Hetero-bifunctional molecules

Abstract

Disclosed herein are heterobifunctional compounds that are mTOR inhibitors. Further described herein are methods of treating diseases and conditions associated with mTOR pathway.

Description

HETERO-BIFUNCTIONAL MOLECULESCROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 666,496, filed on July 1, 2024, which is incorporated by reference herein in its entirety.BACKGROUND

[0002] A number of inherited and somatic mutations in genes that govern Mammalian Target of Rapamycin (mTOR) activity result in dysregulated cell growth or cancer. Germline mutations in tuberosclerosis protein complex (TSC complex), TSC1 or TSC2, give rise to TSC Complex syndrome, a neurocutaneous, autosomal dominant disease that presents as lesions in the skin, brain, heart, kidneys, liver, and lungs. In carcinomas, genetic alterations that activate mTOR signaling largely reside in gain- of-function mutations in upstream regulators such as EGFR, PIK3CA (a subunit of PI3K), and KRAS, as well as loss-of-function mutations in the tumor suppressors PTEN (eliminates PIP3), neurofibromatosis 1 (NFl), and STK11 / LKB 1, part of a trimeric complex that indirectly controls TSC1 / 2 via protein kinase AMP-activated kinase (AMPK). These may or may not be accompanied by mutations in TSC 1 / 2 or mTOR itself. Mutations in mTOR are typically activating mutations that favor an “open” conformation of mTOR. Less commonly found mutations can be found in RAPTOR, RICTOR, and RHEB.

[0003] Rapamycin is an allosteric inhibitor of the mTORC 1 complex that brings members of the immunophilin / cis-trans prolyl isomerase family of FKBP proteins to the FKBP-rapamycin binding (FRB) domain of mTOR thereby sterically occluding mTOR engagement / recognition of S6K. Selectivity of rapamycin for mTORC 1 may arise from the presence of RICTOR / SIN 1 found only in the mT0RC2 complex that may prevents rapamycin access to the FRB domain.

[0004] Whereas forms of rapamycin with altered pharmacokinetic properties (i.e., everolimus, tesirolimus, sirolimus, NAB-sirolimus) have been approved as immunosuppressants or anti-cancer agents, these molecules only weakly hinder the ability of mTORC 1 to phosphorylate 4E-BP1 thus leaving untouched a major avenue in which cancerous cells can exploit mTOR signaling to keep pace with the metabolic demands of cell division and migration. Second generation inhibitors target the ATPase domain of mTOR found in mTORC 1 / 2 complexes, thus likely accounting for the dose limiting toxicities that have posed many challenges to their utility as therapeutic agents. Thus, there is a need for mTORC2-sparing, mTORC 1 inhibitors that prevent protein translation by not only inhibiting S6K phosphorylation but also by preventing 4E-BP1 phosphorylation.Summary

[0005] Described herein are compounds, or a pharmaceutically-acceptable salts or solvate thereof, having a structure represented by a structure of Formula (I):wherein,R1, R2, and R5are each independently hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, - S(=O)2R22, -NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl- C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20;R3and R4are each independently hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20;R6, R7, and R8are each independently hydrogen or C1-C3 alkyl;W is C=O or CHOH;wherein * indicates connectivity of L in the A; wherein a is 1-15;A1is -OR21, -SR21, -NR23R24, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkylcycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20; each R10is independently hydrogen, halogen, -CN, -C(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, Ci-C8alkyl, wherein the Ci-C8alkyl are each independently optionally substituted with one or more R20;R11is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, - NR21C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8-alkynyl, cycloalkyl, Ci-C8alkylcycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20; each R20is independently halogen, -CN, -ORa, -SRb, -S(=O)2Rb, -NRcRd, -S(=O)2NRcRd, - C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, -OC(=O)ORa, -OC(=O)SRb, - C(=O)NRcRd, -OC(=O)NRcRd, -NRaC(=O)NRcRd, -NRaC(=O)Rb, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-C8haloalkyl, Ci-C8hydroxyalkyl, or phenyl; each R21is independently hydrogen, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-C8-cycloalkyl, heterocycloalkyl, Ci-C8- heterocycloalkyl, aryl, Ci-C8-aryl, heteroaryl, or Ci-C8-heteroaryl are each independently optionally substituted with one Rla; each R22is independently hydrogen, -CN, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl,heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl -heterocycloalkyl, aryl, Ci- C8alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted with one or more Rlb;R23and R24are each independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted with one or more Rlc; or R23and R24are taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl optionally substituted with one or more Rld; each Rla, Rlb, Rlc, and Rldis independently oxo, halogen, -CN, -ORa, -SRb, -S(=O)2Rb, -NRcRd, - S(=O)2NRcRd, -C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, -OC(=O)ORa, - OC(=O)SRb, -OC(=O)SRb, -C(=O)NRcRd, -OC(=O)NRcRd, -NRaC(=O)NRcRd, - NRaC(=O)Rb, Ci-C8alkyl, -C2-C8alkenyl, C2-C8alkynyl, Ci-C8haloalkyl, Ci-C8hydroxyalkyl, or phenyl; and each Ra, Rb, Rc, and Rdis independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted; and or Rcand Rdare taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl which is optionally substituted.

[0006] Also provided herein are pharmaceutical compositions comprising a compound disclosed herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier.

[0007] In some aspects, described herein, are methods of treating a disease or disorder comprising administering a compound described herein or a pharmaceutical composition described herein.INCORPORATION BY REFERENCE

[0008] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.DETAILED DESCRIPTION

[0009] While various embodiments of the invention have been shown and described herein, it may be obvious to those skilled in the art that such embodiments are provided by way of example only.Numerous variations, changes, and substitutions may occur to those skilled in the art without departingfrom the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.BRIEF DESCRIPTION OF THE DRAWINGS

[0010] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure may be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0011] FIG. 1 shows the HPLC trace (UV280 nm) of A2-PEG2 -propargyl synthesis.

[0012] FIG. 2 shows the MS-spectra obtained for A2-PEG2 -propargyl synthesis.

[0013] FIG. 3 shows the HPLC trace (UV280) of A4-PEG2 -propargyl.

[0014] FIG. 4 shows the MS-spectra obtained for A4-PEG2 -propargyl.

[0015] FIG. 5 shows the HPLC trace (UV280) of A9-PEG2 -propargyl.

[0016] FIG. 6 shows the MS-spectra obtained for A9-PEG2 -propargyl.

[0017] FIG. 7 shows the HPLC trace (UV254) of M-PEGlO-azide.

[0018] FIG. 8 shows the MS-spectra obtained for M-PEGlO-azide.

[0019] FIG. 9 shows the HPLC trace (UV280) of R-PEGlO-azide.

[0020] FIG. 10 shows the MS-spectra obtained for R-PEG 10 -azide.

[0021] FIG. 11 shows the HPLC trace (UV280) of Compound 1.

[0022] FIG. 12 shows the MS-spectra obtained for Compound 1.

[0023] FIG. 13 shows the HPLC trace (UV280) of Compound 27.

[0024] FIG. 14A Shows the MS-spectra obtained for Compound 27.

[0025] FIG. 14B shows an ’H NMR spectrum of Compound 27.

[0026] FIG. 14C shows a13C NMR spectrum of Compound 27.

[0027] FIG. 14D shows an HMBC spectrum of Compound 27.

[0028] FIG. 14E shows a COSY spectrum of Compound 27.

[0029] FIG. 14F shows an HSQC spectrum of Compound 27.

[0030] FIG. 15A shows the HPLC trace (UV280) of Compound 79.

[0031] FIG. 15B shows spectra obtained for Compound 79.

[0032] FIG. 16A shows the MS-spectra obtained for Compound 79 (doubly charged species).

[0033] FIG. 16B shows an ’H NMR spectrum of Compound 79.

[0034] FIG. 16C shows a13C NMR spectrum of Compound 79.

[0035] FIG. 16D shows an HMBC spectrum of Compound 79.

[0036] FIG. 16E shows a COSY spectrum of Compound 79.

[0037] FIG. 16F shows an HSQC spectrum of Compound 79.

[0038] FIG. 17 shows the HPLC trace (UV280) of Compound 209.

[0039] FIG. 18 shows the MS-spectra obtained for Compound 209 (doubly charged species).

[0040] FIG. 19 shows the HPLC trace (UV280) of Compound 225.

[0041] FIG. 20 shows the MS-spectra obtained for Compound 225 (doubly charged species).

[0042] FIG. 21 depicts generated rapamycin analogs’ potential altered affinities for FKBP12 / FRB.

[0043] FIG. 22 shows log KD binary and log KD ternary affinity for FKBP and FRB for rapamycin and rapamycin analogs.

[0044] FIG. 23 shows the effects of attenuated mTOR and FKBP 12 affinity of Compound 1, Compound 27, and Compound 79 on cellular activity in MCF7 (Breast Cancer) cells.

[0045] FIG. 24 shows the effects of attenuated mTOR and FKBP 12 affinity of Compound 1, and Compound 27 on cellular activity in A547 (Non-Small Cell Lung Cancer) cells.

[0046] FIG. 25 shows the impact of attenuated FRB binding of Compound 27 and Compound 79 in MCF7 (Breast Cancer) cells.

[0047] FIG. 26 shows rapamycin analogs binding affinity.

[0048] FIG. 27 depicts RMC-5552.

[0049] FIG. 28 shows Compounds 1 and Compounds 27 inhibit 4E-BP1 phosphorylation in 786-0 (Renal Cell Carcinoma) cells.

[0050] FIG. 29 shows flowcytometric analysis on the effect of Compounds 1 and Compounds 27 on phospho 4E-BP1 expression in 786-0 (Renal Cell Carcinoma) cells.

[0051] FIG. 30 shows flowcytometric analysis on the effect of Compound 1 and Compound 27 on mTORCl biomarkers in 786-0 (Renal Cell Carcinoma) cells.

[0052] FIG. 31 shows Compound 1 and Compound 27 inhibit 4E-BP1 phosphorylation in 786-0 (Renal Cell Carcinoma) cells.

[0053] FIG. 32 shows flowcytometric analysis on the effect of Compound 1 and Compound 27 on mTORCl biomarkers in A549 (Non-Small Cell Lung Cancer) cells.

[0054] FIG. 33 shows Compound 1 and Compound 27 block elevated 4E-BP1 and S6K phosphorylation due to STK11 loss in NSCLC (Non-Small Cell Lung Cancer).

[0055] FIG. 34 shows Compound 1 and Compound 27 block elevated 4E-BP1 and S6K phosphorylation due to STK11 loss in NSCLC (Non-Small Cell Lung Cancer).

[0056] FIG. 35 shows dosage -dependent effects of Compound 79 and RMC-5552 on mTOR signaling in A549 (Non-Small Cell Lung Cancer) cells.

[0057] FIG. 36A shows do sage -dependent effects of Compound 79 and RMC-5552 on mTOR signaling in A549 (Non-Small Cell Lung Cancer) cells.

[0058] FIG. 36B shows dosage-dependent effects of Compound 79 and RMC-5552 on mTOR signaling in A549 (Non-Small Cell Lung Cancer) cells.

[0059] FIG. 36C shows dosage-dependent effects of Compound 79 and RMC-5552 on mTOR signaling in A549 (Non-Small Cell Lung Cancer) cells.

[0060] FIG. 37 shows consistent impact on 4E-BP1 signaling across different cancer lineages.

[0061] FIG. 38 shows consistent impact on 4E-BP1 signaling across different cancer lineages.

[0062] FIG. 39 shows log KD binary and log KD ternary affinity for FKBP and FRB for rapamycin analogs.

[0063] FIG. 40 shows the impact on phospho-4E-BP 1 by Compound 225 in MCF-7 cell.

[0064] FIG. 41 shows a model for rapamycin analogs interacting with FKBP 12 and FRB.

[0065] FIG. 42 shows the structure and positional numbering for Compound 1.

[0066] FIG. 43A shows the ’H NMR spectrum of Compound 1 in DMSO-de.

[0067] FIG. 43B shows the13C NMR spectrum of Compound 1 in DMSO-de.

[0068] FIG. 43C shows the COSY spectrum of Compound 1 in DMSO-de.

[0069] FIG. 43D shows the HSQC spectrum of Compound 1 in DMSO-de.

[0070] FIG. 43E shows the HSQC spectrum of Compound 1 in DMSO-de.

[0071] FIG. 43F shows the NMR spectroscopic data for Compound 1 in DMSO-de (’H 500 MHz,13C 125 MHz).

[0072] FIG. 44 shows the tumor volume and body weight change with Compound 1 in in an MCF-7 xenograft model.

[0073] FIG. 45 shows the tumor volume and body weight change with Compound 1 in an orthotopic RCC (786-0) xenograft model.

[0074] FIG. 46 shows the tumor volume and body weight change with Compound 1 in a subcutaneous RCC (786-0) xenograft model.

[0075] FIG. 47 shows the tumor volume and body weight change with Compound 1 in a Lung Adenocarcinoma (H2030) xenograft model.TERMINOLOGY

[0076] Unless specifically stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers ±10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.

[0077] The singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “the surfactant” includes reference to one or more specific surfactants, reference to “an antioxidant” includes reference to one or more of such additives.

[0078] The term “subject” as used herein refers to a mammal (e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee or baboon).

[0079] ‘ ‘Effective amount,” “sufficient amount,” and “amount sufficient for” may be used interchangeably and refer to an amount of a substance that is sufficient to achieve an intended purpose or objective.

[0080] As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in thisspecification can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, compositions of the present disclosure can be used to achieve methods of the present disclosure.

[0081] A “therapeutically effective amount” when used in connection with a pharmaceutical composition described herein is an amount of one or more pharmaceutically active agent(s) sufficient to produce a therapeutic result in a subject in need thereof. An “amount” of one or more components in the pharmaceutical composition refers to an amount per unit dose.

[0082] The term “pharmaceutically-acceptable” denotes an attribute of a material which is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable and is acceptable for veterinary as well as human pharmaceutical use.“Pharmaceutically-acceptable” can refer a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively nontoxic, e.g., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0083] The term “derivative” as used herein indicates a chemical or biological substance that is related structurally to a second substance and derivable from the second substance through a modification of the second substance. In particular, if a first compound is a derivative of a second compound and the second compound is associated with a chemical and / or biological activity, the first compound differs from the second compound for at least one structural feature, while retaining (at least to a certain extent) the chemical and / or biological activity of the second compound and at least one structural feature (e.g., a sequence, a fragment, a functional group and others) associated thereto.

[0084] Reference in the specification to “some embodiments,” “an embodiment,” “one embodiment” or “other embodiments” means that a particular feature, structure, or characteristic described in connection with the embodiments is included in at least some embodiments, but not necessarily all embodiments, of the present disclosures. To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below.

[0085] The terms “treat,” “treating” or “treatment,” as used herein, may include alleviating, abating or ameliorating a disease or condition symptoms, preventing additional symptoms, ameliorating or preventing the underlying causes of symptoms, inhibiting the disease or condition, e.g., arresting the development of the disease or condition, relieving the disease or condition, causing regression of the disease or condition, relieving a condition caused by the disease or condition, or stopping the symptoms of the disease or condition either prophylactically and / or therapeutically.

[0086] In various instances, “may” refers to optional alternatives to be used in the alternative or in addition to other specified components.

[0087] "Alkyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which may optionally be unsaturated with one or more double or triple bonds, and preferably having from one to fifteen carbon atoms (i.e., C1-C15 alkyl). In certain embodiments, an alkylcomprises one to six carbon atoms (i.e., Ci-Ce alkyl). In other embodiments, an alkyl comprises one to three carbon atoms (i.e., C1-C3 alkyl). In certain embodiments, the alkyl group is selected from methyl, ethyl, 1-propyl (n-propyl), 1-methylethyl (iso-propyl), 1-butyl (n-butyl), 1 -methylpropyl (sec-butyl), 2- methylpropyl (iso-butyl), 1,1 -dimethylethyl (tert-butyl), 1-pentyl (n-pentyl). The alkyl is attached to the rest of the molecule by a single bond. Unless otherwise specified, the term “alkyl” and its equivalents encompass linear, branched, and / or cyclic alkyl groups. In some instances, an “alkyl” comprises both cyclic and acyclic (linear and / or branched) alkyl components. When an alkyl group is described as “linear,” the referenced alkyl group is not substituted with additional alkyl groups and is unbranched. When an alkyl group is described as “saturated,” the referenced alkyl group does not contain any double or triple carbon-carbon bonds (e.g., alkene or alkyne).

[0088] "Alkylene" or "alkylene chain" refers to a divalent alkyl group, which may optionally be substituted as defined herein.

[0089] "Alkenyl" refers to a straight or branched hydrocarbon chain radical group consisting solely of carbon and hydrogen atoms, containing at least one carbon-carbon double bond, and having from two to twelve carbon atoms. In certain embodiments, an alkenyl comprises two to eight carbon atoms. In other embodiments, an alkenyl comprises two to four carbon atoms. The alkenyl is optionally substituted as described herein. "Alkenylene" or "alkenylene chain" refers to a divalent alkenyl group, which may optionally be substituted as described herein.

[0090] "Alkynyl" refers to a straight or branched hydrocarbon chain radical group consisting solely of carbon and hydrogen atoms, containing at least one carbon-carbon triple bond, and having from two to twelve carbon atoms. In certain embodiments, an alkynyl comprises two to eight carbon atoms. In other embodiments, an alkynyl comprises two to four carbon atoms. The alkynyl is optionally substituted as described herein. "Alkynylene" or "alkynylene chain" refers to a divalent alkynyl group, which may optionally be substituted as described herein.

[0091] "Heteroalkyl" refers to an alkyl group wherein one or more of the carbons of the alkyl group is replaced with a heteroatom. Exemplary heteroatoms include N, O, Si, P, B, and S atoms, preferably N, O and S. Note that valency of heteroatoms may not be identical to that of a carbon atom, so, for example, a methylene (CH2) of an alkyl may be replaced with an NH group, S group, O group, or the like in a heteroalkyl.

[0092] “Heteroalkylene” refers to a divalent heteroalkyl group defined above which links one part of the molecule to another part of the molecule. Unless stated specifically otherwise, a heteroalkylene is optionally substituted as defined herein.

[0093] "Aryl" refers to an aromatic monocyclic or aromatic multicyclic hydrocarbon ring system. The aromatic monocyclic or aromatic multicyclic hydrocarbon ring system contains only hydrogen and carbon and from five to eighteen carbon atoms, where at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) p-electron system in accordance with the Htickeltheory. The ring system from which aryl groups are derived include, but are not limited to, groups such as benzene, fluorene, indane, indene, tetralin and naphthalene.

[0094] “Arylene” group as used herein refers to a divalent aryl group, wherein aryl is as defined herein. The arylene group may optionally be substituted as defined herein.

[0095] The term “Cx.y” or “Cx-Cy” when used in conjunction with a chemical moiety, such as alkyl, alkenyl, or alkynyl is meant to include groups that contain from x to y carbons in the chain. For example, the term “Cx.yalkyl” refers to saturated or unsaturated hydrocarbon groups, including straight-chain alkyl and branched-chain alkyl groups that contain from xto y carbons in the chain. The terms “Cx.yalkenyl” and “Cx.yalkynyl” refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.

[0096] "Cycloalkyl" refers to a saturated ring in which each atom of the ring is carbon. Cycloalkyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12- membered fused bicyclic rings, 6- to 12-membered spirocyclic rings, and 6- to 12-membered bridged rings. In certain embodiments, a cycloalkyl comprises three to ten carbon atoms. In other embodiments, a cycloalkyl comprises five to seven carbon atoms. The cycloalkyl may be attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyls include, e.g., cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic cycloalkyl radicals include, for example, adamantyl, norbomyl (i.e., bicyclo[2.2.1]heptanyl), norbomenyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like.

[0097] “Cycloalkylene” refers to a divalent cycloalkyl group, which may optionally be substituted as defined herein.

[0098] ‘ ‘Halo” or, alternatively, “halogen” or “halide,” means fluoro, chloro, bromo or iodo. In some embodiments, halo is fluoro, kechloro, or bromo.

[0099] “Haloalkyl” refers to an alkyl radical, as defined above, that is substituted by one or more halo radicals, for example, trifluoromethyl, dichloromethyl, bromomethyl, 2,2,2-trifluoroethyl,1 -chloromethyl -2 -fluoroethyl, and the like. In some embodiments, the alkyl part of the haloalkyl radical is optionally substituted as described herein.

[0100] "Heterocycloalkyl" refers to a saturated or unsaturated (e.g., non-aromatic) ring with carbon atoms and at least one heteroatom (e.g., a cycloalkyl wherein one or more of the carbon groups is substituted with a heteroatom). Exemplary heteroatoms include N, O, Si, P, B, and S atoms. Heterocycloalkyl may include monocyclic and polycyclic rings such as 3- to 10-membered monocyclic rings, 6- to 12-membered fused bicyclic rings, 6- to 12-membered spirocyclic rings, and 6- to 12- membered bridged rings. The heteroatoms in the heterocycloalkyl radical are optionally oxidized. One or more nitrogen atoms, if present, are optionally quatemized. The heterocycloalkyl is attached to the rest of the molecule through any atom of the heterocycloalkyl, valence permitting, such as any carbon or nitrogen atoms of the heterocycloalkyl. Examples of heterocycloalkyl radicals include, but are not limited to, dioxolanyl, thienyl[l,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl,isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl.

[0101] “Heterocycloalkylene” refers to a divalent heterocycloalkyl which may optionally be substituted as defined herein. In some embodiments, the heterocycloalkylene is monocyclic. In some embodiments, the heterocycloalkylene is bicyclic.

[0102] "Heteroaryl" refers to an aromatic ring comprising carbon atoms and one or more heteroatoms. Exemplary heteroatoms include N, O, Si, P, B, and S atoms. As used herein, the heteroaryl ring may be selected from monocyclic or bicyclic and fused or bridged ring systems rings wherein at least one of the rings in the ring system is aromatic, i.e., it contains a cyclic, delocalized (4n+2) p-electron system in accordance with the Htickel theory. The heteroatom(s) in the heteroaryl radical may be optionally oxidized. One or more nitrogen atoms, if present, are optionally quatemized. The heteroaryl may be attached to the rest of the molecule through any atom of the heteroaryl, valence permitting, such as a carbon or nitrogen atom of the heteroaryl. Examples of heteroaryls include, but are not limited to, azepinyl, acridinyl, benzimidazolyl, benzindolyl, 1,3-benzodioxolyl, benzofuranyl, benzooxazolyl, benzo [d]thiazolyl, benzothiadiazolyl, benzo[b][l,4]dioxepinyl, benzo[b][l,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothienyl (benzothiophenyl), benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[l,2-a]pyridinyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl,5.6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H- benzo[6,7]cyclohepta[l,2-c]pyridazinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, furanonyl, furo[3,2-c]pyridinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl,1.6-naphthyri dinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[h]quinazolinyl, 1 -phenyl- IH-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl,5.6.7.8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl,6.7.8.9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl (i.e. thienyl).

[0103] “Heteroarylene” refers to a divalent heteroaryl which may optionally be substituted as defined herein. In some embodiments, the heteroaryl is monocyclic. In some embodiments, the heteroaryl is bicyclic.

[0104] The term “substituted” refers to moieties having substituents replacing a hydrogen on one or more carbons or heteroatoms of the structure. It may be understood that “substitution” or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds. The permissible substituents may be one or more and the same or different for appropriate organic compounds.

[0105] For purposes of this disclosure, the heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. In embodiments where it is unspecified whether a group is substituted or unsubstituted, it is intended that the group is unsubstituted.

[0106] Substituents may include any substituents described herein, for example, a halogen, a hydroxyl, a carbonyl (such as a carboxyl, an alkoxycarbonyl, a formyl, or an acyl), a thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), an alkoxyl, a phosphoryl, a phosphate, a phosphonate, a phosphinate, an amino, an amido, an amidine, an imine, a cyano, a nitro, an azido, a sulfhydryl, an alkylthio, a sulfate, a sulfonate, a sulfamoyl, a sulfonamide, a sulfonyl, an aralkyl, a carbocycle, a heterocycle, a cycloalkyl, a heterocycloalkyl, an aromatic and heteroaromatic moiety. In some embodiments, substituents may include any substituents described herein, for example: halogen, hydroxy, oxo (=0), thioxo (=S), cyano (-CN), nitro (-NO2), imino (=N-H), oximo (=N-0H), hydrazine (=N-NH2), -Rb-ORa, -Rb-OC(O)-Ra, -Rb-OC(O)-ORa, -Rb-OC(O)-N(Ra)2, -Rb-N(Ra)2, -Rb-C(O)Ra, - Rb-C(O)ORa, -Rb-C(O)N(Ra)2, -Rb-O-Rc-C(O)N(Ra)2, -Rb-N(Ra)C(O)ORa, -Rb-N(Ra)C(O)Ra, -Rb-N(Ra)S(O)tRa(where t is 1 or 2), -Rb-S(O)tRa(where t is 1 or 2), -Rb-S(O)tORa(where t is 1 or 2), and -Rb-S(O)tN(Ra)2(where t is 1 or 2); and alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, aralkynyl, cycloalkyl, cycloalkylalkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl, and heteroarylalkyl any of which may be optionally substituted by alkyl, alkenyl, alkynyl, halogen, hydroxy, haloalkyl, haloalkenyl, haloalkynyl, oxo (=0), thioxo (=S), cyano (-CN), nitro (-NO2), imino (=N-H), oximo (=N-0H), hydrazine (=N-NH2), -Rb-ORa, -Rb-OC(O)-Ra, -Rb-OC(O)-ORa, -Rb-0C(0)-N(Ra)2, -Rb-N(Ra)2, -Rb-C(O)Ra, -Rb-C(O)ORa, -Rb-C(0)N(Ra)2, -Rb-O-Rc-C(0)N(Ra)2, -Rb-N(Ra)C(O)ORa, -Rb-N(Ra)C(O)Ra, -Rb-N(Ra)S(O)tRa(where t is 1 or 2), -Rb-S(O)tRa(where t is 1 or 2), -Rb-S(O)tORa(where t is 1 or 2) and -Rb-S(O)tN(Ra)2(where t is 1 or 2); wherein each Rais independently selected from hydrogen, alkyl, cycloalkyl, cycloalkylalkyl, aryl, aralkyl, heterocycloalkyl,heterocycloalkylalkyl, heteroaryl, or heteroarylalkyl, wherein each Ra, valence permitting, may be optionally substituted with alkyl, alkenyl, alkynyl, halogen, haloalkyl, haloalkenyl, haloalkynyl, oxo (=0), thioxo (=S), cyano (-CN), nitro (-NO2), imino (=N-H), oximo (=N-0H), hydrazine(=NNH2), -Rb-ORa, -Rb-OC(O)-Ra, -Rb-OC(O)-ORa, -Rb-OC(O)-N(Ra)2, -Rb-N(Ra)2, -Rb-C(O)Ra, - Rb-C(O)ORa, -Rb-C(O)N(Ra)2, -Rb-O-Rc-C(O)N(Ra)2, -Rb-N(Ra)C(O)ORa, -Rb-N(Ra)C(O)Ra, -Rb- N(Ra)S(O)tRa(where t is 1 or 2), -Rb-S(O)tRa(where t is 1 or 2), -Rb-S(O)tORa(where t is 1 or 2) and -Rb-S(O)tN(Ra)2(where t is 1 or 2); and wherein each Rbis independently selected from a direct bond or a straight or branched alkylene, alkenylene, or alkynylene chain, and each Rcis a straight or branched alkylene, alkenylene or alkynylene chain.

[0107] Compounds of the present disclosure also include crystalline and amorphous forms of those compounds, pharmaceutically-acceptable salts, and active metabolites of these compounds having the same type of activity, including, for example, polymorphs, pseudopolymorphs, solvates, hydrates, unsolvated polymorphs (including anhydrates), conformational polymorphs, and amorphous forms of the compounds, as well as mixtures thereof.Rapamycin and derivatives

[0108] Previous medicinal chemistry work on rapamycin was focused on designing compounds for use in treating cancer, and thus the observation that modifications to the macrocyclic ring of rapamycin led to reduced antiproliferative activity of tumor cells led to the prioritization of compounds that retained full binding to mTORCl. Hence, the four rapamycin analogs that are currently FDA approved are essentially identical, as all are modified with solubilizing groups at the C-40hydroxyl position.

[0109] In some embodiments, the compounds described herein consider the structural features that can be important for binding to FKBP12 and combined with additional variables to alter the terminal half-life in vivo. As partitioning into the red blood cells is thought to be driven by binding to immunophilins such as FKBPs, this may spare the compounds described herein from first pass metabolism and lead to the long terminal half-life (24-48 hours) observed in humans with rapamycin.

[0110] In some embodiments, the compounds described herein can be synthesized using synthetic biology techniques to engineer the rapamycin polyketide synthase in Streptomyces rapamycinicus forproducing specific alterations to the structure of products generated through exchange acyltransferases that specify substituents at the a-carbons of the Claisen-type products of PKS assembly and accompanying cytochrome P-45 Os.Compounds[oni] The present disclosure provides compounds and salts, and formulations thereof, for use in treating various diseases.

[0112] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I):Formula (I) wherein,R1, R2, and R5are each independently hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, - S(=O)2R22, -NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl- C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20;R3and R4are each independently hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl,C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20;R6, R7, and R8are each independently hydrogen or C1-C3 alkyl;W is C=O or CHOH;L is selected from the group consisting ofwherein * indicates connectivity of L in the A; wherein a is 1-15;A1is -OR21, -SR21, -NR23R24, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkylcycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20; each R10is independently hydrogen, halogen, -CN, -C(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, Ci-C8alkyl, wherein the Ci-C8alkyl are each independently optionally substituted with one or more R20;R11is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, - NR21C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8-alkynyl, cycloalkyl, Ci-C8alkylcycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20; each R20is independently halogen, -CN, -ORa, -SRb, -S(=O)2Rb, -NRcRd, -S(=O)2NRcRd, - C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, -OC(=O)ORa, -OC(=O)SRb, -C(=O)NRcRd, -OC(=O)NRcRd, -NRaC(=O)NRcRd, -NRaC(=O)Rb, Ci-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, Ci-Cs haloalkyl, Ci-Cs hydroxyalkyl, or phenyl; each R21is independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs -cycloalkyl, heterocycloalkyl, Ci-Cs- heterocycloalkyl, aryl, Ci-Cs-aryl, heteroaryl, or Ci-Cs-heteroaryl are each independently optionally substituted with one Rla; each R22is independently hydrogen, -CN, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl -heterocycloalkyl, aryl, Ci- C8alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted with one or more Rlb;R23and R24are each independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted with one or more Rlc; or R23and R24are taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl optionally substituted with one or more Rld; each Rla, Rlb, Rlc, and Rldis independently oxo, halogen, -CN, -ORa, -SRb, -S(=O)2Rb, -NRcRd, - S(=O)2NRcRd, -C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, -OC(=O)ORa, - OC(=O)SRb, -OC(=O)SRb, -C(=O)NRcRd, -OC(=O)NRcRd, -NRaC(=O)NRcRd, - NRaC(=O)Rb, Ci-C8alkyl, -C2-C8alkenyl, C2-C8alkynyl, Ci-C8haloalkyl, Ci-C8hydroxyalkyl, or phenyl; and each Ra, Rb, Rc, and Rdis independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted; and or Rcand Rdare taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl which is optionally substituted.

[0113] In some embodiment, R1, R2, and R5are each independently hydrogen, halogen, -CN, -OR21, - SR21, -NO2, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, C3-10 cycloalkyl, Ci-Cs alkyl- C3-10 cycloalkyl, 3- 10 membered heterocycloalkyl, Ci-Cs alkyl-3-10 membered heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl. In some embodiment, R3and R4are each independently hydrogen, halogen, -CN, -OR21, -SR21, -NO2, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, C3-10 cycloalkyl, Ci-C8alkyl- C3-10 cycloalkyl, 3-10 membered heterocycloalkyl, Ci-Cs alkyl-3-10 membered heterocycloalkyl,aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl. In some embodiments, R6is CH3. In some embodiments, R7is CH3. In some embodiments, R8is CH3. In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R2is Ci-Cs alkyl. In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is Ci-Cs alkyl. In some embodiments, R4is hydrogen, halogen, -CN, -OR21, - SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is hydrogen. In some embodiments, R2is Ci-Cs alkyl; R3is Ci-Cs alkyl; R4is hydrogen; and R6, R7, and R8are each CH3.

[0114] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-A):Formula (I-A).

[0115] In some embodiments, in Formula (I-A), (i) when R1is CH3, R5is not CH3; or(ii) when R5is CH3, R1is not CH3. In some embodiments, in Formula (I-A), (i) when R1is CH3, R5is not CH3. In some embodiments, in Formula (I-A), (ii) when R5is CH3, R1is not CH3.

[0116] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R1is hydrogen. In some embodiments, R5is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is hydrogen. In some embodiments, R1is hydrogen; R2is Ci-Cs alkyl; R3is Ci-Cs alkyl; R4is hydrogen; R5is hydrogen; and R6, R7, and R8are each CH3.

[0117] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-A):Formula (II-A).

[0118] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is Ci-Cs alkyl. In some embodiments, R4is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is hydrogen. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is Ci-Cs alkyl. In some embodiments, R3is Ci-Cs alkyl; R4is hydrogen; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0119] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-B):Formula (I-B).

[0120] In some embodiments, in Formula (I-B), (i) when R1is CH3, R2is not CH3; or(ii) when R2is CH3 , R1is not CH3. In some embodiments, in Formula (I-B), (i) when R1is CH3, R2is not CH3. In some embodiments, in Formula (I-B), (ii) when R2is CH3 , R1is not CH3.

[0121] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R1is hydrogen. In some embodiments, R2is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R2is hydrogen. In some embodiments, R1is hydrogen; R2is hydrogen; R3is Ci-Cs alkyl; R4is hydrogen; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0122] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-B) :Formula (II-B).

[0123] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is Ci-Cs alkyl. In some embodiments, R2is Ci-Cs alkyl; R3is Ci-Cs alkyl; R4is hydrogen; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0124] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-C) :Formula (I-C) wherein,R1is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-Cs-alkyl-C(=O)R20, -C(=O)C(=O)R22, - C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, -NR21C(=O)NR23R24, - NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci- C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl ; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0125] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or C2-C8 alkyl. In some embodiments, R1is hydrogen. In some embodiments, R1is hydrogen; R2is hydrogen; R3is Ci-Cs alkyl; R4is hydrogen; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0126] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-C) :Formula (II-C).

[0127] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, wherein R1is Ci-Cs alkyl. In some embodiments, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0128] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-D):Formula (I-D).

[0129] In some embodiments, in Formula (I-D), (i) when R2is CH3 , R3is not CH3 or R4is not hydrogen; (ii) when R3is CH3, R2is not CH3 or R4is not hydrogen; or (iii) when R4is hydrogen, at least one of R2or R3is not CH3. In some embodiments, in Formula (I-D), (i) when R2is CH3 , R3is not CH3 or R4is not hydrogen. In some embodiments, in Formula (I-D), (ii) when R3is CH3, R2is not CH3 or R4isnot hydrogen. In some embodiments, in Formula (I-D), (iii) when R4is hydrogen, at least one of R2or R3is not CH3.

[0130] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R2is hydrogen. In some embodiments, R3is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is hydrogen. In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl; R2is hydrogen; R3is hydrogen; R4is Ci-Cs alkyl; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0131] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-D):Formula (II-D).

[0132] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is Ci-Cs alkyl. In some embodiments, R4is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is hydrogen. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is Ci-Cs alkyl. In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl; R3is Ci-Cs alkyl; R4is hydrogen; R5is Ci-Cs alkyl; and R6, R7, and R8are each CH3.

[0133] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-E):Formula (I-E) wherein,R2is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -N02, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-Cs-alkyl-C(=O)R20, -C(=O)C(=O)R22, - C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, -NR21C(=O)NR23R24, - NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci- C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl ; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0134] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or C2-C8alkyl. In some embodiments, R2is hydrogen. In some embodiments, R1is Ci-C8alkyl; R2is hydrogen; R3is Ci-C8alkyl; R4is hydrogen; R5is Ci-C8alkyl; and R6, R7, and R8are each CH,.

[0135] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-E):Formula (II-E).

[0136] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R1is Ci-C8alkyl. In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R2is Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl; R2is hydrogen; and R6, R7, and R8are each CH3.

[0137] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-F):Formula (I-F).

[0138] In some embodiments, in Formula (I-F), (i) when R3is CH3, R5is not CH3 or R4is not hydrogen; (ii) when R4is hydrogen, at least one of R3or R5is not CH3; or (iii) when R5is CH3, R3is not CH3 or R4is not hydrogen. In some embodiments, in Formula (I-F), (i) when R3is CH3, R5is not CH3 or R4is not hydrogen. In some embodiments, in Formula (I-F), (ii) when R4is hydrogen, at least one of R3or R5is not CH3. In some embodiments, in Formula (I-F), (iii) when R5is CH3, R3is not CH3 or R4is not hydrogen.

[0139] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is hydrogen. In some embodiments, R4is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is Ci-Cs alkyl. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is hydrogen. In some embodiments, R1is Ci-Cs alkyl; R2is hydrogen; R3is hydrogen; R4is Ci-Cs alkyl; R5is hydrogen; and R6, R7, and R8are each CH3.

[0140] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-F) :Formula (II-F).

[0141] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl. In some embodiments, R2is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R2is Ci-Cs alkyl. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl; R2is Ci-Cs alkyl; R5is hydrogen; and R6, R7, and R8are each CH3.

[0142] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-G):Formula (I-G).

[0143] In some embodiments, in Formula (I-G), (i) when R3is CH3, R4is not hydrogen; or (ii) when R4is hydrogen, at least one of R1, R2, R3, or R5is not CH3. In some embodiments, in Formula (I-G), (i) when R3is CH3, R4is not hydrogen. In some embodiments, in Formula (I-G), (ii) when R4is hydrogen, at least one of R1, R2, R3, or R5is not CH3.

[0144] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is hydrogen. In some embodiments, R4is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is Ci-Cs alkyl. In someembodiments, R1is Ci-Cs alkyl; R2is Ci-Cs alkyl; R3is hydrogen; R4is Ci-Cs alkyl; R5is hydrogen; and R6, R7, and R8are each CH3.

[0145] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-G):Formula (II-G).

[0146] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl. In some embodiments, R2is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R2is Ci-Cs alkyl. In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R3is Ci-Cs alkyl. In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is hydrogen. In some embodiments, R1is Ci- C8alkyl; R2is Ci-Cs alkyl; R3is Ci-Cs alkyl; R4is hydrogen; and R6, R7, and R8are each CH3.

[0147] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-H):Formula (I-H) wherein,R5is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, -NR21C(=O)NR23R24, - NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci- C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0148] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or C2-C8alkyl. In some embodiments, R5is hydrogen. In some embodiments, R1is Ci-C8alkyl; R2is Ci-C8alkyl; R3is Ci-C8alkyl; R4is hydrogen; R5is hydrogen; and R6, R7, and R8are each CH,.

[0149] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-H):Formula (II-H).

[0150] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R1is Ci-C8alkyl. In some embodiments, R2is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R2is Ci-C8alkyl. In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R4is hydrogen. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R5is Ci-C8alkyl. In some embodiments, R1is Ci-C8alkyl; R2is Ci-C8alkyl; R4is hydrogen; R5is Ci-C8alkyl; and R6, R7, and R8are each CH,.

[0151] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (I-I):Formula (I-I); wherein:R3is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-Cs-alkyl-C(=O)R20, -C(=O)C(=O)R22, - C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, -NR21C(=O)NR23R24, - NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0152] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R3is hydrogen. In some embodiments, R1is Ci-C8alkyl; R2is Ci-C8alkyl; R3is hydrogen; R4is hydrogen; R5is Ci-C8alkyl; R6, R7, and R8are each CH,.

[0153] In some embodiments, disclosed herein, is a compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by Formula (II-I) :Formula (II-I).

[0154] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R1is Ci-C8alkyl. In some embodiments, R2is hydrogen, halogen, -CN, - OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl. In some embodiments, R2is Ci-C8alkyl. In someembodiments, R4is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R4is hydrogen. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-Cs alkyl. In some embodiments, R5is Ci-Cs alkyl. In some embodiments, R1is Ci-Cs alkyl; R2is Ci-Cs alkyl; R4is hydrogen; R5is Ci-Cs alkyl; R6, R7, and R8are each CH3.

[0155] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0156] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0157] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl; wherein the Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl. In some embodiments, R1is hydrogen.

[0158] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl- heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0159] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0160] In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl; wherein the C2-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R1is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8 alkyl. In some embodiments, R1is hydrogen.

[0161] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0162] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0163] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-Cs alkyl, C2-C8 alkenyl, and C2-C8 alkynyl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-Cs alkyl. In some embodiments, R2is hydrogen.

[0164] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl- heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the C2-C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0165] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl,or Ci-Cs alkyl-heteroaryl; wherein the C2-C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0166] In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl; wherein the C2-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R2is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8 alkyl. In some embodiments, R2is hydrogen.

[0167] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0168] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0169] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-Cs alkyl, C2-C8 alkenyl, and C2-C8 alkynyl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-Cs alkyl. In some embodiments, R5is hydrogen.

[0170] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl- heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the C2-C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0171] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl,Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the C2-C8 alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0172] In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl; wherein the C2-C8 alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R5is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, C2-C8 alkyl. In some embodiments, R5is hydrogen.

[0173] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl- heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0174] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0175] In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-Cs alkyl, C2-C8 alkenyl, and C2-C8 alkynyl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, and C2-C8 alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R3is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-Cs alkyl. In some embodiments, R3is hydrogen.

[0176] In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl- heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0177] In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0178] In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl; wherein the Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R4is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl. In some embodiments, R4is Ci-C8alkyl. In some embodiments, R4is methyl.

[0179] In some embodiments, R6is hydrogen or C1-C3 alkyl. In some embodiments, R6is hydrogen. In some embodiments, R6is C1-C3 alkyl.

[0180] In some embodiments, R7is hydrogen or C1-C3 alkyl. In some embodiments, R7is hydrogen. In some embodiments, R7is C1-C3 alkyl. In some embodiments, R8is hydrogen or C1-C3 alkyl. In some embodiments, R8is hydrogen. In some embodiments, R8is C1-C3 alkyl.

[0181] In some embodiments, W is C=O or CHOH. In some embodiments, W is C=O. In some embodiments, W is CHOH.

[0182] In some embodiments, R10is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl- heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0183] In some embodiments, R10is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, - OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0184] In some embodiments, R10is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl; wherein the Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl, are each independently optionally substituted with one or more R20. In some embodiments, R10is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl, C2-C8alkenyl, and C2-C8alkynyl. In some embodiments, R10is hydrogen, halogen, -CN, -OR21, -NO2, -NR23R24, -C(=O)R22, Ci-C8alkyl. In some embodiments, R10is hydrogen or Ci-C8alkyl. In some embodiments, R10is hydrogen.

[0185] In some embodiments, R11is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-C8-alkynyl, cycloalkyl, Ci-C8alkyl -cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0186] In some embodiments, wherein R11is Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl, wherein the Ci-C8alkyl, C2-C8alkenyl, C2-G alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20. In some embodiments, wherein R11is heteroaryl and R20is - NH2.

[0187] In some embodiments, L is selected from the group consisting of

[0188] In some embodiments, a is 1-15. In some embodiments, a is 2-10. In some embodiments, a is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, a is 4, 6, 8, or 10. In some embodiments, a is 4. In some embodiments, a is 6. In some embodiments, a is 8. In some embodiments, a is 10.

[0189] In some embodiments,some embodiments, A is

[0190] In some embodiments, A1is -OR21, -SR21, -NR23R24, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0191] In some embodiments,4, Ci-Cs alkyl, C2-C8 alkenyl, or C2-C8 alkynyl. In some embodiments,wherein * indicates connectivity of A1to L.

[0192] In some embodiments, A1is Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl- heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl. In some embodiments, A1

[0193] In some embodiments, R11is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, - NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, CI-C8alkyl, C2-C8alkenyl, C2-Cs-alkynyl, cycloalkyl, Ci-Cs alkyl -cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

[0194] In some embodiments, R11is cycloalkyl, Ci-Cs alkyl -cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl; wherein the Ci-Cs alkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20. In some embodiments, R11is heteroaryl optionally substituted with one or more R20. In some embodiments,

[0195] In some embodiments, each R21is independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs -cycloalkyl, heterocycloalkyl, Ci-Cs- heterocycloalkyl, aryl, Ci-Cs-aryl, heteroaryl, or Ci- Cs-heteroaryl are each independently optionally substituted with one Rla.

[0196] In some embodiments, each R22is independently hydrogen, -CN, Ci-Cs alkyl, C2-C8 alkenyl, C2- C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2- C8alkynyl, Ci-Cs alkyl -cycloalkyl, heterocycloalkyl, Ci-Cs alkyl -heterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted with one or more Rlb.

[0197] In some embodiments, R23and R24are each independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkylaryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted with one or more Rlc. In some embodiments, R23and R24are taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl optionally substituted with one or more Rld.

[0198] In some embodiments, each Rla, Rlb, Rlc, and Rldis independently oxo, halogen, -CN, -ORa, - SRb, -S(=O)2Rb, -NRcRd, -S(=O)2NRcRd, -C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, -OC(=O)ORa, -OC(=O)SRb, -OC(=O)SRb, -C(=O)NRcRd, -OC(=O)NRcRd, -NRaC(=0)NRcRd, -NRaC(=O)Rb, Ci-C8alkyl, -C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs haloalkyl, Ci-Cs hydroxyalkyl, or phenyl.

[0199] In some embodiments, Ra, Rb, Rc, and Rdis independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl-heterocycloalkyl, aryl, Ci-Cs alkylaryl, heteroaryl, or Ci-Cs alkyl-heteroaryl are each independently optionally substituted.

[0200] In some embodiments, Rcand Rdare taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl which is optionally substituted.Table 1. Exemplary Rapamycin Analogs. Each structure in Table 1 depicts an ether linkage (.0.''CT) at Carbon 40 for illustrative purposes for connectivity to a linker. At Carbon 40,Table 2. Exemplary Linkers. * indicates connectivity of a Linker to a Kinase InhibitorTable 3. Exemplary Kinase Inhibitors.Table 4. Exemplary Heterobifunctional Compounds (HBFs)PHARMACEUTICAL COMPOSITIONS

[0201] In some embodiments, the compound as described herein can be formulated in a pharmaceutical composition comprising least one pharmaceutically-acceptable excipient.

[0202] In some embodiments, the pharmaceutical composition described herein can be formulated as a unit dosage form. In some embodiments, the pharmaceutical composition described herein can be formulated as a form suitable for oral, parenteral, rectal, ocular, intravenous or otic administration, or administration by inhalation.Pharm aceutically-acceptable salts

[0203] Provided herein are pharmaceutically-acceptable salts of the compounds described herein. As used herein, a pharmaceutically-acceptable salt includes, but is not limited to, acid addition salts or basic addition salts. Pharmaceutically-acceptable salts include, but are not limited to, alkali metal salts, such as sodium salts, potassium salts, and lithium salts; alkaline earth metals, such as calcium salts, magnesium salts, and the like; organic amine salts, such as triethylamine salts, pyridine salts, picoline salts, ethanolamine salts, triethanolamine salts, dicyclohexylamine salts, N,N’- dibenzylethylenediamine salts, and the like; inorganic acid salts such as hydrochloride salts, hydrobromide salts, sulfate salts, phosphate salts, and the like; organic acid salts such as formate salts, acetate salts, trifluoroacetate salts, maleate salts, tartrate salts, and the like; sulfonate salts such as methanesulfonate salts, benzene sulfonate salts, p-toluenesulfonate salts, and the like; and amino acid salts, such as arginate salts, asparginate salts, glutamate salts, and the like. Examples of pharmaceutically-acceptable salts include, but are not limited to, bitartrate, bitartrate hydrate, hydrochloride, p-toluenesulfonate, phosphate, sulfate, trifluoroacetate, bitartrate hemipentahydrate, pentafluoropropionate, hydrobromide, mucate, oleate, phosphate dibasic, phosphate monobasic, acetate trihydrate, bis(heptafuorobutyrate), bis(pentafluoropropionate), bis(pyridine carboxylate), bis(trifluoroacetate), chlorohydrate, and sulfate pentahydrate. Other representative pharmaceutically- acceptable salts include, e.g., water-soluble and water-insoluble salts, such as the acetate, amsonate(4,4-diaminostilbene-2,2-disulfonate), benzenesulfonate, benzonate, bicarbonate, bisulfate, bitartrate, borate, butyrate, calcium edetate, camphorsulfonate, camsylate, carbonate, citrate, clavulariate, dihydrochloride, edetate, edisylate, estolate, esylate, fiunarate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexafluorophosphate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynaphthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylbromide, methylnitrate, methylsulfate, mucate, napsylate, nitrate, N-methylglucamine ammonium salt, 3 -hydroxy-2 -naphthoate, oleate, oxalate,palmitate, pamoate (l,l-methene-bis-2-hydroxy-3-naphthoate, einbonate), pantothenate, phosphate / diphosphate, picrate, polygalacturonate, propionate, p-toluenesulfonate, salicylate, stearate, subacetate, succinate, sulfate, sulfosalicylate, suramate, tannate, tartrate, teoclate, tosylate, triethiodide, and valerate salts. A hydrate is another example of a pharmaceutically-acceptable salt.Excipients

[0204] In some embodiments, a pharmaceutical composition can comprise an excipient. An excipient can be an excipient described in the Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986).

[0205] Non-limiting examples of suitable excipients can include a buffering agent, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a chelator, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, a coloring agent.

[0206] In some embodiments an excipient can be a buffering agent. Non-limiting examples of suitable buffering agents can include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate. As a buffering agent, sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium glucomate, aluminium hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium hydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, calcium hydroxide and other calcium salts or combinations thereof can be used in a pharmaceutical composition.

[0207] In some embodiments an excipient can comprise a preservative. Non-limiting examples of suitable preservatives can include antioxidants, such as alpha-tocopherol and ascorbate, and antimicrobials, such as parabens, chlorobutanol, and phenol. Antioxidants can further include but not limited to EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxy anisole (BHA), sodium sulfite, p-amino benzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol and N- acetyl cysteine. In some instances a preservatives can include validamycin A, TL-3, sodium ortho vanadate, sodium fluoride, N-a-tosyl-Phe- chloromethylketone, N-a-tosyl-Lys- chloromethylketone, aprotinin, phenylmethyl sulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitor, phosphatase inhibitor, caspase inhibitor, granzyme inhibitor, cell adhesion inhibitor, cell division inhibitor, cell cycle inhibitor, lipid signaling inhibitor, protease inhibitor, reducing agent, alkylating agent, antimicrobial agent, oxidase inhibitor, or other inhibitor.

[0208] In some embodiments a pharmaceutical composition can comprise a binder as an excipient. Non-limiting examples of suitable binders can include starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose,polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 faty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, and combinations thereof.

[0209] The binders that can be used in a pharmaceutical composition can be selected from starches such as potato starch, com starch, wheat starch; sugars such as sucrose, glucose, dextrose, lactose, maltodextrin; natural and synthetic gums; gelatin; cellulose derivatives such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose, methyl cellulose, ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); waxes; calcium carbonate; calcium phosphate; alcohols such as sorbitol, xylitol, mannitol and water or a combination thereof.

[0210] In some embodiments a pharmaceutical composition can comprise a lubricant as an excipient. Non-limiting examples of suitable lubricants can include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil. The lubricants that can be used in a pharmaceutical composition can be selected from metallic stearates (such as magnesium stearate, calcium stearate, aluminium stearate), faty acid esters (such as sodium stearyl fumarate), faty acids (such as stearic acid), faty alcohols, glyceryl behenate, mineral oil, paraffins, hydrogenated vegetable oils, leucine, polyethylene glycols (PEG), metallic lauryl sulphates (such as sodium lauryl sulphate, magnesium lauryl sulphate), sodium chloride, sodium benzoate, sodium acetate and talc or a combination thereof.

[0211] In some embodiments a pharmaceutical composition can comprise a dispersion enhancer as an excipient. Non-limiting examples of suitable dispersants can include starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose as high HLB emulsifier surfactants.

[0212] In some embodiments a pharmaceutical composition can comprise a disintegrant as an excipient. In some embodiments a disintegrant can be a non-efferve scent disintegrant. Non-limiting examples of suitable non-effervescent disintegrants can include starches such as com starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, microcrystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pecitin, and tragacanth. In some embodiments a disintegrant can be an effervescent disintegrant. Nonlimiting examples of suitable effervescent disintegrants can include sodium bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.

[0213] In some embodiments an excipient can comprise a flavoring agent. Flavoring agents incorporated into an outer layer can be chosen from synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; and combinations thereof. In some embodiments a flavoring agent can be selected from the group consisting of cinnamon oils; oil of wintergreen; peppermint oils; clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oil such aslemon oil, orange oil, grape and grapefruit oil; and fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot.

[0214] In some embodiments an excipient can comprise a sweetener. Non-limiting examples of suitable sweeteners can include glucose (com syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as a sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, sylitol, and the like.

[0215] In some instances, a pharmaceutical composition can comprise a coloring agent. Non-limiting examples of suitable color agents can include food, drug and cosmetic colors (FD&C), drug and cosmetic colors (D&C), and external drug and cosmetic colors (Ext. D&C). A coloring agent can be used as dyes or their corresponding lakes.

[0216] In some instances, a pharmaceutical composition can comprise anti-adherents (anti-sticking agents, glidants, flow promoters, lubricants) (e.g., talc, magnesium stearate, fumed silica (Carbosil, Aerosil), micronized silica (Syloid No. FP 244, Grace U.S.A.), polyethylene glycols, surfactants, waxes, stearic acid, stearic acid salts, stearic acid derivatives, starch, hydrogenated vegetable oils, sodium benzoate, sodium acetate, leucine, PEG-4000 and magnesium lauryl sulfate) anticoagulants (e.g., acetylated monoglycerides), antifoaming agents (e.g., long -chain alcohols and silicone derivatives), antioxidants (e.g., BHT, BHA, gallic acid, propyl gallate, ascorbic acid, ascorbyl palmitate, 4hydroxymethyl-2,6-di-tert-butyl phenol, tocopherol, etc.), binders (adhesives), i.e., agents that impart cohesive properties to powdered materials through particle-particle bonding (e.g., matrix binders (dry starch, dry sugars), fdm binders (PVP, starch paste, celluloses, bentonite, sucrose)), chemical binders (e.g., polymeric cellulose derivatives, such as carboxy methyl cellulose, HPC, HPMC, etc., sugar syrups, com syrup, water soluble polysaccharides (e.g., acacia, tragacanth, guar, alginates, etc), gelatin, gelatin hydrolysate, agar, sucrose, dextrose, non-cellulosic binders (e.g., PVP, PEG, vinyl pyrrolidone copolymers, pregelatinized starch, sorbitol, glucose, etc.), bufferants, where the acid is a pharmaceutically-acceptable acid, (e.g., hydrochloric acid, hydrobromic acid, hydriodic acid, sulfuric acid, nitric acid, boric acid, phosphoric acid, acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, amino acids, ascorbic acid, benzoic acid, boric acid, butyric acid, carbonic acid, citric acid, fatty acids, formic acid, fumaric acid, gluconic acid, hydroquinosulfonic acid, isoascorbic acid, lactic acid, maleic acid, methanesulfonic acid, oxalic acid, parabromophenylsulfonic acid, propionic acid, p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, thioglycolic acid, toluenesulfonic acid, uric acid, etc) and where the base is a pharmaceutically-acceptable base (e.g., an amino acid, an amino acid ester, ammonium hydroxide, potassium hydroxide, sodium hydroxide, sodium hydrogen carbonate, aluminum hydroxide, calcium carbonate, magnesium hydroxide, magnesium aluminum silicate, synthetic aluminum silicate, synthetic hydrotalcite, magnesium aluminum hydroxide, diisopropylethylamine,ethanolamine, ethylenediamine, triethanolamine, triethylamine, triisopropanolamine), or a pharmaceutically-acceptable salt of acetic acid, acrylic acid, adipic acid, alginic acid, alkane sulfonic acid, an amino acid, ascorbic acid, benzoic acid, boric acid, butyric acid, carbonic acid, citric acid, a fatty acid, formic acid, fumaric acid, gluconic acid, hydroquino sulfonic acid, isoascorbic acid, lactic acid, maleic acid, methanesulfonic acid, oxalic acid, parabromophenylsulfonic acid, propionic acid, p- toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, thioglycolic acid, toluene sulfonic acid, and uric acid, chelating agents (e.g., EDTA and EDTA salts), coagulants (e.g., alginates) colorants or opaquants (e.g., titanium dioxide, food dyes, lakes, natural vegetable colorants, iron oxides, silicates, sulfates, magnesium hydroxide and aluminum hydroxide), coolants (e.g. halogenated hydrocarbons (e.g., trichloroethane, trichloroethylene, dichloromethane, fluorotrichloromethane), diethylether and liquid nitrogen) cryoprotectants (e.g., trehelose, phosphates, citric acid, tartaric acid, gelatin, dextran, mannitol, etc.), diluents or fillers (e.g., lactose, mannitol, talc, magnesium stearate, sodium chloride, potassium chloride, citric acid, spray-dried lactose, hydrolyzed starches, directly compressible starch, microcrystalline cellulose, cellulosics, sorbitol, sucrose, sucrose-based materials, calcium sulfate, dibasic calcium phosphate and dextrose disintegrants or super disintegrants (e.g., croscarmellose sodium, starch, starch derivatives, clays, gums, cellulose, cellulose derivatives, alginates, crosslinked polyvinylpyrrolidone, sodium starch glycolate and microcrystalline cellulose), hydrogen bonding agents (e.g., magnesium oxide), flavorants or desensitizers (e.g., spray-dried flavors, essential oils and ethyl vanillin), ion-exchange resins (e.g., styrene / divinyl benzene copolymers, and quaternary ammonium compounds), plasticizers (e.g., polyethylene glycol, citrate esters (e.g., triethyl citrate, acetyl triethyl citrate, acetyltributyl citrate), acetylated monoglycerides, glycerin, triacetin, propylene glycol, phthalate esters (e.g., diethyl phthalate, dibutyl phthalate), castor oil, sorbitol and dibutyl seccate), preservatives (e.g., ascorbic acid, boric acid, sorbic acid, benzoic acid, and salts thereof, parabens, phenols, benzyl alcohol, and quaternary ammonium compounds), solvents (e.g., alcohols, ketones, esters, chlorinated hydrocarbons and water) sweeteners, including natural sweeteners (e.g., maltose, sucrose, glucose, sorbitol, glycerin and dextrins), and artificial sweeteners (e.g., aspartame, saccharine and saccharine salts) and thickeners (viscosity modifiers, thickening agents), (e.g., sugars, polyvinylpyrrolidone, cellulosics, polymers and alginates).

[0217] In some instances, a pharmaceutical composition can comprise proteins (e.g., collagen, gelatin, Zein, gluten, mussel protein, lipoprotein), carbohydrates (e.g., alginates, carrageenan, cellulose derivatives, pectin, starch, chitosan), gums (e.g., xanthan gum, gum arabic), spermaceti, natural or synthetic waxes, camuaba wax, fatty acids (e.g., stearic acid, hydroxystearic acid), fatty alcohols, sugars, shellacs, such as those based on sugars (e.g., lactose, sucrose, dextrose) or starches, polysaccharide-based polymers (e.g., maltodextrin and maltodextrin derivatives, dextrates, cyclodextrin and cyclodextrin derivatives), cellulosic-based polymers (e.g., microcrystalline cellulose, sodium carboxymethyl cellulose, hydroxypropylmethyl cellulose, ethyl cellulose, hydroxypropylcellulose, cellulose acetate, cellulose nitrate, cellulose acetate butyrate, cellulose acetate, trimellitate, carboxymethylethyl cellulose, hydroxypropylmethyl cellulose phthalate), inorganics, (e.g., dicalcium phosphate, hydroxyapitite, tricalcium phosphate, talc and titania), polyols (e.g., mannitol, xylitol and sorbitol polyethylene glycol esters) and polymers (e.g., alginates, poly(lactide coglycolide), gelatin, crosslinked gelatin and agar-agar).

[0218] In some instances, a pharmaceutical composition can comprise adsorbents. Many adsorbents are solid, porous or super porous adsorption materials. They comprise numerous micro- or nanopores within their structures, resulting in very large surface areas, for example, greater than 500 m2 / g. Exemplary absorbents include, without limitation, silica, active carbon, magnesium aluminum silicate, and diatomite.

[0219] In some embodiments, a compound described herein can be present in the form of a prodrug. The term “prodrug” as used herein, can refer to a drug precursor that, following administration to a subject and subsequent absorption, can be converted to an active, or a more active species via some process, such as conversion by a metabolic pathway. Thus, the term can encompass a derivative, which, upon administration to a recipient, can be capable of providing, either directly or indirectly, a compound, salt or a metabolite thereof. Some prodrugs can have a chemical group present on a prodrug that renders it less active and / or confers solubility or some other property to the drug. Once the chemical group has been cleaved and / or modified from the prodrug the active drug can be generated. Prodrugs can increase the bioavailability of a compound described herein when administered to a subject (e.g., by allowing an administered compound described herein to be more readily absorbed) or which enhance delivery of the compound described herein to a biological compartment (e.g., the brain or lymphatic system).

[0220] In some embodiments, prodrugs include compounds where ester groups are bonded to any group that, when administered to a mammalian subject, cleaves to form a free hydroxyl. In some embodiments, compounds of the present disclosure are prodrugs comprising an ester group, wherein the ester group may be cleaved in-vivo to generate a compound having a hydroxyl group at the corresponding position.Administration

[0221] In some embodiments, a pharmaceutical formulation disclosed herein can be formulated into a variety of forms and administered by a number of different means. In some cases, a pharmaceutical formulation can be biodegradable. A pharmaceutical formulation can be administered orally, rectally, parenterally, ocular administration, topically, intravenously, otic administration, by inhalation administration, intranasally, in formulations containing conventionally acceptable carriers, adjuvants, and vehicles as desired. The term "parenteral" as used herein can include subcutaneous, intravenous, intramuscular, or intrastemal injection and infusion techniques. Administration can include injection or infusion, including intra-arterial, intracardiac, intracerebroventricular, intradermal, intraduodenal,intramedullary, intramuscular, intraosseous, intraperitoneal, intrathecal, intratracheal, intravascular, intravenous, intravitreal, epidural and subcutaneous, inhalational, transdermal, transmucosal, sublingual, buccal and topical (including epicutaneous, dermal, enema, eye drops, ear drops, intranasal, vaginal) administration. In some exemplary embodiments, a route of administration can be via an injection such as an intramuscular, intravenous, subcutaneous, intratracheal, or intraperitoneal injection. In some cases, an administering is a systemic administering. A systemic administering may be, for example, a parenteral injection at a site that allows for circulation.

[0222] Solid dosage forms for oral administration can include capsules, tablets, caplets, pills, troches, lozenges, powders, and granules. A capsule can comprise a core material comprising a nutritive protein or composition and a shell wall that encapsulates a core material. In some embodiments a core material can comprise at least one of a solid, a liquid, and an emulsion. Tablets, pills, and the like can be compressed, multiply compressed, multiply layered, and / or coated. A coating can be single or multiple.

[0223] Liquid formulations can include a syrup (for example, an oral formulation), an intravenous formulation, an intranasal formulation, an ocular formulation (e.g., for treating an eye infection), an otic formulation (e.g., for treating an ear infection), an ointment, a cream, an aerosol, and the like. In some cases, a liquid formulation can comprise a gel microsphere, or caulking hydrogel. In some instances, a combination of various formulations can be administered. In some embodiments, a tablet, pill, and the like can be formulated for an extended release profile.

[0224] Drops, such as eye drops or nose drops, may be formulated with one or more of a pharmaceutical composition in an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents. Liquid sprays can be pumped or are conveniently delivered from pressurized packs. Drops can be delivered via a simple eye droppercapped bottle, via a plastic bottle adapted to deliver liquid contents drop-wise, or via a specially shaped closure.

[0225] In some instances, a pharmaceutical composition described herein can be administered in a composition for topical administration. For topical administration, an active agent may be formulated as is known in the art for direct application to a target area. Forms chiefly conditioned for topical application can take the form, for example, of creams, milks, gels, powders, dispersion or microemulsions, lotions thickened to a greater or lesser extent, impregnated pads, ointments or sticks, aerosol formulations (e.g., sprays or foams), hydrogel, soaps, detergents, lotions or cakes of soap. Other conventional forms for this purpose include wound dressings, coated bandages or other polymer coverings, ointments, creams, lotions, pastes, jellies, sprays, and aerosols. Thus, a pharmaceutical composition disclosed herein can be delivered via patches or bandages for dermal administration.

[0226] Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents. Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents,dispersing agents, suspending agents, thickening agents, or coloring agents. In some embodiments, a pharmaceutical composition can comprise the compound described herein and at least one excipient.

[0227] In some embodiments, the pharmaceutical composition described herein is in the form of a unit dose. In some embodiments, the pharmaceutical composition can be co-administered with a vaccine. In some embodiments, the pharmaceutical composition can be an adjuvant to a vaccine. In some embodiments, the pharmaceutical composition increases the efficacy and improve the effectiveness of a vaccine. In some embodiments, the pharmaceutical composition reduces the adverse effects of a vaccine.Methods of Treatment

[0228] Methods of making a kit can include placing a pharmaceutical composition described herein in a container for packaging. A method can further comprise an inclusion of instructions for use. In some cases, instructions for use can direct administration of a unit dose of a pharmaceutical composition to a subject.EXAMPLES

[0229] The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the disclosure; it may be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.

[0230] Example X-l . Generation of the bacterial strains to synthesize compounds.

[0231] The DNA fragments, named Left Arm, AT coding region (AT), Right Arm, and pUC19 backbone, were amplified by PCR using the primers and templates listed in examples, respectively. The PCR products were separated by DNA electrophoresis, and the target fragments were purified. These four purified fragments were assembled using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA) to afford the intermediate plasmid. After validating the sequence of the insert in the intermediate plasmid, this plasmid was subjected to restriction digestion using the restriction enzyme(s) listed in each example. The digestion products were separated by DNA electrophoresis, and the insert fragment was purified. The purified fragment was ligated with pKCl 139 backbone, priorly linearized using the same restriction enzyme(s), using T4 DNA ligase (Thermo Fisher Scientific, MA) to afford the engineering plasmid.

[0232] The engineering plasmid was introduced into acceptor Streptomyces (S. rapamycinicus ATCC 29253, Unless otherwise stated) by conjugation between E. coli and Streptomyces. The plasmid was transformed into E. coli SI 7-1 and plated on Luria-Bertani (LB) agar containing 100 mg / L apramycin (Teknova, CA). After incubating at 30 °C until the appearance of colonies, a single colony was inoculated into 2 mL LB media containing 25 mg / L apramycin in a 5 mL round-bottom tube forgrowing overnight at 30°C. 0.5 mL of the overnight culture was inoculated into 25 mL LB media containing 25 mg / L apramycin in a 250 mL Erlenmeyer flask for growing at 30 °C until OD600 reached 0.4. The culture was centrifuged at 4,000 g for 5 min. After removing the supernatant, the pellet cells were washed with 25 mL LB media three times. The washed cells were resuspended in 2.5 mL LB media and put on ice. .S', rapamycinicus ATCC 29253 spores stock containing 1 * 109spores in 20% glycerol solution was centrifuged at 2,300 g for 5 min. After removing the supernatant, the spores were washed with Difco 2xYT medium (BD, NJ) three times. The spores were resuspended in 100 pL 2xYT media, and the suspension was treated by heat shock at 50°C for 10 min in a water broth. After cooling down to room temperature, 100 pL spore suspension was mixed with 100 pL washed E. coli cells suspension gently. The mixture was spread on dry Mannitol Soy (MS) agar plate evenly, and the cultures were incubated at 29°C for 18 hours. 1 mL aqueous solution containing 1.5 mg nalidixic acid sodium salt and 0.6 mg apramycin, pH = 7, was added onto the grown cultures to overlay the whole plate evenly. After drying the plate surface in the biosafety cabinet, the culture was incubated at 29°C until the conjugants appeared (5-7 days). The conjugants were streaked on 2CM plates (soluble starch 10 g, sodium chloride 1 g, peptone 2 g, dipotassium phosphate 1 g, magnesium sulfate heptahydrate 2 g, calcium carbonate 2 g, ammonium sulfate 2 g, trace element solution (iron(II) sulfate heptahydrate 1 g / L, magnesium chloride hexahydrate 1 g / L, zinc sulfate heptahydrate 1 g / L) 1 mL, difco agar 22 g, distilled water up to 1 L, pH = 7.2) containing 50 mg / L nalidixic acid sodium salt and 25 mg / L apramycin. The streaked plate was first incubated at 30°C for 24 h and then incubated at 37 °C until colonies appeared (3-5 days). These colonies were picked and streaked on new 2CM plates containing nalidixic acid sodium salt and apramycin, and the plates were incubated at 37 °C until colonies appeared (3 days). The resulting colonies were single crossover strains. The single crossover strains were grown on ISP Medium No. 3 (without antibiotics) at 30°C for three generations. The resulting strains were streaked on ISP Medium No. 3, and the single colonies were screened by solid-state fermentation assay. The single colonies were grown on AMO agar (mixture 1: soybean meal 15.4 g, dipotassium phosphate 5 g, L-lysine hydrochloride 17.5 g, difco agar 20 g, distilled water up to 950 mL, pH = 6.0. mixture 2: mannose 25.5 g, distilled water up to 50 mL. Mix these two mixtures after autoclaving at 121°C for 20 min) for 3 days, respectively. The culture on the agar was stamped using a 1000-pL wide-bore pipette tip and transferred into a well of 96-well PCR plate. 100 pL methanol was added to the well, and the PCR plate was sealed with an adhesive foil. The plate was shaken at 37 °C, 300 rpm for 30 min, then centrifuged at 4000 g for 10 min. 1 pL supernatant was subjected to LC-MS analysis using an Agilent 1290 / Ultivo Triple Quad LC / MS on a Kinetex column (Biphenyl lOOA, 1.7 pm, 50 x 2.1 mm, Phenomenex Inc., CA) heated to 40 °C by gradient elution of solvent A (H2O containing 0.1% formic acid) and solvent B (methanol containing 0.1% formic acid) at a flow rate of 0.75 mL / min as following program: T = 0, 70% B; T = 0. 1 min, 70% B; T = 1.1 min, 100% B; T = 1.3 min, 100% B; T = 1.31 min, 70% B; T = 1.8 min, 70% B. UV absorption at 210 nm and 280 nm were recorded. The MS was run on negative mode.

[0233] The strains that didn’t produce rapamycin but produced a rapamycin analog was spread on ISP Medium No. 3 supplemented with 50 mM calcium chloride to grow at 29 °C until sporulation (14 days). The spores were collected in 20% glycerol solution and filtered through a 100 pm cell strainer. The filtrate was stored in a -80°C ultra-low freezer.

[0234] Example X-2. Method to Produce exemplary rapamycin analogs.

[0235] 20 pL spores suspension was used to inoculate 50 mL seed media (yeast extract 5 g, malt extract 4 g, maltose 5 g, L-lysine hydrochloride 5 g, distilled water up to 1 L, pH =6) in a 250 mL Erlenmeyer flask with milk filter cap. After growing at 28°C for 3 days, 5 mL of the seed culture was inoculated into 1 L fermentation media (mixture 1: soybean meal 15.4 g, dipotassium phosphate 5 g, L-lysine hydrochloride 17.5 g, distilled water up to 950 mL, pH = 6.0. mixture 2: mannose 25.5 g, distilled water up to 50 mL. Mix these two mixtures after autoclaving at 121°C for 20 min) in a 2.8-L baffled Lembach flask with a milk filter cap. 4 L fermentation was conducted at 28°C, 220 rpm for 5 days, then the fermentation broth was centrifuged at 4000 g for 20 min at room temperature, and the cell pellet was collected and combined. After transferring the cells into a 1-L glass bottle, 500 mL of acetone was added to the cells. The mixture was shaken vigorously and allowed to settle for 2 hours, then filtered through sintered glass funnel, with sand as the filter aid. The filtrate was concentrated under reduced pressure to remove acetone. The left liquid was extracted by ethyl acetate three times, and the ethyl acetate phase was combined and washed with saturated sodium bicarbonate solution and saturated brine. The organic phase was filtered through anhydrous sodium sulfate and concentrated under reduced pressure. The residue was subjected to purification steps to afford the final rapamycin analog, as follows:

[0236] Plash Step: the residue was dissolved in 5 mL dichloromethane and separated on an Agela Flash Column Silica-CS (40 g) column using a BUCHI Pure C-805 Flash system by gradient elution of solvent A (dichloromethane) and solvent B (methanol) at a flow rate of 50 mL / min as the following program: T = 0, 0% B; T =15 min, 6% B; T = 17 min, 6% B. All elute was collected in 25-mL fractions, and the fractions were subjected to LC-MS analysis. The fractions containing the target rapamycin analog were combined and concentrated under reduced pressure.

[0237] Prep Step: The residue from Flash Step was suspended in 45% acetonitrile aqueous solution and injected onto a Kinetex column (5 pm, F5 100 A, 150 x 21.2 mm, Phenomenex Inc., CA) for separation using a BUCHI pure C-830 Prep system by isocratic elution of 45% acetonitrile with 55% water at a flow rate of 25 mL / min. All elute was collected in 25-mL fractions, and the fractions were subjected to LC-MS analysis. Those fractions containing the rapamycin analog were combined and concentrated under reduced pressure.

[0238] Example X-3. Synthesis of A 1.

[0239] (3 S,6R,7E,9R, 10R, 12R, 15E, 17E, 19E,21 S,23 S,26R,27R,34aS)-9,27-dihydroxy-3-((R)- 1 - ((lS,3R,4R)-4-hydroxy-3-methoxycyclohexyl)propan-2-yl)-10,21-dimethoxy-6,8,12,20,26- pentamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27- epoxypyrido[2,l-c][l]oxa[4]azacyclohentriacontine-l,5,l l,28,29(4H,6H,31H)-pentaone.

[0240] Slight modifications to Example X-l were conducted to generate the strain to produce Al . Three fragments - Left Arm, Right Arm, pUC19 vector- were first assembled to plasmid pAPOOOOXl. pAPOOOOXl was then linearized by PCR with primers at7 backbone _F / at7 backbone R, and the product was assembled with the synthesized gene block, rap A TS. to generate the intermediate plasmid. AS_88, a rapamycin high producing strain generated in-house, was used as the acceptor Streptomyces in the conjugation.

[0241] Templates and primers used:Target Template Fragme Primers fragment ntLengthLeft Arm .S', rapamycinicus 2 kb at7_left_F GAATTCGAGCTCGGTACCCGG genomic DNA GGATCCTTCTAGAACGACGGCGTCTTGGAGACCCT at7Jeft_R CGTACGTCGGAAGACTGACCCCGAAGGCCGACARight Arm .S', rapamycinicus 2 kb at7_right_F CTTCGGGGTCAGTCTTCCGAC genomic DNA GTACGCGTTCCAGC at7_right_R CAAGCTTGCATGCCTGCAGGTCGACTTCTAGAATTTCCCGGA AGCCAGTGGTACGC pUC19 pUC19 2.6 kb at7-pUC19_F TCTAGAAGTCGACCTGCAGGC vector ATGat7-pUC19 R TCTAGAAGGATCCCCGGGTAC CLinearized pAPOOOOXl 6.6 kb at7 backbone _F CTTCCGACGTACGCGTTCCAG pAPOOOO CXI at7 backbone _R CCACTGACCCCGAAGGCCGAC AC

[0242] Sequence of synthesized gene block rap_AT8'.

[0243] GGTGTGTCGGCCTTCGGGGTCAGTGGTACGAACGCCCACGTCATCCTGGAATCGG CACCGCCGACCCAGCCCGCCGACAACGCGGTGATCGAGCGGGCGCCGGAATGGCTGCCCATGGTGATCAGTGCACGTACGCAGTCCGCCCTGACCGAACACGAAGGCCGGTTAAGAGCGTACCTGGCTGCCAGCCCGGGCGTGGATATGCGGGCCGTTGCATCGACGTTGGCCATGACACGGTCGGTGTTCGAGCACCGCGCTGTTCTGTTGGGTGACGACACCGTGACCGGCACCGCGGCGACCGACCCGCGTGTCGTCTTCGTCTTCCCCGGTCAGGGTTCGCAGCGGGCTGGGATGGGCGAAGAGTTGGCAGCAGCGTTCCCGGTGTTCGCTCGGATCCATCAGCAGGTGTGGGACCTGCTGGATGTGCCGGATCTGGAGGTGAACGAGACCGGGTACGCGCAGCCGGCGCTGTTCGCCTTGCAGGTCGCTCTGTTCGGGTTGTTGGAGTCCTGGGGTGTTCGACCGGACGCGGTGGTCGGCCACAGTGTCGGAGAACTGGCGGCCGGGTATGTCTCGGGTCTGTGGTCGCTGGAGGACGCCTGCACGCTGGTGAGCGCAAGAGCACGGCTGATGCAGGCATTACCTGCTGGTGGTGTGATGGTCGCGGTCCCGGTCTCCGAAGATGAGGCGAGGGCAGTTTTAGGTGAGGGTGTCGAGATCGCCGCCGTGAACGGCCCCAGCAGCGTGGTGCTGTCCGGCGACGAGGCTGCTGTCCTGCAGGCCGCTGAGGGGCTGGGGAAGTGGACGAGATTAGCAACCAGCCACGCCTTCCACTCGGCCCGGATGGAGCCGATGCTGGAGGAGTTCAGGACCGTCGCCGAGGGCCTGACGTACCGGACCCCGCAGGTGTCGATGGCCGCGGGTGATCAGGTCACCACCACGGAGTACTGGGTGCGGCAGGTTCGTGACACGGTCCGGTTCGGCGAGCAGGTGGCCTCGTACGAGGATGCGGTGTTCGTGGAGCTGGGTGCGGATCGCTCGTTGGCGAGACTGGTCGACGGCGTTGCGATGTTGCACGGCGATCACGAGGCCCAGGCGGCTGTGTCGGCGTTGGCTCACCTGTACGTCAACGGTGTGACGGTGGACTGGCCGGCATTGCTGGGAGATGCCCCGGCCACCCGGGTGCTGGACCTTCCGACGTACGCGTTCCAGCACCAGC

[0244] Intermediate plasmid name: pAP0000X2

[0245] Restriction enzymes to construct the engineering plasmid: Xbal

[0246] Engineering plasmid name: pAP00130

[0247] Strain name: AS 98

[0248] Al was detected by LC-MS in the solid-state fermentation assay:

[0249] HPLC retention time: 0.997 min; LC-MS m / z [M + HCOO] calc. 944.5 for C5iH78NOi5, found 944.5.

[0250] Example X-2 was conducted to produce Al, the following fractions were collected:

[0251] Retention time = 10-11 min in Flash Step.

[0252] Retention time = 13-16 min in Prep Step.

[0253] 1 mg of Al was prepared as amorphous yellow solid.

[0254] Example X-4. Synthesis of A2.

[0255] (3R,6R,7E,9R, 1 OR, 12R, 14S, 15E, 17E, 19E,21 S,23S,26R,27R,34aS)-9,27-dihydroxy-3-(2-((lS,3R,4R)-4-hydroxy-3-methoxycyclohexyl)ethyl)-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27-epoxypyrido[2,l- c] [l]oxa[4]azacyclohentriacontine-l,5,l 1,28,29(4H,6H,3 lH)-pentaone.

[0256] Templates and primers used:Target Template Fragme Primers fragment ntLengthLeft Arm .S', rapamycinicus 2 kb atl left F ACCATGATTACGCCTCTAGAG genomic DNA GGTCGACACGGCGGTCTGT atl left R ATGACGTGGGCGTTCGTACCGCTGACCCCGAAGGCCGACARight Arm .S', rapamycinicus 2 kb atl right F CGGCCACCCGGGTGCTGGACC genomic DNA TTCCGACGTACGCGTTCCA atl right R AAACGACGGCCAGTTCTAGAAAGGTTTCCTGGAAACTCAGTGTG pUC19 pUC19 2.6 kb atl-pUC19_F TTCCAGGAAACCTTTCTAGAA vector CTGGCCGTCGTTTTACAAC atl -p UC19 R CGCCGTGTCGACCCTCTAGAGGCGTAATCATGGTCATAGCAT pAP00130 1.2 kb atl-at8 F TGTCGGCCTTCGGGGTCAGCGGTACGAACGCCCACGTCATCCTG all -at 8 R TGGAACGCGTACGTCGGAAGGTCCAGCACCCGGGTGGCCG

[0257] Intermediate plasmid name: pAP0000X3

[0258] Restriction enzymes to construct the engineering plasmid: Xbal

[0259] Engineering plasmid name: pAPOOl 16

[0260] Strain name: AS_3

[0261] A2 was detected by LC-MS in the solid-state fermentation assay:

[0262] HPLC retention time: 0.987 min; LC-MS m / z [M + HCOO] calc. 944.5 for C5iH78NOi5, found 944.5.

[0263] Example X-2 was conducted to produce A2, the following fractions were collected:

[0264] Retention time = 12-13 min in Flash Step.

[0265] Retention time = 11-15 min in Prep Step A.

[0266] 1 mg of A2 was prepared as amorphous yellow solid.

[0267] Example X-5. Synthesis of A3.

[0268] (3 S,7E,9R, 1 OR, 12R, 14 S, 15E, 17E, 19E,21 S,23 S,26R,27R,34aS)-9,27-dihydroxy-3 -( (R) - 1 - ((lS,3R,4R)-4-hydroxy-3-methoxycyclohexyl)propan-2-yl)-10,21-dimethoxy-8,12,14,20,26- pentamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27- epoxypyrido [2 , 1 -c]

[0001] oxa[4] azacyclohentriacontine -1,5,11,28 ,29(4H,6H, 31 H) -pentaone .

[0269] Templates and primers used:Target Template FragmePrimers fragme nt nt LengthLeft S. 2 kb pAP00018 L F TACCCGGGGATCCTTCTAGATGGATGACGGTGTArm rapamycini TGTGGAGcus pAP00009 AT3 ATGACGTGGGCGTTCGTACCGCTGACTCCGAAG genomic L R GACGACADNARight .S' 2 kb pAP00009 AT3 CGGCCACCCGGGTGCTGGACCTTCCGACCTACGArm rapcimycini R F CCTTCCA cus pAP00009 AT3 CCTGCAGGTCGACTTCTAGACGGTAGTGTTCAG genomic R R GAACGCTDNA pUC19 pUC19 2.6 kb pAP 00009 _19 F CCTGAACACTACCGTCTAGAAGTCGACCTGCAG vector GCATGCA pAPOOOl 8 19 R AACACCGTCATCCATCTAGAAGGATCCCCGGGT ACCGAGCAT pAP00116 1.2 kb pAP00009 _AT8 TGTCGTC CTTCGGAGTCAGCGGTACGAACGC CCF ACGTCATCC pAP00009 _AT8 TGGAAGGCGTAGGTCGGAAGGTCC AGC ACC CGGR GTGGCCG

[0270] Intermediate plasmid name: pAPOOOl 8.

[0271] Restriction enzyme to construct the engineering plasmid: Xbal.

[0272] Engineering plasmid name: pAPOOOlO

[0273] Strain name: AS_73

[0274] A3 was detected by LC-MS in the solid-state fermentation assay:

[0275] HPLC retention time: 0.936 min; LC-MS m / z [M + HCOO] calc. 944.5 for C5iH78NOi5, found 944.6.

[0276] Example X-2 was conducted to produce A3, the following fractions were collected:

[0277] Retention time = 11.1-13.1 min in Flash Step .

[0278] Retention time = 20.2-24.3 min in Prep Step.

[0279] 12.8 mg of A3 was prepared as amorphous yellow solid.

[0280] Example X-6. Synthesis of A4.

[0281] (3 S,6R,7E,9R, 10R, 12R, 14S, 15E, 17E, 19E,21 S,23 S,26R,27R,34aS)-9,27-dihydroxy-3-((R)- 1 -(( 1 S,3R,4R)-4-hydroxy-3-methoxycyclohexyl)propan-2-yl)-10,2 l-dimethoxy-6,8, 12, 14, 18,26-hexamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27- epoxypyrido [2 , 1 -c]

[0001] oxa[4] azacyclohentriacontine -1,5,11,28 ,29(4H,6H, 31 H) -pentaone .

[0282] Example X-l, with slight modifications, was conducted to generate the strain to produce (3 S,6R,7E,9R, 10R, 12R, 14S, 15E, 17E, 19E,21 S,23 S,26R,27R,34aS)-9,27-dihydroxy-3-((R)- 1 - (( 1 S,3R,4R)-4-hydroxy-3-methoxycyclohexyl)propan-2-yl)-10,2 l-dimethoxy-6,8, 12, 14, 18,26- hexamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27- epoxypyrido [2 , 1 -c]

[0001] oxa[4] azacyclohentriacontine -1,5,11,28 ,29(4H,6H, 31 H) -pentaone . AS_79 was used as the acceptor Streptomyces in the conjugation. To screen the candidate producer using the solid-state fermentation assay, the strains that didn’t produce A9 but produced a rapamycin analog were picked up.

[0283] Templates and primers used:Target Template Fragme Primers fragment ntLengthLeft Arm .S', rapamycinicus 2 kb pRP00038_L_F tacccggggatccttctagaacacggtactgcgg genomic DNA cccaag pAP00038 L R ATGACGTGGGCGTTGGTGCCac tgactccgaaggacgacacgRight Arm .S', rapamycinicus 2 kb pAP00038 R F CCACCACCCGCGTCCTGGACctt genomic DNA ccgacgtacgccttccagcagca pAP00038 R R cctgcaggtcgacttctagacgcaggccaccgc gccggat pUC19 pUC19 2.7 kb pAP00038_19_F cgcggtggcctgcgtctagaagtcgacctgcag vector gcatgca pRP00038 _19 R ccgcagtaccgtgttctagaaggatccccgggta ccgagcAT pAP00021 1.3 kb pAP00038_AT13 tgtcgtccttcggagtcagtGGCACCAACF GCCCACGTCAT pAP00038_ATl 3 tggaaggcgtacgtcggaagGTCCAGGAR CGCGGGTGGTGG

[0284] pAP00021 contains the following DNA sequence:

[0285] GGCACCAACGCCCACGTCCTGCTGGAAGCCCACCCGGCCGGGGAGCCGCCGGCCGAGGAGCCGTCGGCCTCGAAGCCCGGTGAGCCGCTGATCGCCACGCCGCTCACACCACTGCCCGTCTCGGCGCGGACCGCCACGGCCCTCGACGGCCAGGTCCGCCGACTCCGCGAGCACCTCGCCGCCCGTCCCGGCCACGACCCGCGCGCCATCGCCGCGGGCCTGCTCGCCAGGCGTACGACGTTCCCGCACCGCGCCGTGCTGCTCGACGACGACGTCGTCACCGGCACGGCGCTCACCGAGCCGCGCACCGTCTTCGTCTTCCCCGGACAAGGACCGCAGTGGCGCGGCATGGGCGTCGAACTGATGGCGGCCTCCCCGGTGTTCGCCGCCAGGATGCGCCAATGCGCCGACGCGCTGATCCCGCACACGGGCTGGGACCCCATCGCCATGCTCGACGACCCGGAGGTGACCCGCCGCGTCGACGTCGTGCACCCCGTCTGCTGGGCCGTCATGGTGTCGCTGGCCGCCGTGTGGGAGGCCGCGGGCGTACGCCCGGACGCCGTCATCGGACACTCCCAGGGCGAGATCGCCGCGGCCTGTGTCGCCGGAGCGCTCACCCTGGAGGACGGTGCCCGCCTCGTCGCGCTGCGCAGCGCCCTGCTCCTGCGCGAACTCGCCGGACGCGGCGCGATGGGCTCGGTCGCGCTCCCGGCCGCCGACGTCGAGGCGGATGCCGCCCGGATCGACGGCGTCTGGGTCGCGGGCCGCAACGGCGCCACCACCACGACCGTCGCCGGGCGCCCGGACGCCGTCGAAACGCTGATCGCCGACTACGAGGCCCGCGGCGTCTGGGTGCGCCGCATCGCCGTCGACTGCCCGACCCA CACCCCGTTCGTCGACCCGCTGTACGACGAACTCCAGCGGATCGTCGCGGACACCACCTCGCGCACGCCCGAGATCCCGTGGTTCTCCACCGCCGACGAACGCTGGATCGACGCGCCGCTCGACGACGAGTACTGGTTCCGCAACATGCGCCACCCCGTAGGCTTCGCCACGGCCGTGACCGCTGCCCGCGAGCCGGGTGACACCGTGTTCGTCGAGGTCAGCGCGCACCCCGTGCTGCTGCCCGCGATCGACGGCGCGACCGTCGCCACGCTCCGCCGCGGCGGGGGAGTCCACCGGCTGCTCACCGCGCTGGCCGAGGCGCACACAACCGGCGTGCCCGTCGACTGGGCGGCGGTCGTCCCCGCGACGGCGACGGCACACGAC

[0286] Intermediate plasmid name: pAP00038

[0287] Restriction enzymes to construct the engineering plasmid: Xbal

[0288] Engineering plasmid name: pAP00047

[0289] Strain name: AS_154

[0290] A4 was detected by LC-MS in the solid-state fermentation assay:

[0291] HPLC retention time: 0.885 min; LC-MS m / z [M + HCOO] calc. 958.6 for C52H80NOi5, found 958.6.

[0292] Example X-2 was conducted to produce A4, the following fractions were collected:

[0293] Retention time = 10-12 min in Flash Step.

[0294] Retention time = 17-20 min in Prep Step.

[0295] 56.4 mg of A4 was prepared as amorphous yellow solid.

[0296] Example X-7 - Synthesis of A9.

[0297] (3 S,6R,7E,9R, 10R, 12R, 14S, 15E, 17E, 19E,21 S,23 S,26R,27R,34aS)-9,27-dihydroxy-3-((R)- 1 - ((lS,3R,4R)-4-hydroxy-3-methoxycyclohexyl)propan-2-yl)-10,21-dimethoxy-6,8,12,14,26- pentamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27- epoxypyrido [2 , 1 -c]

[0001] oxa[4] azacyclohentriacontine -1,5,11,28 ,29(4H,6H, 31 H) -pentaone .

[0298] Example X-l was conducted to generate the strain to produce(3 S,6R,7E,9R, 10R, 12R, 14S, 15E, 17E, 19E,21 S,23 S,26R,27R,34aS)-9,27-dihydroxy-3-((R)- 1 - ((lS,3R,4R)-4-hydroxy-3-methoxycyclohexyl)propan-2-yl)-10,21-dimethoxy-6,8,12,14,26- pentamethyl-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-hexadecahydro-3H-23,27- epoxypyrido [2 , 1 -c]

[0001] oxa[4] azacyclohentriacontine -1,5,11,28 ,29(4H,6H, 31 H) -pentaone .

[0299] Templates and primers used:Target Template Fragme Primers fragment ntLengthLeft Arm .S'. rapamycinicus 2.5 kb pRP00020 L F gctcggtacccggggatcctTCTAGAcgtc genomic DNA ctggtcgagagtgatg pAPOOOl 3 L R ATGACGTGGGCGTTCGTACCac tgatcccgaacgacgacacacRight Arm .S'. rapamycinicus 2 kb pAPOOOl 3 R F CGGCCACCCGGGTGCTGGACct genomic DNA tccgacgtacgcgttccagcacc pAPOOOl 3 R R cctgcaggtcgactTCTAGAcgcagcccgc tgcgccggat pUC19 pUC19 2.7 kb pAP00013_19_F cgcagcgggctgcgTCTAGAagtcgacct vector gcaggcatgca pRP00020 19 R catcactctcgaccaggacgTCTAGAagga tccccgggtaccgagcAT pAP00130 1.2 kb pAPOOO 13 AT8 tgtcgtcgttcgggatcagtGGTACGAACF GCCCACGTCATCCpAPOOOl 3_AT8_ tggaacgcgtacgtcggaagGTCC AGC AR CCCGGGTGGCCG

[0300] Intermediate plasmid name: pAP00020

[0301] Restriction enzymes to construct the engineering plasmid: Xbal

[0302] Engineering plasmid name: pAP00014

[0303] Strain name: AS_79

[0304] A9 was detected by LC-MS in the solid-state fermentation assay:

[0305] HPLC retention time: 0.883 min; LC-MS m / z: [M + HCOO] calc. 944.5 for C5iH78NOi5, found 944.6.

[0306] Example X-2 was conducted to produce A9, the following fractions were collected:

[0307] Retention time = 11.1-13.1 min in Flash Step .

[0308] Retention time = 12-13 min in Prep Step A.

[0309] 38.3 mg of A9 was prepared as amorphous yellow solid.

[0310] Example X-8. Synthesis of any C27-O-desmethyl rapamycin analog.

[0311] The methyl transferase enzyme named RapQ is responsible for installing a methyl group at the oxygen linked to carbon 27 in the rapamycin molecule. Plasmid pAP00161 was constructed to remove approximately 35% of the RapQ coding sequence from the genome. Streptomyces rapamycinicus strains edited with this plasmid produced rapamycin analogs desmethylated at the 27- O position.Target Template Fragment Primers fragment Length.S'. Ill gcgccctttcgcacatcgacgtgttcLeft Arm rapamycinicus 2.021 kb ctggtggaccggctgaaagagaacggenomic D A.S'. 112 tctttcagccggtccaccagcagtacgtcgtaggggtgaccctgRight rapamycinicus 2.138 kb CgcgcgcggccgcggatcctcaagctgcgcagggccggcgtgtcArm 113 genomic DNALinear 335 aggatccgcggccgcgcgcgatat pKC1139 6.573 kb vector 336 ctagagtcgacctgcagcccaagc

[0312] Plasmid was constructed with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA).

[0313] Example X-9. Synthesis of any C27-O-desmethyl rapamycin analog.

[0314] The methyl transferase enzyme named RapM is responsible for installing a methyl group at the oxygen linked to carbon 16 in the rapamycin molecule. Plasmid pAP00162 was constructed to remove approximately 35% of the RapM coding sequence from the genome. Streptomyces rapamycinicus strains edited with this plasmid produced rapamycin analogs desmethylated at the 16- O position.Target Template Fragment Primers fragment LengthS. 118 gggctgcaggtcgactctagtcgccgggtcgatcccacgggcgtcLeft Arm rapamycinicus 2.289 kb ccggcgcaccgcggccggaaggtcgcgcagggccaggtag120 genomic DNARight S. 119 gccgcggtgcgccggcggatgArm rapamycinicus 232 kb cgcgcgcggccgcggatcctctggaattgtgcggcgggaccggenomic DNALinear 335 aggatccgcggccgcgcgcgatat pKC1139 6.573 kb vector 336 ctagagtcgacctgcagcccaagc

[0315] Plasmid was constructed with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA).

[0316] Example X-10. Synthesis of any C39- -desmethyl rapamycin analog.

[0317] The methyl transferase enzyme named RapI is responsible for installing a methyl group at the oxygen linked to carbon 39 in the rapamycin molecule. Plasmid pAP00160 was constructed to remove about 35% of the RapI coding sequence from the genome. Streptomyces rapamycinicus strains edited with this plasmid produced rapamycin analogs desmethylated at the 39-0 position.Target Template Fragment Primers fragment LengthLeft Arm S. rapamycinicus 2.235 kb 117 gggctgcaggtcgactctaggccgcgcgtaccggctggcatacc genomic DNA 116 gggatcgacgcggccgactggccgRight S. rapamycinicus 2.165 kb 115 cggccgcgtcgatccccatgccgatgttcgcgccgacgtcArm genomic DNA 114 cgcgcgcggccgcggatcctgagtcgggcagccatgatggcgtcLinear 335 aggatccgcggccgcgcgcgatat pKC1139 6.573 kb vector 336 ctagagtcgacctgcagcccaagc

[0318] Plasmid was constructed with NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA).

[0319] Example X-l 1. Cloning, overexpression, and purification of FRB.

[0320] FRB was overexpressed and purified according to the method described previously with modifications 2. To construct the expression plasmid, the primer pair frb_pGEX_4T_3_F / frb_pGEX_4T_3_R was used to amplify the backbone fragment from pGEX-4T- 3. The resulting 5-kb fragment was assembled with the synthesized gBlock fragment, frb, to afford pAB104. After validating the sequence of its insertion, pAB104 was transformed into E. coli BL21(DE3) to overexpress GST tagged FRB. A single colony was picked to grow overnight at 37° C in a 25 mb LB medium containing carbenicillin. The overnight culture was then inoculated (1: 100 v / v) into 800 mb of LB medium containing carbenicillin. The culture was grown at 37 °C until OD600 reached 0.6 and then cooled down on ice for 30 min. Isopropyl- -D-thiogalactopyranoside (IPTG, 0.3 mM final concentration) was added in the culture to induce the recombinant protein overexpression for 20 h at 18 °C, and the cells were harvested by centrifugation (5,000 g, 10 min, 4° C). To purify FRB, the harvested cells were resuspended in 30 mL PBS buffer (GE Healthcare, IL), and lysed by sonication on ice. After configuration (20,000 g, 30 min, 4° C) to remove cellular debris, the supernatant was transferred to a new falcon tube. 1 mL Pierce™ Glutathione Agarose (Thermo Fisher Scientific, MA) was washed by PBS buffer and added into the supernatant and mixed for 1 hour at 4° C. The mixture was then loaded onto a Biorad disposable column, and the resin was washed with 40 mL PBS buffer. After eluting the protein with 50 mM Tris-HCl, 10 mM glutathione (Thermo Fisher Scientific, MA), pH 7.5, buffer exchange was conducted using PD-10 Desalting Column (GE Healthcare, IL) to cleavage buffer (50 mM Tris-HCl, 100 mM NaCl, 10 mM CaC12, pH 8.0). The purity of the GST tagged protein was checked by SDS-PAGE (on 8-16% Mini-PROTEAN® TGX™ Precast Gels, Bio-Rad, CA), and its concentration was determined by the absorbance at 280 nm. 5 mg of the purified GST tagged FRB was taken and diluted using cleavage buffer to 2.5 mL, then 250 |1L thrombin agarose, from Thrombin CleanCleave™ Kit (MilliporeSigma, MA) and prewashed by cleavage buffer, was added. The mixture was incubated at 4° C for 16 h with gentle agitation to keep beads suspended, and then loaded onto a Biorad disposable column. The flow- through was collected, and 0.5 ml PBS washed glutathione agarose was added. The mixture was incubated at 4° C for 2 h with gentle agitation, and then loaded onto a Biorad disposable column. The flow-through was collected and subject to SEC using a Superdex 75 Increase 5 / 150 GL column (GE Healthcare, IL), run with PBS buffer at a flow rate of 0.4 mL / min. The fractions containing FRB (checked by SDS-PAGE) were pooled and concentrated using a 3 kDa MWCO amicon Ultra filter (MilliporeSigma, MA) to 0.1 mg / mL. The protein solution was aliquoted, flash-frozen in liquid nitrogen, and stored at -80° C.

[0321] Example X-12. Cloning, overexpression, and purification of Dual-His FKBP12.

[0322] To construct the expression plasmid, the primer pair pAPOOl 63 R BR / pAPOOl 63 R BE was used to amplify the backbone fragment from pAPOOl 58 (sequence attached). The resulting 5.6-kb fragment was assembled with the synthesized gBlock fragment, dualhis (sequence attached), to afford pAPOOl 63. After validating the sequence of its insertion, pAPOOl 63 was transformed into E. coli BL21(DE3) to overexpress Dual-His tagged FKBP12. A single colony was picked to grow overnight at 37 °C in 2 mb LB medium containing kanamycin (50 mg / L). The overnight culture was then inoculated (1: 100 v / v) into 75 mb of TB medium containing kanamycin. The culture was grown at 37 °C until OD600 reached 0.6 and then cooled down on ice for 30 min. Isopropyl- -D- thiogalactopyranoside (IPTG, 0. 1 mM final concentration) was added in the culture to induce the recombinant protein overexpression for 20 h at 18°C, and the cells in 50 mb medium were harvested by centrifugation (5,000 g, 10 min, 4 °C). To purify Dual-His FKBP12, the harvested cells were lysed by 4 mb B-PER™ Bacterial Protein Extraction Reagent (Thermo Fisher Scientific, MA) at room temperature for 30 min, then 10 mb Binding buffer (50 mM sodium phosphate, 300 mM NaCl, pH 7.4) was added. After configuration (12,000 g, 30 min, 4°C) to remove cellular debris, the supernatant was transferred to a new falcon tube. 2 mb TALON® Superflow™ histidine-tagged protein purification resin (Cytiva, MA) was washed by Binding buffer and added into the supernatant and mixed for 0.5 hour at 4°C. The mixture was then loaded onto a Biorad disposable column, and the resin was washed with 5 mb Wash buffer (50 mM sodium phosphate, 300 mM NaCl 1, 5 mM imidazole, pH 7.4) 3 times. The target protein was eluted using elution buffer with increasing imidazole concentrations (50 mM sodium phosphate, 300 mM NaCl 1, 150 mM / 300mM / 500 mM imidazole, pH 7.4). The eluting fractions were analyzed by SDS-PAGE (Novex™ Tris-Glycine Mini Protein Gels, 4-20%, ThermoFisher, MA), and the fractions containing Dual-his tagged FKBP12 were pooled. Buffer exchange was conducted using PD-10 Desalting Column (Cytiva, MA) to storage buffer (50 mM HEPES, 300 mM NaCl, 1 mM TCEP, 10% glycerol, pH 7.5). The protein was concentrated using a 3 kDa MWCO amicon Ultra filter (Millipore Sigma, MA) to 5.2 mg / mL, determined by Bradford assay (Pierce™ Bradford Plus Protein Assay Kits, ThermoFisher, MA). The protein solution was aliquoted and stored at -80 °C.

[0323] >pAP00158

[0324] GGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACA AGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATA GGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGA GGATCGAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGG ATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGGGGTTCAAGTTGAAACTATTAGTCCTGGTGATGGTCGTACTTTTCCGAAACGCGGCCAGACTTGTGTGGTGCATTACACAGGAATGCTTGAGGATGGCAAAAAATTCGATAGTTCACGTGACCGCAATAAACCATTCAAGTTCATGCTTGGTAAACAGGAAGTTATCAGAGGGTGGGAAGAAGGCGTCGCGCAGATGTCGGTGGGCCAGCGTGCCAAACTTACCATATCTCCTGACTATGCATATGGAGCTACCGGGCACCCCGGAATTATCCCGCCGCATGCGACCCTGGTCTTTGATGTCGAACTGCTGAAATTAGAGGGATCCGGCTCTGGAAGTGGACTGAATGATATATTTGAAGCCCAAAAAATTGAATGGCATGAATAACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTT CCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCAATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTT TGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCGCCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGGACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGAT

[0325] dualhis

[0326] CGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCACCACCATCACCATCACCATCACAGCCGCGCGTGGCGCCATCCGCAGTTTGGCGGCCACCATCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGGGGTTCAAGTTGAAAC

[0327] Example X-13. SPR assays of the binding kinetics of rapamycin analogs to FKBP12.

[0328] SPR assays were conducted with a Biacore S200 system (Cytiva, MA). Multi-cycle kinetics was performed to assay the binding kinetics of rapamycin analogs to FKBP12. All buffers were filtered through 0.2 pm filter units. The assays were performed at 25°C. HBSN (Cytiva, MA) supplemented with 0.005% Tween-20, 50 pM EDTA, and 2% DMSO was used as the running buffer for all cycles. To Perform the multi-cycle kinetics assays, a Series S NTA chip (Cytiva, MA) was docked, and the system was primed and normalized. Two tandem flow cells were used in which the first flow cell was used as the reference. The multi-cycle kinetics assay begins with one conditioning cycle, two startup cycles, and followed by sample cycles. Solvent correction cycles were conducted before and every 50 sample cycles, and blank cycles were conducted before, after, and every fivesample cycles. For the condition cycle, regeneration buffer (350 mM EDTA, 6 M urea, and 50 mM NaOH) was injected at a flow rate of 30 pL / min for 150 s on both flow cells, extra wash after injection was conducted with running buffer, and the surface was stabilized for 120s after injections. For the startup, sample, and blank cycles, the following procedure was performed: to prepare the reference cell (the first cell) and the FKBP12 immobilized cell (the second cell), first, the nickel solution from NTA Reagent Kit (Cytiva, MA) was injected at a flow rate of 5 pL / min 60s on the second flow cell, and extra wash after injection was conducted using running buffer supplemented with 3 mM EDTA, the surface was then stabilized for 30 s. Then, the injection needle is Predip in 50 nM Dual -His FKBP12, diluted in the running buffer, and the Dual -His FKBP12 buffer was injected at a flow rate of 10 pL / min for 40 s on the second flow cell. The surface was then stabilized for 60 s. After that, a blank inject was conducted by injecting running buffer at 50 pL / min for 300 s on both flow cells, after a needle predip in the running buffer. To inject samples (running buffer for blank and start cycles, 0.625 nM, 1.25 nM, 2.5 nM, 5 nM, and 10 nM for rapamycin analogs in running buffer), the injection was in high performance model and the flow rate was 50 pL / min on both flow cells. Contact time was 300 s, with Dissociate time set at 600 s. After sample injection and dissociation, extra wash was conducted with 50% DMSO, as well as Carry-over control. After that, a 150-s injection of the regeneration solution was conducted at a flow rate of 30 pL / min for both flow cells, followed by an extra wash with the running buffer and a 120-s stabilization period. For the solve correction cycles, 8-point solvent correction was conducted, from 1.5% to 2.8% DMSO in the running buffer, according to Cytiva’ s technocal note, on the same prepared cells as the sample cycles, followed by the same regeneration injection.

[0329] The data analysis was performed using Biacore S200 Evaluation Software (vl.1.1). The solvent corrected response curves of the active flow cell minus the reference cell were used. The blank subtracted rapamycin analogs titration curves were fitted to the 1: 1 binding model using the kinetics evaluation.

[0330] Example X-14. SPR assays of the binding kinetics of FRB to FKBP12- rapamycin analogs complexes.

[0331] Multi -cycle kinetics was performed to assay the binding kinetics of FRB to FKBP12- rapamycin analogs complexes. All buffers were filtered through 0.2 pm filter units. The assays were performed at 25°C. HBSN (Cytiva, MA) supplemented with 0.005% Tween-20, 50 pM EDTA, and 2% DMSO was used as the running buffer for all cycles. To Perform the multi -cycle kinetics assays, a Series S NTA chip (Cytiva, MA) was docked, and the system was primed and normalized. Two tandem flow cells were used in which the first flow cell was used as the reference. The multi -cycle kinetics assay begins with one conditioning cycle, three startup cycles, and followed by sample cycles. Solvent correction cycles were conducted before and every 50 sample cycles, and blank cycles were conducted before, after, and every six sample cycles. For the condition cycle, regenerationbuffer (350 mM EDTA, 6 M urea, and 50 mM NaOH) was injected at a flow rate of 30 pL / min for 150 s on both flow cells. For the startup, sample, and blank cycles, the following procedure was performed: to prepare the reference cell (the first cell) and the FKBP12 immobilized cell (the second cell), first, the nickel solution from NTA Reagent Kit (Cytiva, MA) was injected at a flow rate of 5 pL / min 60s on the second flow cell, and extra wash after injection was conducted using running buffer supplemented with 3 mM EDTA, the surface was then stabilized for 30 s. Then, the injection needle is Predip in 50 nM Dual-His FKBP12, diluted in the running buffer, and the Dual-His FKBP12 buffer was injected at a flow rate of 10 pL / min for 15 s on the second flow cell. The surface was then stabilized for 60 s. For sample injection, A-B-A model was used to generate small compound containing running buffer (flanking buffer, 50 nM rapamycin analogs in the running buffer) environment 120-s before and 120-s after the injection of FRB sample, prepared in the flanking buffer, at a flow rate of 50 pL / min for 60s. The injected FRB sample concentrations are 0 nM, 8 nM, 16 nM, 32 nM, 64 nM, and 128 nM, on both flow cells. After sample injection and dissociation, extra wash was conducted with 50% DMSO, as well as Carry-over control. After that, a 150-s injection of the regeneration solution was conducted at a flow rate of 30 pL / min for both flow cells, followed by an extra wash with the running buffer and a 120-s stabilization period. For the solve correction cycles, 8-point solvent correction was conducted, from 1.5% to 2.8% DMSO in the running buffer, according to Cytiva’s technocal note, on the same prepared cells as the sample cycles, followed by the same regeneration injection.

[0332] The data analysis was performed using Biacore S200 Evaluation Software (vl.1.1). The solvent corrected response curves of the active flow cell minus the reference cell were used. The blank subtracted FRB titration curves were fitted to the 1: 1 binding model using the kinetics evaluation.Binding Affinity: FKBP12-Compound: +++, <10 nM; ++, >10 nM and <50 nM; +, > 50 nMBinding Affinity: FKBP12-Compound-FRB: +++, < 50 nM; ++, > 50 nM and < 200 nM; +, >200 nM

[0333] Example X- 15. Synthesis of A 1 -PEG2 -propargyl .To a solution of Al (500 mg, 0.56 mmol, 1 eq.) and DIEA (3.59 g, 27.79 mmol, 50 eq.) in toluene (20 mL) was added 2-(prop-2-yn-l-yloxy)ethyl trifluoromethanesulfonate (2.06 g, 8.89 mmol, 16 eq ). The mixture was stirred at 55°C for 3 h. The mixture was quenched with water (30 mL) and extracted with EtOAc (10 mLx3). The combined organic layers were washed with brine (10 mL), dried over Na2SC>4, fdtered and concentrated. Another 13 batches were carried out as the above. The residue was purified by prep-TLC (DCM / MeOH=20 / l) to afford Al-PEG2-propargyl (2.73 g, 50.1% yield) as a yellow solid. LCMS: m / z 1004.2 (M+Na)+.

[0334] Example X-16. Synthesis of A2-PEG2 -propargyl.Exact Mass: 899,54 Molecular Weight: 900.16Exact Mass: 981.58Molecular Weight: 982.26

[0335] To a solution of A2 (105 mg, 0.117 mmol, 1 eq) in toluene (1.2 mL) was added DIEA (1 mL, 5.8 mmol, 50 eq) and 2-(prop-2-yn-l-yloxy)ethyl trifluoromethanesulfonate (420 mg, 1.8 mmol, 16 eq). The mixture was stirred at 55°C for 3 h. TLC (Hexane-EtOAc 1:2) indicated that the starting material was consumed completely. The mixture was washed with water (10 mL) and extracted with EtOAc (5 mL x2). The organic layer was washed with brine (5 mL), dried over Na2SC>4, fdtered and concentrated. The crude material was dissolved in 500 pL MeCN and purified by HPLC, using reverse phase gradient method (50-100% MeCNTLO, Phenomenex Luna 10 pm PREP Phenyl-Hexyl 100 A, LC Column 250 x 21.2 mm, AXIA Packed, Plow Rate: 36 mL / min, Equilibration: 2.0 min, Run Length: 29.0 min) to afford the final product. (42 mg 37%). LCMS (ESI) m / z: [M+FA-H] calcd. for C56H84NOi6 1026.5790; found 1026.6.

[0336] Example X-17. Synthesis of A4-PEG2 -propargyl.

[0337] To a solution of A4 (208 mg, 0.228 mmol, 1 eq) in toluene (2 mL) was added DIEA (794 pL, 4.56 mmol, 20 eq) and 2-(prop-2-yn-l-yloxy)ethyl trifluoromethanesulfonate (529 mg, 2.28 mmol, 10 eq). The mixture was stirred at 55 °C for 3 h. The mixture was washed with water (6 mL) and extracted with EtOAc (lOmL x2). The organic layer was washed with brine (5 mL), dried over Na2SC>4 and concentrated. The crude mixture appeared orange in color. The crude was dissoleved in 1 mL of MeOH and purified by HPLC using reverse phase gradient method (50-100% MeCN-H2O, Phenomenex Luna 10 pm PREP Phenyl-Hexyl 100 A, LC Column 250 x 21.2 mm, AXIA Packed, Plow Rate: 36 mL / min, Equilibration: 2.0 min, Run Length: 29.0 min) Product formation was monitored by LC-MS. 150 mg total, 55%. LCMS (ESI) m / z: [M+FA-H] calcd for C yHseNOie 1041.3; found 1041.

[0338] Example X-18. Synthesis of A9-PEG2 -propargyl.

[0339] To a solution of A9 (188 mg, 0.209 mmol, 1 eq.) in toluene (2 mL) was added DIEA (1.5 mL, 8.4 mmol, 40 eq) and 2-(prop-2-yn-l-yloxy)ethyl trifluoromethanesulfonate (776 mg, 3.3 mmol, 16 eq.). The mixture was stirred at 55°C for 3 h. The mixture was washed with water (6 mL) and extracted with EtOAc (lOmL x2). The organic layer was washed with brine (5 mL), dried over Na2SO4 and concentrated. The crude was dissolved in 1 mL of MeOH and purified by HPLC using reverse phase gradient method (50-100% MeCN-H2O, Phenomenex Luna 10 pm PREP Phenyl-Hexyl 100 A, LC Column 250 x 21.2 mm, AXIA Packed, Plow Rate: 36 mL / min, Equilibration: 2.0 min, Run Length: 29.0 min (155 mg total, 75%). LCMS (ESI) m / z: [M+FA-H]- calcd. for C56H84NO16 1026.5; found 1026.6.

[0340] Example X-19. Synthesis of M-PEGlO-azide.

[0341] Step 1: tert-butyl (4-(4-amino-3-iodo-lH-pyrazolo[3,4-d]pyrimidin-l-yl)butyl)carbamate:Exact Mass; 432.08Molecular Weight: 432.27

[0342] To a suspension of 3-iodo-lH-pyrazolo[3,4-d]pyrimidin-4-amine (227 mg, 0.869 mmol, 1.0 eq) in DMF (0.8 mb) was added NaH (69 mg, 2.88 mmol, 60 wt.%, 2.0 eq) at 0°C. The mixture was stirred at 0°C for 30 min and then a solution of tert-butyl N-(4-bromobutyl)carbamate (263 mg, 1.043 mmol, 1.2 eq) in DMF (0.15 mb) was added. The mixture was stirred at room temperature for 14 h. The mixture was then added to H2O (2 mb), cooled to 0°C and stirred for 30 min. The resulting precipitate was collected by filtration to give the product as white solid, which was used directly in the next step. (160 mg, 43%).diglyme, H?0. 110 “C Exact Mass; 438.21Molecular Weight: 438.49

[0343] Step 2: tert-butyl (4-(4-amino-3-(2-aminobenzo[d]oxazol-5-yl)-lH-pyrazolo[3,4-d]pyrimidin 1 -yl)butyl)carbamate

[0344] To a bi-phasic suspension of tert-butyl (4-(4-amino-3-iodo-lH-pyrazolo[3,4-d]pyrimidin-l- yl)butyl)carbamate (122 mg, 0.282 mmol, 1.0 eq), 5-(4,4,5,5-tetramethyl-l,3,2-dioxaborolan-2- yl)benzo[d]oxazol-2-amine (110 mg, 0.423 mmol, 1.5 eq), and Na2CO3 (150 mg, 1.4 mmol, 5.0 eq) in l-methoxy-2-(2-methoxyethoxy)ethane (3 mb) and H2O (1.5 mb) was added Pd(PPh3)4 (35 mg, 0.03 mmol, 0.1 eq). The mixture was stirred at 110°C for 3 h. The reaction mixture was then cooled to room temperature and partitioned between EtOAc (20 mb) and H2O (10 mb). The aqueous layer was extracted with EtOAc and the combined organic layers were washed with brine, dried, and concentrated under reduced pressure. Purification by silica gel column chromatography (0-50% MeOH / EtOAc, Column: Biotage® Star HC Duo 10g, Flow Rate: 40 mL / min, Equilibration: 2.0 min, Run Length: 10.0 min) afforded the desired product (62 mg, 50% yield) as a light brown solid.Exact Mass: 438.21 Exact Mass: 338.16Molecular Weight: 438.49 Molecular Weight: 338.38

[0345] Step 3: 5-(4-amino-l-(4-aminobutyl)-lH-pyrazolo[3,4-d]pyrimidin-3-yl)benzo[d]oxazol-2- Amine

[0346] To TFA (0.340 mb, 4.4 mmol, 61.1 eq) was added tert-butyl (4-(4-amino-3-(2- aminobenzo[d]oxazol-5-yl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)butyl)carbamate (31.7 mg, 0.0723 mmol, 1.0 eq) at 0°C. The mixture was warmed to room temperature and stirred for 1 h. The solution was then concentrated under reduced pressure. The oily residue was triturated with MTBE (0.22 mL) and the precipitate was collected by filtration to afford the desired product (60 mg) as light brown solid, which was used directly in the next step.

[0347] Step 4: Azido-PEG 10 o-succinimide 2,5-dioxopyrrolidin-l-yl l-azido-3,6,9,12,15,18,21,24, 27,30-decaoxatritriacontan-33 -oate :

[0348] To a solution of 3-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-[2-(2- azidoethoxy)ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] ethoxy] propanoic acid (200mg, 0.311 mmol, leq) in dichloromethane (2 mL) were added 1- hydroxypyrrolidine-2,5-dione (79 mg, 0.684 mmol, 2.2 eq), 3-(ethyliminomethyleneamino)propyl- dimethyl-ammonium; chloride (107 mg, 0.56 mmol, 1.8 eq). The reaction mixture was stirred at room temperature overnight, diluted with dichloromethane, partitioned with a saturated aqueous solution of NaHCOs and extracted with dichloromethane. The combined organic layers were washed with brine, dried over Na2SC>4 and concentrated to colorless oil, which was used directly in the next step.

[0349] Step 5: M-PEGIO-Azide:

[0350] To a solution of 2,5-dioxopyrrolidin-l-yl l-azido-3,6,9,12,15,18,21,24,27,30- decaoxatritriacontan-33-oate (123 mg, 0.188 mmol, 1.2 eq) in DMF (3.2 mb) was added 5-(4-amino- l-(4-aminobutyl)-lH-pyrazolo[3,4-d]pyrimidin-3-yl)benzo[d]oxazol-2 -Amine (53 mg, 0.156 mmol, 1.0 eq) and EtsN (0.076 mb, 0.546 mmol, 3.5 eq). The reaction mixture was stirred at room temperature for 3 h and was then concentrated under reduced pressure. Purification by silica gel chromatography (0— >50% MeOH / DCM, Column: Biotage® Sfar HC Duo 10g, Flow Rate: 40 mL / min, Equilibration: 2.0 min, Run Length: 10.0 min) afforded the desired product (64 mg, 47% yield) as light brown residue. LCMS (ESI) m / z: [M+H]+calcd. for C39H63N11O12 877.4658; found 877.

[0351] The structure and purity of the final product M-PEGIO-Azide was confirmed by NMR and HR-MS analysis.

[0352] Example X-20. Synthesis of R-PEGlO-azide.

[0353] Step 1: Synthesis of tert-butyl 6-((4-amino-3-iodo-lH-pyrazolo[3,4-d]pyrimidin-l- yl)methyl)-3,4-dihydroisoquinoline-2(lH)-carboxylate

[0354] To a suspension of 3-iodo-lH-pyrazolo[3,4-d]pyrimidin-4-amine (182 mg, 0.697 mmol, 1.0 eq) in DMF (1.8 mL) was added NaH (27 mg, 0.697 mmol, 60 wt.%, 1.0 eq) at 0°C. The mixture was stirred at 0°C for 30 min and then a solution of tertbutyl6-(bromomethyl)-3,4-dihydroisoquinoline- 2(lH)-carboxylate (250 mg, 0.766 mmol, 1.1 eq) in DMF (1.2 mL) was added. The mixture was stirred at room temperature for 2 h. The mixture was then added to H2O (2 mL), cooled to 0°C and stirred for 30 min. The resulting precipitate was collected by filtration to give the product as white solid, which was used directly in the next step. (317 mg, 90%).

[0355] Step 2: Synthesis of tert-butyl 6-((4-amino-3-(2-aminobenzo[d]oxazol-5-yl)-lH-pyrazolo[3,4- d]pyrimidin- 1 -yl)methyl)-3,4-dihydroisoquinoline-2( 1H) -carboxylate

[0356] To a bi-phasic suspension of tert-butyl 6-((4-amino-3-iodo-lH-pyrazolo[3,4-d]pyrimidin-l- yl)methyl)-3,4-dihydroisoquinoline-2(lH)-carboxylate (317 mg, 0.626 mmol, 1.0 eq), 5-(4,4,5,5- tetramethyl-l,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2-amine (306mg, 1.176 mmol, 1.8 eq), and Na2COs (415 mg, 3.92 mmol, 6.0 eq) in l-methoxy-2-(2-methoxyethoxy)ethane (6 mb) and H2O (3 mL) was added Pd(PPh3)4 (91 mg, 0.07 mmol, 0. 1 eq). The mixture was stirred at 110°C for 3 h. The reaction mixture was then cooled to room temperature and partitioned between EtOAc (20 mL) and H2O (10 mL). The aqueous layer was extracted with EtOAc, and the combined organic layers were washed with brine, dried, and concentrated under reduced pressure. Purification by silica gel column chromatography (0-50% MeOH / EtOAc, Biotage® Sfar HC Duo 25g, Plow Rate: 80 mL / min,Equilibration: 2.0 min, Run Length: 10.0 min) afforded the desired product (287mg, 86% yield) as a light brown solid.Exact Mass: 412.18 Molecular Weight: 412.46

[0357] Step 3: Synthesis of 5-(4-amino-l-((l,2,3,4-tetrahydroisoquinolin-6-yl)methyl)- IHpyrazolo [3 ,4-d]pyramidin-3 -yl)benzo [d] oxazol-2 -amine

[0358] To TFA (0.6 mL, 8 mmol, 50 eq) was added tert-butyl 6-((4-amino-3-(2- aminobenzo[d]oxazol-5-yl)-lH-pyrazolo[3,4-d]pyrimidin-l-yl)methyl)-3,4-dihydroisoquinoline- 2(lH)-carboxylate (82 mg, 0.159 mmol, 1.0 eq.) at 0°C. The mixture was warmed to room temperature and stirred for 1 h. The solution was then concentrated under reduced pressure. The oily residue was triturated with MTBE (0.22 mL) and the precipitate was collected by filtration to afford the desired product (100 mg) as light brown solid, which was used directly in the next step.

[0359] Step 4: R-PEGIO-Azide:

[0360] To a stirred solution of 5-(4-amino-l-((l,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-lH- pyrazolo[3,4-d]pyrimidin-3-yl)benzo[d]oxazol-2-amine (1.8 g, 4.02 mmol, 1.0 eq.) , Azido-PEGIO- acid (2.23 g, 4.02 mmol, 1 eq.), HOBT (0.81 g, 6.02 mmol, 1.5 eq.) and TEA (1.2 g, 12.05 mmol, 1.5 eq.) in DMF (20 mL) was added EDCI (1.15 g, 6.02 mmol, 1.5 eq.). The mixture was stirred at 25°C for 2 h. The reaction mixture was concentrated. The crude product was purified by silica gel column (DCM / MeOH=100 / l~5 / l) to afford R-PEG10- Azide (2.5 g, 49.80% yield) as yellow oil.

[0361] LCMS: m / z 950.4 (M+H)+.'H-NMR (400 MHz, DMSO-de): 8 8.28 (s, 1H), 7.55 (s, 2H), 7.46 (d, J= 8.4 Hz, 1H), 7.39 (d, J = 1.2 Hz, 1H), 7.22 (dd, J= 8.0, 1.6 Hz, 1H), 7.13 (s, 3H), 5.49 (s, 2H), 4.62 (s, 1H), 4.54 (s, 1H), 3.67- 3.57 (m, 9H), 3.56-3.52 (m, 9H), 3.49-3.45 (m, 23H), 3.39 (dd, J= 9.6, 4.4 Hz, 5H), 2.83-2.78 (m, 1H), 2.73-2.67 (m, 1H), 2.63 (t, J= 6.8 Hz, 2H).

[0362] Example XX- 1. Synthesis of Compound 1.

[0363] Synthesis of Compound 1 via Click reaction

[0364] To a solution of A 1-PEG2 -propargyl (200 mg, 0.204 mmol, 1.0 eq.), TBTA (432.5 mg, 0.815 mmol, 4.0 eq.) and R-PEGIO-Azide (290.3 mg, 0.306 mmol, 1.5 eq.) in DMSO (6 mL) was added Cu(MeCN)4PFe (151.9 mg, 0.408 mmol, 2.0 eq.). The reaction mixture was stirred at 25°C for 3 h. Another 13 batches were carried out as the above. The mixture was concentrated under reduced pressure. The residue purified by prep-HPLC (60-95% MeCN-EEO, Excsep C18 21.2-250mm, Flow Rate: 15 mL / min, Equilibration: 2.0 min, Run Length: 17.0 min) to afford Compound 1 (1.9 g, 34.5% yield) as a white solid; LCMS: m / z 1931.9 (M+H)+; ’H-NMR (400 MHz, CD3OD): 8 8.28 (s, 1H), 8.01 (s, 1H), 7.47 (d, J= 28.4 Hz, 2H), 7.33 (d, J= 8.0 Hz, 1H), 7.22-7.08 (m, 3H), 6.50-6.36 (m, 1H), 6.34-6.12 (m, 2H), 6.11-5.93 (m, 1H), 5.82-5.63 (m, 1H), 5.55 (s, 2H), 5.38-5.21 (m, 1H), 5.18- 5.01 (m, 2H), 4.73 (s, 1H), 4.65 (s, 1H), 4.62 (s, 2H), 4.55 (t, J= 4.8 Hz, 2H), 4.25-4.14 (m, 1H), 4.12-4.03 (m, 1H), 3.96 (d, J= 5.2 Hz, 1H), 3.86 (t, J= 4.8 Hz, 2H), 3.79-3.69 (m, 6H), 3.65-3.61 (m, 2H), 3.59-3.46 (m, 34H), 3.35-3.33 (m, 8H), 3.29-3.24 (m, 3H), 3.17-3.09 (m, 4H), 3.08-3.02 (m, 1H), 2.89 (t, J= 5.2 Hz, 1H), 2.84-2.62 (m, 5H), 2.49 (dd, J= 17.6, 8.7Hz, 1H), 2.40-1.90 (m, 8H), 1.88-1.53 (m, 16H), 1.50-1.26 (m, 6H), 1.23-1.06 (m, 4H), 1.04-0.98 (m, 3H), 0.95 (d, J= 6.4 Hz, 2H), 0.91-0.82 (m, 6H), 0.78-0.69 (m, 1H).

[0365] Example XX-2. Synthesis of Compound 27.

[0366] Synthesis of Compound 27 via Click reaction

[0367] To a solution of A2-PEG2-propargyl (100.7 mg, 102.5 pmol, 1.0 eq) and R-PEGIO-Azide (151 mg, 158.7 pmol, 1.5 eq) in DMSO (10.2 mL) was added Cu(MeCN)4PFe Tetrakis(acetonitrile)copper(I) hexafluorophosphate (79 mg, 211 pmol, 2.0 eq) followed by Tris(benzyltriazolylmethyl)amine TBTA (224 mg, 423 pmol, 4.0 eq). The reaction mixture was then stirred at room temperature for 3 h. The reaction mixture was concentrated under reduced pressure. The crude was dissolved in 500 pL of MeOH and purified using reverse phase gradient method (50- 100% MeCN-FLO, Phenomenex Luna 10 pm C18(2) 100 A, LC Column 250 x 10 mm, Flow Rate: 8 mL / min, Equilibration: 2.0 min, Run Length: 29.0 min) afforded the desired product (29 mg, 15%) as a colorless amorphous solid. The structure and purity of the final product, Compound 27, was confirmed by NMR and HR-MS analysis.

[0368] ’H NMR (DMSO-d6) 8H: 6.41 (dd, 14.6, 11.1, 1H), 6.21 (m, 1H), 6.13 (m, 1H), 6.10 (m, 1H), 5.45 (dd, 14.9, 9.7, 1H), 5.15 (d, 9.9, 1H), 5.04 (m, 1H), 4.90 (bd, 4.7, 1H), 4.02 (d, 4.2, 1H), 4.00 (obs., 1H), 3.94 (d, 4.2, 1H), 3.63 (obs., 1H), 3.43 (obs., 1H), 3.30 (s, 3H), 3.25 (m, 1H), 3.16 (s, 3H), 3.16 (obs., 1H), 3.05 (s, 3H), 3.04 (obs., 1H), 2.94 (m, 1H), 2.72 (m, 1H), 2.59 (m, 1H), 2.39 (m, 1H), 2.22 (m, 1H), 2.05 (bd, 13.5, 1H), 2.00 (m, 1H), 1.93 (obs., 1H), 1.92 (obs., 1H), 1.88 (obs., 1H), 1.86 (obs., 1H), 1.69 (s, 3H), 1.65 (obs., 1H),1.64 (s, 3H), 1.60 (obs., 1H), 1.57 (obs., 1H), 1.55 (obs., 1H), 1.53 (obs., 2H),1.44 (obs., 2H), 1.39 (obs., 1H), 1.36 (obs., 1H), 1.29 (obs., 1H), 1.27 (obs., 1H), 1.17 (obs., 1H), 1.16 (obs., 1H), 1.12 (obs., 1H), 1.07 (obs., 1H), 1.07 (obs., 1H), 1.04 (m, 1H), 0.97 (d, 6.5, 3H), 0.90 (d, 6.6, 3H), 0.83 (d, 6.40, 3H), 0.80 (obs., 1H), 0.73 (d, 6.5, 3H), 0.71 (obs., 1H).

[0369] 13C NMR (DMSO-d6): SC 210.5, 207.6, 199.0, 169.6, 169.2, 167.1, 163.6, 158.2, 156.0,154.2, 148.4, 144.5, 144.4, 143.9, 139.4, 137.9, 137.0, 135.3, 134.9, 132.9, 132.5, 130.5, 128.4, 127.7, 127.1, 127.0, 126.6, 125.6, 124.6, 124.2, 120.5, 115.0, 108.9, 99.0, 97.3, 85.6, 82.7, 82.3, 82.2, 75.7, 70.8, 69.6, 69.5, 69.4, 68.7, 68.6, 66.7, 66.2, 63.5, 57.0, 56.9, 55.5, 50.9, 49.5, 49.3, 44.9, 44.3, 43.6, 43.3, 40.3, 39.8, 39.5, 38.9, 36.4, 35.2, 35.1, 34.9, 33.4, 31.6, 31.1, 30.1, 29.9, 29.8, 28.0, 26.4, 26.2, 24.3, 21.7, 20.3, 16.0, 15.6, 13.5, 13.3, 10.5.

[0370] Example XX-3. Synthesis of Compound 79.

[0372] To a solution of A4-PEG2-propargyl (103.6 mg, 104 pmol, 1.0 eq) and R-PEG10- Azide (198 mg, 208 pmol, 2.0 eq) in in DMSO (2.0 mL) was added Cu(MeCN)4PFe (77.5 mg, 208 pmol, 2.0 eq) followed by TBTA (220.7 mg, 416 pmol, 4.0 eq). The reaction mixture was then stirred at room temperature for 3 h. The reaction mixture was concentrated under reduced pressure, by reverse phase gradient method (50-100% MeCN-H2O, Phenomenex Luna 10 pm C18(2) 100 A, LC Column 250 x 10 mm, Flow Rate: 8 mL / min, Equilibration: 2.0 min, Run Length: 29.0 min) afforded the desired product (43 mg, 22 % yield) as a colorless amorphous solid.

[0373] 'HNMR (DMSO-d6) 8H: 4.95 (bd, 5.0, 1H), 2.12 (m, 1H), 1.57 (obs., 1H), 1.66 (obs., 1H), 1.38 (obs., 1H), 1.54 (obs., 1H), 1.28 (obs., 1H), 3.42 (obs., 1H), 3.10 (obs., 1H), 2.03 (m, 1H), 1.53(obs., 2H), 1.77 (obs., 1H), 1.19 (obs., 1H), 4.04 (obs., 1H), 1.77 (obs., 1H), 1.35 (obs., 1H), 3.71 (m, 1H), 5.49 (obs., 1H), 6.34 (d, 15.5, 1H), 6.08 (d, 11.1, 1H), 6.39 (dd, 14.8, 11.1, 1H), 5.51 (obs., 1H),2.31 (m, 1H), 1.39 (obs., 1H), 1.04 (obs., 1H), 2.36 (obs., 1H), , 3.97 (d, 4.3, 1H), 4.02 (d, 4.3, 1H), , 5.12 (d, 10.1, 1H), 3.24 (m, 1H), 2.74 (m, 1H), 2.42 (m, 1H), 4.99 (m, 1H), 1.68 (obs., 2H), 1.04 (obs., 1H), 0.96 (obs., 1H), 1.25 (obs., 1H), 1.90 (obs., 1H), 0.62 (obs., 1H), 2.96 (m, 1H), 3.03 (obs., 1H), 1.92 (obs., 1H), 1.10 (obs., 1H), 1.54 (obs., 1H), 0.82 (obs., 1H), 0.73 (d, 6.5, 3H), 1.79 (s, 3H), 0.98 (d, 6.6, 3H), 0.81 (d, 6.40, 3H), 1.75 (s, 3H), 0.81 (d, 6.4, 3H), 0.78 (d, 6.8, 3H), 3.12 (s, 3H), 3.15 (s, 3H), 3.31 (s, 3H), 3.61 (m, 2H), 3.51 (m, 2H), 4.51 (obs., 2H), , 8.02 (s, 1H), 4.50 (m, 2H), 3.80 (t, 5.2, 2H), 3.50 (obs., 2H), 3.40-3.50 (bm, 2H), 3.63 (obs., 2H), 2.62 (m, 2H), 4.54, 4.61 (bs, 2H), 7.12 (broad overlap), 7.12 (broad overlap), 7.12 (broad overlap), 2.80-2.70 (m, 2H), 3.61-3.63 (m, 2H), 5.49 (bs, 2H), 8.27 (s, 1H), 7.22 (dd, 8.1, 1.7, 1H), 7.45 (d, 8.1, 1H), 7.52 (bs, 1H), 7.39 (d,1.7, 1H).

[0374] 13C NMR (DMSO-d6): 8C 198.8, 169.3, 169.2, 169.3, 167.0, 163.5, 158.2, 156.0, 154.2, 15.7,15.7, 148.4, 144.5, 144.4, 143.9, 140.7, 14.8, 137.0, 136.6, 135.3, 135.4, 134.9, 135.1, 132.9, 133.1,132.5, 131.2, 13.6, 13.2, 129.4, 128.4, 127.7, 127.8, 126.6, 126.7, 126.4, 125.6, 125.7, 124.7, 124.2,120.5, 12.7, 115.0, 108.9, 99.1, 97.3, 85.4, 82.5, 82.5, 78.5, 75.8, 73.8, 69.6-69.8, 69.5, 69.4, 68.7, 68.6, 66.8, 66.1, 63.5, 57.1, 56.9, 55.5, 51.0, 49.5, 49.3, 45.4, 43.6, 43.3, 46.3, 41.8, 40.1, 40.1, 39.5, 38.9, 42.6, 38.3, 36.0, 35.4, 34.8, 33.5, 33.0, 33.4, 32.3, 31.0, 29.8, 29.7, 28.0, 28.8, 26.5, 26.3, 24.5, 210.4, 21.8, 207.8, 20.5.

[0375] Example XX-4. Synthesis of Compound 209.

[0376] Synthesis of Compound 209 via Click Reaction.

[0377] To a solution of A9-PEG2-propargyl (133 mg, 136 pmol, 1.0 eq) and R-PEGIO-Azide (334 mg, 351 pmol, 2.5 eq) in DMSO (2.7 mL) was added Cu(MeCN)4PFe (101 mg, 272 pmol, 2.0 eq) followed by TBTA (289 mg, 544 pmol, 4.0 eq). The reaction mixture was then stirred at room temperature for 3 h. The reaction mixture was concentrated under reduced pressure. The crude was resuspended 500 pL of MeOH and purified by reverse phase gradient method (50-100% MeCN-FEO, Phenomenex Luna 10 pm C18(2) 100 A, LC Column 250 x 10 mm, Flow Rate: 8 mL / min, Equilibration: 2.0 min, Run Length: 29.0 min) afforded the desired product (47 mg, 18 % yield) as a colorless amorphous solid.

[0378] Example XX-5. Synthesis of Compound 225.Chemical Formula: C57H8QN2O17Exact Mass: 1064.5457 Molecular Weight: 1065.2640

[0379] To a solution of A9 (206.6 mg, 229.5 pmol, 1.0 eq) in DCM (1.1 mL) was added pyridine (203 pL. 2.5 mmol, 11.1 eq). The solution was cooled to 0 °C and then -nitrophenyl chloroformate (92.5 mg, 0.459 mmol, 2 eq) was added. The reaction was stirred at 0°C for 30 mins, then warmed up to room temperature. TLC indicated the starting material was consumed completely after 2 h. To the reaction mixture was then added DCM (1 mL) and the solution was then poured into H2O. The aqueous layer was extracted with DCM and the combined organic layers were dried over Na2SC>4 and concentrated under reduced pressure. The crude material was purified by silica gel chromatography (0— >100% EtOAc / Hex, Column: Biotage® Sfar HC Duo 25g, Flow Rate: 80 mL / min, Equilibration: 2.0 CV, Run Length: 15 CV) to afford the desired product (212 mg, 86% yield) as a yellow amorphous solid.

[0380] Step 1:

[0381] Synthesis of l-amino-27-(6-((4-amino-3-(2-aminobenzo[d]oxazol-5-yl)-lHpyrazolo[3,4- d]pyrimidin-l-yl)methyl)-3,4-dihydroisoquinolin-2(lH)-yl)-3,6,9,12,15,18,21,24-octaoxaheptacosan- 27-one.

[0382] To a solution of 5-(4-amino-l-((l,2,3,4-tetrahydroisoquinolin-6-yl)methyl)-lHpyrazolo[3,4- d]pyramidin-3-yl)benzo[d]oxazol-2-amine (593 mg, 1.44 mmol, 1.7 eq), l-{[(tert- butoxy)carbonyl]amino}- 3,6,9,12,15,18,21,24-octaoxaheptacosan-27-oic acid (465 mg, 0.859 mmol, 1.0 eq) in DMF (8.6 mb) was added EtsN (360 pL, 2.6 mmol, 3.0 eq) followed by PyBOP (581 mg, 1.12 mmol, 1.3 eq). The reaction was stirred at room temperature for 2 h and then the reaction mixture was concentrated under reduced pressure and the crude residue was purified by reverse phase gradient method (10-100% MeCN-TEO, Biotage® Star C18 60g, Flow Rate: 50 mL / min, Equilibration: 2.0 CV, Run Length: 15 CV) followed by second purification using silica gel chromatography (0— >50% MeOH / DCM, Column: Biotage® Star HC Duo 25g, Flow Rate: 80 mL / min, Equilibration: 2.0 CV, Run Length: 12 CV) to afford the desired product (120 mg, 15% yield) as a colorless oil. LCMS (ESI) m / z-. [M + H] calcd. for C46H66N9O12: 936.4; found 936.3.

[0383] Step 2:

[0384] To a solution of product from previous step (120 mg, 0.128 mmol, 1.0 eq) in dioxane (0.55 mL) was added HCI (4 M in dioxane, 0.3 mL, 1.28 mmol, 10 eq). The reaction stirred for 2 h and then was concentrated under reduced pressure to an oil. The oil was azeotroped with DCM (3 x 15 mL) to afford the crude desired product (100% yield, HCI) as a tan solid, which was used directly in the next step. LCMS (ESI) m / z: [M + H] calcd. for C4IH57N9OIO: 836.43; found 836.3.

[0385] To a solution of R-PEG8-NH2 (107 mg, 128 pmol, 2.0 eq) in DMA (360 pL) at 0 °C was added EtsN (54 pL, 384 pmol, 6.0 eq) followed by A9-C40-carbonate (68 mg, 64 pmol, 1.0 eq). The reaction mixture was warmed to room temperature and stirred for 5 h. TLC indicated the starting material was consumed completely. The reaction mixture was concentrated and dissolved in 2.5 pL of 0.01% formic acid / MeCN, MeOH(l: 1) and purified by reverse-phase chromatography (10% — » 100% McCN / FUO. Phenomenex Kinetex 5 pm F5 100 A, LC Column 150 x 21.2 mm, AXIA Packed, Flow Rate: 16 mL / min, Equilibration: 2.0 min, Run Length: 40 min) to afford the desired product (54 mg, 48% yield) as a colorless amorphous solid.

[0386] Example XX-6. Overexpression, purification, and preparation of biotinylated FKBP12.

[0387] Cell culture and chemical reagents

[0388] 786-0, A549, Calu-1, H460, H2122, DLD1 and MCF7 cell lines were purchased from the American Type Culture Collection (ATCC). JHUEM7 cell was purchased from Creative Bioarray. All cell lines were cultured and maintained according to provider’s recommended protocols. Sources of chemical reagents are: Rapamycin (Cat. No. UNI 993, AK Scientific); TORC1 inhibitor RMC-5552 (Cat. No. HY-132168, MedChemExpress).

[0389] Western blot analysis

[0390] Cells were treated with compounds with various doses for 5 hours. Cell lysates were generated with PBS / 1% NP40 buffer supplemented with protease inhibitor mixture (Thermo Scientific, catalog no. 87786). Protein sample loading buffer was added to cell lysates, and proteins were separated on SDS-PAGE (Bio-Rad Criterion TGX Precast Gel). Antibodies used for immunoblotting were purchased from Cell Signaling Technology: 4E-BP1 (Cat. No. 9644), Phospho- 4E-BP1 (Thr37 / 46) (Cat. No. 2855), Akt (pan) (Cat. No. 4691), Phospho-Akt (Ser473) (Cat. No. 4060), p70 S6 Kinase (Cat. No. 2708), Phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), HRP conjugated Rabbit IgG (Cat. No. 7074), and HRP conjugated beta actin (Cat. No. 5125) from Cell Signaling Technology. ECL western blot substrates were purchased from Thermo Scientific (Cat. No. 34096 and 32209). Western blot images were captured and processed using Li-Cor Odyssey XF imager.

[0391] Flow cytometry analysis

[0392] Cells were treated with compounds with various doses for 4-5 hours. Cells were stained with fixable viability dye (Cat. 565388, BD Biosciences), washed with PBS, fixed with fixation buffer (Cat. 565388, BD Biosciences), washed and permeabilized with BD phosflow perm / wash buffer (Cat. 557885, BD Biosciences). Fixed / permeabilized cells were stained intracellularly with anti-phospho protein antibodies from Cell Signaling Technology: phospho-S6 (pS240 / pS244) (Cat. 34918), phospho-4E-BP 1 (pT37 / pT46) (Cat. 5123). Flow cytometric analysis was performed with BD FACS Symphony A3 instrument. Data were analyzed using Flowjo (v. 10.8.1) software. Assays were performed with triplicates and Geometric Mean Fluorescent Intensity was plotted using GraphPad Prism (10.1.2.) software.

[0393] Example XX-7 - Overexpression, purification, and preparation of biotinylated FKBP12.

[0394] Overexpression, purification, and preparation of Biotinylated FKBP12. pAP00158 was transformed into E. coli BL21(DE3) to overexpress N-ter His / C-ter AviTag tagged FKBP12. A single colony was picked to grow overnight at 37oC in 2 mb LB medium containing kanamycin (50 mg / L). The overnight culture was then inoculated (1: 100 v / v) into 75 mb of TB medium containing kanamycin. The culture was grown at 37oC until OD600 reached 0.6 and then cooled down on ice for 30 min. Isopropyl-|3-D-thiogalactopyranoside (IPTG, 0.1 mM final concentration) was added in the culture to induce the recombinant protein overexpression for 20 h at 18oC, and the cells in 50 mb medium were harvested by centrifugation (5,000 g, 10 min, 4oC). To purify FKBP12, the harvested cells were lysed by 4 mb B-PER™ Bacterial Protein Extraction Reagent (Thermo Fisher Scientific, MA) at room temperature for 30 min, then 10 mb Binding buffer (50 mM sodium phosphate, 300 mM NaCl, pH 7.4) was added. After configuration (12,000 g, 30 min, 4oC) to remove cellular debris, the supernatant was transferred to a new falcon tube. 2 mb TALON® Superflow™ histidine -tagged protein purification resin (Cytiva, MA) was washed by Binding buffer and added into the supernatant and mixed for 0.5 hour at 4oC. The mixture was then loaded onto a Bio-Rad disposable column, andthe resin was washed with 5 mL Wash buffer (50 mM sodium phosphate, 300 mM NaCl 1, 5 mM imidazole, pH 7.4) 3 times. The target protein was eluted using elution buffer (50 mM sodium phosphate, 300 mM NaCl 1, 150 mM, pH 7.4). The eluting fractions were analyzed by SDS-PAGE (Novex™ Tris-Glycine Mini Protein Gels, 4-20%, ThermoFisher, MA), and the fractions containing FKBP12 were pooled. Buffer exchange was conducted using PD-10 Desalting Column (Cytiva, MA) to storage buffer (50 mM HEPES, 300 mM NaCl, 1 mM TCEP, 10% glycerol, pH 7.5). The protein was concentrated using a 3 kDa MWCO amicon Ultra filter (Millipore Sigma, MA) to 10 mg / mL, determined by Bradford assay (Pierce™ Bradford Plus Protein Assay Kits, ThermoFisher, MA). The protein solution was aliquoted and stored at -80oC. To prepare biotinylated FKBP12, a 300-ul in vitro biotinylation reaction was set up by mixing: lx PBS (Gibco, pH = 7.2, ThermoFisher, MA), 100 pM N-ter His / C-ter AviTag tagged FKBP12, 5 mM MgC12, 5 mM ATP, 0.2 pM BirA Biotin Ligase (MBP-tag, Recombinant, Amid Biosciences, CA), 0.15 mM Biotin. After reaction at 30oC for 0.5 h, the same amount of fresh biotin and MBP-BirA was added and the mixture was incubated for a further hour. Then 100 pl amylose beads (MBP-Spin Protein Miniprep Kit, ZYMO RESEARCH, CA), prewashed by PBS, was added, and the mixture was rotated at room temperature for 1 hour. Centrifugation was conducted to remove the beads, and the supernatant was buffer exchanged to PBS using PD SpinTrap G-25 column (Cytiva, MA). The purity was checked by SDS-PAGE, and protein concentration, determined Bradford assay, was 0.85 mg / mL. The protein solution was aliquoted and stored at -80oC.

[0395] Example XX-8 - SPR assays of the binding kinetics of heterobifiinctional compounds (HBFs) to FKBP12.

[0396] SPR assays of the binding kinetics of heterobifiinctional compounds (HBFs) to FKBP12. SPR assays were conducted with a Biacore S200 system (Cytiva, MA). Multi-cycle kinetics was performed to assay the binding kinetics of HBFs to FKBP12. All buffers were filtered through 0.2 pm filter units. The assays were performed at 25oC. HBSN (Cytiva, MA) supplemented with 0.005% Tween- 20, 50 pM EDTA, and 2% DMSO was used as the running buffer for all cycles. To Perform the multicycle kinetics assays, Biotin CAPture Kit (Cytiva, MA) was used. The Series S CAP chip (Cytiva, MA) was docked, and the system was primed and normalized. Two tandem flow cells were used in which the first flow cell was used as the reference. The multi-cycle kinetics assay begins with one conditioning cycle, three startup cycles, and followed by sample cycles. Solvent correction cycles were conducted before and every 50 sample cycles, and blank cycles were conducted before, after, and every six sample cycles. For the condition cycle, regeneration buffer, containing 3 parts of Regeneration Stock 1 and 1 part of Regeneration Stock 2, was injected at a flow of 10 pL / min for 60 s on both flow cells three times. For each regeneration injection, extra wash after regeneration injection was conducted with the running buffer. For the startup, sample, and blank cycles, the following procedure was performed: to prepare the reference cell (the first cell) and the FKBP12 immobilizedcell (the second cell), first, Biotin CAPture Reagent (Cytiva, MA) was injected at a flow rate of 2 pL / min 300 s on both flow cells using the Low sample consumption mode. And Biotinylated FKBP12, diluted in running buffer to 0.1 pM, was injected at a flow rate of 10 pL / min for 30 s on the second flow cell. The surface was then stabilized for 300 s. To inject samples (running buffer for blank and start cycles, 1.5625 nM, 3.125 nM, 6.25 nM, 12.5 nM, 25 nM, and 50 nM HBFs in running buffer), the injection was in high performance model and the flow rate was 50 pL / min on both flow cells. Contact time was set at 120 s, with Dissociate time set at 600 s. After sample injection and dissociation, extra wash was conducted with 50% DMSO. After that, a 120-s injection of the regeneration solution was conducted at a flow rate of 10 pL / min for both flow cells, followed by an extra wash with the running buffer and a 60-s stabilization period. For the solve correction cycles, an 8-point solvent correction was conducted, from 1.5% to 2.8% DMSO in the running buffer, according to Cytiva’s technical note, on the same prepared cells as the sample cycles, followed by the same regeneration injection.

[0397] The data analysis was performed using Biacore S200 Evaluation Software (vl.1.1). The solvent corrected response curves of the active flow cell minus the reference cell were used. The blank subtracted HBF titration curves were fitted to the 1: 1 binding model using the kinetics evaluation.

[0398] Example XX-9 - SPR assays of the binding kinetics of FRB to FKBP 12-HBF complexes.

[0399] Multi -cycle kinetics was performed to assay the binding kinetics of FRB to FKBP 12-HBF complexes. All buffers were filtered through 0.2 pm filter units. The assays were performed at 25oC. HBSN (Cytiva, MA) supplemented with 0.005% Tween-20, 50 pM EDTA, and 2% DMSO was used as the running buffer for all cycles. To Perform the multi-cycle kinetics assays, a Series S CAP chip (Cytiva, MA) was docked, and the system was primed and normalized. Two tandem flow cells were used in which the first flow cell was used as the reference. The multi -cycle kinetics assay begins with one conditioning cycle, three startup cycles, and followed by sample cycles. Solvent correction cycles were conducted before and every 50 sample cycles, and blank cycles were conducted before, after, and every six sample cycles. For the condition cycle, the regeneration buffer, containing 3 parts of Regeneration Stock 1 and 1 part of Regeneration Stock 2, was injected at a flow of 10 pL / min for 60 s on both flow cells three times. For each regeneration injection, extra wash after regeneration injection was conducted with the running buffer. For the startup, sample, and blank cycles, the following procedure was performed: to prepare the reference cell (the first cell) and the FKBP 12 immobilized cell (the second cell), first, Biotin CAPture Reagent (Cytiva, MA) was injected at a flow rate of 2 pL / min 300 s on both flow cells using the Low sample consumption mode For the startup, sample, and blank cycles, the following procedure was performed: to prepare the reference cell (the first cell) and the FKBP 12 immobilized cell (the second cell), first, Biotin CAPture Reagent (Cytiva, MA) was injected at a flow rate of 2 pL / min 300 s on both flow cells using the Low sample consumption mode.Then, biotinylated FKBP12, diluted in running buffer to 0.1 pM, was injected at a flow rate of 10 pL / min for 30 s on the second flow cell. The surface was then stabilized for 300 s. For sample injection, A-B-A model was used to generate HBF containing running buffer (flanking buffer, 50 nM HBFs in the running buffer) environment 120-s before and 120-s after the injection of FRB sample, prepared in the flanking buffer, at a flow rate of 50 pL / min for 60s. The injected FRB sample concentrations are 0 nM, 24.7 nM, 74. 1 nM, 222.2 nM, 666.6 nM, and 2000 nM, on both flow cells. After sample injection and dissociation, extra wash was conducted with 50% DMSO. After that, a 120-s injection of the regeneration solution was conducted at a flow rate of 10 pL / min for both flow cells, followed by an extra wash with the running buffer and a 60-s stabilization period. For the solve correction cycles, an 8-point solvent correction was conducted, from 1.5% to 2.8% DMSO in the running buffer, according to Cytiva’s technical note, on the same prepared cells as the sample cycles, followed by the same regeneration injection.

[0400] The data analysis was performed using Biacore S200 Evaluation Software (vl.1.1). The solvent corrected response curves of the active flow cell minus the reference cell were used. The blank subtracted FRB titration curves were fitted to the 1: 1 binding model using the kinetics evaluation.Binding Affinity: FKBP12-Compound: +++, < 2 nM; ++, >2 nMBinding Affinity: FKBP12-Compound-FRB: +++, < 500 nM; ++, > 500 nM and < 2000 nM; +, >2000 nM

[0401] Rapamycin analogs Al, A2, A4, and A9 were evaluated with rapamycin for their FKBP12 affinity as seen in FIG. 22. FIG. 22 shows log KD binary binding of FKBP / rapamycin analog or FKBP / rapamycin.

[0402] In FIG. 23, MCF7 cells were treated with Rapamycin, compound 1, compound 27, compound 79 or RMC-5552 at indicated concentrations for 5 hours in vitro. Cell lysates were generated with PBS / 1% NP40 buffer supplemented with protease inhibitor mixture (Thermo Scientific, catalog no. 87786). Protein sample loading buffer was added to cell lysates, and proteins were separated on SDS- PAGE (Bio-Rad Criterion TGX Precast Gel). Western blotting was performed with the followingantibodies (antibodies were purchased from Cell Signaling Technology unless otherwise noted): Phospho-Akt (Ser473) (Cat. No. 4060), Akt (pan) (Cat. No. 4691), Phospho-4E-BPl (Thr37 / 46) (Cat. No. 2855), 4E-BP1 (Cat. No. 9644), HRP conjugated Rabbit IgG (Cat. No. 7074), and HRP conjugated beta actin (Cat. No. 5125). Chemiluminescent reaction and image capturing were performed using ECL western blot substrates (Thermo Scientific, Cat. No. 34096 and 32209) and Li- Cor Odyssey XF imager, y, p and a indicate different 4E-BP1 phospho-species.

[0403] In FIG. 24, A549 cells were treated with Rapamycin, compound 1, compound 27 or RMC- 5552 at indicated concentrations for 5 hours in vitro. Western blot analysis for phospho-Akt (Ser473) (Cat. No. 4060), Phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), and phospho-4E-BP 1 (Thr37 / 46) (Cat. No. 2855) were performed as described in FIG. 21.

[0404] In FIG. 25, MCF7 cells were treated with Rapamycin, compound 27, compound 79 or rMLN- PEGlO-azide at indicated concentrations for 5 hours in vitro. Western blot was performed for phospho-Akt (Ser473) (Cat. No. 4060), total Akt (Cat. No. 4691), phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), total p70 S6 kinase (Cat. No. 2708), phospho-4E-BP 1 (Thr37 / 46) (Cat. No. 2855), total 4E-BP1 (Cat. No. 9644) and beta actin (Cat. No. 5125) as described in FIG. 21.

[0405] FIG. 26 plots rapamycin analogs (Al, A2, A3, A4, and A9) and rapamycin binding affinity to FKBP12 and FRB.

[0406] In FIG. 28, 786-0 cells were treated with Rapamycin, compound 1, compound 27 or RMC- 5552 at indicated concentrations for 5 hours in vitro. Western blot was performed for phospho-Akt (Ser473) (Cat. No. 4060), total Akt (Cat. No. 4691), phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), total p70 S6 kinase (Cat. No. 2708), phospho-4E-BPl (Thr37 / 46) (Cat. No. 2855), total 4E- BP1 (Cat. No. 9644) and beta actin (Cat. No. 5125) as described in Fig. 21.

[0407] In, FIG. 29, cells were treated with compound 1, compound 27, RMC-5552 or Rapamycin with various doses for 4-5 hours. Cells were stained with fixable viability dye (Cat. 565388, BD Biosciences), washed with PBS, fixed with fixation buffer (Cat. 565388, BD Biosciences), washed and permeabilized with BD phosflow perm / wash buffer (Cat. 557885, BD Biosciences).Fixed / permeabilized cells were stained intracellularly with anti-phospho protein antibodies from Cell Signaling Technology: phospho-4E-BPl (pT37 / pT46) (Cat. 5123). Flow cytometric analysis was performed with BD FACS Symphony A3 instrument. Data were analyzed using Flowjo (v.10.8. 1) software. Assays were performed with triplicates and Geometric Mean Fluorescent Intensity was plotted using GraphPad Prism (10.1.2.) software.

[0408] In FIG. 30, 786-0 cells were treated with Rapamycin, Rapamycin-PEGlO-rMLN, compound 1, compound 27 or RMC-5552 with various doses for 4-5 hours. As described in Fig. 26, cells were stained with fixable viability dye (Cat. 565388, BD Biosciences), and processed for washing, fixation and permeabilization. Fixed / permeabilized cells were stained intracellularly with anti-phospho protein antibodies from Cell Signaling Technology: phospho-S6 (pS240 / pS244) (Cat. 34918), phospho-4E- BP1 (pT37 / pT46) (Cat. 5123) and phospho-Akt (pS473) (Cat. 5315). Flowcytometric analysis wasperformed with BD Symphony A3. Data were analyzed using Flowjo (v. 10.8. 1) software. Assays were performed with triplicates and Geometric Mean Fluorescent Intensity was plotted using GraphPad Prism (10.1.2.) software.

[0409] In FIG. 28, 786-0 cells were treated with Rapamycin, Rapamycin-PEGlO-rMLN, compound 1, compound 27, or RMC-5552 at indicated concentrations for 5 hours in vitro. Western blot was performed for phospho-Akt (Ser473) (Cat. No. 4060), total Akt (Cat. No. 4691), phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), total p70 S6 kinase (Cat. No. 2708), phospho-4E-BPl (Thr37 / 46) (Cat. No. 2855), total 4E-BP1 (Cat. No. 9644) and beta actin (Cat. No. 5125) as described in FIG. 21.

[0410] In FIG. 32, cells were treated with Rapamycin-PEGlO-rMLN, compound 1, compound 27 or RMC-5552 with various doses for 4-5 hours. As described in FIG. 26, cells were stained with fixable viability, and processed for washing, fixation and permeabilization. Fixed / permeabilized cells were stained intracellularly with phospho-4E-BPl (pT37 / pT46), phospho-S6 (pS240 / pS244) and phospho- Akt (pS473) antibody followed by flowcytometric analysis with BD Symphony A3. Data were analyzed using Flowjo (v.10.8. 1) software. Assays were performed with triplicates and Geometric Mean Fluorescent Intensity was plotted using GraphPad Prism (10.1.2.) software.

[0411] In FIG. 33, NSCLC cell lines (Calu-1, H460, H2122 and A549) were analyzed for mTORCl biomarkers. A549 cells were treated with Rapamycin, compound 1, compound 27 or RMC-5552 at indicated concentrations for 5 hours in vitro. Western blot was performed for phospho-Akt (Ser473) (Cat. No. 4060), total Akt (Cat. No. 4691), phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), total p70 S6 kinase (Cat. No. 2708), phospho-4E-BPl (Thr37 / 46) (Cat. No. 2855), total 4E-BP1 (Cat. No. 9644) and beta actin (Cat. No. 5125) as described in FIG. 23.

[0412] In FIG. 34, A549 were analyzed for mTORCl biomarkers by Western blot as described in FIG. 30. Expression of phosphor-4E-BPl, phosphor- Akt and ratio of phospho-4E-BPl to phospho Akt were quantified from Western blot data using Li-Cor Odyssey XF imager. Quantitative data were plotted using GraphPad Prism (10.1.2.) software.

[0413] In FIG. 35 A549 cells were treated with Rapamycin, compound 79 or RMC-5552 at indicated concentrations for 5 hours in vitro. Western blot was performed for phospho-Akt (Ser473) (Cat. No. 4060), total Akt (Cat. No. 4691), phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234), total p70 S6 kinase (Cat. No. 2708), phospho-4E-BPl (Thr37 / 46) (Cat. No. 2855), total 4E-BP1 (Cat. No. 9644) and beta actin (Cat. No. 5125) as described in FIG. 23.

[0414] In FIG. 36A, FIG. 36B, and FIG. 36C, A549 were analyzed for mTORCl biomarkers by Western blot as described in Fig. 32. Expression of phospho r-4E-BPl, phosphor-Akt and ratio of phospho-4E-BP 1 to phospho Akt were quantified from Western blot data using Li-Cor Odyssey XF imager. Quantitative data were plotted using GraphPad Prism (10. 1.2.) software.

[0415] In FIG. 37, A549 (Non-Small Cell Lung Cancer), DLD-1 (Colorectal Cancer), MCF-7 (Breast Cancer), JHUEM-7 (Endometrium Cancer) cells were treated with Rapamycin, compound 1, compound 27 or RMC-5552 at indicated concentrations for 5 hours in vitro. Western blot wasperformed for phospho-p70 S6 Kinase (Thr389) (Cat. No. 9234) and phospho-4E-BP 1 (Thr37 / 46) (Cat. No. 2855) as described in Fig. 23.

[0416] In FIG. 38, A549 (Non-Small Cell Lung Cancer), DLD-1 (Colorectal Cancer), MCF-7 (Breast Cancer), JHUEM-7 (Endometrium Cancer) cells were treated with compound 27, compound 1 or RMC-5552 at indicated concentrations for 4-5 hours in vitro. As described in Fig. 26, cells were stained with fixable viability, and processed for washing, fixation and permeabilization.Fixed / permeabilized cells were stained intracellularly with phospho-4E-BPl (pT37 / pT46) (Cat. 5123) antibody followed by flowcytometric analysis with BD Symphony A3. Data were analyzed using Flowjo (v. 10.8.1) software. Assays were performed with triplicates and Geometric Mean Fluorescent Intensity was plotted using GraphPad Prism (10.1.2.) software.

[0417] FIG. 39 plots the binding affinity of FKBP12 with Compound 1, Compound 27, Compound 225, and RMC-5552 and FKBP 12 -Compound complexes with FRB.

[0418] In FIG. 40, MCF-7 (BC) cells were treated with compound 225 or RMC-5552 at indicated concentrations for 4 hours in vitro. As described in Fig. 26, cells were stained with fixable viability, and processed for washing, fixation and permeabilization. Fixed / permeabilized cells were stained intracellularly with phospho-4E-BPl (pT37 / pT46) (Cat. 5123) antibody followed by flowcytometric analysis with BD Symphony A3. Data were analyzed using Flowjo (v. 10.8. 1) software. Assays were performed with triplicates and Geometric Mean Fluorescent Intensity was plotted using GraphPad Prism (10.1.2.) software.

[0419] FIG. 41 illustrates rapamycin analogs, A9 and Al, and models rapamycin analogs A9 and 16- O-desmethyl-A9 interacting with FKBP12 and FRB.

[0420] FIG. 44 shows the tumor volume and body weight change with Compound 1 in an MCF-7 xenograft model. The experimental conditions were as follows:

[0421] Cell Culture: The MCF-7 tumor cells were maintained in medium supplemented with 10% heat inactivated fetal bovine serum at 37°C in an atmosphere of 5% CO2 in air. The tumor cells were routinely subcultured twice weekly. The cells growing in an exponential growth phase were harvested and counted for tumor inoculation.

[0422] Animals: MCF-7 Balb / c nude, female, 6-8 weeks, weighing approximately 18-22g.

[0423] Tumor Inoculation: For MCF-7 model, 60-day release |3-estradiol pellet (Innovative research of America, 0.36 mg / pellet, 60-days release, SE-121) was implanted into each mouse’s left flank 2-3 days before cell inoculation. Then each mouse was inoculated subcutaneously in the right flank with MCF-7 cells (10* 106) with Matrigel (50:50) for tumor development. The test compound administration and the animal numbers in each group are shown in the below experimental design table.

[0424] FIG. 45 shows the tumor volume and body weight change with Compound 1 in an orthotopic RCC (786-0) xenograft model. The experimental conditions were as follows:

[0425] Cell Culture: The 786-O-Luc tumor cells were maintained in medium supplemented with 10% heat inactivated fetal bovine serum at 37 °C in an atmosphere of 5% CO2 in air. The tumor cells was routinely subcultured twice weekly. The cells growing in an exponential growth phase was harvested and counted for tumor inoculation.

[0426] Animals: NOD SCID, female, 6-8 weeks, weighing approximately 18-22g.

[0427] Tumor Inoculation: Each mouse was injected with 786-O-Luc tumor cells (3 x 10A6) in 30 L of PBS mixed with 25% Matrigel into the kidney. All animals were monitored for bioluminescence when the average tumor volume reached the appropriate size (2-3 week). Mice were picked out and assigned into 6 groups using randomized block design based upon their bioluminescence.

[0428] FIG. 46 shows the tumor volume and body weight change with Compound 1 in a subcutaneous RCC (786-0) xenograft model. The experimental conditions were as follows:

[0429] Cell Culture: The 786-0 tumor cells were maintained in medium supplemented with 10% heat inactivated fetal bovine serum at 37°C in an atmosphere of 5% CO2 in air. The tumor cells were routinely subcultured twice weekly. The cells growing in an exponential growth phase were harvested and counted for tumor inoculation.

[0430] Animals: Balb / c nude, female, 6-8 weeks, weighing approximately 18-22g.

[0431] Tumor Inoculation: For 786-0 model, each mouse was inoculated subcutaneously in the right flank with 786-0 cells (5* 106) with Matrigel (50:50) for tumor development. The animals were randomized and treatment was started when the average tumor volume reaches approximately- 150 mm3.

[0432] FIG. 47 shows the tumor volume and body weight change with Compound 1 in a Lung Adenocarcinoma (H2030) xenograft model. The experimental conditions were as follows:

[0433] Cell Culture: The NCI-H2030 tumor cells were maintained in medium supplemented with 10% heat inactivated fetal bovine serum at 37°C in an atmosphere of 5% CO2 in air. The tumor cells were routinely subcultured twice weekly. The cells growing in an exponential growth phase were harvested and counted for tumor inoculation.

[0434] Animals: Balb / c nude, female, 6-8 weeks, weighing approximately 18-22g.

[0435] Tumor Inoculation: For NCI-H2030 model, each mouse was inoculated subcutaneously in the right flank with NCI-H2030 cells (10* 106) with Matrigel (50:50) for tumor development. The animals were randomized and treatment was started when the average tumor volume reaches approximately- 150 mm3.

Claims

CLAIMS1. A compound, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I):wherein,R1, R2, and R5are each independently hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, - S(=O)2R22, -NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl- C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, Ci- C8alkyl, C2-Cs alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl -heterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20;R3and R4are each independently hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, - S(=O)2R22, -NO2, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-c8-alkyl- C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, Ci- C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl -heterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20;R6, R7, and R8are each independently hydrogen or C1-C3 alkyl;W is C=O or CHOH;L is selected from the group consistingwherein * indicates connectivity of L in the A; wherein a is 1-15;A1is -OR21, -SR21, -NR23R24, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl -cycloalkyl, heterocycloalkyl, Ci-C8alkyl -heterocycloalkyl, aryl, Ci-C8alkylaryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2- C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20; each R10is independently hydrogen, halogen, -CN, -C(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, Ci- C8alkyl, wherein the Ci-C8alkyl are each independently optionally substituted with one or more R20;R11is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, - C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, - OC(=O)NR23R24, -NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, - NR21C(=O)OR21, Ci-C8alkyl, C2-C8alkenyl, C2-C8-alkynyl, cycloalkyl, Ci-C8alkylcycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20; each R20is independently halogen, -CN, -ORa, -SRb, -S(=O)2Rb, -NRcRd, -S(=O)2NRcRd, - C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, -OC(=O)ORa, -OC(=O)SRb, - C(=O)NRcRd, -OC(=O)NRcRd, -NRaC(=O)NRcRd, -NRaC(=O)Rb, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-C8haloalkyl, Ci-C8hydroxyalkyl, or phenyl; each R21is independently hydrogen, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-Cs -cycloalkyl, heterocycloalkyl, Ci-Cs- heterocycloalkyl, aryl, Ci-Cs-aryl, heteroaryl, or Ci-Cs-heteroaryl are each independently optionally substituted with one Rla; each R22is independently hydrogen, -CN, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl are each independently optionally substituted with one or more Rlb;R23and R24are each independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl are each independently optionally substituted with one or more Rlc; or R23and R24are taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl optionally substituted with one or more Rld; each Rla, Rlb, Rlc, and Rldis independently oxo, halogen, -CN, -ORa, -SRb, -S(=O)2Rb, - NRcRd, -S(=O)2NRcRd, -C(=O)Rb, -OC(=O)Rb, -C(=O)ORa, -C(=O)SRb, - OC(=O)ORa, -OC(=O)SRb, -OC(=O)SRb, -C(=O)NRcRd, -OC(=O)NRcRd, - NRaC(=O)NRcRd, -NRaC(=O)Rb, Ci-C8alkyl, -C2-C8alkenyl, C2-C8alkynyl, Ci-C8haloalkyl, Ci-Cs hydroxyalkyl, or phenyl; and each Ra, Rb, Rc, and Rdis independently hydrogen, Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl; wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkylheterocycloalkyl, aryl, Ci-Cs alkyl -aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl are each independently optionally substituted; and or Rcand Rdare taken together with the nitrogen atom to which they are attached to form a heterocycloalkyl which is optionally substituted.

2. The compound of claim 1, wherein R1, R2, and R5are each independently hydrogen, halogen, - CN, -OR21, -SR21, -NO2, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, C3-10 cycloalkyl, Ci-C8alkyl- C3-10 cycloalkyl, 3-10 membered heterocycloalkyl, Ci-Cs alkyl-3-10 membered heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl.

3. The compound of claim 1, wherein R3and R4are each independently hydrogen, halogen, -CN, - OR21, -SR21, -NO2, Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, C3-10 cycloalkyl, Ci-C8alkyl- C3-10 cycloalkyl, 3-10 membered heterocycloalkyl, Ci-Cs alkyl-3-10 membered heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkyl -heteroaryl.

4. The compound of any one of claims 1-3, wherein R6is CH3.

5. The compound of any one of claims 1-4, wherein R7is CH3.

6. The compound of any one of claims 1-5, wherein R8is CH3.

7. The compound of any one of claims 1-6, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

8. The compound of claim 7, wherein R2is Ci-Cs alkyl.

9. The compound of any one of claims 1-8, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

10. The compound of claim 9, wherein R3is Ci-C8alkyl.

11. The compound of any one of claims 1-10, wherein R4is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

12. The compound of claim 11, wherein R4is hydrogen.

13. The compound of claim 1, wherein:R2is Ci-C8alkyl;R3is Ci-C8alkyl;R4is hydrogen; andR6, R7, and R8are each CH3.

14. The compound of any one of claims 1-13, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-A):Formula (I-A) wherein:(i) when R1is CH3, R5is not CH3; or(ii) when R5is CH3, R1is not CH3.

15. The compound of claim 14, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

16. The compound of claim 15, wherein R1is hydrogen.

17. The compound of any one of claims 14-16, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

18. The compound of claim 17, wherein R5is hydrogen.

19. The compound of claim 1, wherein:R1is hydrogen;R2is Ci-C8alkyl;R3is Ci-Cs alkyl;R4is hydrogen;R5is hydrogen; andR6, R7, and R8are each CH3.

20. The compound of any one of claims 14-19, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-A) :Formula (II-A).

21. The compound of any one of claims 1-8, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

22. The compound of claim 21, wherein R3is Ci-C8alkyl.

23. The compound of claim 21 or 22, wherein R4is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

24. The compound of claim 23, wherein R4is hydrogen.

25. The compound of any one of claims 21-23, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

26. The compound of claim 25, wherein R5is Ci-C8alkyl.

27. The compound of claim 1, wherein:R3is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

28. The compound of any one of claims 21-27, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-B):Formula (I-B) wherein:(i) when R1is CH3, R2is not CH3; or(ii) when R2is CH3 , R1is not CH3.

29. The compound of claim 28, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

30. The compound of claim 29, wherein R1is hydrogen.

31. The compound of any one of claims 28-30, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

32. The compound of claim 31, wherein R2is hydrogen.

33. The compound of claim 1, wherein:R1is hydrogen;R2is hydrogen;R3is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

34. The compound of any one of claims 28-33, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-B):Formula (II-B).

35. The compound of any one of claims 1-34, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, - N02, -C(=O)R22, or Ci-C8alkyl.

36. The compound of claim 35, wherein R5is Ci-Cs alkyl.

37. The compound of claim 1, wherein:R2is Ci-C8alkyl;R3is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH,.

38. The compound of any one of claims 35-37, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-C):Formula (I-C) wherein,R1is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -N02, -NR23R24, -NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-C8-alkyl-C(=O)R20, -C(=O)C(=O)R22,-C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl ; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

39. The compound of claim 38, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or C2-C8alkyl.

40. The compound of claim 39, wherein R1is hydrogen.

41. The compound of claim 1, wherein:R1is hydrogen;R2is hydrogen;R3is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

42. The compound of any one of claims 38-41, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-C):Formula (II-C).

43. The compound of any one of claims 1-6, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

44. The compound of claim 43, wherein R1is Ci-C8alkyl.

45. The compound of claim 43 or 44, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

46. The compound of any one of claims 43-45, wherein R5is Ci-C8alkyl.

47. The compound of claim 1, wherein:R1is Ci-C8alkyl;R5is Ci-Cs alkyl; andR6, R7, and R8are each CH3.

48. The compound of any one of claims 43-45, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-D):Formula (I-D) wherein:(i) when R2is CH3 , R3is not CH3 or R4is not hydrogen;(ii) when R3is CH3, R2is not CH3 or R4is not hydrogen; or(iii) when R4is hydrogen, at least one of R2or R3is not CH3.

49. The compound of claim 48, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

50. The compound of claim 48 or 49, wherein R2is hydrogen.

51. The compound of any one of claims 48-50, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

52. The compound of claim 51, wherein R3is hydrogen.

53. The compound of any one of claims 46-50, wherein R4is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

54. The compound of claim 51, wherein R4is Ci-C8alkyl.

55. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is hydrogen;R3is hydrogen;R4is Ci -C8alkyl;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

56. The compound of any one of claims 48-55, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-D) :Formula (II-D).

57. The compound of any one of claims 1-6, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

58. The compound of claim 57, wherein R3is Ci-Cs alkyl.

59. The compound of claim 57 or 58, wherein R4is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

60. The compound of claim 59, wherein R4is hydrogen.

61. The compound of any one of claims 57-60, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

62. The compound of claim 61, wherein R5is Ci-C8alkyl.

63. The compound of any one of claims 57-62, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

64. The compound of claim 63, wherein R1is Ci-C8alkyl.

65. The compound of claim 1, wherein:R1is Ci-C8alkyl;R3is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

66. The compound of any one of claims 57-65, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-E) :Formula (I-E) wherein,R2is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-Cs-alkyl-C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl ; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

67. The compound of claim 66, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or C2-C8alkyl.

68. The compound of claim 66 or 67, wherein R2is hydrogen.

69. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is hydrogen;R3is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

70. The compound of any one of claims 66-69, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-E):Formula (II-E) .

71. The compound of any one of claims 1-6, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

72. The compound of claim 71, wherein R1is Ci-Cs alkyl.

73. The compound of claim 71 or 72, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

74. The compound of claim 73, wherein R2is Ci-C8alkyl.

75. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is hydrogen; andR6, R7, and R8are each CH3.

76. The compound of any one of claims 71-75, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-F):Formula (I-F) wherein:(i) when R3is CH3, R5is not CH3 or R4is not hydrogen;(ii) when R4is hydrogen, at least one of R3or R5is not CH3; or(iii) when R5is CH3, R3is not CH3 or R4is not hydrogen.

77. The compound of claim 76, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

78. The compound of claim 77, wherein R3is hydrogen.

79. The compound of any one of claims 77-78, wherein R4is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

80. The compound of claim 79, wherein R4is Ci-C8alkyl.

81. The compound of any one of claims 77-80, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

82. The compound of claim 81, wherein R5is hydrogen.

83. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is hydrogen;R3is hydrogen;R4is Ci -C8alkyl;R5is hydrogen; andR6, R7, and R8are each CH3.

84. The compound of any one of claims 76-83, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-F):Formula (II-F).

85. The compound of any one of claims 1-6, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

86. The compound of claim 85, wherein R1is Ci-C8alkyl.

87. The compound of claim 85 or 86, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

88. The compound of claim 87, wherein R2is Ci-Cs alkyl.

89. The compound of any one of claims 85-88, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

90. The compound of claim 89, wherein R5is Ci-Cs alkyl.

91. The compound of claim 1, wherein:R1is Ci-Cs alkyl;R2is Ci-C8alkyl;R5is hydrogen; andR6, R7, and R8are each CH,.

92. The compound of any one of claims 84-91, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-G):Formula (I-G) wherein: wherein:(i) when R3is CH,. R4is not hydrogen; or(ii) when R4is hydrogen, at least one of R1, R2, R3, or R5is not CH,.

93. The compound of claim 92, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

94. The compound of claim 93, wherein R3is hydrogen.

95. The compound of claim 93 or 94, wherein R4is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

96. The compound of claim 95, wherein R4is Ci-C8alkyl.

97. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is Ci-C8alkyl;R3is hydrogen;R4is Ci -C8alkyl;R5is hydrogen; andR6, R7, and R8are each CH3.

98. The compound of any one of claims 92-97, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-G) :Formula (II-G).

99. The compound of claim of any one of claims 1-6, wherein R1is hydrogen, halogen, -CN, -OR21, - SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

100. The compound of claim 99, wherein R1is Ci-C8alkyl.

101. The compound of claim 99 or 100, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

102. The compound of claim 101, wherein R2is Ci-C8alkyl.

103. The compound of any one of claims 99-102, wherein R3is hydrogen, halogen, -CN, -OR21, - SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

104. The compound of claim 103, wherein R3is Ci-C8alkyl.

105. The compound of any one of claims 99-104, wherein R4is hydrogen, halogen, -CN, -OR21, - SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

106. The compound of claim 105, wherein R4is hydrogen.

107. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is Ci-C8alkyl;R3is Ci-C8alkyl;R4is hydrogen; andR6, R7, and R8are each CH3.

108. The compound of any one of claims 99-107, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-H):Formula (I-H) wherein,R5is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-Cs-alkyl-C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkyl-heterocycloalkyl, aryl, Ci-C8alkyl-aryl, heteroaryl, or Ci-C8alkyl-heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

109. The compound of claim 108, wherein R5is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or C2-C8alkyl.

110. The compound of claim 109, wherein R5is hydrogen.

111. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is Ci-C8alkyl;R3is Ci-C8alkyl;R4is hydrogen;R5is hydrogen; andR6, R7, and R8are each CH3.

112. The compound of any one of claims 108-111, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-H):Formula (II-H).

113. The compound of any one of claims 1-6, wherein R1is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

114. The compound of claim 113, wherein R1is Ci-Cs alkyl.

115. The compound of claim 113 or 114, wherein R2is hydrogen, halogen, -CN, -OR21, -SR21, - NO2, -C(=O)R22, or Ci-C8alkyl.

116. The compound of claim 115, wherein R2is Ci-C8alkyl.

117. The compound of any one of claims 113-116, wherein R4is hydrogen, halogen, -CN, -OR21, - SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

118. The compound of claim 117, wherein R4is hydrogen.

119. The compound of any one of claims 113-118, wherein R5is hydrogen, halogen, -CN, -OR21, - SR21, -NO2, -C(=O)R22, or Ci-C8alkyl.

120. The compound of claim 118, wherein R5is Ci-C8alkyl.

121. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is Ci-C8alkyl;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH.

122. The compound of any one of claims 113-121, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (I-I):Formula (I-I); wherein:R3is hydrogen, halogen, -CN, -OR21, -SR21, -S(=O)R22, -S(=O)2R22, -NO2, -NR23R24, - NR21S(=O)2R22, -S(=O)2NR23R24, -C(=O)R22, -OC(=O)R22, -Ci-Cs-alkyl-C(=O)R20, -C(=O)C(=O)R22, -C(=O)OR21, -C(=O)NR21OR21, -OC(=O)OR21, -C(=O)NR23R24, -OC(=O)NR23R24, - NR21C(=O)NR23R24, -NR21S(=O)2NR23R24, -NR21C(=O)R22, -NR21C(=O)OR21, C2-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, Ci-C8alkyl-cycloalkyl, heterocycloalkyl, Ci-C8alkylheterocycloalkyl, aryl, Ci-C8alkyl -aryl, heteroaryl, or Ci-C8alkyl -heteroaryl; wherein the Ci-C8alkyl, C2-C8alkenyl, C2-C8alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

123. The compound of claim 122, wherein R3is hydrogen, halogen, -CN, -OR21, -SR21, -NO2, - C(=O)R22, or Ci-C8alkyl.

124. The compound of claim 123, wherein R3is hydrogen.

125. The compound of claim 1, wherein:R1is Ci-C8alkyl;R2is Ci-C8alkyl;R3is hydrogen;R4is hydrogen;R5is Ci-C8alkyl; andR6, R7, and R8are each CH3.

126. The compound of any one of claims 122-125, or a pharmaceutically-acceptable salt or solvate thereof, having a structure represented by a structure of Formula (II-I) :Formula (II-I).

127. The compound of any one of claims 1-126, wherein W is CHOH.

128. The compound of any one of claims 1-126, wherein W is C=O.

129. The compound of any one of claims 1-127, wherein each R10is hydrogen or Ci-Cs alkyl.

130. The compound of claim 129, wherein each R10is hydrogen.

131. The compound of any one of claims 1-130, wherein A1is -OR21, -SR21, -NR23R24, Ci-Cs alkyl,C2-C8 alkenyl, or C2-C8 alkynyl.

132. The compound of claim 131, wherein A1is, wherein * indicates connectivity of A1to L.

133. The compound of any one of claims 1-132, wherein A1is Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl -heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkylheteroaryl.

134. The compound of claim 133, wherein A1is CtT-hctcrocycloalkyl.

135. The compound of claim 133, wherein A1is, wherein * indicates connectivity of A1to L.

136. The compound of any one of claims 1-135, wherein R11is Ci-Cs alkyl-cycloalkyl, heterocycloalkyl, Ci-Cs alkyl -heterocycloalkyl, aryl, Ci-Cs alkyl-aryl, heteroaryl, or Ci-Cs alkylheteroaryl, wherein the Ci-Cs alkyl, C2-C8 alkenyl, C2-C8 alkynyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl are each independently optionally substituted with one or more R20.

137. The compound of claim 136, wherein R11is heteroaryl and R20is -NH2.

138. The compound of claim 136 or 137, wherein139. The compound of any one of claims 1-138, wherein A is141. The compound of any one of claims 1-139, wherein L isThe compound of any one of claims 1-139, wherein L is143. The compound of any one of claims 1-142, wherein a is 2-10.

144. The compound of claim 143, wherein a is 4, 6, 8, or 10.

145. A pharmaceutical composition comprising the compound of any one of claims 1-144, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient or carrier.

146. A method of treating a disease or disorder in a subject in need thereof, comprising administering the compound of any one of claims 1-144 or the pharmaceutical composition of claim 145.

Images