Fusion protein fused with igg fc domain and comprising LRRD2 of slit3 protein, and use thereof for improving muscle function, enhancing muscle strength, or preventing or treating muscle disease

Abstract

The present invention relates to a fusion protein having an IgG Fc domain fused thereto and comprising LRRD2 of a SLIT3 protein, and a use thereof for improving muscle function, strengthening muscle strength, or preventing, alleviating or treating muscle diseases. More specifically, the present invention provides a fusion protein having an IgG Fc domain fused thereto and comprising LRRD2 of a SLIT3 protein, a nucleic acid molecule encoding the fusion protein, a recombinant vector carrying the nucleic acid molecule, a transformant comprising the recombinant vector, a method for preparing a fusion protein using the transformant, and a composition for improving muscle function, strengthening muscle strength, or preventing or treating muscle diseases, comprising the fusion protein.

Description

Fusion protein comprising LRRD2 of Slit3 protein fused with IgG Fc domain and use thereof for improving muscle function, strengthening muscle, or preventing or treating muscle disease

[0001] The present invention relates to a fusion protein comprising LRRD2 of a Slit3 protein fused with an IgG Fc domain and its use for improving muscle function, strengthening muscle strength, or preventing, improving, or treating muscle diseases, and more specifically, to a fusion protein comprising LRRD2 of a Slit3 protein fused with an IgG Fc domain, a nucleic acid molecule encoding the fusion protein, a recombinant vector comprising the nucleic acid molecule, a transformant comprising the recombinant vector, a method for producing the fusion protein using the transformant, and a composition comprising the fusion protein for improving muscle function, strengthening muscle strength, or preventing or treating muscle diseases.

[0002] Slit proteins are well known to regulate the movement of neurons and axons during the development of the nervous system. Slit proteins can regulate physiological activity by interacting with Robo receptors, and are known to act as factors that regulate various intracellular processes in various tissues, including the heart, lungs, kidneys, and breast tissues. Recently, it has been reported that Slit proteins play an important role in regulating cell growth, adhesion, and migration, and that Slit proteins may be involved in migration during cell differentiation. Specifically, Non-Patent Document 1 reports that Slit and Robo proteins are expressed during the embryonic development stage of vertebrates, and that the expression of Slit3, Robo1, and Robo2 proteins increases in muscle tissue. According to this report, Slit3 protein is expressed more in myoblasts of embryonic hindlimb muscle tissue and is mentioned to be involved in migration.

[0003] Furthermore, Patent Document 1 discloses that LRRD2 of the Slit3 protein can be used to prevent or treat sarcopenia by promoting the differentiation of myoblasts, thereby inducing an increase in muscle mass. LRRD2 is administered as an injection, requiring patients to visit a hospital to receive it. However, its short half-life in vivo necessitates a shortened administration cycle for its efficacy to be fully realized. Consequently, excessive drug use is expected to result in reduced efficacy.

[0004] Accordingly, the present inventors developed a Slit3 LRRD2-Fc fusion protein that improves the efficacy of LRRD2 by increasing its in vivo half-life, and completed the present invention.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] (Patent Document 1) Republic of Korea Publication No. 10-2017-0138920

[0008] [Non-patent literature]

[0009] (Non-patent literature 1) Neil Vargesson et al., Mechanisms of development 106.1 (2001): 175-180

[0010] The purpose of the present invention is to provide a fusion protein for improving the in vivo half-life of LRRD2 of Slit3 protein, thereby enhancing its efficacy in treating muscle diseases.

[0011] Another object of the present invention is to provide a nucleic acid molecule encoding the aforementioned fusion protein, a recombinant vector comprising the nucleic acid molecule, and a transformant comprising the recombinant vector.

[0012] Another object of the present invention is to provide a method for producing the above-described fusion protein.

[0013] Another object of the present invention is to provide a composition that improves the muscle function, muscle strength, or prevents or treats muscle diseases of LRRD2 of Slit3 protein.

[0014] To solve the above-described problem, the present invention provides a fusion protein comprising LRRD2 of Slit3 protein, to which an IgG Fc domain is fused.

[0015] In the present invention, the IgG Fc domain may be IgG1, IgG1 containing the N297Q mutation, or IgG4.

[0016] In the present invention, the IgG Fc domain can be fused to the C-terminus of LRRD2 of the Slit3 protein.

[0017] In the present invention, the fusion protein may additionally include a linker between the IgG Fc domain and LRRD2 of the Slit3 protein.

[0018] In the present invention, the linker is (GGGS)n, where n can be an integer from 1 to 10.

[0019] In the present invention, the fusion protein may additionally include a signal sequence at the N-terminus of LRRD2 of the Slit3 protein.

[0020] In the present invention, the signal sequence may be cystatin S.

[0021] In the present invention, the cystatin S may include the amino acid sequence of SEQ ID NO: 15.

[0022] In addition, the present invention provides a nucleic acid molecule encoding the aforementioned fusion protein and a recombinant vector comprising the same.

[0023] In addition, the present invention provides a transformant comprising the above-described recombinant vector.

[0024] In the present invention, the transformant may be a Chinese hamster ovary cell line.

[0025] The present invention also provides a method for producing a fusion protein comprising LRRD2 of a Slit3 protein fused with an IgG Fc domain, comprising a step of culturing the transformant described above.

[0026] The present invention also provides a pharmaceutical composition for improving muscle function, strengthening muscle strength, or preventing or treating muscle diseases, comprising the above-described fusion protein.

[0027] In the present invention, the pharmaceutical composition may be an injection.

[0028] In the present invention, the muscle disease may be due to decreased muscle function, muscle wasting, or muscle degeneration.

[0029] In the present invention, the muscle disease may be at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, and sarcopenia.

[0030] The LRRD2 of the Slit3 protein, to which the IgG Fc domain of the present invention is fused, not only exhibits a significantly increased half-life and body exposure compared to the LRRD2 of the Slit3 protein alone, but also exhibits an even more improved half-life and body exposure compared to the Slit3 LRRD2 fused to albumin, and exhibits a significant muscle mass increasing effect in a sarcopenia animal model, and thus can be effectively utilized for improving muscle function, strengthening muscle strength, or preventing, improving, or treating muscle diseases.

[0031] Figure 1 is an SDS-PAGE image of a Slit3 LRRD2-Fc expression test using the Expi293F system.

[0032] Figure 2 is an SDS-PAGE image of the Slit3 LRRD2-Fc expression test using the ExpiCHO system.

[0033] Figure 3 shows quantitative graphs of the Slit3 LRRD2-Fc expression test.

[0034] Figure 4 shows the results of SDS-PAGE analysis of GFC peak fractions for six constructs (#1, #2, #3, #4, #5, and #6).

[0035] Figure 5 is an SDS-PAGE image of Slit3 LRRD2-Fc candidates (#1, #2, #3, #4, #5, and #6) for in vitro efficacy testing.

[0036] Figure 6 shows the results of binding assay (ELISA) of Slit3 LRRD2-Fc candidates (#1, #2, #3, #4, #5, and #6) with Robo 2 expressed in C2C12 cells.

[0037] Figure 7 shows the myogenin qRT-PCR results according to treatment with Slit3 LRRD2-Fc candidates (#1, #2, #3, #4, #5, and #6) in C2C12 cells (Control: 1X PBS).

[0038] Figure 8 shows representative images and quantitative graphs of MyHC staining following treatment with Slit3 LRRD2-Fc candidates (#1, #2, #3, #4, #5, and #6) in C2C12 cells.

[0039] Figure 9 shows the results of SPR analysis including binding affinity (KD) between Slit3 LRRD2-Fc candidates (#1, #3, #5) and Robo receptors (Robo1, Robo2).

[0040] Figure 10 shows the results of FcRn binding immunoassay of Slit3 LRRD2-Fc candidates (#1, #3, #5).

[0041] Figure 11 is a graph showing the blood concentration following a single dose of the Slit3 LRRD2-Fc lead molecule (construct #3).

[0042] Figure 12 is a graph showing the change in body weight following administration of Slit3 LRRD2-Fc lead molecule (construct #3) in ovariectomized mice (*** significant difference at the p<0.001 level compared to OVX-PBS through independent sample t-test).

[0043] Figure 13 is a graph showing changes in feed intake following administration of Slit3 LRRD2-Fc lead molecule (construct #3) in ovariectomized mice (* significant difference at the p<0.05 level compared to OVX-PBS through independent sample t-test).

[0044] Figure 14 shows the results of confirming the effect of strengthening muscle function through a wheel running test after administering Slit3 LRRD2-Fc lead molecule (construct #3) to ovariectomized mice (*** significant difference at the p < 0.001 level compared to OVX-PBS through independent sample t-test).

[0045] Figure 15 is a graph showing the muscle mass and relative muscle mass of mice administered Slit3 LRRD2-Fc lead molecule (construct #3) in ovariectomized mice, and the data are expressed as mean ± SEM (*** / ** / * Significant difference at the levels of p < 0.001, p < 0.01, and p < 0.05 compared to OVX-PBS via independent sample t-test; ### / ## / # Significant difference at the levels of p < 0.001, p < 0.01, and p < 0.05 compared to OVX-PBS via ANOVA test).

[0046] Figure 16 shows a test schedule to determine the efficacy of Slit3 LRRD2-Fc lead molecule (construct #3) in improving muscle strength, muscle function, and muscle quality in naturally aging mice.

[0047] Figure 17 is a graph showing the change in body weight according to the administration of Slit3 LRRD2-Fc lead molecule (construct #3) in naturally aged mice (### ANOVA test showed a significant difference at the p < 0.001 level compared to Aged-PBS).

[0048] Figure 18 is a graph showing changes in rotarod latency according to administration of Slit3 LRRD2-Fc lead molecule (construct #3) in naturally aged mice (### / ## ANOVA test showed significant differences at the p < 0.001 and p < 0.01 levels compared to Aged-PBS).

[0049] Figure 19 is a graph showing changes in grip strength following administration of Slit3 LRRD2-Fc lead molecule (construct #3) in naturally aging mice (### / # ANOVA test showed significant differences at the p < 0.001 and p < 0.05 levels compared to Young-PBS).

[0050] Figure 20 is a graph showing the results of evaluating the muscle quality improvement effect of administration of Slit3 LRRD2-Fc lead molecule (construct #3) in naturally aging mice using muscle tissue cross-sectional area analysis.

[0051] Figure 21 is a graph showing the change in fiber area distribution of muscle tissue cross-sectional area analysis according to administration of Slit3 LRRD2-Fc lead molecule (construct #3) in naturally aged mice (# ANOVA test shows a significant difference at the p < 0.05 level compared to Aged-PBS).

[0052] Figure 22 shows a test schedule to determine the efficacy of Slit3 LRRD2-Fc lead molecule (construct #3) in improving muscle strength, muscle function, and muscle quality in dexamethasone-induced mice.

[0053] Figure 23 is a graph showing the change in body weight according to the administration of Slit3 LRRD2-Fc lead molecule (construct #3) in dexamethasone-induced mice (### / ## ANOVA test showed a significant difference at the p < 0.001 and p < 0.01 levels compared to the normal control group).

[0054] Figure 24 is a graph showing changes in rotarod latency according to administration of Slit3 LRRD2-Fc lead molecule (construct #3) in dexamethasone-induced mice (### / ## ANOVA test showed significant differences at the p < 0.001 and p < 0.01 levels compared to the normal control group).

[0055] Figure 25 is a graph showing changes in grip strength following administration of Slit3 LRRD2-Fc lead molecule (construct #3) in dexamethasone-induced mice (## / # ANOVA test shows significant differences at the p < 0.01, p < 0.05 levels compared to the normal control group; *** ANOVA test shows significant differences at the p < 0.001 level compared to the normal control group).

[0056] Hereinafter, the present invention will be described in more detail.

[0057] All technical terms used in this invention, unless otherwise defined, have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of this invention.

[0058] As described above, LRRD2 of Slit3 protein can be used to prevent or treat sarcopenia by promoting differentiation of myoblasts and inducing an increase in muscle mass. However, because its half-life in vivo is very short, the administration cycle must be short for its efficacy to be exerted, and it is expected that this will lead to a problem of reduced efficacy due to excessive drug use.

[0059] Accordingly, the present inventors sought a solution to the above-described problem by developing a protein in which the IgG Fc domain and the LRRD2 of the Slit3 protein are fused, thereby improving the efficacy of LRRD2 by increasing the in vivo half-life of LRRD2. The LRRD2 of the Slit3 protein to which the IgG Fc domain of the present invention is bound exhibits the same cytological efficacy as the LRRD2 of the Slit3 protein to which the IgG Fc domain is not bound, and the in vivo half-life and body exposure are significantly increased compared to the LRRD2 of the Slit3 protein to which the IgG Fc domain is not bound, thereby enabling more effective prevention or treatment of muscle-related diseases.

[0060] Accordingly, the first aspect of the present invention relates to a fusion protein comprising LRRD2 of a Slit3 protein fused with an IgG Fc domain.

[0061] In the fusion protein of the present invention, "LRRD2 of Slit3 protein" refers to the second leucine rich repeat domain (LRRD2) in the Slit3 protein, which is approximately 23 kDa in size. The present inventors have confirmed through previous studies that the Slit3 protein or the LRRD2 in this protein binds to the Robo2 receptor, releases β-catenin bound to M-cadherin of myoblasts through the Slit-Robo system, activates β-catenin, increases the expression of myogenin, and induces differentiation of myoblasts, thereby promoting muscle formation. In the present invention, the term "Slit3 LRRD2" means "LRRD2 of Slit3 protein" and can be used interchangeably.

[0062] In the fusion protein of the present invention, the Slit3 LRRD2 is of human origin and can be used as a fragment comprising the full-length LRRD2 or a partial amino acid sequence thereof within the Slit3 protein consisting of 1523 amino acids. The full-length amino acid sequence of the Slit3 protein is disclosed in NCBI GenBank: AAQ89243.1, and in a specific embodiment of the present invention, the Slit3 LRRD2 is used in the form of a fragment comprising amino acids 278 to 486 (209 amino acids) of the full-length Slit3 protein consisting of 1523 amino acids. In the fusion protein of the present invention, the Slit3 LRRD2 can comprise or consist of the following amino acid sequence of SEQ ID NO: 1:

[0063]

[0064] In the fusion protein of the present invention, “Slit3 LRRD2” may include a functional equivalent to the amino acid sequence of SEQ ID NO: 1.

[0065] The above "functional equivalent" may have at least 70%, preferably 80%, more preferably 90%, and even more preferably 95% sequence homology with the amino acid sequence of SEQ ID NO. 1 of the present invention due to addition, substitution, or deletion of amino acids in the protein or peptide, and refers to a protein or peptide that exhibits substantially the same physiological activity as the protein or peptide composed of the amino acid sequence of SEQ ID NO. 1. For example, it may include amino acid sequences having sequence identity of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%. The "% sequence identity" for an amino acid sequence is determined by comparing a comparison region with two optimally aligned sequences, wherein a portion of the amino acid sequence in the comparison region may include additions or deletions (i.e., gaps) compared to a reference sequence for the optimal alignment of the two sequences (which does not include additions or deletions).

[0066] Specifically, the fusion protein may be included within the scope of the present invention not only as a protein or peptide having its wild-type amino acid sequence, but also as an amino acid sequence variant thereof. The amino acid sequence variant refers to a protein or peptide having a sequence that differs from the wild-type amino acid sequence of Slit3 LRRD2 by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof.

[0067] Amino acid exchanges that can occur in proteins and peptides without altering their overall molecular activity are well known in the art (H.Neurath, RLHill, The Proteins, Academic Press, New York, 1979). The most common exchanges are between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, Asp / Gly. In some cases, modifications such as phosphorylation, sulfation, acetylation, glycosylation, methylation, and farnesylation can also occur.

[0068] The Slit3 LRRD2 of the present invention, or a variant thereof, can be extracted from nature, synthesized (Merrifleld, J. Amer. chem. Soc. 85:2149-2156, 1963), or prepared by a genetic recombination method based on a DNA sequence (Sambrook et al, Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989).

[0069] In the fusion protein of the present invention, the IgG Fc domain is for extending the blood half-life of Slit3 LRRD2, and for example, wild-type IgG1 without mutation, IgG1 with a mutation that reduces antibody-dependent cell-mediated cytotoxicity (ADCC) and / or a mutation that reduces complement-dependent cytotoxicity (CDC), or wild-type IgG4 can be used. The mutated IgG1 may be IgG1 containing the N297Q mutation, but is not limited thereto. Preferably, the IgG Fc domain may be of human origin. In a specific embodiment of the present invention, it was confirmed that the in vivo half-life and in vivo exposure of Slit3 LRRD2 fused with the IgG Fc domain increased 26-fold and 4,700-fold, respectively, compared to Slit3 LRRD2 alone.

[0070] In the fusion protein of the present invention, the wild-type IgG1 may be used as a full-length 232 amino acid sequence or as a fragment comprising a partial amino acid sequence thereof. The full-length amino acid sequence of human IgG1 may be disclosed in NCBI GenBank: AEV43323.1. In the fusion protein of the present invention, the wild-type IgG1 may comprise or consist of the amino acid sequence of the following SEQ ID NO: 2:

[0071]

[0072] In the fusion protein of the present invention, the IgG1 comprising the N297Q mutation may refer to an IgG1 comprising an amino acid substitution of N297Q according to the Kabat numbering system. According to the present invention, the IgG1 comprising the N297Q mutation may comprise or consist of an amino acid sequence in which asparagine (N) at position 82 in the amino acid sequence of SEQ ID NO: 2 is substituted with glutamine (Q). In the fusion protein of the present invention, the IgG1 comprising the N297Q mutation may comprise or consist of the amino acid sequence of the following SEQ ID NO: 3:

[0073]

[0074] In the fusion protein of the present invention, the wild-type IgG4 may be used as a full-length 229 amino acid sequence or as a fragment comprising a partial amino acid sequence thereof. The full-length amino acid sequence of human IgG4 may be disclosed in NCBI GenBank: AAB59394.1. In the fusion protein of the present invention, the wild-type IgG4 may comprise or consist of the amino acid sequence of SEQ ID NO: 4 below:

[0075]

[0076] In the fusion protein of the present invention, the wild-type IgG1, IgG1 containing the N297Q mutation, or wild-type IgG4 may each include a functional equivalent to the amino acid sequences of SEQ ID NOs: 2, 3, and 4. The description of the term “functional equivalent” is the same as described above, and therefore, its description is omitted.

[0077] The fusion protein according to the present invention may be in a form in which the IgG Fc domain is linked to the C-terminus or N-terminus of Slit3 LRRD2. For example, the Slit3 LRRD2 and the IgG Fc domain may be linked in that order, and preferably, the IgG Fc domain may be linked to the C-terminus of Slit3 LRRD2.

[0078] In the fusion protein of the present invention, a linker may be additionally included between the IgG Fc domain and the LRRD2 of the Slit3 protein. The linker may provide additional flexibility to the junction site of the IgG Fc domain and the LRRD2 of the Slit3 protein, thereby preventing potential collisions between the LRRD2 moieties by the Fc dimer. A preferred type of linker may be (GGGS)n, wherein n may be an integer from 1 to 10, and preferably n may be an integer from 1 to 5. Therefore, the specific sequence of the linker used in the present invention is

[0079]

[0080] It may be, but is not limited to,

[0081] In the present invention, the N-terminus of LRRD2 of the Slit3 protein may additionally include a signal sequence. Examples of the signal sequence may include, but are not limited to, cystatin S or interleukin-2 (IL2).

[0082] In the present invention, the cystatin S is of human origin and may include a full-length or partial amino acid sequence consisting of 141 amino acids. The full-length amino acid sequence of the cystatin S is disclosed in NCBI GenBank: EAX10135.1, and in a specific embodiment of the present invention, a fragment consisting of the 1st to 20th amino acids (20 amino acids) of the full-length cystatin S consisting of 141 amino acids was used. In the fusion protein of the present invention, the cystatin S may include or consist of the amino acid sequence of the following SEQ ID NO: 15:

[0083]

[0084] In the present invention, the IL2 is of human origin and may include a full-length or partial amino acid sequence consisting of 38 amino acids. The full-length amino acid sequence of IL2 is disclosed in NCBI GenBank: AAB86861.1, and in a specific embodiment of the present invention, a fragment consisting of the 1st to 20th amino acids (20 amino acids) of the full-length IL2 consisting of 38 amino acids was used. In the fusion protein of the present invention, IL2 may include or consist of the amino acid sequence of the following SEQ ID NO: 16:

[0085]

[0086] In the present invention, the cystatin S and IL2 may each include functional equivalents of the amino acid sequences of SEQ ID NOs: 15 and 16. The description of the term "functional equivalent" is the same as described above, and therefore, its description is omitted.

[0087] A second aspect of the present invention relates to a nucleic acid molecule encoding the aforementioned fusion protein, a recombinant vector comprising the nucleic acid molecule, and a transformant into which the recombinant vector has been introduced.

[0088] As used herein, the term "nucleic acid molecule" has a comprehensive meaning including DNA and RNA molecules, and the nucleotides, which are the basic structural units of the nucleic acid molecule, include not only natural nucleotides but also analogues in which the sugar or base moiety is modified. The sequence of the nucleic acid molecule encoding the fusion protein of the present invention may be modified, and the modifications include additions, deletions, non-conservative substitutions, or conservative substitutions of nucleotides.

[0089] In addition, all sequences used in the present invention, including nucleic acid sequences and amino acid sequences, are interpreted to include sequences that show substantial identity with the sequences listed in the sequence listing, considering mutations that have biologically equivalent activity. The term, 'substantial identity', means a sequence that shows at least 60% homology, more specifically 70% homology, even more specifically 80% homology, and most specifically 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology when the sequence of the present invention and any other sequence are aligned to the greatest extent possible and the aligned sequences are analyzed using an algorithm commonly used in the art.

[0090] In the present invention, a preferred example of the nucleic acid molecule may be a nucleic acid molecule encoding a fusion protein in which an IgG Fc domain is linked to the C-terminus of Slit3 LRRD2. More preferably, the nucleic acid molecule may be a nucleic acid molecule encoding a fusion protein in which an IgG Fc domain is linked to the C-terminus of Slit3 LRRD2 and a signal sequence is linked to the N-terminus of Slit3 LRRD2. Specifically, the base sequence encoding the cystatin S is linked to the 5'-terminus of the base sequence encoding the IgG Fc domain, and the base sequence encoding the IgG Fc domain is linked to the 3'-terminus of the base sequence encoding Slit3 LRRD2, so that a fusion protein in the form of cystatin S-Slit3 LRRD2-IgG Fc can be produced.

[0091] A recombinant vector according to the second aspect of the present invention may include a base sequence encoding the above-described fusion protein and a promoter functionally linked to the base sequence.

[0092] The term "functionally linked" means that there is a functional link between a nucleic acid expression control sequence (such as a promoter, signal sequence, or an array of transcription factor binding sites) and a secondary sequence, wherein the expression control sequence influences the transcription and / or translation of the nucleic acid corresponding to the secondary sequence.

[0093] The vector system of the present invention can be prepared according to methods well known in the art, such as those described in the literature [Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001)].

[0094] In general, vectors can be constructed for cloning or expression purposes. Furthermore, vectors can be constructed for use in eukaryotic or prokaryotic host cells. For example, if the vector is constructed for expression in prokaryotic cells, it includes a strong promoter to initiate transcription (e.g., the pLλ promoter, the trp promoter, the lac promoter, the tac promoter, and the T7 promoter), a ribosome binding site, or translation initiation and transcription / translation stop sequences. In particular, when E. coli is used as a host cell, the promoter and operator in the operon for tryptophan biosynthesis in E. coli (Yanofsky, C., J. Bacteriol., 158:1018-1024 (1984)) and the left-hand promoter of phage λ (pLλ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., 14:399-445 (1980)) can be used as regulatory sequences. When Bacillus is used as the host cell, the promoter for the gene encoding the toxin protein of Bacillus thuringiensis (Appl. Environ. Microbiol. 64:3932-3938(1998); and Mol. Gen. Genet. 250:734-741(1996)) or other operable promoters in Bacillus can be used as the regulatory sequence.

[0095] Numerous conventional vectors available for prokaryotic cells are well known to those skilled in the art, and selection of an appropriate vector is a matter of selection. Conventional vectors used in the present invention include, but are not necessarily limited to, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, pUC19, λgtㆍ4λB, λ-charon, λΔz1, and M13.

[0096] For example, when the vector is prepared for a eukaryotic host cell, promoters derived from the genomes of animal cells, mammalian cells (e.g., metallothionein promoter) or mammalian viruses (e.g., adenovirus late promoter; vaccinia virus 7.5 K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) may be used, among others. The vector generally contains a polyadenylation site for the transcript. Examples of commercially available virus-based vectors include pcDNA 3 (Invitrogen; contains a cytomegalovirus promoter and polyadenylation signal), pSI (Promega; contains an SV 40 promoter and polyadenylation signal), pCI (Promega; contains a cytomegalovirus promoter and polyadenylation signal), and pREP7 (Invitrogen; contains an RSV promoter and an SV 40 polyadenylation signal).

[0097] When the vector is produced for yeast, the promoters of genes for phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase, lactase, enolase and alcohol dehydrolase can be used as regulatory sequences.

[0098] When the expression vector is prepared for plant cells, various plant-functional promoters known in the art can be used, including the cauliflower mosaic virus (CaMV) 35S promoter, the pigwort mosaic virus 35S promoter, the sugarcane bacilliform virus promoter, the Comerina yellow mottle virus promoter, the light-inducible promoter from the subunit of ribulose-1,5-bis-phosphate carboxylase (ssRUBISCO), the rice cytosolic triosephosphate isomerase (TPI) promoter, the adenine phosphoribosyltransferase (APRT) promoter from Arabidopsis, the rice actin 1 gene promoter, and the mannopine synthase and octopine synthase promoters.

[0099] In addition, the recombinant vector of the present invention may additionally include a base sequence that allows easy separation of the expressed fusion protein, including but not limited to glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), and 6X His (hexahistidine; Qiagen, USA). Due to these additional sequences, the expressed fusion protein can be separated by affinity chromatography in a quick and easy manner.

[0100] The expression vector of the present invention preferably comprises one or more markers that enable selection of a transformed host, for example, genes conferring resistance to antibiotics such as ampicillin, gentamicin, chloramphenicol, streptomycin, kanamycin, neomycin, geneticin and tetracycline, URA3 gene, genes conferring resistance to other toxic compounds such as metal ions.

[0101] The transformant according to the second aspect of the present invention may comprise a recombinant vector expressing the above-described fusion protein.

[0102] The above term, "transformant", refers to an organism in which genetic changes have been artificially introduced into cells by introducing external DNA into the host, thereby making the DNA replicable as a chromosomal element or by completing chromosomal integration.

[0103] Useful hosts for preparing transformants are well known in the art. For example, prokaryotic host cells such as strains of the genus Bacillus, such as Escherichia coli, Bacillus subtilis, and Bacillus thuringiensis; Streptomyces, Pseudomonas, Proteus mirabilis, or Staphylococcus; fungi such as Aspergillus species; eukaryotic host cells such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces, or Neurospora crassa; lower eukaryotic cells; The host cell may be a higher eukaryotic cell such as an insect-derived cell; a plant cell; or a cell derived from a mammal such as a COS7 cell (monkey kidney cell), NSO cell, SP2 / 0, Chinese hamster ovary (CHO) cell, W138, baby hamster kidney (BHK) cell, MDCK, myeloma cell line, HuT 78 cell, or 293 cell, but is not limited thereto, and any host cell commonly used in the art may be used without limitation.

[0104] In a specific embodiment of the present invention, a transformant was produced using a Chinese hamster ovary cell line as a host cell.

[0105] Transformation of host cells can be accomplished by numerous methods known in the art. For example, when prokaryotic cells are used as host cells, the CaCl2 method, the Hanson method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9:2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166:557-580 (1983)), and electrophoresis can be used for transformation. In addition, when eukaryotic cells are used as host cells, microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and particle bombardment can be used for transformation. In addition, when plant cells are used as host cells, Agrobacterium-mediated transformation is the most preferred method, as it allows for the necessary bypass for regeneration of adjacent plants from protoplasts.

[0106] A third aspect of the present invention relates to a method for producing a fusion protein comprising LRRD2 of a Slit3 protein fused with an IgG Fc domain. Specifically, the method comprises the steps of (a) culturing the transformant described above under conditions for expression; and (b) obtaining the produced fusion protein.

[0107] Transformants for producing the fusion protein of the present invention can be cultured using appropriate media and culture conditions known in the art. These culture processes can be easily adjusted and used by those skilled in the art depending on the selected strain. Cell culture is categorized into suspension culture and adherent culture based on cell growth pattern, and batch, fed-batch, and continuous culture based on culture method. The culture medium used must appropriately satisfy the requirements of the specific strain.

[0108] The medium used for culturing animal cells contains various carbon sources, nitrogen sources, and trace element components. Examples of carbon sources that can be used include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These carbon sources can be used alone or in combination. Examples of nitrogen sources that can be used include organic nitrogen sources such as peptone, yeast extract, meat juice, malt extract, corn steep liquor (CSL), and soybean meal; and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. These nitrogen sources can be used alone or in combination. The above-mentioned medium may contain, as personnel, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and the corresponding sodium-containing salt. It may also contain a metal salt such as magnesium sulfate or iron sulfate. In addition, amino acids, vitamins, and suitable precursors may be included.

[0109] During cultivation, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid can be appropriately added to the culture to adjust the pH of the culture. Furthermore, antifoaming agents such as fatty acid polyglycol esters can be used to suppress bubble formation during cultivation. Furthermore, oxygen or an oxygen-containing gas (e.g., air) is injected into the culture to maintain an aerobic state. The culture temperature is typically between 20°C and 45°C, preferably between 25°C and 40°C.

[0110] In the method for producing the fusion protein of the present invention, the obtaining step (b) can be performed to obtain the fusion protein in an isolated form. For example, when expressed in bacteria transformed to express the fusion protein, expression typically occurs after promoter induction, and expression continues, resulting in the formation of an insoluble precipitate of the protein (i.e., inclusion bodies). Several suitable protocols exist for isolating the inclusion bodies. The fusion protein that has formed the inclusion bodies can be reformed through dilution or dialysis using a suitable buffer. The fusion protein can then be purified using standard methods known in the art, including solubility fractionation using ammonium sulfate, size-differential filtration (ultrafiltration), and column chromatography (depending on size, net surface charge, hydrophobicity, or affinity).

[0111] The fusion protein of the present invention can also be expressed in plants. Transformation of plant cells can be performed using conventional methods known in the art, including electroporation, particle bombardment, and Agrobacterium-induced transformation. Among these, Agrobacterium-induced transformation is most preferred. Agrobacterium-induced transformation can generally be performed using leaf explants and other tissues such as cotyledons and hypocotyls.

[0112] Selection of transformed cells can be performed by exposing the culture medium containing the transformed cells to selection agents such as metabolic inhibitors, antibiotics, and herbicides. Once the cells have been transformed and stably express a marker gene that confers resistance to the selection gene, they grow and differentiate during culture. Examples of markers include, but are not limited to, glycophosphate resistance genes and the neomycin phosphotransferase (nptII) system. The generation or regeneration of plants from plant protoplasts or various exogenous agents is well known in the art. The resulting transformed rooted shoots are then plated on a suitable plant growth medium. The generation or regeneration of plants containing the exogenous gene induced by Agrobacterium can be performed by methods known in the art.

[0113] The above fusion protein may be used in an unpurified state, or may be further recovered, purified, and concentrated for use. Specifically, methods commonly used in the art (e.g., dialysis, salt precipitation, chromatography, etc.) may be used, through which recovery, purification, and concentration can be performed simultaneously. More specifically, chromatography (e.g., ion exchange chromatography, size exclusion chromatography, or affinity chromatography) may be used for recovery, purification, and concentration, and the type and order of columns used therefor may be appropriately selected depending on the characteristics of the fusion protein, the culture method, etc.

[0114] The fourth aspect of the present invention relates to the use of LRRD2 of Slit3 protein, to which an IgG Fc domain is fused, for improving muscle function, strengthening muscle strength, or improving muscle disease, and provides a pharmaceutical composition for improving muscle function, strengthening muscle strength, or preventing or treating muscle disease, comprising the above-described fusion protein.

[0115] The term "muscle function" as used herein refers to the ability of a muscle to exert force by contraction, and includes muscle strength, which is the ability of a muscle to exert maximum contraction force to overcome resistance; muscle endurance, which is the ability of a muscle to contract and relax for a given weight for a long time or for a number of repetitions; and power, which is the ability to exert strong force in a short period of time. The above muscle function is proportional to muscle mass, and the term "improvement of muscle function" refers to improving muscle function decline due to muscle wasting or degeneration in a more positive direction.

[0116] The term "strengthening muscle" as used herein means increasing muscle strength and / or muscle density, including improving overall muscle strength due to increased skeletal muscle mass and improved muscle function, and does not refer to effects that are limited to patient groups with specific diseases.

[0117] The muscle disease of the present invention is preferably a disease reported in the art as a muscle disease caused by muscle dysfunction, muscle wasting or muscle degeneration, and more preferably at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia and sarcopenia, but is not limited thereto.

[0118] The above muscle wasting or degeneration is caused by congenital factors, acquired factors, aging, etc., and muscle wasting is characterized by the gradual loss of muscle mass, weakening and degeneration of muscles, especially skeletal muscles or voluntary muscles and cardiac muscles.

[0119] More specifically, the above muscles comprehensively refer to tendons, muscles, and tendons.

[0120] A pharmaceutical composition comprising the fusion protein of the present invention may be formulated as a dosage form for oral or parenteral administration. The fusion protein comprising LRRD2 of the Slit3 protein, to which an IgG Fc domain is fused, is a high molecular weight biological agent and, similar to general protein drugs, has physicochemical properties that make it easily degradable by gastric acid and digestive enzymes (e.g., pepsin, trypsin, chymotrypsin, etc.). Therefore, when administered orally, bioavailability may be significantly reduced.

[0121] In order to prevent loss of efficacy due to such physiological degradation and to secure bioaccessibility of the active ingredient, when applying it as an oral formulation, a special formulation that applies advanced drug delivery technology such as enteric coating, microencapsulation, liposome, polymeric nanoparticle, and bioadhesive delivery system that can protect the protein from gastric acid or digestive enzymes is required.

[0122] Therefore, the fusion protein of the present invention may be more effective when applied as a parenteral administration formulation such as an injection, an external preparation, an inhalation, etc., and the present invention also encompasses such parenteral formulations.

[0123] Injectable formulations can be administered via various routes, including intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Injectable formulations may include sterile aqueous solutions, non-aqueous suspensions, emulsions, liposomal formulations, or lyophilized powders. These formulations may contain commonly used excipients, such as antimicrobials (e.g., parabens, sorbic acid), isotonic agents (e.g., dextrose, sodium chloride), and stabilizers (e.g., glycine, polyols).

[0124] The fusion protein comprising LRRD2 of Slit3 protein, to which the IgG Fc domain of the present invention is fused, is a high molecular weight biological agent, and it is difficult to effectively deliver it in vivo using conventional topical skin preparations (e.g., simple creams, ointments, etc.). However, it has been proven that transdermal delivery of protein drugs is possible by applying recently developed microneedle-based transdermal delivery technology, tissue penetration enhancement technology using ECM-modifying auxiliary proteins such as hyaluronidase, or active transdermal drug delivery systems such as electroporation and iontophoresis. Therefore, the present invention includes a pharmaceutical composition comprising the fusion protein that can be provided in the form of a patch, a microneedle-shaped solid formulation, or a liposome gel, in combination with an active transdermal delivery technology.

[0125] Meanwhile, dry powder inhalers (DPIs) or aerosol formulations (MDIs) can be used for inhalation formulations to control particle dispersibility and gas propulsion, and these formulations can include appropriate powder bases (e.g., lactose, mannitol) and stabilizing additives. When designing the formulation, the spray stability of the protein, microaerosolization, and respiratory mucosal penetration should be considered.

[0126] The pharmaceutical composition of the present invention can be prepared as one or more of the oral and parenteral dosage forms described above, and the preparation thereof can be performed based on a pharmaceutical technique commonly used in the art or a related literature (e.g., Remington's Pharmaceutical Sciences, 15th Edition, Chapter 87).

[0127] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level may be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. That is, the total effective amount of the composition of the present invention may be administered to a patient as a single dose, or may be administered as multiple doses in a fractionated treatment protocol for long-term administration. It is important to consider all of the above factors and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0128] The dosage of the pharmaceutical composition of the present invention varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. The daily dosage may be administered in one to several divided doses, preferably in an amount of 0.01 to 50 mg, more preferably 0.1 to 30 mg per kg of body weight per day based on the fusion protein when administered parenterally, and in an amount of preferably 0.01 to 100 mg, more preferably 0.01 to 10 mg per kg of body weight per day based on the fusion protein when administered orally. However, since the dosage may increase or decrease depending on the administration route, severity of obesity, sex, body weight, age, etc., the above dosage does not limit the scope of the present invention in any way.

[0129] The pharmaceutical composition of the present invention can be used alone or in combination with other drugs or treatments. Hereinafter, the present invention will be described in more detail through examples. However, the present invention can be modified in various ways and can have various forms, and the specific examples and descriptions described below are only to help understand the present invention and are not intended to limit the present invention to a specific disclosed form. It should be understood that the scope of the present invention includes all modifications, equivalents, and substitutes included in the spirit and technical scope of the present invention.

[0130]

[0131] Example 1. Design of Slit3 LRRD2-Fc candidate and gene acquisition

[0132] 1-1. Slit3 LRRD2-Fc candidate material design

[0133] Slit3 LRRD2 is the second LRR domain of the approximately 23 kDa Slit3 protein, consisting of 209 amino acids. We aimed to design a Slit3 LRRD2-Fc candidate in which the IgG Fc domain is fused to the C-terminus of Slit3 LRRD2. Considering the structure and dimensions of Slit3 and Fc (IgG1) obtained through modeling (SWISS-MODEL), we determined that steric hindrance in the formation of the Slit3 LRRD2-Fc dimer would not be significant.

[0134] To produce candidate molecules, expression vectors were constructed using pcDNA3.1(+). During construct design, factors that could affect expression levels, structural stability, and efficacy were considered, and candidate vectors were derived through combinations of signal sequences, flexible linkers, and IgG subtypes.

[0135] For the signal peptide, cystatin S (CYT) and one of the signal peptides, IL2, were selected. Next, the presence or absence of a linker (GGGSGGGS) that provides additional flexibility to the LRRD2 moiety and the Fc domain junction site, and finally, for the IgG subtype, three types were considered: IgG1, IgG1 with the N297Q mutation, and IgG4 (all including the hinge region). A total of 12 constructs combining these are listed in Table 1.

[0136] Construct #Construct nameSignal sequenceLinker(Y / N)IgG subtypeTheoretical pI / MW1CYT-LRR2-IgG1Cystatin SNIgG18.79 / 98909.622CYT-LRR2-L-IgG1Cystatin SYIgG18.79 / 99942.563CYT-LRR2-IgG1 MTCystatin SNIgG1,N297Q8.79 / 98937.684CYT-LRR2-L-IgG1 MTCystatin SYIgG1,N297Q8.79 / 99970.65CYT-LRR2-IgG4Cystatin SNIgG48.60 / 98188.486CYT-LRR2-L-IgG4Cystatin SYIgG48.60 / 99221.427IL2-LRR2-IgG1Interleukin-2NIgG18.79 / 98909.628IL2-LRR2-L-IgG1Interleukin-2YIgG18.79 / 99942.569IL2-LRR2-IgG1 MTInterleukin-2NIgG1,N297Q8.79 / 98937.6810IL2-LRR2-L-IgG1 MTInterleukin-2YIgG1,N297Q8.79 / 99970.611IL2-LRR2-IgG4Interleukin-2NIgG48.60 / 98188.4812IL2-LRR2-L-IgG4Interleukin-2YIgG48.60 / 99221.42

[0137] *MW refers to the molecular weight of the homo-dimer.

[0138] The amino acid sequences of the 12 fusion proteins expressed by the 12 constructs in Table 1 above are shown in Table 2.

[0139]

[0140]

[0141] 1-2. Synthesis of the Slit3 LRRD2-Fc candidate gene and acquisition of plasmid DNA.

[0142] Twelve genes in Table 1 were synthesized. During synthesis, a Kozak sequence (GCCACC) was commonly inserted before the N-terminal signal sequence of Slit3 LRRD2, and a stop codon (TGA) was inserted after the C-terminal of IgG Fc. HindIII and EcoRI were used as the 5' and 3' replication sites, respectively, and the restriction sites (HindIII / EcoRI) in the gene sequence were excluded from the design of the expression cassette. Codon optimization was performed to suit HEK293T cells. The synthesized genes were dissolved in sterile distilled water to a concentration of approximately 100 ng / μL, and transformation was performed as follows to obtain single colonies. First, 1 μL of plasmid DNA was injected into DH5α competent cells (100 μL) that had been thawed by incubating on ice for 10 minutes, and then taped. After an additional 20 minutes of incubation on ice, heat shock was performed for 1 minute and 30 seconds in a heat block set to approximately 42°C. After completion of the heat shock, the soluble cells were left on ice for 5 minutes, 1 mL of LB broth medium was added, and a recovery period was performed by shaking at 250 rpm for approximately 1 hour in a 37°C shaking incubator. 50 μL of the soluble cells that had completed the recovery period were plated on LB agar solid medium containing 100 μg / mL ampicillin and cultured overnight at 37°C to check for single colonies. Once a single colony was confirmed, the cells were inoculated into 5 mL of LB broth medium containing 100 μg / mL ampicillin, cultured overnight at 37°C, and mixed with 500 μL of sterilized 30% glycerol to prepare an E. coli glycerol stock.

[0143] Plasmid DNA for animal cell transfection was obtained using QIAGEN's midiprep kit or maxi prep kit, and the isolation and purification of plasmid DNA from E. coli cell stocks were performed according to the kit's protocol. The purified plasmid DNA was concentrated using a NanoDrop device, diluted to 1 μg / μL with sterile distilled water, and stored frozen (-20±5°C).

[0144]

[0145] Example 2. Primary screening based on expression level of Slit3 LRRD2-Fc candidate substances

[0146] The Slit3 LRRD2-Fc candidate group was narrowed down from 12 to 6 through a primary screening based on expression level. The purpose of the primary screening was to select expression host cells and signal sequences that are important in terms of candidate productivity, and the expression levels were evaluated based on SDS-PAGE. Twelve Slit3 LRRD2-Fc candidates were produced using transient expression systems derived from HEK293 and CHO cells, and the cell line with higher productivity was selected as the expression host cell. Six candidates containing signal sequences with high expression levels among CYT and IL2 were selected from the selected expression host cells.

[0147] The results of expression tests of 12 constructs using the Expi293F and ExpiCHO transient expression systems are shown in Table 3 and Figures 1 to 3.

[0148] Expi293F expression system Construct number Construct name Quantification of LRRD2-Fc (dimer) in Protein A eluate Eluate volume (mL) Eluate concentration (mg / mL) Purity % (densitometer) Target amount (mg) 1 CYT-LRR2-IgG1 ~ 30.10 38 0.88 ~ 0.25 0 CYT-LRR2-L-IgG1 ~ 30.14 5 7 6.39 ~ 0.33 2 CYT-LRR2-IgG1 MT ~ 30.05 8 9 1.8 ~ 0.16 0 CYT-LRR2-L-IgG1 MT~30.07387.99~0.1935CYT-LRR2-IgG4~30.20958.12~0.3646CYT-LRR2-L-IgG4~30.1760.62~0 .3097IL2-LRR2-IgG1~30.10681.4~0.2598IL2-LRR2-L-IgG1~30.0883.74~0.2019IL2-LRR2-IgG1 MT~30.0489.34~0.10710IL2-LRR2-L-IgG1 MT~30.04592.96~0.12511IL2-LRR2-IgG4~30.14862.93~0.27912IL2-LRR2-L-IgG4~30.15958.87~0.281ExpiCHO expression systemConstruct numberConstruct namePA Quantification of LRRD2-Fc (dimer) in eluateEluate volume (mL)Eluate concentration (mg / mL)Purity % (densitometer)Target amount (mg)1CYT-LRR2-IgG1~30.29752.9~0.4712CYT-LRR2-L-IgG1~30.27555.14~0.4553CYT-LRR2-IgG1 MT~30.19357.99~0.3364CYT-LRR2-L-IgG1 MT~30.2261.11~0.4035CYT-LRR2-IgG4~30.35246~0.4866CYT-LRR2-L-IgG4~30.28545.24~0.38 77IL2-LRR2-IgG1~30.24551.97~0.3828IL2-LRR2-L-IgG1~30.23952.89~0.3799IL2-LRR2-IgG1 MT~30.17459.7~0.31210IL2-LRR2-L-IgG1 MT~30.16364.96~0.31811IL2-LRR2-IgG4~30.23150.12~0.34712IL2-LRR2-L-IgG4~30.23246.24~0.322.

[0149]

[0150] In both expression systems, normal expression was confirmed when transfected with the positive control (PC, antibody expression vector), and no non-specific expression was observed when transfected with the negative control (NC, pcDNA 3.1(+) empty vector).

[0151] After Protein A purification, the neutralized fraction of each construct was quantified using a 660 nm protein assay to confirm the total protein amount, and the target expression level was calculated through target purity analyzed by SDS-PAGE. Although there were slight size differences among the constructs, it was confirmed that most of the main bands were detected around 98 kDa, which is the expected size on the SDS-PAGE gel. Overall, the target expression level was higher in the ExpiCHO system than in Expi293F based on the same construct, and the difference was up to 2.5 times. Considering the similarity in terms of physical properties such as glycosylation for productivity and future CHO cell line development, ExpiCHO was judged to be a more suitable system for the transient expression of Slit3 LRRD2-Fc.

[0152] In addition, when looking at the trend according to the signal sequence, CYT showed relatively higher expression than IL2. When CYT was applied as a signal sequence to a construct with the same structure, the expression level increased up to 1.7 times in the Expi293 system and up to 1.4 times in the ExpiCHO system compared to IL2. Therefore, CYT, which has a high target expression level, was selected as the signal sequence, and six constructs (constructs #1-6) containing the CYT signal sequence were selected through the primary screening.

[0153]

[0154] Example 3. Obtaining samples for in vitro efficacy verification

[0155] ExpiCHO-S, selected as an expression cell line, was transfected with six constructs (constructs #1-6) and cultured under the high expression conditions of the ExpiCHO system user guide. After Protein A purification, 500 μL was injected into a Superdex 200 10 / 300 GL column to perform GFC purification (buffer: 1X PBS). 500 μL of the eluted fractions before and after the GFC main peak were analyzed by SDS-PAGE, and five major fractions were pooled and concentrated. The results of the SDS-PAGE analysis are shown in Figure 4.

[0156] The obtained pooled sample was concentrated and diluted with 1X PBS to approximately 0.4 mg / mL to prepare a sample for in vitro testing. The results of concentration analysis using a 660 nm protein assay and purity analysis using SDS-PAGE are shown in Table 4 and Fig. 5.

[0157] Construct number, sample concentration (660 nm protein assay), sample purity (SDS-PAGE), 10.418 mg / mL, 83.92%, 20.404 mg / mL, 84.69%, 30.411 mg / mL, 82.46%, 40.462 mg / mL, 85.12%, 50.455 mg / mL, 70.18%, 60.455 mg / mL, 67.30%

[0158]

[0159] Example 4. Secondary screening based on in vitro potency of Slit3 LRRD2-Fc candidate

[0160] The aim of the secondary screening was to determine the effect of inserting a linker (GGGSGGGS) into the Slit3 LRRD2-Fc candidate based on in vitro potency. The purpose of introducing the linker was to determine the possibility of enhancing the binding of Slit3 LRRD2-Fc to the Robo receptor and increasing potency through additional flexibility between the Fc platform and the Slit3 LRRD2 moiety. Therefore, if the effect of linker insertion was small or the potency was reduced, three constructs without linker (constructs #1, #3, and #5) were selected through secondary screening considering the possibility of proteolytic susceptibility and immunogenicity. If the potency was significantly increased by linker insertion, three constructs with linker insertion (constructs #2, #4, and #6) were selected through secondary screening.

[0161] 4-1. Robo binding assay (C2C12 cell binding ELISA)

[0162] To confirm the binding ability of Slit3 LRRD2-Fc candidate to Robo receptor, C2C12 cells, which are mouse myoblasts expressing Robo2 receptor on the cell surface, were used. First, Slit3 LRRD2-Fc candidate was coated on a 96-well plate, and then C2C12 cell lysate was treated, and Robo2 was captured using anti-Robo2 antibody to perform ELISA. 0, 0.3, 3, and 30 μg of cell lysate were treated, and dose-dependent curves were generated, through which the relative binding ability of Slit3 LRRD2-Fc candidate to Robo2 receptor was compared.

[0163] C2C12 cells were seeded at approximately 7.5 × 10 in a 10 mm dish. 6Cells were seeded onto plates and harvested when the plates were 40-50% full, and lysis was performed. First, 1 mL of lysis buffer containing 250 μL of 0.5% NP40, 5 mL (0.5 M) of 50 mM Tris (pH 7.5), 1.5 mL (5 M) of 150 mM NaCl, and 1X diluted protease inhibitor cocktail (100X) was added to a 100 mm plate and incubated on ice for 20 minutes. The cells were scraped with a scraper and transferred to a 1.7 mL microcentrifuge tube, then fixed to a floating sponge and sonicated in an ultrasonic bath filled with ice water for approximately 20 minutes. The cell lysate was centrifuged for 5 minutes (8,000 rpm, 4°C) and the supernatant was harvested.

[0164] The protein concentration of the supernatant was confirmed using the BCA quantitation method. BCA quantitation was performed as follows. First, the standard curve was diluted to concentrations of 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 2.0 μg / mL using BSA (stock 2 mg / mL), and 10 μL / well was dispensed in duplicate into a 96-well plate. The samples were diluted 1-fold, 2-fold, 5-fold, and 10-fold, respectively, and 10 μL / well was dispensed in triplicate. Afterwards, 190 μL of BCA working reagent was added, and the mixture was incubated in a 37°C incubator for 30 minutes. The BCA working reagent was prepared by mixing reagent A and B in a 50:1 ratio. After 30 minutes, the absorbance value was measured at a wavelength of 562 nm, and quantified by subtracting the blank OD value from all OD values ​​including the standard and unknown proteins.

[0165] BSA (negative control) and six Slit3 LRRD2-Fc candidates diluted to 0.1 μM in 1X PBS were coated eight times (100 μL per well) in a MaxiSorp 96-well plate. After coating, the plates were washed three times with 300 μL of 1X PBS (PBST) containing 0.05% Tween 20. The plates were blocked with PBST containing 1% BSA for approximately 2 hours and washed three times with 300 μL PBST. The proteins (cell lysates) isolated above were treated at 0, 0.3, 3, and 30 μg / well for each coating condition, incubated for 2 hours at RT, and washed three times with 300 μL PBST. The primary antibody (anti-Robo2, rabbit) was diluted 1:1000 in PBST containing 0.1% BSA and treated, and incubated for approximately 2 hours at RT. After completion, the cells were washed three times with 300 μL PBST. The secondary antibody (anti-rabbit IgG, goat) was diluted 1:2000 in PBST containing 0.1% BSA and treated, and incubated for 2 hours at RT. After completion, the cells were washed five times with 300 μL PBST. 100 μL of TMB was treated, and incubation was performed at 37°C for approximately 30 minutes. The reaction was stopped by treating 100 μL of stop solution, and the absorbance value was measured at a wavelength of 450 nm.

[0166] The results of the comparison of Robo2 receptor binding ability confirmed through the Robo binding assay (ELISA) are as shown in Figure 6. Six types of Slit3 LRRD2-Fc constructs were coated on a plate, and 0, 3, and 30 μg of C2C12 cell lysates expressing Robo2 were treated, respectively. When detected with Robo2 antibody, it was confirmed that the absorbance value increased as the amount of lysate treated increased. On the other hand, there was no significant difference when BSA, the negative control, was coated on the plate. Constructs with the best Robo2 binding ability were #1 and #3, and when the results according to the presence / absence of the linker were compared, the three constructs without a linker (#1, #3, and #5) showed stronger binding to Robo2 than the three constructs with a linker inserted (#2, #4, and #6) (#1 > #2, #3 > #4, #5 > #6).

[0167] 4-2. Myogenin qRT-PCR

[0168] Myogenin is known as an early-stage marker of C2C12 cell differentiation. Therefore, RNA prep was completed within 24 hours of drug treatment, and cDNA was synthesized, followed by myogenin qRT-PCR. qRT-PCR was performed using the LightCycler 480 SYBR Green I Master kit (Roche). Primers binding to the myogenin gene were each diluted to 10 pM, and the synthesized cDNA was used at a 1 / 10 dilution. Primer sequences are shown in Table 5.

[0169] Primer sequence Forward: GCCATCCAGTACATTGAGCG SEQ ID NO: 29 Reverse: GCTGTGGGAGTTGCATTCAC SEQ ID NO: 30

[0170]

[0171] The results are shown in Fig. 7. When C2C12 cells were treated with six types of Slit3 LRRD2-Fc constructs, all showed higher expression of myogenin than the control group, and among them, constructs #2 and #3 showed relatively high expression levels (fold change of approximately 1.7 times). There was no consistent trend in the results comparing the presence / absence of linkers. Depending on the presence / absence of linkers in the same construct, the expression of myogenin was #1 < #2, #3 > #4, #5 > #6 (former: without linker, latter: with linker).

[0172] 4-3. Myosin heavy chain (MyHC) staining

[0173] MyHC is a representative myogenic differentiation marker, known to be particularly expressed during myotube formation. In in vitro assays for sarcopenia treatment, MyHC staining is a key method for assessing the myogenic potential of drugs. Therefore, we performed MyHC staining using C2C12 cells to confirm the myogenic potential of the Slit3 LRRD2-Fc candidate.

[0174] C2C12 cells were seeded in 24-well plates at a density of approximately 5 х 10 4 C2C12 cells were seeded to a cell / well ratio of 1. When the wells were more than 95% confluent, six candidates, NC (BSA) and Slit3 LRRD2-Fc, were diluted to 10 nM in differentiation-inducing medium (high-glucose DMEM containing 2% horse serum) and treated. The differentiation-inducing medium (including drugs) was replaced daily.

[0175] After 3 days of differentiation induction, when myotubes were formed, the culture medium was removed and fixed with 4% paraformaldehyde solution for approximately 10 minutes. After completion, the cells were washed three times with 1X PBS. After incubation with 0.1% Triton X-100 (10 mM sodium citrate buffer) for approximately 10 minutes, the cells were washed three times with 1X PBS. Blocking was performed with 1X PBS containing 2% BSA for approximately 1 hour. PBST was added to the wells and washed three times for approximately 10 minutes. After this, 800 μL of primary antibody (anti-myosin antibody) was diluted 1:500 in 1X PBS containing 1% BSA, and incubated overnight at 4°C. The cells were washed three times for approximately 10 minutes with 1X PBS (PBST) containing 0.1% Tween 20. Secondary antibody (anti-mouse IgG Alexa Fluor 555) was diluted 1:1000 in 1X PBS containing 1% BSA, treated with 800 μL, and incubated for 1 hour and 30 minutes at RT. After completion, the cells were washed three times with PBST for approximately 10 minutes each. Nuclei were stained with DAPI (1 μg / mL = 1:10000) for 5 minutes, and washed three times with DIW. After fixation, 7 images were acquired using a confocal microscope. The area of ​​the myotubes (3 or more nuclei) was quantified using the Image J program using the acquired images, and the results were graphed.

[0176] Representative images obtained by confocal imaging after MyHc staining and quantitative graph results of analysis of the myotube area are shown in Fig. 8. All six Slit3 LRRD2-Fc constructs treated conditions were confirmed to have higher myotube areas than the control group, with an average increase of more than 20%. Construct #3, which showed the highest result, showed an increase of more than 30% compared to the control group. When comparing the results according to the presence / absence of a linker, the three constructs without a linker (constructs #1, #3, and #5) showed relatively higher efficacy than the three constructs with a linker inserted (constructs #2, #4, and #6) (#1 > #2, #3 > #4, #5 > #6).

[0177]

[0178] Example 5. Additional efficacy verification of three secondary screening selections

[0179] In Example 4, three linker-less Slit3 LRRD2-Fc constructs (constructs #1, #3, and #5) were selected through in vitro potency-based secondary screening. Before final selection of drugs for Slit3 LRRD2-Fc PK and in vivo potency studies, the three selected constructs were further subjected to additional potency validation, including SPR for Robo receptor binding affinity and Lumit™ FcRn binding immunoassay kit (Promega).

[0180] 5-1. SPR analysis

[0181] The binding affinity (K) was measured by SPR analysis using human recombinant Robo1 (Origene, Cat. No. TP327713) and Robo2 (Origene, Cat. No. TP326390) as ligands and three selected Slit3 LRRD2-Fc constructs (constructs #1, #3, #5) as analytes. D) results are shown in Set#1 of Fig. 9. In addition, one more set was analyzed to compare the binding affinity of Slit3 LRRD2-Fc constructs #1, #3 and albumin-fused Slit3 LRRD2 for Robo1 and Robo2 receptors, and the results are shown in Set#2 of Fig. 9. The albumin-fused Slit3 LRRD2 used was composed of the amino acid sequence of SEQ ID NO: 31. The underlined portion in the amino acid sequence of SEQ ID NO: 31 corresponds to Slit3 LRRD2, and the non-underlined portion corresponds to albumin:

[0182]

[0183] As a result of the analysis, the binding affinity of the three selected Slit3 LRRD2-Fc types and the Robo1 and Robo2 receptors was equal to or higher than that of albumin-fused Slit3 LRRD2, and regardless of Robo1 and Robo2, K D are all at subnanomolar levels (~10 -11 M) confirmed that a strong binding was formed between Slit3 LRRD2-Fc and the Robo receptor.

[0184] 5-2. FcRn binding immunoassay

[0185] The FcRn binding immunoassay was performed according to the technical manual of the kit, and the binding ability of the three Slit3 LRRD2-Fc constructs to FcRn was confirmed as shown in Fig. 10. In addition to the three selected candidate substances, the control antibody in the kit and the albumin-fused Slit3 LRRD2 were also tested for the purpose of comparing the FcRn binding ability. The albumin-fused Slit3 LRRD2 was the same as that used in Example 5-1 above. Due to the nature of the inhibition assay, it can be judged that the higher the efficacy is, the lower the signal is at a relatively low concentration. Based on the dose-response curve, all three Slit3 LRRD2-Fc constructs showed stronger FcRn binding ability than not only the albumin-fused Slit3 LRRD2 but also the control antibody. There was no significant difference among the three Slit3 LRRD2-Fc constructs, and the IC 50 When calculated, it was confirmed to be at the level of 10 nM.

[0186]

[0187] Example 6. Drug selection for Slit3 LRRD2-Fc PK and in vivo efficacy testing

[0188] Taking into account the results obtained so far, we aimed to select one final candidate (lead compound) of Slit3 LRRD2-Fc for PK and in vivo efficacy testing through a multi-faceted evaluation. Evaluation items included target expression level, target purity, in vitro efficacy, FcRn binding, and potential effects on ADCC / CDC, and each item was evaluated with a weighted score. The maximum score among the three constructs was 10 points, and the remaining constructs were assigned in proportion to their relative levels. The evaluation results are shown in Table 6. The sum of the weighted scores was 7.8 points for Construct #1, 9.8 points for Construct #3, and 9.0 points for Construct #5, ranking them 3rd, 1st, and 2nd, respectively. Accordingly, Construct #3 was selected as the final candidate lead molecule.

[0189] Evaluation ItemsWeighted Relative Score (0 / 2 / 4 / 6 / 8 / 10)Construct #001Construct #003Construct #005Target Expression0.110810Target Purity0.110106In vitro EfficacyTRAP Staining / Activity0.16108Receptor Binding0.110108Myogenin Expression0.18108MyHC Staining0.1101010FcRn Binding0.2101010ADCC / CDC Safety0.221010Weighted Total (Score)-7.89.89.0Ranking-312

[0190]

[0191] Example 7. Pharmacokinetic evaluation test of Slit3 LRRD2-Fc lead molecule

[0192] In Example 6, construct #3 (CYT-LRR2-IgG1 MT), which was selected as the final candidate, was administered intravenously to SD rats to determine the in vivo kinetics and derive pharmacodynamic parameters.

[0193] 7-1. Preparation of experimental animals and drug administration

[0194] Eight-week-old SD rats (Orient Bio Co., Ltd.) were housed in an environment automatically maintained with an internal temperature of 22±2℃, humidity of 55±5%, noise of 50 phon or less, lighting of 150–300 Lux, a 12-hour light / dark cycle, and differential pressure of 5 mmHg or more. Solid food (Purina) was provided ad libitum throughout the experimental period, and water was provided ad libitum with reverse osmosis water, which was replaced once a week.

[0195] To administer Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT) at a concentration of 5 mg / mL, the calculated dose (0.6 mL) based on the average body weight of the rat (300 g) was administered intravenously at a concentration of 5 mg / mL. 0.2 to 2 mL of whole blood were collected from the caudal vein of the rats at 0, 0.25, 0.5, 2, 4, 8, 24, 48, and 72 hours, respectively, and placed in 1.7 mL microcentrifuge tubes. The blood samples obtained at each hour were centrifuged at 3,000 rpm for 15 minutes within approximately 1 hour to obtain the first supernatant, and the second supernatant (plasma) obtained by performing centrifugation once more under the same conditions was placed in a 1.7 mL microcentrifuge tube to obtain plasma samples. Plasma samples were stored under ultra-low temperature (-75±10 ℃) until analysis.

[0196] 7-2. Blood drug concentration according to changes over time

[0197] Analysis of the blood concentration of the test substance, Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT), was performed using a commercial ELISA kit (IgG1 human ELISA kit, BMS2092) from Invitrogen.

[0198] The blood drug concentrations (average values ​​for the results of two repeated analyses) over time after administration of the Slit3 LRRD2-Fc lead molecule are shown in Table 7 and Figure 11. Pharmacokinetic parameters (PK parameters) were calculated with N=5.

[0199] Plasma concentration (ng / mL), Slit3 LRRD2-Fc lead molecule time Rat #1 Rat #2 Rat #3 Rat #4 Rat #50.25 hr192374.321145426.321134249.197130743.149178555.6030.5 hr141540.138125960.736112325.295109381.305133381.1452 hr46913.28543482.52818138.90817326.41766035.6944 hr1550.5931619.6001780.8582267.1904320.4898 hr166.609225.418150.265196.119192.34224 hr71.65173.13256.78494.19580.75148 hr22.23425.24327.08531.08319.07172 hr23.089Range out31.17925.65516.437

[0200] LLOQ=1.56 ng / mL

[0201] 7-3. PK parameters

[0202] To derive PK parameters, blood drug concentration data over time, as determined by ELISA, were analyzed using WinNonlin software. The slope was derived using points at 8, 24, and 48 hours, estimated as the β phase, in a slope selector. PK parameters are presented in Table 8.

[0203] Slit3 LRRD2-Fc lead molecule, IV (10 mpk), N=5PK parameter results 1 / 2 (hr)14.04±1.81Tmax(hr)N / ACmax(ng / mL)156270±27633CL_obs(mL / hr / kg)41.68±10.02Vss_obs(L / kg)62.33±20.95AUC last (ng.hr / mL)251375±59885AUC inf _obs(ng.hr / mL)250873±60033

[0204]

[0205] The mean terminal half-life (t) of Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT) when administered intravenously at 10 mg / kg 1 / 2 ) is about 14 hours, the average clearance (CL_obs) is about 42, and the average body exposure (AUC) is last ) was confirmed to be approximately 251,375 ng.hr / mL. Compared to the results of this test, as confirmed in Table 9, the half-life of the Slit3 LRRD2-Fc lead molecule was found to increase approximately 26-fold compared to LRRD2. The exposure in the body was approximately 4,700-fold increased compared to LRRD2.

[0206] Half-life extensionFc-fusionNot applicableMolecular nameSlit3 LRRD2-FcLRRD2SpeciesHumanHumanPK experimental data2022.092020.07AnimalSD rat (8 weeks, male)C57BL6 mouse (8 weeks, male)t 1 / 2 (hr)14.04±1.810.54±0.10Cmax(ng / mL), average156270-AUClast(ng.hr / mL), average25137538.50AUCinf(ng.hr / mL), average25087352.96

[0207]

[0208] Example 8. In vivo efficacy test of Slit3 LRRD2-Fc on sarcopenia using a mouse ovariectomy model.

[0209] 8-1. Preparation of experimental animals and drug administration

[0210] After acclimatizing 8-week-old C57BL / 6 female mice (Coatec) for 7 days, 8 mice were randomly selected and sham OP was performed as a normal control group, and the remaining 53 mice were anesthetized with zoletil and xylazine and ovariectomized (OVX) under aseptic conditions.

[0211] Eight weeks after ovariectomy, body weight was measured, and three animals that did not gain weight were excluded from the test group. Then, G2 to G6 were randomly distributed as shown in Table 10 based on body weight, whole body BMD, and lean mass values ​​so that the average values ​​were distributed as evenly as possible. The test substance (LRRD2-Fc) was administered IV to test animals that underwent OVX at 0.4 mpk, 2.0 mpk, and 10.0 mpk for 8 weeks, and compared with sham OP (normal control) and OVX (negative control). As a positive control drug, ZA was administered IP as a single dose for OVX, and then PBS was administered for other administration schedules.

[0212] Trial group design

[0213] Test group Number of animals Administered substance Administration route Dosage Dosage volume (μL) G1 (Sham OP) 8 PBS IV 0 100 G2 (OVX_vehicle) 10 PBS IV 0 100 G3 (OVX_0.4 mpk) 10 LRRD2-Fc IV 0.4 mpk 100 G4 (OVX_2.0 mpk) 10 LRRD2-Fc IV 2 mpk 100 G5 (OVX_10.0 mpk) 10 LRRD2-Fc IV 10 mpk 100 G6 (OVX_ZA) 10 ZA / PBS*IP / IV 0.01 mpk 100

[0214] G1: normal control, G2: negative control

[0215] * ZA was administered as a single IP dose, and thereafter PBS was administered IV at the same time as the other groups.

[0216] Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT) was administered starting 8 weeks after ovariectomy. G1 and G2 received IV administration of PBS twice a week for 8 weeks, and G6 received a single IP administration of ZA followed by IV administration of PBS (twice a week for 8 weeks). G3 to G5 received IV administration of Slit3 LRRD2-Fc twice a week for 8 weeks.

[0217] 8-2. Measurement of body weight and feed intake

[0218] To minimize mouse stress due to weight measurement, measurements were taken at two-week intervals for a total of eight weeks, starting before surgery, immediately before treatment, and two weeks after treatment.

[0219] Feed intake was measured once a week for eight weeks, starting two weeks after the start of drug administration. Feed was fed in fixed quantities, and the remaining amount was measured per cage one week later. The difference was calculated, and the average intake per animal was calculated. No measurements were taken during the two-week wheel-running test.

[0220] As shown in Figures 12 and 13, all doses of Slit3 LRRD2-Fc did not induce significant changes in body weight and feed intake in OVX mice.

[0221] 8-3. Wheel running test

[0222] Five weeks after initiating drug administration, the number of wheel rotations was measured. One animal was placed per cage, and the measurement was performed for three days. The measurement was then converted to kilometers (km). As a result, as shown in Figure 14, a tendency for muscle function to increase was confirmed in the 10.0 mpk administration group.

[0223] 8-4. Blood collection

[0224] On the day of autopsy, cardiac blood samples were collected after restricting water and food intake for 4 hours. The collected blood was left at room temperature to coagulate, then centrifuged at 5,000 rpm for 5 minutes to separate the serum. The supernatant was collected and separated again under the same conditions. A portion of the serum was subjected to biochemical tests on the day of autopsy, and the remaining serum was stored in an ultra-low temperature freezer (-75±10°C) until analysis and used for ELISA testing.

[0225] 8-5. Autopsy

[0226] Six and three days before autopsy, calcein was dissolved in 2% sodium bicarbonate in PBS to a concentration of 10 mg / ml, filtered, and administered IP at a dose of 40 mg / kg. At the time of autopsy, the mice were anesthetized with Zoletil 50 and xylazine, and cardiac blood sampling was performed. The gastrocnemius (GA), soleus (SOL), tibialis anterior (TA), and extensor digitorum longus (EDL) muscles were excised. The muscles on the right side were stored in an ultra-low temperature freezer (-75±10℃), and the muscles on the left side were fixed in 4% PFA and then weighed. The uterus was excised and weighed to confirm the success of the OVX surgery. The left femur and tibia were stored in an ultra-low temperature freezer (-75±10℃) after removing all tissues attached to the bones, and the spine from the cervical to lumbar vertebrae was fixed in 4% PFA and stored in PBS.

[0227] As confirmed in Figure 15, administration of Slit3 LRRD2-Fc at 2.0 mpk and 10.0 mpk significantly increased the weights of the gastrocnemius and extensor digitorum longus muscles in a dose-dependent manner.

[0228]

[0229] Example 9. In vivo efficacy of Slit3 LRRD2-Fc on sarcopenia using a natural aging mouse model.

[0230] 9-1. Preparation of experimental animals and drug administration

[0231] Male C57BL / 6J mice (SPF), 6 weeks and 21 months old, were obtained from Janvier Labs, visually inspected for appearance, and acclimated for 12 days while observing general symptoms. Healthy animals were used in the experiment. The test schematic of this example is as shown in Fig. 16. After the acclimation period, the body weights of the individuals were measured and randomly distributed so that the average body weights were evenly distributed, and the test groups were designed as shown in Table 11. The administered substances, vehicle and Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT), were administered intravenously (IV).

[0232] Trial group design

[0233] Test groupAdministered substanceAge (months)Number of animalsAdministered dose (mpk)Number of times administered (times / week)Administered volume (mL / kg)Administration routeG1 (Young)Vehicle (PBS)220N / A45IVG2 (Aged, PBS)Vehicle (PBS)2218N / A43.3IVG3 (Aged, TA* 2 mpk)Slit3LRRD2-Fc2218223.3IVG4 (Aged, TA 10 mpk)Slit3LRRD2-Fc22181023.3IVG5 (Aged, TA 20 mpk)Slit3LRRD2-Fc22182023.3IVG6 (Aged, TA 10 mpk)Slit3LRRD2-Fc22181043.3IV

[0234] * TA: Test article

[0235] 9-2. Weight measurement

[0236] As shown in Figure 17, the body weight levels of all aged mouse groups (G2-G6) were statistically significantly higher than those of the normal control group (G1) when body weights were measured twice a week from the start of test substance administration (Day 0) and on the day of autopsy (Day 56).

[0237] 9-3. Rotarod latency test

[0238] After the start of test substance administration, the rotarod latency test was conducted on the 4th week (Day 28) and the 8th week (Day 56). The animals were carefully placed on the rotarod treadmill (JD-A-07RA5, BS Technolab Inc., Korea) and the rotation speed was increased at regular intervals from 4 rpm to 40 rpm, and the time spent on the treadmill for 300 seconds was measured in seconds.

[0239] As a result, as shown in Fig. 18, the rotarod latency levels of all aged mouse groups (G2-G6) on the 28th and 56th days after the start of test substance administration were statistically significantly lower than those of G1, and the rotarod latency levels of G5 and G6 were confirmed to be significantly higher than those of G2 (### p < 0.001, ## p < 0.01).

[0240] 9-4. Grip strength test

[0241] On the 4th week (Day 28) and 8th week (Day 56) after the start of test substance administration, the animals were placed on a grip strength tester (47200, Ugo Basile, Italy) and, after confirming that they were suspended, the tail was gently pulled to measure the grip strength of the limbs. Adaptation training for grip strength was conducted 1–2 days prior to the test, and the test was conducted at a fixed time in the afternoon on the test day.

[0242] As a result, as shown in Fig. 19, the grip strength levels of G2, G3, G4, and G5 were statistically significantly lower than those of G1 on the 28th day after the start of test substance administration, and on the 8th week (Day 56) after the start of test substance administration, the grip strength levels of all aged mouse groups (G2-G6) tended to be lower than those of G1, but it was confirmed that the grip strength tended to increase depending on the concentration of substance administered in the test substance administration groups (G3-G6).

[0243] 9-5. Cross-sectional area (CSA) analysis

[0244] In order to confirm the improvement in muscle quality due to the test substance, the cross-sectional area of ​​muscle tissue was cut and the muscle fiber area was confirmed by the following method. The lower extremity muscle tissue fixed in 10% neutral buffered formalin solution was prepared for histopathological examination through general tissue processing such as trimming, dehydration, paraffin embedding, and sectioning. Then, hematoxylin & eosin (H&E) staining was performed, and the size of the muscle fibers was measured using an image analyzer (Zen 2.3 blue edition, Carl Zeiss, Germany). Among the collected muscles, only the gastrocnemius, soleus, and extensor digitorum longus muscles were used for analysis. The evaluation target groups were G1, a normal control group, G2, a negative control group, and G5 and G6, which confirmed the improvement in muscle function due to the test substance.

[0245] As a result of the analysis, as shown in Figure 20, the gastrocnemius muscle showed no difference in the average value between the groups, but in the case of the gastrocnemius and extensor digitorum longus muscles, the values ​​of the test substance administration groups (G5, G6) showed an upward trend compared to the negative control group G2. In addition, as a result of analyzing the fiber area distribution for the two tissues, as shown in Figure 21, 2600 μm 2 Exceeding 2800 μm 2 In the following sections, the cross-sectional area of ​​the extensor digitorum longus muscle of the test substance-administered group G6 was statistically significantly higher than that of G2 (# p < 0.05).

[0246] The results of this example show that in a naturally aged sarcopenia mouse model, the Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT) showed improved behavioral evaluation results by improving skeletal muscle strength, muscle function, and muscle quality compared to the negative control group of aged mice (G2).

[0247]

[0248] Example 10. In vivo efficacy of Slit3 LRRD2-Fc on sarcopenia using a dexamethasone-induced mouse model.

[0249] 10-1. Preparation of experimental animals and drug administration

[0250] Seven-week-old male C57BL / 6J mice (SPF) were obtained from Janvier Labs, visually inspected for appearance, and acclimated for 7 days while observing general symptoms. Healthy animals were used in the experiment. The experimental schematic of this example is as shown in Fig. 22. After the acclimation period, the body weight of the animals was measured and randomly distributed so that the average body weight was evenly distributed, and the test groups were designed as shown in Table 12. The administered substances, vehicle and Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT), were administered intravenously (IV), and 20-hydroxyecdysone (20E) and HMB (beta-hydroxy-beta-methylbutyrate) were administered orally (PO).

[0251] Test group, administered substance, number of animals, administered concentration (mpk), number of administrations per week, administered amount (mL / kg), route of administration, G1 (vehicle, PBS), PBS10N / A44IV, G2 (DXM negative control), PBS12N / A44IV, G3 (DXM, positive control), 20E1250710, POG4 (DXM, positive control), HMB12600710, POG5 (DXM, TA* 5 mpk), Slit3 LRRD2-Fc12544IV, G6 (DXM, TA* 10 mpk), Slit3 LRRD2-Fc121044IV, G7 (DXM, TA* 40 mpk), Slit3 LRRD2-Fc124044IV

[0252] * TA: Test article

[0253] 10-2. Weight measurement

[0254] Body weight was measured 1 day before the start of induction (Day -1) and twice a week after the start of induction (Day 0) until the day of autopsy (Day 29). As shown in Fig. 23, there was no significant difference in body weight in any sarcopenia-induced group on the start of induction (Day 0) (G1-G7), but on Day 29, the body weight levels of all sarcopenia-induced groups (G2-G7) were statistically significantly lower than those of the normal control group (G1) (### p < 0.001, ## p < 0.01).

[0255] 10-3. Rotarod latency test

[0256] A rotarod latency test was conducted 1 day before the initiation of induction (Day -1) and 1 day before autopsy (Day 28), and the test method was the same as in Example 9-3. As a result, as shown in Fig. 24, the rotarod latency levels of all sarcopenia-induced groups (G2-G7) on Day 28 were statistically significantly lower than those of the normal control group (G1) (### p < 0.001 or ## p < 0.01).

[0257] 10-4. Grip strength test

[0258] A grip strength test was performed using the same method as in Example 9-4 on Day -1 (one day before the initiation of induction) and Day 28 (one day before autopsy). As a result, as shown in Fig. 25, on Day 28, the grip strength levels of all sarcopenia-induced groups (G2-G7) were statistically significantly lower than those of the normal control group (G1) (*** p < 0.001), and the HMB 600 mpk administration group (G4), Slit3 LRRD2-Fc 10 mpk administration group (G6), and Slit3 LRRD2-Fc 40 mpk administration group (G7) were significantly higher than those of the induced control group (G2) (## p < 0.01, # p < 0.05).

[0259] The results of this example demonstrate that in a mouse model of sarcopenia induced by dexamethasone, the Slit3 LRRD2-Fc lead molecule (CYT-LRR2-IgG1 MT) significantly enhanced muscle function and strength compared to the induced control group. Therefore, in line with the current trend in the development of sarcopenia treatments focusing on improving muscle strength and function, it is expected that repeated administration of this test substance will have a therapeutic effect through improvement in muscle strength and function.

Claims

1. A fusion protein comprising LRRD2 of the Slit3 protein, to which the IgG Fc domain is fused.

2. A fusion protein according to claim 1, wherein the IgG Fc domain is IgG1, IgG1 containing the N297Q mutation, or IgG4.

3. A fusion protein in the first paragraph, wherein the IgG Fc domain is fused to the C-terminus of LRRD2 of the Slit3 protein.

4. A fusion protein according to claim 1, further comprising a linker between the IgG Fc domain and LRRD2 of the Slit3 protein.

5. A fusion protein according to claim 4, wherein the linker is (GGGS)n, wherein n is an integer from 1 to 10.

6. A fusion protein in which a signal sequence is additionally fused to the N-terminus of LRRD2 of the Slit3 protein in the first paragraph.

7. A fusion protein according to claim 6, wherein the signal sequence is cystatin S.

8. In the 7th paragraph, the cystatin S is a fusion protein comprising the amino acid sequence of SEQ ID NO:

15.

9. A nucleic acid molecule encoding a fusion protein of any one of claims 1 to 8.

10. A recombinant vector comprising the nucleic acid molecule of paragraph 9.

11. A transformant containing the recombinant vector of Article 10.

12. In claim 11, the transformant is a Chinese hamster ovary cell line.

13. A method for producing a fusion protein comprising LRRD2 of a Slit3 protein fused with an IgG Fc domain, comprising a step of culturing the transformant of claim 11.

14. A pharmaceutical composition for improving muscle function, strengthening muscle strength, or preventing or treating muscle disease, comprising a fusion protein of any one of claims 1 to 8.

15. A pharmaceutical composition according to claim 14, wherein the pharmaceutical composition is an injection.

16. A pharmaceutical composition according to claim 14, wherein the muscle disease is caused by decreased muscle function, muscle wasting, or muscle degeneration.

17. A pharmaceutical composition according to claim 14, wherein the muscle disease is at least one selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia, cachexia, and sarcopenia.

Images