antibody or antigen-binding fragment thereof specifically recognizing B7H3 is a full-length antibody ( “anti-B7H3 full-length antibody” ) . In some embodiments, the anti-B7H3 full-length antibody comprises an Fc region, such as a human Fc region. In some embodiments, the Fc region is derived from an IgG molecule, such as any one of the IgG1, IgG2, IgG3, or IgG4 subclass.

[0198] In some embodiments, the antibody or antigen-binding fragment thereof specifically recognizing B7H3 is an scFv ( “anti-B7H3 scFv” ) . In some embodiments, the VH and VL of the anti-B7H3 scFv are connected via a peptide linker, e.g., a peptide linker comprising the amino acid sequence of SEQ ID NO: 41, 42, or 48. In some embodiments, the anti-B7H3 scFv comprises the amino acid sequence of SEQ ID NO: 23, or a variant thereof having at least about 80%(e.g., at least about any of 85%, 90%, 95%, 96%, 97%, 98%, 99%or more) amino acid sequence homology to SEQ ID NO: 23.

[0199] The multispecific antigen binding proteins (MSAPs) of the present disclosure may comprise a signal peptide N-terminal to the MSAP. In some embodiments, the signal peptide is derived from an immunoglobulin propeptide, such as mouse IgG heavy chain (mIgG) . In some embodiments, the signal peptide derived from immunoglobulin propeptide comprises the amino acid sequence of SEQ ID NO: 46. IV. Pharmaceutical Compositions and Kits

[0200] Also provided are pharmaceutical compositions comprising any of the engineered immune cells described herein (e.g., engineered immune cell expressing a DLL3-targeted chimeric receptor, or engineered immune cell expressing an MSAP, or engineered immune cell co-expressing a DLL3-targeted chimeric receptor and an MSAP) , and optionally a pharmaceutically acceptable excipient. Also provided are pharmaceutical compositions comprising any of the MSAPs described herein, and optionally a pharmaceutically acceptable excipient; wherein the MSAP is not secreted by the engineered immune cell. Any excipient suitable for the storage and administration of engineered immune cells and / or protein constructs (e.g., MSAPs, such as any of the anti-DLL3 and / or anti-B7H3 MSAPs described herein) can be used herein. The excipient may not affect the viability, bioactivity, and / or secretion of the encoded MSAPs of the engineered immune cells.

[0201] “Excipient” means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, solvent, or encapsulating material. Excipients include, for example, encapsulating materials or additives such as absorption accelerators, antioxidants, binders, buffers, carriers, coating agents, coloring agents, diluents, disintegrating agents, emulsifiers, extenders, fillers, flavoring agents, humectants, lubricants, perfumes, preservatives, propellants, releasing agents, sterilizing agents, sweeteners, solubilizers, wetting agents and mixtures thereof. The term “excipient” can also refer to a diluent, adjuvant (e.g., Freunds’ adjuvant (complete or incomplete) or vehicle.

[0202] Excipients may be pharmaceutically acceptable excipients. Examples of pharmaceutically acceptable excipients include buffers, such as phosphate, citrate, and other organic acids; antioxidants, including ascorbic acid; low molecular weight (e.g., fewer than about 10 amino  acid residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and / or nonionic surfactants, such as TWEENTM, polyethylene glycol (PEG) , and PLURONICSTM. Other examples of pharmaceutically acceptable excipients are described in Remington and Gennaro, Remington’s Pharmaceutical Sciences (18th ed. 1990) .

[0203] In one embodiment, each component is “pharmaceutically acceptable” in the sense of being compatible with the other ingredients of a pharmaceutical formulation, and suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit / risk ratio. See, e.g., Lippincott Williams &Wilkins: Philadelphia, PA, 2005; Handbook of Pharmaceutical Excipients, 6th ed.; Rowe et al., Eds.; The Pharmaceutical Press and the American Pharmaceutical Association: 2009; Handbook of Pharmaceutical Additives, 3rd ed.; Ash and Ash Eds.; Gower Publishing Company: 2007; Pharmaceutical Preformulation and Formulation, 2nd ed.; Gibson Ed.; CRC Press LLC: Boca Raton, FL, 2009. In some embodiments, pharmaceutically acceptable excipients are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. In some embodiments, a pharmaceutically acceptable excipient is an aqueous pH buffered solution.

[0204] Excipients may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is an exemplary excipient when a composition (e.g., a pharmaceutical composition) is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid excipients, particularly for injectable solutions. An excipient can also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. Compositions can take the form of solutions, suspensions, emulsion, powders (e.g., freeze-dried) , sustained-release formulations, and the like. In some embodiments, the composition can be reconstituted.

[0205] Compositions, including pharmaceutical compositions, may contain a binding molecule (e.g., an antibody) , for example, in isolated or purified form, together with a suitable amount of excipients.

[0206] In some embodiments, there is provided a pharmaceutical composition comprising: i) an engineered immune cell (e.g., engineered T cell) expressing a DLL3-targeted chimeric receptor (e.g., anti-DLL3 CAR) , ii) an MSAP (e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs described herein) , and iii) optionally a pharmaceutically acceptable excipient.

[0207] In other embodiments, provided herein is a pharmaceutical composition comprising: i) an engineered immune cell comprising: (a) a first nucleic acid encoding a chimeric receptor (e.g., an anti-DLL3 CAR) comprising an antigen binding domain that specifically binds to DLL3, and (b) a second nucleic acid encoding a multispecific antigen binding protein (MSAP; e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs) provided herein, and ii) optionally a pharmaceutically acceptable excipient.

[0208] In some embodiments, provided herein is a pharmaceutical composition comprising: (a) a first nucleic acid comprising a sequence encoding a chimeric receptor (e.g., an anti-DLL3 CAR) comprising an antigen binding domain that specifically binds to DLL3, and (b) a second nucleic acid comprising a sequence encoding a multispecific antigen binding protein (MSAP; e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs) provided herein, and ii) optionally a pharmaceutically acceptable excipient.

[0209] In some embodiments, provided herein is a pharmaceutical composition comprising: i) a vector comprising (a) a first nucleic acid comprising a sequence encoding a chimeric receptor (e.g., an anti-DLL3 CAR) comprising an antigen binding domain that specifically binds to DLL3, and (b) a second nucleic acid comprising a sequence encoding a multispecific antigen binding protein (MSAP; e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs) provided herein, and ii) optionally a pharmaceutically acceptable excipient.

[0210] In some embodiments, provided herein is a pharmaceutical composition comprising: i) a first vector comprising a nucleic acid comprising a sequence encoding a chimeric receptor (e.g., an anti-DLL3 CAR) comprising an antigen binding domain that specifically binds to DLL3; ii) a second vector comprising a nucleic acid comprising a sequence encoding a multispecific antigen binding protein (MSAP; e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs) provided herein; and iii) optionally a pharmaceutically acceptable excipient.

[0211] The choice of excipient may be determined in part by the particular cell, binding molecule, and / or antibody, and / or by the method of administration. Accordingly, there are a variety of suitable formulations. A. Pharmaceutical Composition Formulation

[0212] Suitable pharmaceutically acceptable excipient for engineered immune cells may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide) ; and preservatives. The pharmaceutically acceptable excipient may contain autologous serum, such as human serum. In some embodiments, the pharmaceutically acceptable excipient is non-toxic, biocompatible, non-immunogenic, biodegradable, and can avoid recognition by the host’s defense mechanism. The excipient may also contain adjuvants such as preserving stabilizing, wetting, emulsifying agents and the like. The pharmaceutically acceptable excipient may enhance the stability of the engineered immune cells or the MSAPs secreted thereof. The pharmaceutically acceptable excipient may reduce aggregation of the MSAPs secreted by the engineered mammalian cell. The final form may be sterile and may also be able to pass readily through an injection device such as a hollow needle. The proper viscosity may be achieved and maintained by the proper choice of excipients.

[0213] In some embodiments, the pharmaceutical composition is formulated to have a pH in the range of about 4.5 to about 9.0, including for example pH ranges of about any one of 5.0 to about 8.0, about 6.5 to about 7.5, or about 6.5 to about 7.0. The pharmaceutical composition can also be made to be isotonic with blood by the addition of a suitable tonicity modifier, such as glycerol.

[0214] Typically, acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers, antioxidants including ascorbic acid, methionine, Vitamin E, sodium metabisulfite; preservatives, isotonicifiers, stabilizers, metal complexes (e.g., Zn-protein complexes) ; chelating agents such as EDTA and / or non-ionic surfactants.

[0215] Buffers may be used to control the pH in a range which optimizes the therapeutic effectiveness, especially if stability is pH dependent. Suitable buffering agents for use with the present disclosure include both organic and inorganic acids and salts thereof. For example, citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate. Additionally, buffers may comprise histidine and trimethylamine salts such as Tris.

[0216] In order for the pharmaceutical compositions to be used for in vivo administration, they are preferably sterile. The pharmaceutical composition may be rendered sterile by filtration through sterile filtration membranes. The pharmaceutical compositions herein generally can be placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.

[0217] Various compositions and delivery systems are known and can be used with the therapeutic agents provided herein, including, but not limited to, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the chimeric receptor and / or MSAP, construction of a nucleic acid as part of a retroviral or other vector, etc.

[0218] In some embodiments, the pharmaceutical composition must meet certain standards for administration to an individual. For example, the United States Food and Drug Administration has issued regulatory guidelines setting standards for cell-based immunotherapeutic products, including 21 CFR 610 and 21 CFR 610.13. Methods are known in the art to assess the appearance, identity, purity, safety, and / or potency of pharmaceutical compositions. In some embodiments, the pharmaceutical composition is substantially free of extraneous protein capable of producing allergenic effects, such as proteins of an animal source used in cell culture other than the engineered immune cells. In some embodiments, “substantially free” is less than about any of 10%, 5%, 1%, 0.1%, 0.01%, 0.001%, 1 ppm or less of total volume or weight of the pharmaceutical composition. In some embodiments, the pharmaceutical composition is prepared in a GMP-level workshop. In some embodiments, the pharmaceutical composition comprises less than about 5 EU / kg body weight / hr of endotoxin for parenteral administration. In some embodiments, at least about 70%of the engineered immune cells in the pharmaceutical composition are alive for intravenous administration. In some embodiments, the pharmaceutical composition has a “no growth” result when assessed using a 14-day direct inoculation test method as described in the United States Pharmacopoeia (USP) . In some embodiments, prior to administration of the pharmaceutical composition, a sample including both the engineered immune cells and the pharmaceutically acceptable excipient should be taken for sterility testing approximately about 48-72 hours prior to the final harvest (or coincident with the last re-feeding of the culture) . In some embodiments, the pharmaceutical composition is free of mycoplasma contamination. In some embodiments, the pharmaceutical composition is free of detectable microbial agents. In some embodiments, the pharmaceutical composition is free of communicable disease agents, such as HIV type I, HIV type II, HBV, HCV, Human T-lymphotropic virus, type I; and Human T-lymphotropic virus, type II. In some embodiments, the pharmaceutical composition is free of viral (e.g., lentivirus) components during manufacture. B. Kits

[0219] In some embodiments, there is provided a kit comprising any of the engineered immune cells and / or MSAPS (or nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical composition thereof) described herein. In some embodiments, the kit may further comprise instruction (s) on methods of using the engineered immune cells and / or MSAPS (or nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical composition thereof) , such as uses or methods described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, intravenous injectors or drips, and package inserts with instructions for performing any methods described herein.

[0220] In some embodiments, the kit and / or composition comprises a culture medium used in the methods provided herein, whether provided individually as components, in any combination, or as the culture medium admixed with cells (e.g., any of the engineered immune cells described herein) . In some embodiments, the kit comprises reagents suitable for expanding the engineered immune cells, such as media, cytokine, ITSEA, and human albumin serum.

[0221] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits may include at least one vial, test tube, flask, bottle, syringe, or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there is more than one component in the kit, the kit also will generally contain a second, third, or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing any of the engineered immune cells and / or MSAPS (or nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical composition thereof) described herein, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained, for example.

[0222] In some embodiments, the kits may further comprise instruction (s) on methods of making or methods of treatment using any of the engineered immune cells and / or MSAPS (or nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical composition thereof) described herein, such as methods of making or methods of treatment described herein. V. Methods of Treating Cancer

[0223] The present disclosure provides a method of treating a cancer in an individual (e.g., human) in need thereof, comprising administering to the individual an effective amount of any of the engineered immune cells (e.g., engineered T cells) provided herein, any of the multispecific antigen binding proteins ( “MSAPs” ; e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs) provided herein, and / or any of the pharmaceutical compositions provided herein. In some embodiments, there is provided a method of treating a cancer in an individual in need thereof, comprising administering to the individual an effective amount of any of the engineered immune cells provided herein. In some embodiments, the engineered immune cell comprises a) a first nucleic acid encoding a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and b) a second nucleic acid encoding an MSAP. In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the cancer is selected from the group consisting of small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer. In some embodiments, the cancer is small cell lung cancer.

[0224] Also provided are methods of treating a cancer in an individual in need thereof, comprising administering an effective amount of a combination of a DLL3 antagonist and a B7H3 antagonist, or an antagonist of DLL3 and B7H3 to the individual. In some embodiments, the cancer is DLL3 positive and / or B7H3 positive. In some embodiments, the antagonist of DLL3 and B7H3 is an engineered immune cell comprising (i) a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3 and (ii) an MSAP comprising a first moiety that specifically binds to B7H3 and a second moiety that specifically binds to CD3. In some embodiments, the combination of the DLL3 antagonist and the B7H3 antagonist comprises (i) an engineered immune cell comprising a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3 and (ii) an MSAP comprising a first moiety that specifically binds to B7H3 and a second moiety that specifically binds to CD3. In some embodiments, the cancer is selected from the group consisting of small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer. In some embodiments, the cancer is small cell lung cancer.

[0225] In some embodiments, the cancer is an DLL3-expressing cancer. A cancer, such as a solid tumor malignancy, can be associated with the increased expression of a tumor associated antigen (TAA) or tumor specific antigen (TSA) , e.g., over-expression compared to a healthy state, or mis-expression in the cancer cells that is different from a healthy state (e.g., not expressed by corresponding healthy cells or tissues) . Such cancers may be further associated with one or more additional antigens (e.g., B7H3) , e.g., over-expression compared to a healthy state, or mis-expression at a location different from a healthy state. In some instances, the cancer is heterogeneous such that the cancer cells may express different levels of TSAs / TAAs and / or may express different TSAs / TAAs across the cancer cell milieu. Thus, in some instances, the cancer may present with increased expression of a first TSA / TAA (e.g., DLL3) and, over the course of administering a therapy targeting that first TSA / TAA (e.g., DLL3) , the cancer composition may shift by downregulating the expression of the first TSA / TAA (e.g., DLL3) and / or upregulating the expression of a second TSA / TAA (e.g., B7H3) .

[0226] In some embodiments, the cancer is a DLL3-positive cancer that expresses, such as selectively expresses or abnormally expresses (e.g., overexpresses) DLL3. The expressed DLL3 can either be a wild-type form or a mutant form (e.g., constitutively active, or with increased activity, or with reduced or absent activity) . In some embodiments, the DLL3-positive cancer is a solid tumor cancer. Examples of DLL3-positive cancers include but are not limited to small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer. In some embodiments, the DLL3-positive cancer is small cell lung cancer (SCLC) .

[0227] DLL3 has been shown to be expressed in up to 85%of small cell lung cancer cases, 81%of neuroendocrine carcinomas (NECs) of the cervix, 76.9%of poorly differentiated gastroenteropancreatic cancers, 76.6%of castration-resistant neuroendocrine prostate cancers (NEPCs) , 74%of large cell NECs, and 68%of neuroendocrine bladder cancers (see Rudin et al. (2023) J. Hematol. Oncol. 16: 66) . To assess DLL3 status, IHC can be used, and staining intensity can be categorized into four groups: 0 (no staining) , 1+ (weak positivity) , 2+ (moderate positivity) , and 3+ (strong positivity) . The percentage of DLL3-positive tumor cells with different staining intensities can be evaluated under a microscope (%cell 0, %cell 1+, %cell 2+and %cell 3+) , and H-Score can be calculated according to the following formula: Score= 1×H-Score= 1× [%cells 1+ (weak positive) ] +2× [%cells 2+ (medium positive) ] +3× [%cells 3+ (strong positive) ] , H-score range: 0-300. A tumor sample with an H-score less than 50 can be considered to express low levels of DLL3. A tumor sample with an H-score greater than or equal to 50 but less than 150 can be considered to express moderate levels of DLL3. A tumor sample with an H-score greater than or equal to 150 but less than or equal to 300 can be considered to express high levels of DLL3 (see Lab Invest 98, 15–26 (2018) ) . Besides H-score, the expression level of DLL3 can also be determined by flow cytometry.

[0228] In some embodiments, the DLL3-positive cancer expresses high levels of DLL3 (e.g., 150 ≤ H-score ≤ 300) . In some embodiments, the DLL3-positive cancer expresses moderate levels of DLL3 (e.g., 50 ≤ H-score < 150) . In some embodiments, the DLL3-positive cancer expresses low levels of DLL3 (e.g., 10 ≤ H-score < 50) . In some embodiments, administration of the engineered immune cell comprising the chimeric receptor and / or the MSAP is dependent on the DLL3 expression level of the DLL3-positive cancer. In some embodiments, DLL3 staining intensity is used to identify and / or select an individual for administration of the engineered immune cell comprising the chimeric receptor (e.g., an anti-DLL3 CAR) and / or the MSAP. In some embodiments, the method of treatment further comprises selecting an individual for treatment based on the DLL3 staining intensity of the DLL3-positive cancer. For example, in some embodiments, the method of treatment further comprises selecting an individual for treatment based on that the DLL3-positive cancer expresses moderate or low levels of DLL3. In some embodiments, the method of treatment further comprises selecting an individual for treatment based on that the DLL3-positive cancer expresses a high level of DLL3.

[0229] In some embodiments, cancer is DLL3 positive. In some embodiments, the cancer is B7H3 positive. In some embodiments, the cancer is DLL3 positive when treatment is initiated. In some embodiments, the cancer is B7H3 positive when treatment is initiated. In some embodiments, the cancer progressively loses DLL3 antigen expression over the course of treatment.

[0230] In some embodiments, there is provided a method of treating a cancer (e.g., a DLL3-positive cancer) in an individual (e.g., human) , comprising administering to the individual an engineered immune cell (e.g., engineered T cell) comprising (a) a first nucleic acid encoding a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) ; wherein the chimeric receptor comprises: (i) an antigen binding domain (e.g., scFv, sdAb, or Fab) specifically recognizing DLL3; (ii) an optional hinge domain (e.g., derived from CD8α) ; (iii) a transmembrane domain (e.g., derived from CD8α) ; (iv) an optional intracellular co-stimulatory signaling domain (e.g., derived from CD137) ; and (v) an intracellular signaling domain (e.g., derived from CD3ζ) . In some embodiments, there is provided a method of treating a cancer (e.g., a DLL3-positive cancer) in an individual (e.g., human) , comprising administering to the individual the engineered immune cell provided herein, for example, an engineered immune cell as described in Section II. In some embodiments, the engineered immune cell is a T cell. In some embodiments, the T cell is further engineered to not express endogenous TCR or to express a reduced level of endogenous TCR. In some embodiments, the cancer is selected from the group consisting of small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer. In some embodiments, the cancer is small cell lung cancer.

[0231] In some embodiments, there is provided a method of treating a cancer (e.g., a DLL3-positive cancer or a B7H3-positive cancer) in an individual (e.g., human) , comprising administering to the individual an engineered immune cell (e.g., engineered T cell) comprising (a) a first nucleic acid encoding a chimeric receptor; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) that specifically binds to DLL3 or to B7H3. In some embodiments, there is provided a method of treating a cancer (e.g., a DLL3-positive cancer or a B7H3-positive cancer) in an individual (e.g., human) , comprising administering to the individual an engineered immune cell (e.g., engineered T cell) comprising (a) a first nucleic acid encoding a chimeric receptor; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) provided herein, for example, an MSAP as described in Section III. In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid encoding a cleavable linker (e.g., a 2A peptide) . In some embodiments, the engineered immune cell (e.g., T cell) comprises a nucleic acid sequence encoding a polypeptide having an amino acid sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 45. In some embodiments, the engineered immune cell is a T cell. In some embodiments, the T cell is further engineered to not express endogenous TCR or to express a reduced level of endogenous TCR. In some embodiments, the cancer is selected from the group consisting of small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer. In some embodiments, the cancer is small cell lung cancer.

[0232] In some embodiments, the method of treating a cancer as described herein can achieve one or more of the following biological activities: (1) killing (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) cancer cells; (2) inhibiting (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) proliferation of cancer cells; (3) inducing (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 1.5, 2, 3, 4, 5, 10, 20, or more folds) T cell expansion; (4) reducing (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) tumor size; (5) alleviating (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) one or more symptoms in an individual (e.g., human) having cancer; (6) inhibiting (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) tumor metastasis (e.g., metastasis to lymph nodes) ; (7) reducing (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) the presentation, incidence, or burden of pre-existing tumor metastasis (e.g., metastasis to lymph nodes) ; (8) prolonging survival, such as prolonging the survival of the individual by at least any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, or 24 months, or more; (9) prolonging time to cancer progression, such as prolonging the time to cancer progression by at least any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks, or more; (10) preventing, inhibiting, or reducing (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) the likelihood of the recurrence of a cancer; and / or (11) increasing, enhancing, or stimulating (e.g., at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 1.5, 2, 3, 4, 5, 10, 20, or more folds) an immune response or function in a subject by activating effector cells (e.g., T cells) . In some embodiments, the engineered immune cells (e.g., engineered T cells) administered to the individual have increased or enhanced (e.g., increasing at least about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 1.5, 2, 3, 4, 5, 10, 20, or more folds) priming, activation, proliferation, IFN-γ cytokine production, and / or cytolytic activity relative to non-engineered immune cells. In some embodiments, the method further activates bystander immune cells (i.e., non-engineered immune cells native to the individual, e.g., native T cells) . In some embodiments, the individual is a human.

[0233] The methods provided herein may be practiced in a primary therapeutic setting, i.e., wherein the methods being carried out are the primary / definitive therapy. In some embodiments, the method may be carried out before or in conjunction with the primary / definitive therapy. In some embodiments, the method is used to treat an individual (such as a human) who has previously been treated. Any of the methods of treatment provided herein may be used to treat an individual (such as a human) who has not previously been treated. In some embodiments, the method is used as a first line therapy. In some embodiments, the method is used as a second line therapy.

[0234] The methods described herein are suitable for treating a variety of cancers, including both solid cancer and liquid cancer. The methods are applicable to cancers of all stages, including early-stage cancer, non-metastatic cancer, primary cancer, advanced cancer, locally advanced cancer, metastatic cancer, or cancer in remission. The methods described herein may be used as a first therapy, second therapy, third therapy, or combination therapy with other types of cancer therapies known in the art, such as chemotherapy, surgery, radiation, gene therapy, immunotherapy, bone marrow transplantation, stem cell transplantation, targeted therapy, cryotherapy, ultrasound therapy, photodynamic therapy, radio-frequency ablation or the like, in an adjuvant setting or a neoadjuvant setting. In some embodiments, the cancer has been refractory to prior therapy.

[0235] In some embodiments, the method is suitable for treating cancers that express (e.g., overexpress) a specific TSA or TAA (e.g., DLL3 and / or B7H3) on the surface of the cancer cells. In some embodiments, the cancer cells in the individual express at least about any of more than 2, 5, 10, 20, 50, 100, 200, 500, 1000, or more fold of a specific TSA or TAA (e.g., DLL3 and / or B7H3) compared to normal cells.

[0236] The methods of treating a cancer described herein further comprise any suitable methods for the administration of an engineered immune cell (e.g., anti-DLL3 CAR) and / or the administration of a protein construct (e.g., MSAP, such as any of the anti-DLL3 and / or anti-B7H3 MSAPs described herein) . In some embodiments, the engineered immune cell and the MSAP are administered in a single composition. In some embodiments, the MSAP is secreted by the engineered immune cell. In some embodiments, the MSAP is not secreted by the engineered immune cell (i.e., the MSAP is added to the composition) . In some embodiments, the engineered immune cell and the MSAP are administered in separate compositions. The engineered immune cell can be administered before, after, or simultaneously with the MSAP administration. “Administration” used herein encompasses all above administration situation, including direct administration and indirect administration. For example, when the engineered immune cell expresses both the DLL3-targeted chimeric receptor and the MSAP, and only the engineered immune cell is actually administered to the individual to be treated, the MSAP secreted by the engineered immune cell is still considered as being administered (i.e., indirectly) to the individual.

[0237] Exemplary routes of administration of any of the engineered immune cells (e.g., engineered T cells) and / or MSAPs (e.g., any of the anti-DLL3 and / or anti-B7H3 MSAPs) described herein (or nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical compositions thereof) include, but are not limited to, intravenous, intracavitary, intraarterial, intramuscular, subcutaneous, parenteral, transdermal, topical, inhalation, oral, or intraperitoneal routes, or be delivered into lymph glands, body spaces, organs, or tissues known to contain cancer cells. In some embodiments, the engineered immune cells and / or MSAPs, nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical compositions thereof, are administered intravenously, such as by infusion. Intravenous infusion can be at any suitable rate. For example, in some embodiments, the engineered immune cells and / or MSAPs described herein can be infused to an individual (e.g., human) in need thereof over a period of time no more than about any of 24 hours, 20 hours, 18 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hours, 30 minutes, or less. In some embodiments, the engineered immune cells and / or MSAPs described herein, or pharmaceutical composition thereof, is infused to the individual over a period of time of any one of about 30 minutes to about 1 hour, about 1 to about 2 hours, about 2 to about 4 hours, about 4 to about 6 hours, about 6 to about 8 hours, about 8 to about 10 hours, about 10 to about 12 hours, about 12 to about 18 hours, about 18 to about 24 hours, about 30 minutes to about 2 hours, about 2 to about 5 hours, about 5 to about 10 hours, about 10 to about 20 hours, about 30 minutes to about 10 hours, or about 30 minutes to about 20 hours.

[0238] In some embodiments, the method of treating comprises administration of any of the engineered immune cells described herein or pharmaceutical compositions thereof, for example at a range of about ten thousand to about 100 billion cells and / or ten thousand to about 100 billion cells per kilogram of body weight. In some embodiments, the engineered immune cells or pharmaceutical composition thereof is administered at a dosage of at least about any of 104, 105, 106, 107, 108, or 109 cells / kg of body weight of the individual. In some embodiments, the engineered immune cell co-expressing the chimeric receptor and an MSAP is administered at a dose less than that when the engineered immune cell expresses the chimeric receptor only. Dosages may vary depending on attributes particular to the cancer and / or patient and / or other treatments. The method may occur without or with the administration of one or more cytokines.

[0239]

[0240] In some embodiments, the MSAP for administration is secreted by the engineered immune cell. In such situations, the dosage of administration (indirect administration) of the MSAP follows the dosage of the administration (direct administration) of the engineered immune cell. In some embodiments, the engineered immune cell co-expressing the DLL3-targeted chimeric receptor (e.g., anti-DLL3 CAR) and the MSAP is administered at the dose of about 1×104 cells / kg to about 1×108 cells / kg. In some embodiments, the MSAP secreted by the engineered immune cell is at a dose less than that when MSAP is not secreted by the engineered immune cell and needs to be externally provided. Dosages may vary depending on attributes particular to the disease or disorder and / or patient and / or other treatments.

[0241] The dosing regimen of the engineered immune cells and / or MSAPs described herein, nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical compositions thereof, administered to the individual (such as a human) may vary with the particular composition, the method of administration, and the particular type of cancer being treated. In some embodiments, the effective amount of the engineered immune cells and / or MSAPs, nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical compositions thereof, is below the level that induces a toxicological effect (i.e., an effect above a clinically acceptable level of toxicity) or is at a level where a potential side effect can be controlled or tolerated when the composition is administered to the individual.

[0242] In some embodiments, the pharmaceutical composition provided herein contains the engineered immune cells and / or MSAPs (or nucleic acids or vectors (e.g., viral vectors) encoding thereof) in amounts effective to treat or prevent the cancer, such as a therapeutically effective or prophylactically effective amount. Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects. For repeated administrations over several days or longer, depending on the condition, the treatment is repeated until a desired suppression of cancer symptoms occurs. However, other dosage regimens may be useful and can be determined.

[0243] The optimal dosage and treatment regime for a particular patient can be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly. In certain embodiments, once the engineered immune cells (either expressing the chimeric receptor alone or co-expressing the chimeric receptor and an MSAP) are administered to an individual (e.g., a human) , the biological activity of the engineered immune cell populations and / or MSAPs is measured by any of a number of known methods. Parameters to assess include specific binding of an engineered immune cell or non-engineered immune cell (e.g., bystanders) to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry. In certain embodiments, the ability of the engineered immune cells or non-engineered immune cells (e.g., bystanders) to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32 (7) : 689-702 (2009) , and Herman et al. J. Immunological Methods, 285 (1) : 25-40 (2004) . In certain embodiments, the biological activity of the engineered immune cells or non-engineered immune cells (e.g., bystanders) also can be measured by assaying expression and / or secretion of certain cytokines, such as CD107a, IFNγ, IL-2, and TNF. In some aspects, the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load. Also see Examples 3 and 5 for methods of assessments.

[0244] In some embodiments, the individual to whom the engineered immune cells and / or MSAPs described herein (or nucleic acids or vectors (e.g., viral vectors) encoding thereof, or pharmaceutical composition thereof) are administered is a primate, such as a human, monkey, gorilla, chimpanzee, etc. In some embodiments, the individual is a human. The individual can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric individuals. In some embodiments, the individual is a mammal, including but are not limited to, mice, rats, hamsters, guinea pigs, rabbits, chinchillas, cats, dogs, horses, donkeys, cows, goats, sheep, deer, monkeys, apes, etc. In some embodiments, the individual is a livestock. In some embodiments, the individual is a companion animal. In some examples, the individual is a validated animal model for disease, adoptive cell therapy, and / or for assessing toxic outcomes. VI. Methods of Making Engineered Immune Cells and MSAPs

[0245] Also provided are methods of making any of the engineered immune cells (e.g., an engineered T cell) described herein, such as engineered immune cell expressing a DLL3-targeted chimeric receptor (e.g., CAR) , engineered immune cell expressing an MSAP (e.g., anti-DLL3×anti-CD3 or anti-B7H3×anti-CD3 bispecific antibody) , or engineered immune cell co-expressing a DLL3-targeted chimeric receptor and an MSAP. Also provided are methods of making any of the MSAPs described herein. Methods of cloning vector construction, protein expression and purification, cell preparation (e.g., enrichment and / or activation) and transfection, etc., are well-known in the art. Any of the isolated nucleic acids and vectors described under Section II “D. Nucleic acids and vectors encoding the chimeric receptor and / or multispecific antigen binding protein” can be used herein to make the engineered immune cells and / or MSAPs. Also see Examples 1 and 2 for exemplary making methods.

[0246] In some embodiments, there is provided a method of making an engineered immune cell (e.g., an engineered T cell) , wherein the engineered immune cell comprises (a) a first nucleic acid encoding a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3×anti-CD3 MSAP or anti-B7H3×anti-CD3 MSAP) ; wherein the method comprises: introducing into a population of immune cells the first nucleic acid encoding the chimeric receptor and the second nucleic acid encoding the MSAP. In some embodiments, the method further comprises providing the population of immune cells before introducing the first nucleic acid and / or the second nucleic acid. Hence in some embodiments, the engineered immune cell is made from a method comprising providing a population of immune cells and introducing into the population of immune cells a first nucleic acid encoding the chimeric receptor and a second nucleic acid encoding the MSAP. In some embodiments, the first nucleic acid and the second nucleic acid are on different vectors. In some embodiments, the first nucleic acid and the second nucleic acid are introduced into the population of immune cells simultaneously. In some embodiments, the first nucleic acid is introduced into the population of immune cells before introducing the second nucleic acid. In some embodiments, the method further comprises isolating and / or enriching a plurality of engineered immune cells expressing the DLL3-targeted chimeric receptor, then introducing into the plurality of engineered immune cells the second nucleic acid encoding the MSAP. In some embodiments, the second nucleic acid is introduced into the population of immune cells before introducing the first nucleic acid. In some embodiments, the method further comprises isolating and / or enriching a plurality of engineered immune cells expressing the MSAP, then introducing into the plurality of engineered immune cells the first nucleic acid encoding the DLL3-targeted chimeric receptor. In some embodiments, the first nucleic acid and the second nucleic acid are on the same vector (e.g., under the control of the same promoter or different promoters) . In some embodiments, the method further comprises isolating and / or enriching a plurality of engineered immune cells that express both the DLL3-targeted chimeric receptor and the MSAP. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR (e.g., using standard methods known in the art) .

[0247] In some embodiments, the first nucleic acid and the second nucleic acid are introduced into the population of immune cells simultaneously. In some embodiments, the first nucleic acid and the second nucleic acid are on the same vector. In some embodiments, the first nucleic acid and the second nucleic acid are on the same vector and under the control of separate promoters, wherein the separate promoters are the same promoter or different promoters. In some embodiments, the first nucleic acid and the second nucleic acid are on the same vector and under the control of the same promoter, wherein the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid encoding a cleavable linker, such as a self-cleaving peptide. In some embodiments, the self-cleaving peptide is selected from the group consisting of T2A, P2A, E2A, and F2A. In some embodiments, the cleavable linker is a P2A peptide comprising the amino acid sequence of SEQ ID NO: 43.

[0248] In some embodiments, there is provided a method of making an engineered immune cell (e.g., engineered T cell) , wherein the engineered immune cell comprises (a) a first nucleic acid encoding a chimeric receptor as described in Section II above; and (b) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ; e.g., anti-DLL3×anti-CD3 MSAP or anti-B7H3×anti-CD3 MSAP) as described in Section III above; wherein the first nucleic acid and the second nucleic acid are on the same vector and under the control of the same promoter; wherein the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid (e.g., IRES, or encoding a cleavable linker such as 2A peptide) ; and wherein the method comprises: (a) providing a population of immune cells, and (b) introducing into the population of immune cells the vector comprising the first nucleic acid and the second nucleic acid. In some embodiments, the first nucleic acid is upstream of the second nucleic acid. In some embodiments, the vector comprising the first nucleic acid and the second nucleic acid encodes a polypeptide comprising the amino acid sequence of SEQ ID NO: 44 or 45. In some embodiments, the engineered immune cell is further engineered to not express or to express a reduced level of endogenous TCR.

[0249] In some embodiments, the first nucleic acid and / or the second nucleic acid are introduced into the population of immune cells via a viral vector. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus (AVV) vectors, lentiviral vector, retroviral vectors, herpes simplex viral vector, and derivatives thereof.

[0250] In some embodiments, the first nucleic acid and / or the second nucleic acid are under the control of a promoter. In some embodiments, the promoter is selected from the group consisting of a phosphoglycerate kinase (PGK) promoter (e.g., PGK-1 promoter) , a Rous Sarcoma Virus (RSV) promoter, an Simian Virus 40 (SV40) promoter, a cytomegalovirus (CMV) immediate early (IE) gene promoter, an elongation factor 1 alpha (EF1-α) promoter, a ubiquitin-C (UBQ-C) promoter, a cytomegalovirus CMV) enhancer / chicken beta-actin (CAG) promoter, polyoma enhancer / herpes simplex thymidine kinase (MC1) promoter, a beta actin (β-ACT) promoter, a myeloproliferative sarcoma virus enhancer, negative control region deleted, d1587rev primer-binding site substituted (MND) promoter, an NFAT promoter, a promoter, and an NFκB promoter. In some embodiments, the promoter is an hEF1α promoter.

[0251] In some embodiments, the engineered immune cell is prepared by introducing the chimeric receptors into the immune cell, such as a T cell. In some embodiments, the chimeric receptor is introduced to the immune cell by transfecting any one of the isolated nucleic acids or vectors described herein. In some embodiments, the immune cell (e.g., engineered immune cell expressing the chimeric receptor) is further engineered to express an MSAP (such as any of the anti-DLL3 and / or anti-B7H3 MSAP described herein) , by transfecting any one of the isolated nucleic acids or vectors described herein. In some embodiments, the chimeric receptor is introduced to the immune cell by inserting proteins into the cell membrane while passing cells through a microfluidic system, such as CELL  (see, e.g., U.S. Patent Application Publication No. 20140287509) .

[0252] Methods of introducing vectors or isolated nucleic acids into a mammalian cell are known in the art. The vectors described can be transferred into an immune effector cell by physical, chemical, or biological methods. In some embodiments, the chimeric receptor and / or multispecific antigen binding protein described herein is expressed by introducing a nucleic acid comprising a sequence encoding the chimeric receptor and / or multispecific antigen binding protein into a cell in vivo (in vivo cell therapy) or in vitro (including autologous cell therapy and allogeneic cell therapy) . In some embodiments, the cell is an immune cell.

[0253] Physical methods for introducing an isolated nucleic acid or vector into an immune cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and / or exogenous nucleic acids are well-known in the art. See, e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. In some embodiments, the vector is introduced into the cell by electroporation.

[0254] Biological methods for introducing an isolated nucleic acid or vector into an immune cell include the use of DNA and RNA vectors. Viral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.

[0255] Chemical means for introducing an isolated nucleic acid or vector into an immune cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro is a liposome (e.g., an artificial membrane vesicle) .

[0256] RNA molecules encoding any of the chimeric receptors and / or MSAP described herein may be prepared by a conventional method (e.g., in vitro transcription) and then introduced into the immune cells via known methods such as mRNA electroporation. See, e.g., Rabinovich et al., Human Gene Therapy 17: 1027-1035 (2006) .

[0257] The transduced or transfected immune cell can be propagated ex vivo after introduction of the vector or isolated nucleic acid. For example, the transduced or transfected immune cell can be cultured to propagate for at least about any of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 9 days, 10 days, 12 days, or 14 days. The transduced or transfected immune cells may be further evaluated or screened to select the engineered mammalian cell, e.g., expressing the chimeric receptor, or expressing both the chimeric receptor and the MSAP.

[0258] Reporter genes may be used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al. FEBS Letters 479: 79-82 (2000) ) . Suitable expression systems are well known and may be prepared using known techniques or obtained commercially.

[0259] Other methods to confirm the presence of the nucleic acid encoding the chimeric receptors and / or MSAPs in the engineered immune cell, include, for example, molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological methods (such as ELISAs and Western blots) .

[0260] In some embodiments, the engineered immune cell is a T cell. T cells for use in expansion and genetic modification can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, any number of T cell lines available in the art, may be used. For example, T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as FicollTM separation. In some embodiments, cells from the circulating blood of an individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS) . In some embodiments, the wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations. Initial activation steps in the absence of calcium may lead to magnified activation. As those of ordinary skill in the art would readily appreciate a washing step may be accomplished by methods known to those in the art, such as by using a semi-automated “flow-through” centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca2+-free, Mg2+-free PBS, PlasmaLyte A, or other saline solution with or without buffer. Alternatively, the undesirable components of the apheresis sample may be removed and the cells directly resuspended in culture media.

[0261] T cells can be isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient or by counterflow centrifugal elutriation. A specific subpopulation of T cells, such as CD3+, CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, can be further isolated by positive or negative selection techniques. For example, in some embodiments, T cells are isolated by incubation with anti-CD3 / anti-CD28 (i.e., 3×28) -conjugated beads, such as M-450 CD3 / CD28 T, for a time period sufficient for positive selection of the desired T cells. In some embodiments, the time period is about 30 minutes. In a further embodiment, the time period ranges from about 30 minutes to about 36 hours or longer and all integer values there between, such as about 10 to about 24 hours. In a further embodiment, the time period is at least about 1, 2, 3, 4, 5, or 6 hours. For isolation of T cells from patients with leukemia, use of longer incubation times, such as 24 hours, can increase cell yield. Longer incubation times may be used to isolate T cells in any situation where there are few T cells as compared to other cell types, such in isolating T cells from tumor tissue or from immune-compromised individuals. Further, use of longer incubation times can increase the efficiency of capture of CD8+ T cells. For example, by simply shortening or lengthening the time T cells are allowed to bind to the CD3 / CD28 beads and / or by increasing or decreasing the ratio of beads to T cells, subpopulations of T cells can be preferentially selected for or against at culture initiation or at other time points during the process. Additionally, by increasing or decreasing the ratio of anti-CD3 and / or anti-CD28 antibodies on the beads or other surface, subpopulations of T cells can be preferentially selected for or against at culture initiation or at other desired time points. The skilled artisan would recognize that multiple rounds of selection can also be used. It may be desirable to perform the selection procedure and use the “unselected” cells in the activation and expansion process. “Unselected” cells can also be subjected to further rounds of selection.

[0262] In some embodiments, the population of immune cells are enriched for CD4+ and / or CD8+ cells. In some embodiments, the population of immune cells are enriched for both CD4+and CD8+ cells, such as by using CD4 Nanobeads and CD8 Nanobeads. In some embodiments, the population of immune cells are activated before introducing the nucleic acid encoding the chimeric receptor and / or the MSAP into the immune cells, such as by using anti-CD3 / CD28 particles. The enrichment of CD4+ and / or CD8+ cells may be performed before introducing the nucleic acid encoding the chimeric receptor and / or the MSAP into the population of immune cells. The enrichment of CD4+ and / or CD8+ cells may be performed after introducing the nucleic acid encoding the chimeric receptor and / or the MSAP into the population of immune cells (e.g., a mixture of PBMC) .

[0263] In some embodiments, the cells may be incubated on a rotator for varying lengths of time at varying speeds at 2-10℃, or at room temperature.

[0264] T cells for stimulation can also be frozen after a washing step. Without being bound by theory, the freeze and subsequent thaw step may provide a more uniform product by removing granulocytes and to some extent monocytes in the cell population. After the washing step that removes plasma and platelets, the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, one method involves using PBS containing 20%DMSO and 8%human serum albumin, or culture media containing 10%dextran 40 and 5%dextrose, 20%human serum albumin and 7.5%DMSO, or 31.25%plasmalyte-A, 31.25%dextrose 5%, 0.45%NaCl, 10%dextran 40 and 5%dextrose, 20%human serum albumin, and 7.5%DMSO or other suitable cell freezing media containing for example, Hespan and PlasmaLyte A. The cells then are frozen to -80℃ at a rate of 1℃ per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20℃ or in liquid nitrogen.

[0265] In some embodiments, cryopreserved cells are thawed and washed as described herein and allowed to rest for one hour at room temperature prior to activation.

[0266] In some embodiments, prior to or after genetic modification of the T cells expressing the chimeric receptors or co-expressing the chimeric receptors and the MSAPs described herein, the T cells can be activated and expanded generally using methods as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005.

[0267] Generally, T cells can be expanded by contact with a surface having attached thereto an agent that stimulates a CD3 / TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the T cells. In particular, T cell populations may be stimulated as described herein, such as by contact with an anti-CD3 antibody, or antigen binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule is used. For example, a population of T cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody, under conditions appropriate for stimulating proliferation of the T cells. To stimulate proliferation of either CD4+ T cells or CD8+ T cells, an anti-CD3 antibody and an anti-CD28 antibody can be used. Examples of an anti-CD3 antibody include UCHT1, OKT3, HIT3a (BioLegend, San Diego, US) can be used as can other methods commonly known in the art (Graves J, et al., J. Immunol. 146: 2102 (1991) ; Li B, et al., Immunology 116: 487 (2005) ; Rivollier A, et al., Blood 104: 4029 (2004) ) . Examples of an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) can be used as can other methods commonly known in the art (Berg et al., Transplant Proc. 30 (8) : 3975-3977 (1998) ; Haanen et al., J. Exp. Med. 190 (9) : 13191328 (1999) ; Garland et al., J. Immunol Meth. 227 (1-2) : 53-63 (1999) ) .

[0268] In addition to CD4 and CD8 markers, other phenotypic markers vary significantly, but in large part, reproducibly during the course of the cell expansion process. Thus, such reproducibility enables the ability to tailor an activated T cell product for specific purposes. EXAMPLES

[0269] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present disclosure, and are not intended to limit the scope of what the inventors regard as their disclosure nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc. ) but some experimental errors and deviations should be accounted for. The examples below are intended to be purely exemplary of the disclosure and should therefore not be considered to limit the disclosure in any way.

[0270] The present disclosure has been described in terms of particular embodiments found or proposed by the present inventor to comprise preferred modes for the practice of the disclosure. It will be appreciated by those of skill in the art that, in light of the present disclosure, numerous modifications and changes can be made in the particular embodiments exemplified without departing from the intended scope of the disclosure. For example, due to codon redundancy, changes can be made in the underlying DNA sequence without affecting the protein sequence. Moreover, due to biological functional equivalency considerations, changes can be made in protein structure without affecting the biological action in kind or amount. All such modifications are intended to be included within the scope of the appended claims. Example 1: Plasmid construction, virus preparation, titer evaluation

[0271] As shown in the schematic diagram FIG. 1A, cells were genetically engineered, as described in further detail below, to produce and secrete T cell engager molecules comprising an anti-DLL3 domain and an anti-CD3 domain (referred to hereinafter as “anti-DLL3 TCE” or “DLL3 TCE” ) as well as to express anti-DLL3 chimeric antigen receptors (anti-DLL3 CAR) . To generate the anti-DLL3 CAR, two exemplary anti-DLL3 VHH domains (anti-DLL3 VHH1: SEQ ID NO: 4; anti-DLL3 VHH2: SEQ ID NO: 8) were connected with a 3×G4S linker (GGGGSGGGGSGGGGS, SEQ ID NO: 41) . The amino acid sequence of the tandem VHH domain is shown as SEQ ID NO: 9. The tandem anti-DLL3 VHH fragment was fused with additional protein sequences yielding a full CAR comprising a CD8α signal peptide (SEQ ID NO: 35) , the tandem VHH domain (e.g., SEQ ID NO: 9) , a CD8α hinge domain (SEQ ID NO: 36) , a CD8α transmembrane domain (SEQ ID NO: 37) , a CD137 co-stimulatory signaling domain (SEQ ID NO: 38) , and a CD3ζ primary intracellular signaling domain (SEQ ID NO: 39) . The anti-DLL3 CAR can also be generated by any other known method. For example, the nucleic acid sequence encoding the CD8α signal peptide and the tandem VHH domain can be chemically synthesized and cloned upstream of a CAR backbone polypeptide of a pre-modified lentiviral vector via restriction sites by molecular cloning techniques known in the art, the CAR backbone polypeptide including a CD8α hinge domain, a CD8α transmembrane domain, a CD137 co-stimulatory signaling domain, and a CD3ζ primary intracellular signaling domain. An exemplary anti-DLL3 CAR sequence is shown as SEQ ID NO: 40. See Table 2 below. Control anti-DLL3 CAR constructs that lacked secreted TCE constructs were also generated (i.e., “D3598” ) .

[0272] To generate the anti-DLL3 TCE, an exemplary anti-DLL3 VHH (anti-DLL3 VHH3, SEQ ID NO: 14) and an exemplary anti-CD3 scFv (I2C, SEQ ID NO: 32) were connected with a G4S linker (GGGGS, SEQ ID NO: 42) . The amino acid sequence of the anti-DLL3 TCE is shown as SEQ ID NO: 33. See Table 2 below.

[0273] As shown in the schematic diagram FIG. 1B, cells were genetically engineered, as described in further detail below, to produce and secrete T cell engager molecules comprising an anti-B7H3 domain and an anti-CD3 domain (referred to hereinafter as “anti-B7H3 TCE” or “B7H3 TCE” ) as well as to express an exemplary anti-DLL3 CAR, as described above. To generate an exemplary anti-B7H3 TCE, an exemplary anti-B7H3 scFv (SEQ ID NO: 23) and an exemplary anti-CD3 scFv (I2C, SEQ ID NO: 32) were connected with a G4S linker (GGGGS, SEQ ID NO: 42) . The amino acid sequence of the anti-B7H3 TCE is shown as SEQ ID NO: 34. See Table 2 below.

[0274] To co-express the exemplary anti-DLL3 CAR and anti-DLL3 TCE, the exemplary anti-DLL3 TCE was linked to the C-terminus of the exemplary anti-DLL3 CAR via a cleavable 2A linker (e.g., a P2A linker, SEQ ID NO: 43) . To co-express the exemplary anti-DLL3 CAR and anti-B7H3 TCE, the exemplary anti-B7H3 TCE was linked to the C-terminus of the anti-DLL3 CAR via a cleavable 2A linker (e.g., a P2A linker, SEQ ID NO: 43) . See Table 2 below. Table 2. Exemplary amino acid sequences.

[0275] Nucleic acid constructs comprising the above CAR / TCE systems were chemically synthesized and cloned into a pre-modified lentiviral vector (PLVX) downstream and operably linked to a constitutive hEF1α promoter for in vitro transcription (i.e., a lentiviral PLVX-EF1A vector) .

[0276] The lentivirus packaging plasmid mixture containing pMDLg. pRRE (Addgene#12251) , pRSV-REV (Addgene#12253) and pMD2. G (Addgene#12259) were pre-mixed with the lentiviral PLVX-EF1A vectors encoding the exemplary anti-DLL3 CAR / anti-DLL3 TCE and anti-DLL3 CAR / anti-B7H3 TCE systems described above at a pre-optimized ratio with polyetherimide (PEI) , then mixed and incubated at room temperature for 15 minutes. The transfection mix then was added dropwise to HEK293T cells and mixed gently. Transfected HEK293T cells were incubated overnight in a cell incubator with 5%CO2 at 37℃. Forty-eight hours post-transfection, cell supernatants were collected and centrifuged at 4℃ and 500 g for 10 min, then filtered through a 0.45 μm PES filter followed by ultra-centrifugation for lentivirus concentration. The post-centrifugation supernatants were carefully discarded and the virus pellets were rinsed cautiously with pre-chilled Dulbecco’s PBS (DPBS) . The viruses were resuspended properly, and stored at -80℃. The virus titer was also determined by standard titration methods. Example 2: Preparation of engineered T Cells expressing anti-DLL3 chimeric antigen  receptors (CAR) and T cell engagers

[0277] T cells were isolated from healthy donor PBMCs (Sailybio) using the isolation kit CytoSinctTM CD4 Nanobeads (human) (Genscript, Cat. #L00863) and CytoSinctTM CD8 Nanobeads (human) (Genscript, Cat. #L00864) following manufacturer’s protocols as described below. Cell number was first determined and PBMCs were centrifuged at 300 g for 10 min at room temperature (15-25℃) . The supernatant was aspirated completely, and cells were resuspended into a single cell suspension at 108 cells per 1 mL in isolation buffer. 10 μL Nanobeads were added for each 100 μL cell suspension of 107 total cells. The Nanobeads and cells were mixed well by gently pipetting or tapping on the bottom of the tube and incubated for 15 min at 2-8℃. Cells were washed once by adding 1 mL of isolation buffer per 107 cells, mixed well by gentle pipetting, and centrifuged at 300 g for 10 min. Supernatant was aspirated completely. Cells were resuspended up to 108 cells in 500 μL of isolation buffer. For magnetic separation, CytoSinctTM gL columns (Genscript, Cat#D00008) was placed in the magnetic field of a suitable MACS Separator. The column was rinsed once with 3 mL isolation buffer, and the buffer was allowed to run through the column but not run dry. The cell suspension was transferred onto the prepared columns using a pipette and the unlabeled cells were collected in the flow-through. The column was washed with 3 mL isolation buffer, and unlabeled cells were collected in the flow-through with a suitable tube. The washing step was repeated another two times. New Isolation Buffer was added when the column stopped dripping, but before it ran dry. The column was removed from the magnet and placed on a new tube for cell collection. 5 mL isolation buffer was pipetted onto the column. The fraction with the magnetically labeled cells was immediately flushed out by firmly applying the plunger through the column chamber supplied with the column. The cells were then centrifuged and re-suspended in TexMACS GMP Medium&1L (Miltenyi #170-076-309) with 300 IU / mL IL-2 (Jiangsu Jinsili Pharmaceutical, S10970055) .

[0278] The prepared T cells were adjusted to the concentration of 106 cells per 1 mL and subsequently pre-activated for 48 hours using Enceed TM T cell Activation reagent (Genscript, L00899-1) according to manufacturer’s protocol. The Enceed T cell Activation reagent is composed of biodegradable matrix-coated nanoparticles conjugated with mouse anti-human CD3 and mouse anti-human CD28 antibodies. The recommended titer is 1: 200 (i.e., 5 μL of Enceed TM T cell Activation reagent for activation of 1×106 T cells) .

[0279] The pre-activated T cells were transduced with lentivirus stocks by adding lentivirus stock directly into the culture medium (TexMACS GMP Medium supplemented with 300 IU / mL IL-2) at proper multiplicity of infection (MOI) . Additional IL-2 was supplemented to a final concentration of 300 IU / mL. The transduced cells were then transferred to a cell culture incubator with 5%CO2 at 37℃ for transgene expression. Fresh medium was replaced 24 hours post-lentiviral infection. Infected T cells were maintained in TexMACS GMP medium and 300 IU / mL IL-2 at a cell density between 5×105 to 1×106 cells / mL.

[0280] To verify the effect of TCEs on allogeneic CAR-T cells, anti-DLL3 CAR-T cells that secreted anti-B7H3 TCEs were further knocked out for TCR gene expression (i.e., “Allo-M3118” ) were also generated. Anti-DLL3 CAR-T cells (i.e., M3085) and anti-DLL3 CAR-T cells that secrete anti-B7H3 TCEs (i.e., M3118) were simultaneously generated as controls. The endogenous TCR of M3118 was knocked out 7 days post-infection via CRISPR / Cas9. Briefly, electroporation buffer A and electroporation buffer B (Celetrix, Cat. #1204) were mixed at a 1: 1 ratio ( “electroporation buffer A / B” ) and afterwards aliquoted at a volume of 140 μL in sterile 1.5 mL RNase-free microcentrifuge tubes. 16 μg Cas9 Nuclease and 0.4 nmol gRNA (AGAGTCTCTCAGCTGGTACA, SEQ ID NO: 47) were added to 60 μL mixed electroporation buffer A / B, mixed, and incubated for 10 min at room temperature to allow the formation of the gRNA / Cas9 ribonucleoprotein complex (gRNA / Cas9) . 1.2×107 cells were resuspended in 70 μL mixed electroporation buffer A / B, mixed with the 60 μL gRNA / Cas9 described above, and electroporated. After that, the cells were immediately cultured in RPMI1640 medium at 37 ℃ with 5%CO2. Cells were harvested on day 14 and the percentage of CAR-positive T cells was determined as described below. Since the expression of CD3 was found to be downregulated after TCR ablation, CD5 was instead used for detecting cells of the T cell lineage, which is also an activation marker of T cells. Representative FACS plots of the percentage of anti-DLL3 CAR T cells (i.e., “DLL3+” ; M3085, M3118 and Allo-M3118) at harvest are shown in FIG. 10.

[0281] Anti-DLL3 CAR expression was determined at 7 days (anti-DLL3 TCE constructs and controls) or 9 days (anti-B7H3 constructs and controls) post-infection by collecting 5×105 CAR-T cells from each group, and then incubating the cells with MonoRabTM Rabbit Anti-Camelid VHH Cocktail (Genscript, A02017-200) for 30 min at 4℃. Upon completion of incubation, cells were harvested and washed with DPBS, then centrifuged at 300 g for 5 min at 20℃, the supernatant was aspirated completely, and the cells were resuspended in 100 μL DPBS. The CAR expression level of the prepared CAR-T cells was assessed via flow cytometry (ACEA NovoCyte) . The percentage of CAR positive T cells was further analyzed by Flowjo 7.6. See Table 3 below. UnT (or “UNT” ) represented untransduced T cells that lacked CAR expression as a negative control. As shown in Table 3, CAR-T cells were successfully transduced, and CAR expression level of each CAR-T cell group ranged from 55.64%to 80.87%. Table 3. Percentage of CAR positive (CAR%) T cells. Example 3: Characterization of the engineered anti-DLL3 CAR-T Cells against DLL3- positive target cells

[0282] The anti-tumor function of anti-DLL3 CAR-T cells generated as described in Examples 1 and 2 above were then characterized to identify the CAR-T cell activity in the presence of DLL3-positive target cells, as described in more detail below.

[0283] Statistical significance for the above-described tests was determined using the two-tailed Student's t-test. P<0.05 was considered significant. The statistical analysis was performed using the GraphPad Prism 9.3.1 software. The statistical significance P values in figure mean as following: *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001. CAR-T cell cytotoxicity:

[0284] The cytotoxicity of anti-DLL3 CAR-T cells (i.e., “UD3661” ) and anti-DLL3 CAR-T cells secreting anti-DLL3 TCE (i.e., “D3598” ) was assayed as follows.

[0285] The DLL3-expressing SHP-77 cancer cell line was used as a target cell and was engineered to express the firefly luciferase reporter gene (i.e., “SHP-77. Luc” ) . This engineered target cell was further engineered to knock out DLL3, thereby creating a DLL3-negative SHP-77. Luc cell line (i.e., “SHP-77 DLL3 KO. Luc” ) . Then 100 μL of SHP-77. Luc tumor cells or SHP-77 DLL3 KO. Luc tumor cells were added to a 96 well plate and centrifuged at 300×g for 1 minute. Then 100 μL anti-DLL3 CAR-T cells or untransduced T cells ( “UNT” , to control for nonspecific T cell lysis) were added to the plate at the effector (CAR-T or UNT) to target cell (E / T) ratio of 3: 1, 1: 1, or 1: 3. After 20h-24h incubation at 37℃ with 5%CO2 in a cell culture incubator, 100 μL supernatant from each well was collected for interferon gamma (IFN-γ) release assay. The co-cultured cells were then added with 100 μL One-Lite Luciferase Assay System reagent mix (Vazyme, DD1203-03) and incubated at room temperature for 1 minute. The remaining amount of live target cells was indicated by luciferase activity as indicated in Relative Light Units (RLU) and read by a microplate reader (Tecan Spark) . The cytotoxicity of anti-DLL3 CAR-T cells against target cells was calculated using the following formula:

[0286] RLUsample refers to the luciferase activity determined from wells with co-cultured SHP-77. Luc target cells and anti-DLL3 CAR-T cells, i.e., from one of each of the tested experimental conditions.

[0287] RLUmin refers to the luciferase activity determined from wells into which Triton X-100 was added at a final concentration of 1%upon initiation of the cytotoxicity assay.

[0288] RLUUNT refers to the luciferase activity as determined from wells with co-cultured SHP-77. Luc target cells and T cells un-transduced with an anti-DLL3 CAR construct.

[0289] As shown in FIG. 2A, specific cytotoxicity was observed in both anti-DLL3 CAR-T cell groups against DLL3-positive SHP-77. Luc cells, in contrast to the nonspecific low-level cytotoxicity demonstrated by the UNT cells against the SHP-77. Luc tumor cells. Both D3598 and UD3661 showed comparable efficacy against DLL3-positive SHP-77. Luc cells. Notably, little background cytolysis was observed from anti-DLL3 CAR-T cell groups against SHP-77-DLL3 KO. Luc tumor cells (FIG. 2B) . These results demonstrate that the anti-DLL3 CAR-T cells act specifically on target cells that express DLL3 antigen.

[0290] The 100 μL supernatant that was collected from each well to assess for IFN-γ release was then tested using the HTRF human IFN gamma kit (Cisbio, #62HIFNGPEH) per manufacturer’s protocol. Briefly, HTRF reagents were allowed to warm up to room temperature for at least 30 min before the assay. 16 μL / well supernatants from co-culture assay were transferred to a 384 well assay plate (Greiner Bio-One, #784075) , followed by the addition of 4 μL / well pre-mixed HTRF reagents prepared according to the kit manual. The plate was then sealed with parafilm and incubated overnight at room temperature. The plate was read on an HTRF compatible reader Tecan Spark 10M. IFN-γ concentration was calculated by referring to the signal obtained by standard curves provided by the kit.

[0291] As shown in FIG. 3, anti-DLL3 CAR-T cells secreted functional amounts of IFN-γ upon co-culture with DLL3 positive SHP-77. Luc tumor cells. In contrast, there was little secretion of IFN-γ by UNT cells co-cultured with target SHP-77. Luc tumor cells. Notably, significantly higher cytokine release was observed in D3598 in comparison to UD3661, suggesting secreting anti-DLL3 TCEs may lower the risk of cytokine release syndrome (CRS) induced by CAR-T cells. IFN-γ release in the supernatant of both of the anti-DLL3 CAR-T cell groups co-cultured with SHP-77 DLL3 KO. Luc was also detected, but remained lower than the detection limit of the kit (data not shown) . Bystander T cell cytotoxicity:

[0292] The cytotoxicity of bystander T cells not comprising anti-DLL3 CARs was tested to demonstrate the ability of the secreted T cell engager (TCE) to recruit and activate T cells against cells that present specific target antigens.

[0293] In this experiment, 1×105 SHP-77. Luc cells were plated in bottom wells with either 5×105 bystander untransduced T cells ( “UNT” ; FIG. 4A) or bystander untransduced γδ-T cells ( “UNgdT” ; FIG. 4B) with an E: T ratio of 1: 5. Then transwell inserts (Corning, Cat No. 3392) were added to the wells, into which were pipetted the anti-DLL3 CAR-T cells (i.e., D3598 or UD3661) at one of three values: 3×105 cells, 1×105 cells, or 0.33×105 cells) . After 72 hours, bioluminescence was quantified by preparing One-Lite Luciferase Assay System reagent mix (Vazyme, DD1203-03) according to manufacturer’s protocol and adding the reagent mix to the co-cultured cells in order to detect the remaining luciferase activity in each well. Luciferase is expressed only by the target cells, so the luciferase activity in each well correlates directly to the number of viable target cells in each well. The maximum luciferase activity was obtained by adding culture media to target cells in the absence of effector cells. The cytotoxicity was then calculated using the formula as described above.

[0294] As shown in FIGs. 4A and 4B, bystander UNT or UngdT cells co-cultured with UD3661 demonstrated significant cytotoxicity against DLL3-positive SHP-77. Luc tumor cells, however bystander UNT or UngdT cells co-cultured with D3598 showed little or only basal levels of target-cell killing. These results indicate that bystander UNT cells or UngdT cells were only able to activate and to kill DLL3-positive SHP-77. Luc tumor cells in response to the secreted anti-DLL3 TCE. T cell function:

[0295] The functional properties of anti-DLL3 CAR-T cells (i.e., “UD3661” ) and anti-DLL3 CAR-T cells secreting anti-DLL3 TCEs (i.e., “D3598” ) was assayed as follows: a. Expansion

[0296] T cell persistence and expansion of anti-DLL3 CAR-T cells (i.e., each of UD3661 and D3598) was assessed using a repetitive stimulation tumor challenge model. In brief, 2×105 CAR-T cells (D3598 or UD3661) were co-cultured with 6×105 SHP-77. Luc cells in a 12-well plate. Three days later, cells were harvested to determine the relative ratio of viable T cells and tumor cells. Anti-DLL3 CAR-T cells were quantified and then re-plated with fresh SHP-77. Luc tumor cells at an E: T ratio of 1: 3 for another round of antigen (i.e., DLL3) stimulation. Four such rounds were carried out, each denoted as R1 (i.e., round 1) , R2 (i.e., round 2) , R3 (i.e., round 3) , and R4 (i.e., round 4) .

[0297] As shown in FIGs. 5A and 5B, significant advantages were observed in UD3661 engineered T cells in comparison to the D3598 engineered T cells. Anti-DLL3 CAR-T cell persistence in response to repetitive tumor-associated antigen (i.e., DLL3) challenge mediated by SHP-77. Luc tumor cells was substantially enhanced by the secretion of the anti-DLL3 TCE. b. Activation

[0298] T cell activation of anti-DLL3 CAR-T cells (i.e., each of UD3661 and D3598; CAR-positive: “CAR+” ) and bystander T cells (i.e., CAR-negative ( “CAR-” ) T cells) was assessed using a repetitive stimulation tumor challenge model, with CD25 and CD69 surface markers used as activation level readouts via flow cytometry.

[0299] As shown in FIGs. 6A and 6B, the levels of CD25 and CD69 were higher in CAR-negative cells of UD3661 cell group compared to D3598 cell group, indicating that CAR-negative cells were activated by the secreted anti-DLL3 TCE. Meanwhile, as shown in FIGs. 6C and 6D, the levels of CD25 and CD69 were similar in CAR-positive cells regardless of experimental group (i.e., D3598 or UD3661 groups) . c. Exhaustion

[0300] T cell exhaustion of anti-DLL3 CAR-T cells (i.e., each of UD3661 and D3598; CAR-positive: “CAR+” ) and bystander T cells (i.e., CAR-negative ( “CAR-” ) T cells) was assessed using a repetitive stimulation tumor challenge model, with TIM-3, LAG-3, and PD-1 surface markers used as exhaustion level readouts via flow cytometry.

[0301] As shown in FIGs. 7A-7C, the expression of TIM-3 and LAG-3 but not PD-1 were slightly elevated in CAR-negative cells from the UD3661 cell group compared to the D3598 cell group. By comparison, the expression of TIM-3 and PD-1 but not LAG-3 showed a significantly decreasing trend in UD3661 CAR-positive cells compared to D3598 CAR-positive cells (FIGs. 7D-7F) .

[0302] Notably, the CAR-positive and CAR-negative cells of the D3598 cell group and of the UD3661 cell group exhibited different profiles of activation and exhaustion markers, as described above. Anti-DLL3 CAR-T cells that secreted anti-DLL3 TCEs thus may recruit bystander CAR-negative cells to kill antigen-specific (i.e., DLL3+) target cells while maintaining a lower level of T cell exhaustion. Example 4: Characterization of DLL3 and / or B7H3 antigenic expression in SCLC

[0303] Three small cell lung cancer (SCLC) cell lines from the SCLC CellMiner Cross Database (https:  / / discover. nci. nih. gov / rsconnect / SclcCellMinerCDB / ) were analyzed, as shown in FIG. 8. These results demonstrated that DLL3 gene expression level was not correlated with B7H3 (CD276) gene expression level. This finding was further investigated as described below.

[0304] The expression of DLL3 and B7H3 in SCLC tumor tissue were detected via Immunohistochemistry (IHC) . The intensity of staining was multiplied by the percentage (P) of cells staining negative (0) , weak (1+) , moderate (2+) , and strong (3+) in the following equation. Histo-score (i.e., H-score) was calculated using the following formula using the percentage (P) of cells (0%to 100%) , where P0 is the proportion of negative (0) cells, P1+ is the percentage of 1+cells, P2+ is the percentage of 2+ cells, and P3+ is the percentage of 3+ cells, which are summed; H-score=0 × P0 + 1 × P1+ + 2 × P2+ + 3 × P3+. This gives an analytical range for H-score from 0 to 300.

[0305] After calculating the H-scores for DLL3 and B7H3, the number of samples in each H-score value range was analyzed statistically, as shown in Table 4 below. Among the 23 samples, varying degrees of DLL3 and / or B7H3 expression were found. For example, when the H-score of DLL3 was found to be 0, the H-score values of B7H3 were scattered between 50-200. FIG. 9 shows representative SCLC tumor tissue cross-sections from exemplar tumors (i.e., Tumor 17, Tumor 25, Tumor 14, Tumor 9, and Tumor 2) stained via IHC for DLL3 or B7H3 to calculate H-score. Representative H-scores are provided in FIG. 9. The expression of DLL3 increased sequentially from the leftmost tumor to the rightmost tumor, but there was no such trend in the expression of B7H3 in these tumors. The results above indicate that there is no correlation between the expression of DLL3 and of B7H3 by SCLC tumor cells, and therefore targeted therapy of DLL3 and B7H3 could overcome the heterogeneity of SCLC tumors, as further explored in Example 5 below. Table 4. Statistics of H-scores with different values. Note: “H” indicates H-score; “ / ” indicates no such samples. Example 5: Characterization of engineered anti-DLL3 CAR-T Cells against DLL3- positive / B7H3-positive target cells

[0306] Human T cells were cultured using T Cell Activation / Expansion Kit (Miltenyi #130‐091‐441) and anti-DLL3 CAR-T cells were generated as described in Examples 1 and 2 above. CAR expression of the anti-DLL3 CAR-T cells (M3085) and anti-DLL3 CAR-T cells secreting anti-B7H3 TCE (M3118) was determined at 9 days post-infection by MonoRabTM Rabbit Anti-Camelid VHH Cocktail via flow cytometry.

[0307] These cells were then characterized to identify the CAR-T cell activity in the presence of DLL3-positive / B7H3-positive target cells. The cytotoxicity of anti-DLL3 CAR T cells and bystander cells, the persistence of anti-DLL3 CAR T cells, the activation of anti-DLL3 CAR T cells, and the exhaustion of anti-DLL3 CAR T cells was analyzed using the protocols provided in Example 3 above. Anti-DLL3 CAR T cell groups included the following: (i) anti-DLL3 CAR-T cells (i.e., “M3085” ) , (ii) anti-DLL3 CAR-T cells secreting anti-B7H3 TCE (i.e., anti-B7H3 TCE: “M3118” ) ,  and (iii) anti-DLL3 CAR-T cells secreting anti-B7H3 TCE and knocked out for TCR gene  (anti-B7H3 TCE / TCRKO: “Allo-M3118” ) . CAR-T cell cytotoxicity:

[0308] Naked anti-DLL3 CAR-T cells (M3085) , anti-DLL3 CAR-T cells secreting anti-B7H3 TCE (M3118) , or untransduced T cells (UNT) were co-cultured with SHP-77. Luc (high expression of DLL3 and B7H3 antigens) or SHP-77 DLL3 KO. Luc (little to no expression of DLL3 antigen and high expression of B7H3 antigen) at the effector (CAR-T or UNT) to target cell (E: T) ratio of 3: 1, 1.5: 1, 1: 1.3, 1: 2.6, and 1: 5.2 for 20 hours.

[0309] As shown in FIGs. 11A and 11B, anti-DLL3 CAR-T cells secreting anti-B7H3 TCE (M3118) exhibited stronger tumor cell lysis against SHP-77. Luc and SHP-77-DLL3 KO. Luc tumor cells than naked anti-DLL3 CAR-T cells (M3085) . Notably, M3118 CAR-T cells showed significantly greater target cell killing against SHP-77-DLL3 KO. Luc (i.e., DLL3-negative) tumor cells than M3085 CAR-T cells, which showed little to no cytolysis. These results demonstrate that anti-B7H3 TCE-secreting anti-DLL3 CAR-T cells specifically kill DLL3-negative tumor cells that cannot be recognized by the naked anti-DLL3 CAR-T cells, thereby reducing the antigen escape of tumor cells to overcome tumor heterogeneity. Bystander T cell cytotoxicity:

[0310] Effector (M3085 or M3118) CAR-T cells, target tumor cells (SHP‐77-DLL3 KO. Luc) and bystander (CD8+ T cells or γδ-T cells) were co-cultured at the effector: target: bystander ratio of 5: 1: 10, 10: 1: 5, and 10: 1: 10 for 20 hours as described in Example 3 above. As shown in FIGs. 12A-12C, compared with the control group, anti-B7H3 TCEs secreted by anti-DLL3 CAR-T cells significantly mediated the activation of CD8+ T cell lysis and γδ-T cell lysis against DLL3-negative tumor cells and had a beneficial effect on overcoming complex tumor heterogeneity. T cell function:

[0311] T cell function of anti-DLL3 CAR-T cells secreting anti-B7H3 TCEs ( “M3118” ) , including CAR-T cells that lack endogenous TCR ( “Allo-M3118” ) were interrogated, as described below. a. Expansion

[0312] Persistence of M3118 (anti-DLL3 CAR-T cells secreting anti-B7H3 TCE) and Allo-M3118 (anti-DLL3 CAR-T cells secreting anti-B7H3 TCE and further knocked out for TCR gene expression, or “Allo-anti-DLL3 CAR‐TCE T cells” ) were evaluated in a repetitive tumor challenge assay as described in Example 3 above using the cell line H82. Luc, which expresses both DLL3 and B7H3. In brief, anti-DLL3 CAR-T cells (M3118 or Allo-M3118) were co-cultured with H82. Luc cells in a 24-well plate at an E: T ratio of 1: 2. After three days, cells were harvested to determine the relative ratio of total viable T cells (by detecting the percentage of CD5-positive cells) and CAR-positive (CAR+) T cells. The harvested cells were re-plated with fresh H82. Luc tumor cells at an E: T ratio of 1: 2 for another round of T cell stimulation. Three such rounds of subsequent T cell stimulation were performed, denoted R1 (i.e., “round 1” ) , R2 (i.e., “round 2” ) , and R3 (i.e., “round 3” ) . The group of untransduced T cells (UNT or UnT) served as negative controls. The persistence of each anti-DLL3 CAR-T cell group was then evaluated by calculating the proportion of CD5-positive T cells among total live cells and then further calculating the proportion of CAR+ T cells.

[0313] Furthermore, the proportion of CD5+ T cells out of total live cells (i.e., co-cultured T cells and H82. Luc tumor cells) can indicate the degree of T cell cytotoxicity against H82. Luc target cells: namely, the higher the proportion of CD5+ T cells, the stronger the degree of cytotoxicity against H82. Luc tumor cells.

[0314] As shown in FIG. 13A, M3118 CAR-T cells and Allo-M3118 CAR-T cells showed comparable cytotoxicity against H82. Luc tumor cells. As shown in FIGs. 13B and 13C, Allo-M3118 CAR-T cells demonstrated stronger proliferative capacity than M3118 CAR-T cells. After three rounds of T cell stimulation using H82. Luc tumor cells, the Allo-M3118 CAR-positive cells showed a 17.1-fold increase in number, nearly double the fold increase of M3118 CAR-positive cells. These results demonstrate that knockout of TCR enhances CAR-T cell persistence and proliferation. b. Activation and Exhaustion

[0315] The levels of CAR-T cell activation and exhaustion after three rounds of stimulation by antigen-expressing H82. Luc tumor cells were also analyzed. Detection of two activation markers (i.e., CD25 and CD69) and three exhaustion markers (i.e., TIM-3, LAG-3, and PD-1) was performed by flow cytometry. The ratio of marker-positive (i.e., CD25+, CD69+, TIM-3+, LAG-3+, PD-1+) CD5+ T cells to total CD5+ T cells was calculated after round 3 stimulation. As shown in FIG. 14A, M3118 CAR-T cells and Allo-M3118 CAR-T cells showed comparable levels activation. However, Allo-M3118 CAR-T cells showed significantly reduced levels of exhaustion markers as shown in FIG. 14B, indicative of an improved exhaustion phenotype that has greater potential for long-term CAR-T cell survival and functional activity in vivo. SEQUENCE LISTING

Claims

1.An engineered immune cell comprising:(i) a first nucleic acid encoding a chimeric receptor, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; and(ii) a second nucleic acid encoding a multispecific antigen binding protein ( “MSAP” ) .2.The engineered immune cell of claim 1, wherein the MSAP is secreted by the engineered immune cell.3.The engineered immune cell of claim 1 or 2, wherein the antigen binding domain of the chimeric receptor is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, a single chain Fv (scFv) , a single domain antibody (sdAb) , and a peptide ligand specifically binding to DLL3.4.The engineered immune cell of claim 3, wherein the antigen binding domain of the chimeric receptor is an sdAb ( “anti-DLL3 sdAb” ) .5.The engineered immune cell of claim 4, wherein the anti-DLL3 sdAb is a tandem anti-DLL3 sdAb comprising at least two anti-DLL3 VHH domains.6.The engineered immune cell of claim 4 or 5, wherein the anti-DLL3 sdAb comprises:(i) a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14;(ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3;(iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7;(iv) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13;(v) a VHH comprising the amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14; and / or(vi) a tandem anti-DLL3 sdAb comprising an amino acid sequence of SEQ ID NO: 9.7.The engineered immune cell of any one of claims 1-6, wherein the chimeric receptor is a chimeric antigen receptor (CAR) , and wherein the chimeric receptor further comprises a transmembrane domain and an intracellular signaling domain.8.The engineered immune cell of claim 7, wherein the transmembrane domain is derived from the group consisting of CD8α, CD4, CD28, 4-1BB, CD80, CD86, CD152, and PD-1; optionally wherein the transmembrane domain is derived from CD8α.9.The engineered immune cell of claim 7 or 8, wherein the intracellular signaling domain is derived from the group consisting of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d; optionally wherein the intracellular signaling domain is derived from CD3ζ.10.The engineered immune cell of any one of claims 7-9, wherein the chimeric receptor further comprises an intracellular co-stimulatory signaling domain.11.The engineered immune cell of claim 10, wherein the intracellular co-stimulatory signaling domain is derived from a co-stimulatory molecule selected from the group consisting of CD27, CD28, CD137, OX40, CD40, PD-1, LFA-1, ICOS, CD2, CD7, LIGHT, NKG2C, B7-H3, TNFRSF9, TNFRSF4, TNFRSF8, CD40LG, ITGB2, KLRC2, TNFRSF18, TNFRSF14, HAVCR1, LGALS9, DAP10, DAP12, CD83, ligands of CD83, and any combination thereof; optionally wherein the intracellular co-stimulatory signaling domain is derived from a cytoplasmic domain of CD137.12.The engineered immune cell of any one of claims 7-11, wherein the chimeric receptor further comprises a hinge domain located between the antigen binding domain and the transmembrane domain; optionally wherein the hinge domain is derived from CD8α.13.The engineered immune cell of any one of claims 1-12, wherein the chimeric receptor comprises the amino acid sequence of SEQ ID NO: 10.14.The engineered immune cell of any one of claims 1-13, wherein the first nucleic acid further encodes a chimeric receptor signal peptide N-terminal to the chimeric receptor.15.The engineered immune cell of any one of claims 1-14, wherein the MSAP comprises:(i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and(ii) a second moiety that specifically binds to a target epitope on an immune cell.16.The engineered immune cell of claim 15, wherein the immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof; optionally wherein the immune cell is a T cell.17.The engineered immune cell of claim 15 or 16, wherein the second moiety specifically binds to an epitope of a T cell-specific protein selected from the group consisting of CD3, CD4, CD8, TCRα, TCRβ, TCRγ, and TCRδ.18.The engineered immune cell of claim 17, wherein the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) .19.The engineered immune cell of claim 18, wherein the anti-CD3 antigen binding moiety is selected from the group consisting of a Fab, a Fab’, a (Fab’) 2, an Fv, an scFv, and an sdAb.20.The engineered immune cell of claim 18 or 19, wherein the anti-CD3 antigen binding moiety comprises:(i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30;(ii) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31; and / or(iii) an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32.21.The engineered immune cell of any one of claims 15-20, wherein the first moiety specifically binds to B7H3 ( “anti-B7H3 molecule” ) .22.The engineered immune cell of claim 21, wherein the anti-B7H3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb.23.The engineered immune cell of claim 21 or 22, wherein the anti-B7H3 molecule comprises:(i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21;(ii) a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22; and / or(iii) anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23.24.The engineered immune cell of any one of claims 21-23, wherein the MSAP comprises an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23, and an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32.25.The engineered immune cell of any one of claims 15-20, wherein the first moiety specifically binds to DLL3 ( “anti-DLL3 molecule” ) .26.The engineered immune cell of claim 25, wherein the anti-DLL3 molecule comprises a Fab, Fab’, (Fab’) 2, Fv, scFv, or sdAb.27.The engineered immune cell of claim 25 or 26, wherein the anti-DLL3 molecule comprises:(i) a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14;(ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3;(iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7;(iv) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13; and / or(v) an anti-DLL3 sdAb comprising an amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14.28.The engineered immune cell of any one of claims 25-27, wherein the MSAP comprises an anti-DLL3 sdAb comprising the amino acid sequence of SEQ ID NO: 14, and an anti-CD3 scFv comprising the amino acid sequence of SEQ ID NO: 32.29.The engineered immune cell of any one of claims 15-28, wherein the MSAP comprises a peptide linker between the first moiety and the second moiety.30.The engineered immune cell of claim 29, wherein the MSAP comprises the amino acid sequence of SEQ ID NO: 33 or SEQ ID NO: 34.31.The engineered immune cell of any one of claims 1-30, wherein the second nucleic acid further encodes a signal peptide N-terminal to the MSAP.32.The engineered immune cell of any one of claims 1-31, wherein the first nucleic acid and the second nucleic acid are connected via a linking nucleic acid encoding a cleavable linker; optionally wherein the cleavable linker is a 2A peptide.33.The engineered immune cell of any one of claims 1-32, wherein the engineered immune cell is selected from the group consisting of T cell, NK cell, B cell, monocyte, dendritic cell, and any combination thereof.34.The engineered immune cell of claim 33, wherein the engineered immune cell is a T cell.35.The engineered immune cell of claim 34, wherein the T cell is engineered to not express or express a reduced level of endogenous TCR.36.A pharmaceutical composition comprising the engineered immune cell of any one of claims 1-35, and a pharmaceutically acceptable excipient.37.A method of treating a cancer in an individual in need thereof, comprising administering to the individual an effective amount of the engineered immune cell of any one of claims 1-35, or the pharmaceutical composition of claim 36.38.The method of claim 37, wherein the cancer is selected from the group consisting of small cell lung cancer, neuroendocrine carcinomas, neuroendocrine prostate cancer, neuroendocrine tumors, endometrial cancer, ovarian cancer, breast cancer, cervical cancer, glioma, melanoma, testis cancer, urothelial cancer, and stomach cancer; optionally wherein the cancer is small cell lung cancer.39.A multispecific antigen binding protein ( “MSAP” ) comprising:(i) a first moiety that specifically binds to a tumor antigen ( “anti-tumor molecule” ) , and(ii) a second moiety that specifically binds to a target epitope on an immune cell.40.The MSAP of claim 39, wherein the second moiety specifically binds to CD3 ( “anti-CD3 antigen binding moiety” ) , wherein the anti-CD3 antigen binding moiety comprises:(i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 24, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 25, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 26, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 28, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 29, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 30;(ii) a VH comprising the amino acid sequence of SEQ ID NO: 27, and a VL comprising the amino acid sequence of SEQ ID NO: 31; and / or(iii) an anti-CD3 scFv comprises the amino acid sequence of SEQ ID NO: 32.41.The MSAP of claim 39 or 40, wherein the first moiety specifically binds to B7H3 ( “anti-B7H3 molecule” ) .42.The MSAP of claim 41, wherein the anti-B7H3 molecule comprises:(i) an H-CDR1 comprising the amino acid sequence of SEQ ID NO: 15, an H-CDR2 comprising the amino acid sequence of SEQ ID NO: 16, an H-CDR3 comprising the amino acid sequence of SEQ ID NO: 17, an L-CDR1 comprising the amino acid sequence of SEQ ID NO: 19, an L-CDR2 comprising the amino acid sequence of SEQ ID NO: 20, and an L-CDR3 comprising the amino acid sequence of SEQ ID NO: 21;(ii) a VH comprising the amino acid sequence of SEQ ID NO: 18, and a VL comprising the amino acid sequence of SEQ ID NO: 22; and / or(iii) an anti-B7H3 scFv comprising the amino acid sequence of SEQ ID NO: 23.43.The MSAP of claim 39 or 40, wherein the first moiety specifically binds to DLL3 ( “anti-DLL3 molecule” ) .44.The MSAP of claim 43, wherein the anti-DLL3 molecule comprises:(i) a CDR1, a CDR2, and a CDR3 having the amino acid sequences of the CDR1, CDR2, and CDR3, respectively, as set forth in SEQ ID NO: 4, SEQ ID NO: 8, or SEQ ID NO: 14;(ii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 1, a CDR2 comprising the amino acid sequence of SEQ ID NO: 2, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 3;(iii) a CDR1 comprising the amino acid sequence of SEQ ID NO: 5, a CDR2 comprising the amino acid sequence of SEQ ID NO: 6, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7;(iv) a CDR1 comprising the amino acid sequence of SEQ ID NO: 11, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 13; and / or(v) an anti-DLL3 sdAb comprising an amino acid sequence of any one of SEQ ID NOs: 4, 8, and 14.45.The MSAP of any one of claims 39-44, wherein the MSAP comprises the amino acid sequence of SEQ ID NO: 33 or SEQ ID NO: 34.46.An isolated nucleic acid encoding the MSAP of any one of claims 39-45.47.The isolated nucleic acid of claim 46, comprising a second nucleic acid sequence encoding a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3.48.The isolated nucleic acid of claim 47, wherein the chimeric receptor is a chimeric antigen receptor (CAR) , optionally wherein the CAR comprises the amino acid sequence set forth in SEQ ID NO: 10.49.The isolated nucleic acid of claim 47 or 48, wherein the nucleic acid sequence encoding the chimeric receptor is upstream or downstream to the nucleic acid sequences encoding the MSAP, the chimeric receptor nucleic acid sequence and the MSAP nucleic acid sequence are separated by a third nucleic acid sequence encoding a cleavable linker.50.The isolated nucleic acid of any one of claims 47-49, comprising a nucleic acid sequence encoding a polypeptide having an amino acid sequence set forth in SEQ ID NO: 44 or SEQ ID NO: 45.51.A vector comprising the isolated nucleic acid of any one of claims 46-50.52.A host cell comprising the isolated nucleic acid of any one of claims 46-50 or the vector of claim 51.53.An engineered immune cell comprising:(i) a first nucleic acid encoding a chimeric receptor; and(ii) a second nucleic acid encoding the MSAP of any one of claims 39-45, the isolated nucleic acid of any one of claims 46-50, or the vector of claim 51.54.The engineered immune cell of claim 53, wherein the chimeric receptor comprises an antigen binding domain that specifically binds to DLL3; optionally wherein the chimeric receptor is a CAR.55.A method for treating a cancer in an individual in need thereof, comprising administering an effective amount of a combination of a DLL3 antagonist and a B7H3 antagonist, or an antagonist of DLL3 and B7H3 to the individual; optionally wherein the cancer is DLL3 positive and / or B7H3 positive.56.The method of claim 55, wherein the antagonist of DLL3 and B7H3 is an engineered immune cell comprising: (i) a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3 and (ii) an MSAP comprising a first moiety that specifically binds to B7H3 and a second moiety that specifically binds to CD3.57.The method of claim 55, wherein the combination of the DLL3 antagonist and the B7H3 antagonist comprises: (i) an engineered immune cell comprising a chimeric receptor comprising an antigen binding domain that specifically binds to DLL3 and (ii) an MSAP comprising a first moiety that specifically binds to B7H3 and a second moiety that specifically binds to CD3.

Images