Polynucleotide influenza vaccine encoding hemagglutinin and neuramidase
A polynucleotide-based vaccine encoding NA and HA separated by a furin cleavage site and 2A peptide addresses the challenges of antigenic drift and variable NA responses, enhancing vaccine efficacy and manufacturing efficiency.
Patent Information
- Application Number
- PCT/US2025/040564
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-02
- Filing Date
- 2025-08-04
- Publication Date
- 2026-02-05
AI Technical Summary
Current seasonal influenza vaccines face challenges such as rapid antigenic drift due to selective pressure on HA, variable NA-specific responses, uncertain NA content, long manufacturing pipelines, and variable efficacy, leading to ineffective vaccines against certain virus subtypes.
A polynucleotide-based vaccine strategy that encodes neuraminidase (NA) and hemagglutinin (HA) separated by a furin cleavage site and a 2A polypeptide, expressed from a single DNA or mRNA construct, to induce broad and robust immune responses.
The strategy elicits strong immune responses to both NA and HA, providing broad protection against multiple influenza strains and reducing the need for frequent reformulation, with improved vaccine efficacy and manufacturing efficiency.
Smart Images

Figure US2025040564_05022026_PF_FP_ABST
Abstract
Description
[0001] POLYNUCLEOTIDE INFLUENZA VACCINE ENCODING HEMAGGLUTININ AND NEURAMIDASE
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This patent application claims priority to U.S. Provisional Application No. 63 / 678,716 filed on August 2, 2024, the contents of which are incorporated by reference in their entireties.
[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0005] This invention was made with government support under contract numbers 75N93019C00050 and UC6 AI058607 from the National Institute of Allergy and Infectious Diseases, National Institutes of Health. The government has certain rights in this invention.
[0006] SEQUENCE LISTING STATEMENT
[0007] This application includes a sequence listing in XML format titled “155554_00787_ST26.xml”, which is 87,182 bytes in size and was created on July 31, 2025. The sequence listing is electronically submitted with this application via Patent Center and is incorporated herein by reference in its entirety.
[0008] BACKGROUND
[0009] Seasonal influenza virus infection causes significant disease burden globally every year. In the 2022-23 season, it was estimated there were over 30 million cases in the United States alone, and worldwide there can be between 250,000 and 500,000 deaths from influenza illness in a given season. Seasonal influenza viruses also create a significant economic burden, an estimated $25 billion USD in a typical flu season.
[0010] Vaccines are one of the main tools for battling seasonal influenza. Flu vaccines typically induce a highly focused response to antigenic domains of the viral protein hemagglutinin (HA) and to a lesser extent, to the viral protein neuraminidase (NA). The HA-directed antibodies elicited by a flu vaccine typically block host receptor engagement and thus, mediate virus neutralization. However, the strong effect of these antibodies places a significant selective pressure on antigenic sites in the head domain of HA, leading to rapid viral antigenic drift. This antigenic drift necessitates that the seasonal influenza vaccine is reformulated every year. Seasonal influenza vaccines typically target three or four of the virus strains that are expected to be circulating, typically an H1N1 Influenza A virus (IAV), an H3N2 IAV, a Victoria-lineage Influenza B virus (IBV), and a Yamagata-lineage IBV. While subunit, recombinant protein, and live-attenuated FDA-approved influenza vaccines exist, the most widely administered seasonal influenza vaccines consist of influenza viral particles that are grown to scale in eggs then inactivated with detergents. This process ‘splits’ the viral particles and subsequently exposes the immune system to multiple antigenic viral proteins, such as NA and HA, upon vaccination. Split inactivated vaccines are normalized only on HA content, leaving the amount and integrity of the other major glycoprotein, NA, uncertain. Indeed, it has been shown that NA-specific human antibodies poorly recognize NA within split inactivated vaccines and that the NA-directed vaccine responses themselves can be highly variable. Additionally, relatively long manufacturing pipelines necessitate 6-8 months between strain selection and vaccine administration, allowing time for mutations to arise in circulating strains that change the antigenicity relative to vaccine strains. Egg-adapted mutations acquired by vaccine strains during production can also significantly alter antigenicity. These issues can lead to extreme examples where the vaccines end up being ineffective against certain subtypes of influenza viruses, shown recently in the 2014-15, 2016-17 and 2017-18 influenza seasons. Even under more normal conditions, seasonal influenza vaccines still elicit only -20-60% vaccine efficacy. Thus, there is a need for influenza vaccines that are effective, broadly protective, and easy to produce at scale.
[0011] BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIGs. 1A-1H demonstrate that NA and HA can be properly expressed from a single DNA construct by separation via furin cleavage sites and PTV-2A motif. FIG. 1A is a diagram of the NA-F2A-HA expression vector. Open reading frame, ORF; furin protease, F; carboxypeptidase, CP; signal peptide peptidase, SPP. FIG. IB shows the results of cell-based ELIS As against 293 T cells transfected with the indicated plasmids and stained with dilutions of an N2 polyclonal antibody. FIG. 1C shows an area under the curve-analysis (AUC) of 4 independent experiments represented in FIG. IB. Arb. Units=Arbitrary Units. FIG. ID shows the results of cell-based ELISAs against 293T cells transfected with the indicated plasmids and stained with an H3 HA-specific monoclonal antibody, 9H10. FIG. IE shows an AUC analysis of 4 independent experiments represented in FIG. ID. FIG. IF shows confocal microscopy images of cells transfected with the indicated plasmids, stained with Hoescht 33342 (blue), N2 polyclonal antibody (red), and H3 monoclonal antibody, 9H10 (green). FIG. 1G shows a graph of NA activity detected by ELLA assay using 293T cells transfected with plasmids expressing the indicated genes. FIG. 1H shows confocal microscopy images of HA fusion assay in 293 T cells 24 hours post transfection, stained with Hoescht 33342 (blue) and the fluorescent lectin, WGA (green). FIG. IB and FIG. ID are representative of four independent experiments, and FIG. 1C, FIG. IE, and FIG. 1G include means from all four independent experiments. For FIG. IF and FIG. 1H, images were taken 24 hours post transfection and are representative of two independent experiments. All scale bars = 30 pm. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini-Hochberg FDR correction. FDR-corrected p-values are reported above sample groups. Data are shown as means ± standard error of mean (SEM).
[0013] FIGs. 2A-2L demonstrate that vaccination with an H3N2 NA-F2A-HA mRNA-LNP is as immunogenic against both antigens in mice as mRNA-LNPs encoding either antigen. FIG. 2A is a schematic of vaccine groups and vaccination regimen. FIG. 2B shows the results of cell-based ELISAs against 293T cells transfected with a A / Tasmania / 503 / 2020 NA expression plasmid. FIG. 2C shows an AUC analysis for data shown in FIG. 2B. FIG. 2D shows the results of cellbased ELISAs against 293T cells transfected with a A / Tasmania / 503 / 2020 HA expression plasmid. FIG. 2E shows an AUC analysis for data shown in FIG. 2D. FIG. 2F shows the results of HAI assays performed with the indicated virus. Values below the limit of detection (LOD) (10 HAI units, dotted line) were set to 6 HAI units for inclusion in the plot. FIG. 2G shows the results of ELLA assays performed with an active N2 enzyme. Values below the LOD (10 units, dotted line) were set to 5 for inclusion in the plot. FIG. 2H shows the results of MNso assays performed using the indicated virus. Values below LOD (1, dotted line) were set to 0.5 for inclusion in the plot. FIG. 21 shows the results of PRNTso assays performed using the indicated virus in MDCK cells. Any values under the LOD (ULD) (100, dotted line) are shown as 5 for inclusion in the plot. FIG. 2J is a schematic of vaccine groups and challenge layout. FIG. 2K shows change in body weight over 14 days following lethal challenge with the indicated virus. Dashed line indicates humane endpoint, loss of greater than 25% of starting bodyweight. FIG. 2L shows percent survival of vaccinated mice following challenge with the indicated virus. If only part of the group survived, that number is indicated in parentheses. For FIGs. 2F-2I, line shown is the mean. For all experiments, n = 5 mice per group and experiments using sera were all performed with sera taken 21 days post vaccination. Mice were vaccinated with doses as follows: BSA, 10 pg; luciferase mRNA-LNPs, 5.1 pg; NA mRNA-LNPs, 2.275 pg; HA mRNA- LNPs, 2.725 pg; NA mRNA-LNP, 2.275 and HA mRNA-LNPs, 2.725 pg; NA-F2A-HA mRNA- LNPs 5.1 pg; Flulaval, 10 pg. For all panels, data are representative of two independent experiments, and are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0014] FIGs. 3A-3P demonstrate that the NA-F2A-HA mRNA-LNP design can be applied to additional influenza virus subtypes to induce superior immunogenic responses to Flulaval in mice. FIG. 3A is a schematic showing vaccine design of H1N1, IBV-Victoria, and IBV- Yamagata NA-F2A-HA mRNA-LNPs. FIG. 3B shows the results of cell-based ELIS As against 293T cells transfected with the indicated NA expression plasmid. FIG. 3C shows an AUC analysis of data in FIG. 3B. FIG. 3D shows the results of cell-based ELISAs against 293T cells transfected with the indicated HA expression plasmid. FIG. 3E shows an AUC analysis of data in FIG. 3D. FIG. 3F shows the results of PRNTso assays performed using the indicated virus in MDCK cells. FIG. 3G shows the results of cell-based ELISAs against 293T cells transfected with the indicated NA expression vector. FIG. 3H shows an AUC analysis of data in FIG. 3G. FIG. 31 shows the results of cell-based ELISAs against 293T cells transfected with the indicated HA expression plasmid. FIG. 3J shows an AUC analysis of data in FIG. 31. FIG. 3K shows the results of PRNTso assays performed using the indicated virus in MDCK cells. FIG. 3L shows the results of cell-based ELISAs against 293T cells transfected with the indicated NA expression plasmid. FIG. 3M shows an AUC analysis of data in FIG. 3L. FIG. 3N shows the results of cellbased ELISAs against 293T cells transfected with the indicated HA expression plasmid. FIG. 30 shows an AUC analysis of data in FIG. 3N. FIG. 3P shows the results of PRNTso assays performed using the indicated virus in MDCK cells. For FIG. 3F, FIG. 3K, and FIG. 3P, any values under the LOD (ULD) (100, dotted line) are shown as 50 for inclusion in the plot. For all experiments, n = 5 mice per group and experiments using sera were all performed with sera taken 21 days post vaccination. mRNA-LNP vaccinated mice all received 5 pg of their respective vaccine, and Flulaval vaccinated mice received 10 pg of a Flulaval dose. For all panels, data are representative of two independent experiments, and shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini-Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0015] FIGs. 4A-4O demonstrate that a mixture of four NA-F2A-HA mRNA-LNPs elicits protective immune responses against lethal H1N1, H3N2, and IBV-Yamagata challenges. FIG. 4A is a schematic of the vaccination and challenge experiment. FIGs. 4B-4E each show an AUC analysis using cell-based ELISAs against 293T cells transfected with the NA or HA for the indicated virus strains. FIGs. 4F-4I show the results of PRNT50 assays performed using the indicated viruses in MDCK cells. Any values under the LOD (ULD) (100, dotted line) are shown as 50 for inclusion in the plot. FIGs. 4J-4L show change in bodyweight through 14 days following lethal challenge with the indicated viruses. Dashed line indicates humane endpoint, loss of greater than 25% of starting bodyweight. FIGs. 4M-4O show percent survival of vaccinated mice following challenge with the indicated viruses. For all experiments, n = 5 mice per group and experiments using sera were all performed with sera taken 21 days post vaccination. mRNA-LNP vaccinated mice all received 10 pg total of their respective vaccine (2.5 pg of each H1N1, H3N2, IBV-V and IBV-Y NA-F2A-HA mRNA-LNPs for ‘four mRNA- LNP’ group), and Flulaval vaccinated mice received 10 pg of a Flulaval dose. For all panels, data are representative of two independent experiments, and are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini-Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0016] FIGs. 5A-5P demonstrate that a mixture of four NA-F2A-HA mRNA-LNPs elicits a strong immune response to not only vaccine strain NA, HA, and HA stalk, but also diverse group 1 and 2 HAs, and limits disease following H1N1 viral challenge in ferrets. FIG. 5A is a schematic of the vaccination and challenge experiment. FIGs. 5B-5E each show an AUC analysis using cell-based ELISAs against 293T cells transfected with the NA or HA for the indicated virus strains. ELISAs are shown as net change in antibody reactivity between prevaccination sera (d-2) to post-vaccination (d28) sera. FIGs. 5F-5I show the results of PRNTso assays using the indicated viruses in MDCK cells. Any values under the LOD (ULD) (100, dotted line) are shown as 50 for inclusion in the plot. Any values over the LOD (OLD) (3,200) are shown as 4,000 for inclusion in the plot. FIG. 5 J shows change in body weight over 14 days post viral challenge. Dotted line = 0. FIG. 5K shows the results of performing qRT-PCR on oral swab samples taken from ferrets at -3-, 2-, 4- or 7-days post infection. FIG. 5L shows the viral load determined from plaque assays using oral swabs taken from ferrets at -3, 2-, 4-, or 7-days post infection. Any values not detected (LOD = 10 PFU / mL, dotted line) are shown as 5 for inclusion in the plot. FIGs. 5M-5N show the results of cell-based ELISAs (left) and the corresponding AUC analysis (right) against 293T cells transfected with the indicated HA stalk expression plasmid. AUC analysis is shown as net change in antibody reactivity between predotted line) and post-vaccination (solid line) ferret sera. FIG. 50 shows the results of a Luminex binding assay performed with group 1 HAs. FIG. 5P shows the results of a Luminex binding assay performed with group 2 HAs. Comparisons to the right of each panel are between the four mRNA-LNP- and Flulaval-vaccinated groups of animals. For all panels, n = 4 ferrets per experimental group and the experiment was performed once. mRNA-LNP vaccinated ferrets received 30 pg total of their respective vaccine (7.5 pg of each H1N1, H3N2, IBV-V and IBV-Y NA-F2A-HA LNPs for ‘four mRNA-LNP’ group), and Flulaval vaccinated ferrets received a full 60 pg of a Flulaval dose. Data are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benj ami ni -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0017] FIGs. 6A-6D show validation of the A / Tasmania / 503 / 2020-reactive antibodies used for antigen detection. FIG. 6A shows the results of cell-based ELISAs against MDCK cells infected with the indicated virus (MOI = 3) at 24 hours post infection, stained using dilutions of an anti- N2 polyclonal antibody. FIG. 6B shows an AUC analysis of data represented in FIG. 6A. FIG. 6C shows the results of cell-based ELISAs against MDCK cells infected with the indicated virus (MOI = 3) at 24 hours post infection, stained using dilutions of an anti-H3 monoclonal antibody, 9H10. FIG. 6D shows an AUC analysis of data represented in FIG. 6C. FIG. 6A and FIG. 6C are representative of four independent experiments (n = 4), and FIG. 6B and FIG. 6D include replicates from four independent experiments. Data are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini-Hochberg FDR correction. FDR-corrected p-values were rounded to the nearest decimal point and reported above sample groups.
[0018] FIGs. 7A-7F demonstrate that the four mRNA-LNP vaccine can be used to boost preexisting immune responses established by pre-immune vaccination mix or Flulaval. FIG. 7A shows the results of ELISAs against A / California / 04 / 2009 whole virus using sera taken from vaccinated mice 21 days post vaccination. ‘Pre-immune mix l’= mix of inactivated A / California / 04 / 2009, A / Wyoming / 03 / 2003, B / Malaysia / 2506 / 2004, and B / Yamagata / 16 / 1988, ‘Pre-immune mix 2’ = Flulaval. FIG. 7B shows an AUC analysis of data represented in FIG. 7A. FIG. 7C shows the results of cell-based ELISAs against 293T cells transfected with the indicated HA expression plasmid using sera 14 days after boost with indicated vaccines. FIG. 7D shows an AUC analysis of data represented in FIG. 7C. FIG. 7E shows the results of cellbased ELISAs against 293T cells transfected with indicated NA expression plasmid using sera 14 days after boost with indicated vaccines. FIG. 7F shows an AUC analysis of data represented in FIG. 7E. Mice were first primed with either 10 pg of BSA, 10 pg (2.5 pg of each component) of ‘Pre-immune mix 1’ group, or 10 pg of Flulaval for ‘Pre-immune mix 2’ group. After 21 days, mice were then boosted with either 10 pg of BSA or 10 pg of the four mRNA-LNP mix (2.5 pg of each H1N1, H3N2, IBV-V and IBV-Y NA-F2A-HA LNPs), and post-boost sera was taken following 14 days. Vaccination is representative of two independent experiments (n=5 mice per group shown). Data are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal-Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini-Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0019] FIGs. 8A-8D show validation of headless, stalk-only HA constructs. FIG. 8A shows the results of cell-based ELISAs against 293T cells transfected with either an H1N1 full length HA or HA stalk-only (hlHA) expression plasmid, stained with dilutions of a conformation specific anti-influenza virus stalk antibody, CR9114. FIG. 8B shows an AUC analysis of ELISAs represented in FIG. 8A. FIG. 8C shows the results of cell-based ELISAs against 293T cells transfected with either an H3N2 full length HA or HA stalk-only (hlHA) expression plasmid, stained with dilutions of CR9114. FIG. 8D shows an AUC analysis of ELISAs represented in FIG. 8C. FIG. 8 A and FIG. 8C are representative of four independent experiments (n = 4), and FIG. 8B and FIG. 8D include replicates from four independent experiments. Data are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal- Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0020] FIGs. 9A-9B demonstrate that Flulaval elicits similar immune responses when administered intradermally or intramuscularly to mice. FIG. 9A shows the results of cell-based ELTSAs against 293T cells transfected with indicated NA and HA expression plasmids using sera taken 21 days post vaccination. Solid lines indicate intradermal (I.D.) vaccination and dotted line indicates intramuscular (I.M.) vaccination. FIG. 9B shows an AUC analysis of ELISA shown in FIG. 9A. Vaccination is representative of two independent experiments (n = 5 mice per group shown). Data are shown as means ± SEM. For all panels including statistics, significance was determined using Kruskal -Wallis test followed by pairwise Wilcoxon rank-sum tests with a Benjamini -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0021] FIG. 10 shows a CLUSTAL O (1.2.4) alignment of the sequences of the HA protein from the H1N1 A / Victoria / 2570 / 2019 vaccine strain (SEQ ID NO: 22) and the HA protein from A / Hawaii / 70 / 2019 (SEQ ID NO: 41).
[0022] FIG. 11 shows a CLUSTAL O (1.2.4) alignment of the sequences of the HA protein from the H3N2 A / Tasmania / 503 / 2020 vaccine strain (SEQ ID NO: 21) and the HA protein from A / Switzerland / 9715293 / 2013 (SEQ ID NO: 42).
[0023] FIG. 12 shows a CLUSTAL O (1.2.4) alignment of the sequences of the HA protein from the B / Washington / 02 / 2019 vaccine strain (SEQ ID NO: 23) and the HA protein from B / Colorado / 06 / 2017 (SEQ ID NO: 43).
[0024] FIGs. 13A-13G show expression of the H5 and N1 proteins from A / Texas / 37 / 2024 from a DNA vector. FIG. 13A is a schematic of the pCAGGs-NA-F2A-HA genetic design and expression of unmodified glycoproteins. Furin cleavage site, FCS; porcine teschovirus-1 2A site (PTV-2A); signal peptide (SP); furin, F; signal peptide peptidase, SPP; endoplasmic reticulum, ER. FIG. 13B is a schematic of in vitro testing of DNA constructs. FIG. 13C shows the results of cell-based ELISAs against 293T cells transfected with the indicated plasmid and stained with dilutions of an anti-influenza HA antibody, CR9114. FIG. 13D shows confocal microscopy images of 293T cells transfected with the indicated plasmid and stained with Hoescht 33342 (blue), anti-HA antibody, CR9114 (green), and anti-H5Nl NA polyclonal sera (red). FIG. 13E shows the results of cell-based ELISAs against 293T cells transfected with the indicated plasmid and stained with dilutions of an anti-Nl influenza polyclonal serum. FIG. 13F shows NA activity detected by ELLA assay using 293T cells transfected with the indicated plasmid. FIG. 13G shows confocal microscopy images of an HA fusion assay in 293T cells transfected with the indicated plasmids and stained with wheat germ agglutinin (WGA) to stain cell surfaces. For FIG. 13D and FIG. 13G, images are representative of two independent experiments and were taken of cells fixed 24 hours post-transfection. Scale bars = 30pm. Panels C, E, F are representative of four independent experiments and data are shown as means ± standard error of mean (SEM). Where indicated, significance was determined using a Kruskal-Wallis test followed by a Mann-Whitney U test with a Benjamini -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0025] FIGs. 14A-14E demonstrate that DNA vaccination of mice elicits sera reactivity and functionally inhibitory antibody responses. FIG. 14A is a schematic detailing vaccine groups and regimen. FIG. 14B shows the results of cell-based ELISAs against 293T cells transfected with an A / Texas / 37 / 2024 HA-expressing plasmid and stained with dilutions of sera from indicated groups of vaccinated mice following prime and boost (left) and area under the curve (AUC) analysis (right). FIG. 14C shows the results of cell-based ELISAs against 293T cells transfected with an A / Texas / 37 / 2024 NA-expressing plasmid and stained with dilutions of sera from indicated groups of vaccinated mice, following prime and boost (left) AUC analysis (right). FIG. 14D shows the results of neuraminidase inhibition assays (NAIs) using ELLA assays performed with cells transfected with a A / Texas / 37 / 2024 NA expression plasmid and sera from indicated groups of vaccinated mice following prime and boost. Values below the LOD (1 :20 dilution, dotted line) were set to 15 for inclusion in the plot. FIG. 14E shows the results of microneutralization assays using a A / Texas / 37 / 2024 reporter virus. Values below the LOD (1:20 dilution, dotted line) were set to 15 for inclusion in the plot, n = 5 mice per group shown, and mice were vaccinated with doses as follows: pCAGGs-Luciferase, 50pg; pCAGGs NA, 23pg, pCAGGs-HA, 27pg; pCAGGs-NA-F2A-HA 50|ig; for both prime and boost. All data are representative of two independent experiments. For FIGs. 14B-14C, data are shown as mean ± SEM. For FIGs. 14D-14E, lines indicate means. Statistical significance for FIGs. 14B-14D was determined using a Mann-Whitney U test with a Benjamini-Hochberg FDR correction. For FIG. 14E, a Kruskal-Wallis test followed by a Mann-Whitney U test with a Benhjamini -Hochberg FDR correction was used for testing statistical significance. FDR-corrected p-values are reported above sample groups.
[0026] FIGs. 15A-15I demonstrate that DNA vaccination protects mice from lethal challenge with A / Texas / 37 / 2024. FIG. 15A is a schematic detailing vaccine groups and vaccination / challenge regimen. Mice were primed with vaccine groups and bled to assess immune responses 19 days post prime (P+19). Mice were then boosted 21 days post-prime (P+21) and bled 14 later (B+14). Groups were then challenged, and lungs were either taken 3 days post infection (DPI) or followed for bodyweight, survival, and clinical scores for 14 days. FIGs. 15B-15E show qRT-PCR results for lung homogenates taken from mice day 3 postinfection for A / Texas / 37 / 2024 HA (FIG. 15B), CXCL-10 (FIG. 15C), IFN- (FIG. 15D), and TNF-a (FIG. 15E). FIG. 15F shows clinical scores of vaccinated mice following lethal challenge with A / Texas / 37 / 2024. FIG. 15G shows viral lung titer of vaccinated mice 3 days post-infection determined using plaque assays on MDCK cells. Limit of detection (LOD, dotted line) is 10 PFU / mL, and values under the LOD (ULD) are shown as 5 PFU / mL for inclusion in the plot. FIG. 15H shows change in bodyweight over 14 days post-viral challenge. Dotted line = 75% humane endpoint of loss of greater than 25% of starting body weight. FIG. 151 shows percent survival of vaccinated mice following challenge with A / Texas / 37 / 2024. n = 4 mice per group shown, and mice were vaccinated with doses as follows: pCAGGs-Luciferase, 50pg; pCAGGs NA, 23 pg, pCAGGs-HA, 27pg; pCAGGs-NA-F2A-HA 50pg; for both prime and boost. All data are representative of two independent experiments and are shown as means ± SEM. Where indicated, statistical significance was determined using a Kruskal-Wallis test followed by a Mann-Whitney U test with a Benjamini -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0027] FIGs. 16A-16F demonstrate that mRNA-LNP vaccination of mice elicits robust immune responses with functional neutralization activity. FIG. 16A is a schematic detailing vaccine groups and regimen. FIG. 16B shows the results of cell-based ELISAs against 293T cells transfected with an A / Texas / 37 / 2024 HA-expressing plasmid and stained with dilutions of sera from indicated groups of vaccinated mice following prime and boost (left) and AUC analysis (right). FIG. 16C shows the results of cell-based ELISAs against 293 T cells transfected with an A / Texas / 37 / 2024 NA-expressing plasmid and stained with dilutions of sera from indicated groups of vaccinated mice, following prime and boost (left) and AUC analysis (right). FIG. 16D shows the results of hemagglutination inhibition assays (HAIs) performed with A / Texas / 37 / 2024 virus. Values below limit of detection (10 HAI units, dotted line) were set to 5 for inclusion in the plot. FIG. 16E shows the results of neuraminidase inhibition assay (NAIs) using ELLA assays performed with cells transfected with a A / Texas / 37 / 2024 NA expression plasmid and sera from indicated groups of vaccinated mice following prime and boost. Values below the LOD (1:20 dilution, dotted line) were set to 10 for inclusion in the plot. FIG. 16F shows the results of microneutralization assays performed using an A / Texas / 37 / 2024 reporter virus. Values below the LOD (1:20 dilution, dotted line) were set to 10 for inclusion in the plot, n = 4 mice per group shown, and mice were vaccinated with doses as follows: Luciferase mRNA-LNP 5pg; NA-F2A- HA mRNA-LNP 5 pg; for both prime and boost. All data are representative of two independent experiments. For FIGs. 16B-16C, data are shown as mean ± SEM. For FIGs. 16D-16F, lines indicate means. Where indicated, statistical significance was determined using a Mann-Whitney U test with a Benjamini -Hochberg FDR correction. FDR-corrected p-values are reported above sample groups.
[0028] FIGs. 17A-17J demonstrate that mRNA-LNP vaccination protects mice from lethal challenge with A / Texas / 37 / 2024. FIG. 17A is a schematic detailing vaccine groups and vaccination / challenge regimen. Mice were primed with vaccine groups and bled to assess immune responses 19 days post prime (P+19). Mice were then boosted 21 days post-prime (P+21) and bled 14 later (B+14). Groups were then challenged, and lungs were either taken 3 days post infection (DPI) or followed for body weight, survival, and clinical scores for 14 days. FIG. 17B shows qRT-PCR results for lung homogenates taken from mice day 3 post-infection for A / Texas / 37 / 2024 HA. FIG. 17C shows the viral lung titer of vaccinated mice 3 days postinfection determined using plaque assays on MDCK cells. Limit of detection (LOD, dotted line) is 10 PFU / mL, and values under the LOD (ULD) are shown as 5 PFU / mL for inclusion in the plot. FIGs. 17D-17F show qRT-PCR results for lung homogenates taken from mice day 3 postinfection for CXCL-10 (FIG. 17D), IFN-0 (FIG. 17E), and TNF-a (FIG. 17F). FIG. 17G shows hematoxylin and eosin staining of lung sections of challenged mice taken at three days postinfection. Scale bar for 5X and inset = 500 pm and 100 pm, respectively. FIG. 17H shows clinical scores of vaccinated mice following lethal challenge with A / Texas / 37 / 2024. FIG. 171 shows change in bodyweight over 14 days post-viral challenge. Dotted line = 75% humane endpoint of loss of greater than 25% of starting bodyweight. Crosses represent days in which one or more mouse succumbed to infection as described in FIG. 17J. FIG. 17J shows percent survival of vaccinated mice following challenge with A / Texas / 37 / 2024. n = 4 mice per group shown, except control -vaccinated mice for FIGs. 17H-17J had n=3, and mice were vaccinated with doses as follows: Luciferase mRNA-LNP 5 pg; NA-F2A-HA mRNA-LNP 5 pg; for both prime and boost. All data are representative of two independent experiments and are shown as means ± SEM. Where indicated, statistical significance was determined using a Mann-Whitney U test. P-values are reported above sample groups.
[0029] FIG. 18 is a schematic of the vaccine strategy described in Example 3. This strategy utilizes one construct that encodes a full-length HA protein and another construct that encodes both a NA protein and a headless hemagglutinin (hlHA) protein, separated by a furin cleavage site and a 2A ribosome-skipping sequence, in a single open reading frame (NA-F2A-hlHA).
[0030] FIGs. 19A-19E demonstrate that the encoded epitopes (i.e., NA and hlHA) were properly expressed from the NA-F2A-hlHA constructs. The indicated DNA plasmids were transfected into mammalian cells and antibody binding to NA and HA stalk was assessed via ELISA. In FIGs. 19A-19C, HA stalk binding was measured for plasmids encoding epitopes from A / Texas / 37 / 2024 (FIG. 19A), A / Shanghai / 02 / 2013 (FIG. 19B), and A / Louisiana / 12 / 2024 (FIG. 19C). In FIGs. 19D-19E, NA binding was measured in A / Texas / 37 / 2024 NA serum (FIG. 19D) and in anti-Nl A / Texas / 37 / 2024 NA polyclonal sera (FIG. 19E).
[0031] FIGs. 20A-20B demonstrate that DNA vaccination of mice with the NA-F2A-hlHA constructs elicits robust immune responses in both the presence and absence of the full-length HA construct. Mice were vaccinated with the indicated constructs, and antibody responses to the indicated NA (FIG. 20A) and hlHA (FIG. 20B) proteins were measured in post-vaccination sera.
[0032] DETAILED DESCRIPTION
[0033] The present invention provides compositions comprising one or more polynucleotides that encode a neuraminidase (NA) polypeptide and a hemagglutinin (HA) polypeptide separated by a furin cleavage site and a self-cleaving 2A polypeptide. Methods of using these compositions to induce an immune response to influenza in a subject are also provided.
[0034] The compositions of the present invention are designed for use in a novel influenza vaccine strategy, as demonstrated in Examples 1-3. In Example 1, the inventors describe mRNA- based vaccines that utilize this strategy. In Example 2, they demonstrate that this strategy can also be utilized for DNA-based vaccines and that it can be applied to a highly pathogenic avian influenza (HP Al) H5N1 virus. And, in Example 3, they demonstrate the use of this strategy with modified (i.e., headless) HA polypeptides.
[0035] Compositions:
[0036] In a first aspect, the present invention provides compositions comprising at least one NA- F2A-HA polynucleotide. As used herein, the term “NA-F2A-HA polynucleotide” refers to a polynucleotide that encodes from 5’ to 3’: a neuraminidase (NA) polypeptide, a furin cleavage site (F), a self-cleaving 2A polypeptide (2A), and a hemagglutinin (HA) polypeptide. NA-F2A- HA polynucleotides are designed such that both the NA polypeptide and the HA polypeptide that are expressed therefrom are free of residual amino acids.
[0037] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to a series of amino acid residues connected by peptide bonds between the alpha-amino and carboxy groups of adjacent residues, forming a polymer of amino acids. Polypeptides may be modified to include non-amino acid moieties (e.g., via acetylation, glycosylation) and may include amino acid analogs.
[0038] Neuraminidase (NA) is an enzymatic protein found on the surface of influenza viruses. As used herein, the term “neuraminidase (NA) polypeptide” may refer to an NA polypeptide of any subtype (e.g., N1-N9) from any strain of influenza virus. In some embodiments, the subtype of the NA polypeptide is Nl, N2, or N9. The NA polypeptide(s) used with the present invention may be wild-type proteins or modified proteins.
[0039] As used herein, a “wild-type protein” is a protein that is in its natural, unmodified form. In contrast, a “modified protein” is a protein that has been altered to comprise a mutation. As used herein, the term “mutation” refers to a difference in an amino acid sequence relative to a reference sequence, such as a wild-type sequence. Mutations include insertions, deletions, and substitutions. An “insertion” is an addition of one or more amino acid residues relative to a reference sequence. An insertion may add 1, 2, 3, 4, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, or more amino acid residues to a sequence. A “deletion” is a removal of one or more amino acid residues relative to a reference sequence. A deletion may remove 1, 2, 3, 4, 5, 10, 20, 50, 100, 200, or more amino acids residues from a sequence. A “substitution” is a replacement of one amino acid in a reference sequence with a different amino acid. A substitution may be conversative (i.e., a replacement with an amino acid that has similar properties) or radical (i.e., a replacement with an amino acid that has different properties).
[0040] In the Examples, the inventors tested polynucleotides that encode NA polypeptides from a variety of influenza viruses, including various strains of influenza A and influenza B (see Table 1). The sequences of the disclosed NA polypeptides are provided as SEQ ID NOs: 11-20. Thus, in some embodiments, the NA polypeptide comprises any one of SEQ ID NOs: 11-20 or a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID Nos: 11-20.
[0041] Table 1. Polynucleotides tested in the Examples
[0042] “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window. The aligned sequences may comprise insertions or deletions (i.e., gaps) relative to each other for optimal alignment. The percentage is calculated by determining the number of matched positions at which an identical nucleic acid base or amino acid residue occurs in both sequences, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100. Protein and nucleic acid sequence identities can be evaluated using the Basic Local Alignment Search Tool ("BLAST"), which is well known in the art (Karlin and Altschul, Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc. Natl. Acad. Sci. USA (1990) 87: 2267-2268; Altschul et al. Gapped BLAST and PSLBLAST: a new generation of protein database search programs. Nucl. Acids Res. (1997) 25: 3389-3402). The BLAST programs identify homologous sequences by identifying similar segments between a query amino acid or nucleic acid sequence and a test sequence, which is preferably obtained from a protein or nucleic acid sequence database. The BLAST programs can be used with the default parameters or with modified parameters provided by the user.
[0043] Hemagglutinin (HA) is a glycoprotein found on the surface of influenza viruses. As used herein, the term “hemagglutinin (HA) polypeptide” may refer to an HA polypeptide of any subtype (e.g., H1-H18) from any strain of influenza virus. In some embodiments, the subtype of the HA polypeptide is Hl, H3, H5 or H7. The HA polypeptide(s) used with the present invention may be wild-type proteins or modified proteins. HA is a homotrimer wherein each monomer is a single polypeptide chain having an HA1 region and an HA2 region. The HA2 region sits on top of the HA1 region. The HA1 region comprises the head domain, which is immunodominant and comprises a cell binding region that binds to sialic acid-containing receptors on the surface of cells to promote fusion of the viral membrane with the cell membrane. The HA1 region and HA2 region are linked by disulfide bridges.
[0044] In the Examples, the inventors tested polynucleotides that encode HA polypeptides from a variety of influenza viruses, including various strains of influenza A and influenza B (see Table 1). Specifically, they tested polynucleotides that encode the full-length HA polypeptides of SEQ ID NOs: 21-30 and polynucleotides that encode the headless HA (hlHA) polypeptides of SEQ ID NOs: 35-38. Thus, in some embodiments, the HA polypeptide is: (a) a full-length HA polypeptide selected from SEQ ID NOs: 21-30; (b) a headless HA polypeptide selected from SEQ ID NOs: 35-38; or (c) a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOs: 21-30 and 35-38.
[0045] In some embodiments, the HA polypeptide is a full-length HA polypeptide. A “full-length HA polypeptide” is an HA polypeptide that comprises all domains of HA, namely: the signal peptide, the head domain (included in the HA1 domain), the stalk domain (included in the HA2 domain), the transmembrane domain, and the cytoplasmic tail. For illustration of the different domains of HA, an exemplary wild-type HA polypeptide sequence is provided as SEQ ID NO: 50, its globular head domain is provided as SEQ ID NO: 51, its stalk domain is provided as SEQ ID NO: 52, and its transmembrane domain and cytoplasmic tail are provided as SEQ ID NO: 53. Notably, the sequence of the head domain (SEQ ID NO: 51) is inserted within the stalk domain (SEQ ID NO: 52) within the full-length wild-type HA protein (SEQ ID NO: 50).
[0046] In other embodiments, the HA polypeptide is a headless HA polypeptide or an HA polypeptide that lacks at least a portion of the head domain. A “headless HA polypeptide (hlHA)” is a modified HA polypeptide that lacks the globular head domain of HA. A headless HA polypeptide comprises, at a minimum, the transmembrane domain of HA and the cytoplasmic tail of HA. The head domain of HA is immunodominant, meaning that the immune response to an HA polypeptide is skewed in favor of epitopes within this domain. Thus, removing the head domain generates an HA polypeptide with an altered immunogenicity. For example, removal of the head domain may generate an HA polypeptide in which epitopes that are typically subdominant (i.e., epitopes that are not targeted or targeted to a lower degree during an immune response), such as the HA stalk domain, become immunodominant. In some embodiments, the headless HA polypeptide consists of the transmembrane domain and cytoplasmic tail of HA. In other embodiments, the headless HA polypeptide further comprises the stalk domain of HA. Because the stalk domain of HA is highly conserved, it has great potential for use as an antigen in a universal vaccine that provides broad cross-protection against different influenza subtypes.
[0047] Many suitable headless HA polypeptides are known in the art, including those disclosed in US Patent Application Publication No. 2023 / 0390383 and Hamele et al. (J Virol 98(10):e0116624, 2024), which are both hereby incorporated by reference their entireties. The headless HA polypeptides disclosed in these references are provided as SEQ ID NOs: 55-58. In SEQ ID NO: 54, which is referred to as “4G headless HA”, the HA1 sequence between Cys52 and Cys277 is replaced with a -GGGG- linker (SEQ ID NO: 59). In SEQ ID NO: 55 and SEQ ID NO: 56, which are referred to as “mini headless HA” and “GCN4 headless HA”, respectively, a majority of the HA1 sequence is replaced with a -GGGG- linker (SEQ ID NO: 59) and a disulfide bond is introduced to stabilize the HA2 trimers. Mini headless HA does not include the trimerization motif (GCN4), whereas GCN4 headless HA does. In SEQ ID NO: 57, which is referred to herein as “6SS headless HA”, the HA1 sequence is replaced with a -GSG- linker and a loop on the stalk is replaced with a -GSGGSG- linker (SEQ ID NO: 60). Thus, the stalk domain of 6SS headless HA (SEQ ID NO: 58) is not the full-length HA stalk domain. (Note: Each of these four headless HA designs is based on a previously described headless HA polypeptide of the same name, but they have been modified to include the HA transmembrane domain and cytoplasmic tail for membrane anchoring.) Of these four headless HA designs, 6SS is the only headless HA that is thought to fold correctly. Thus, all the headless HA polypeptides that were used in the Examples are based on the 6SS design. However, those of skill in the art can readily design other headless HA polypeptides using any of these headless HA designs as a template.
[0048] In some embodiments, the HA polypeptide includes a signal peptide at its N-terminus for membrane trafficking. In some embodiments, the signal peptide is an HA signal peptide. The HA signal peptide is important for starting co-translational insertion into the ER membrane. It contains about 10 hydrophobic amino acids that can form an alpha-helix, but there is little sequence conservation between HA subtypes. The HA signal polypeptide may comprise SEQ ID NO: 61 or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 61. In preferred embodiments, the signal peptide is the native HA signal peptide that is naturally found at the N-terminus of the HA polypeptide. In other embodiments, the signal peptide is an IL12 signal peptide, which has been well characterized and is efficiently targeted to the cell membrane. The IL12 signal peptide may include the polypeptide of SEQ ID NO: 62 or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 62. However, any signal peptide that targets a protein to the cellular membrane may be included in the HA polypeptide.
[0049] “Self-cleaving 2A polypeptides” or “2A peptides” are a class of 18-22 amino-acid-long polypeptides that induce ribosomal skipping during translation of a protein, resulting in the production of multiple proteins from a single RNA transcript. Self-cleaving 2A polypeptides are known in the art as described, for example, in Kim, J. H. et al., PLOS ONE, 6(4), el8556. Suitable self-cleaving 2A polypeptides may include, without limitation, FMDV 2A, equine rhinitis A virus (ERAV) 2A (E2A), porcine teschovirus 2A (PTV-2A), and Thoseaasigna virus 2A (T2A). The inventors utilized the PTV-2A motif of SEQ ID NO: 40 as the self-cleaving 2A polypeptide in the constructs tested in the Examples. Thus, in some embodiments, the selfcleaving 2A polypeptide comprises a PTV-2A motif. In some embodiments, the PTV-2A motif comprises SEQ ID NO: 40. In some embodiments, the self-cleaving 2A polypeptide comprises a sequence that has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 40.
[0050] A “furin cleavage site” is a is a peptide sequence that is recognized and cleaved the serine protease furin. The inventors utilized the furin cleavage site of SEQ ID NO: 39 in the polynucleotides tested in the Examples. Thus, in some embodiments, the furin cleavage site comprises SEQ ID NO: 39 or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 39. The inclusion of a furin cleavage site results in the removal of residual amino acids from the self-cleaving 2A polypeptide that would otherwise be left on the HA polypeptide and NA polypeptide. Thus, in preferred embodiments, the HA polypeptide(s) and NA polypeptide(s) are free of residual amino acids from the furin cleavage site and the self-cleaving 2A polypeptide when expressed.
[0051] In the Examples, the inventors tested NA-F2A-HA polynucleotides that encode the specific polypeptide constructs presented in Table 1, namely polynucleotides that encode the polypeptide constructs of SEQ ID NOs: 1-10 and 31-34. Thus, in some embodiments, the NA- F2A-HA polynucleotide encodes a polypeptide construct selected from SEQ ID NOs: 1-10 and 31-34 and sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to one of SEQ ID NOs: 1-10 and 31-34.
[0052] In some embodiments, the compositions comprise two or more NA-F2A-HA polynucleotides that encode different NA polypeptides and / or different HA polypeptides. In Example 1, the inventors test compositions that comprise four different NA-F2A-HA polynucleotides that each encode NA / HA polypeptides from a different virus (i.e., one polynucleotide encoding NA / HA polypeptides from H3N2 A / Tasmania / 503 / 2020, one polynucleotide encoding NA / HA polypeptides from H1N1 A / Victoria / 2570 / 2019, one polynucleotide encoding NA / HA polypeptides from IBV_V B / Washington / 02 / 2019, and one polynucleotide encoding NA / HA polypeptides from IBV_Y B / Phuket / 3073 / 2013). Thus, in some embodiments, the compositions comprise two or more NA-F2A-HA polynucleotides that encode NA / HA polypeptides from different viruses. In some embodiments, the NA / HA polypeptides are different NA / HA subtypes. In some embodiments, the compositions comprise four different NA- F2A-HA polynucleotides. In other embodiments, the compositions comprise two or more NA- F2A-HA polynucleotides that encode different variations of an NA or HA polypeptide from a single virus. For example, the compositions may comprise one polynucleotide that encodes the full-length, wild-type version of an HA polypeptide and another polynucleotide that encodes a modified version of the same HA polypeptide (e.g., a headless version). Additionally or alternatively, the compositions may comprise one polynucleotide that encodes the full-length, wild-type version of an NA polypeptide and another polynucleotide that encodes a modified version of the same NA polypeptide.
[0053] In Example 3, the inventors test compositions that comprise (1) an NA-F2A-HA polynucleotide that encodes a headless HA polypeptide, and (2) a second polynucleotide that encodes a full-length HA polypeptide. A polynucleotide that encodes only an HA polypeptide (i.e., that does not also encode an NA polypeptide) is referred to herein as an “HA polynucleotide”. Thus, in some embodiments, the compositions further comprise both an NA- F2A-HA polynucleotide and an HA polynucleotide. In some embodiments, the HA polypeptide encoded by the NA-F2A-HA polynucleotide is a headless HA polypeptide and the additional HA polypeptide encoded by the HA polynucleotide is a full-length HA polypeptide. In some embodiments, the full-length HA polypeptide encoded by the HA polynucleotide is selected from SEQ ID NOs: 21-30 or a polypeptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NO: 21-30.
[0054] The terms “polynucleotide,” “nucleic acid,” and “oligonucleotide” are used interchangeably herein to refer a polymer of DNA or RNA. A polynucleotide may be singlestranded or double-stranded and may represent the sense or the antisense strand. A polynucleotide may be synthesized or obtained from a natural source. A polynucleotide may contain natural, non-natural, or altered nucleotides, as well as natural, non-natural, or altered internucleotide linkages (e.g., phosphoroamidate linkages, phosphorothioate linkages). The phrase “5’ to 3’” refers to the directionality of a polynucleotide. The 5' end of a polynucleotide has a phosphate group attached to the fifth carbon and the 3' end of a polynucleotide has a hydroxyl (-OH) group attached to the third carbon.
[0055] In Example 2, the inventors demonstrate that their NA-F2A-HA vaccine strategy can be used effectively for both DNA-based and mRNA-based vaccines. Thus, in some embodiments, the NA-F2A-HA polynucleotide is DNA. In other embodiments, the NA-F2A-HA polynucleotide is RNA. In specific embodiments, the polynucleotide is positive strand RNA (i.e., RNA that can be directly translated into protein in a host cell).
[0056] In embodiments in which the NA-F2A-HA polynucleotide is DNA, the NA-F2A-HA polynucleotide may further comprise a promoter. As used herein, the term “promoter” refers to a DNA sequence that defines where transcription of a polynucleotide begins. RNA polymerase and the necessary transcription factors bind to the promoter to initiate transcription. Promoters are typically located directly upstream (i.e., at the 5' end) of the transcription start site. However, a promoter may also be located at the 3’ end, within a coding region, or within an intron of a gene that it regulates. Promoters may be derived in their entirety from a native or heterologous gene, may be composed of elements derived from multiple regulatory sequences found in nature, or may comprise synthetic DNA. The promoter may be constitutive or inducible, tissue or cell-type specific or global. In embodiments in which the NA-F2A-HA polynucleotide comprises a promoter, the promoter may be operably linked the sequence encoding the NA-F2A-HA protein construct to allow it to drive expression of the encoded polypeptides. A promoter is “operably linked” to a polynucleotide if the promoter is positioned such that it can affect transcription of the polynucleotide.
[0057] Further, in embodiments in which the NA-F2A-HA polynucleotide is DNA, the NA-F2A- HA polynucleotide may be part of a vector. The term “vector” refers to a DNA molecule that is used to carry a particular DNA segment (i.e., a DNA segment included in the vector) into a host cell. Some vectors are capable of autonomous replication in a host cell (e.g., bacterial vectors that include an origin of replication and episomal mammalian vectors). Other vectors can be integrated into the genome of a host cell such that they are replicated along with the host genome (e g., viral vectors and transposons). Vectors may include heterologous genetic elements that are necessary for propagation of the vector or for expression of an encoded gene product. Vectors may also include a reporter gene or a selectable marker gene. In the Examples, the inventors inserted NA-F2A-HA polynucleotides into the plasmid pCAGGS, which is a mammalian expression that contains a strong promoter (i.e., the CAG promoter) and is commonly used for gene overexpression. A “plasmid” is a small circular DNA molecule that can replicate independently from chromosomal DNA. Thus, in some embodiments, the NA-F2A-HA polynucleotide is part of a plasmid. In specific embodiments, the plasmid is pCAGGS.
[0058] Due to the degeneracy of the genetic code, various polynucleotides can encode the same polypeptide. The present invention encompasses any polynucleotide that encodes (from 5’ to 3’) a NA polypeptide, a furin cleavage site, a self-cleaving 2A polypeptide, and a HA polypeptide. In the Examples, the inventors codon optimized their NA-F2A-HA polynucleotides to enhance protein expression and reduce immunogenicity. Thus, in some embodiments, the NA-F2A-HA polynucleotide, or at least a portion thereof, is codon optimized. “Codon optimization” is a process used to increase expression of a polynucleotide in a particular host cell by altering the sequence of the polynucleotide to accommodate the codon bias of the host cell. Computer programs for generating codon-optimized sequences for use in a particular host cell are known in the art.
[0059] In embodiments in which the polynucleotide is RNA, the polynucleotide may be modified for increased stability against degradation (in vivo and / or ex vivo). The RNA of the present invention may be stabilized using any RNA stabilization method known in the art. RNA stabilization can be achieved, for example, by via inclusion of a 5’ cap and / or a 3’ polyadenosine tail in the RNA. A “5' cap” is a specially altered nucleotide that is included on the 5' end of some primary transcripts. Examples of suitable 5’ caps include, but are not limited to, m7G(5')ppp (5'(A,G(5')ppp(5')A and G(5')ppp(5')G. A “3’ poly-adenosine (poly A) tail” is a chain of adenine nucleotides added to the 3' end of messenger RNA (mRNA) molecules in eukaryotes via the non-templated process of polyadenylation. The 3’ poly-Atail may comprise about 10 to 200 adenosine nucleotides, about 10 to 100 adenosine nucleotides, about 40 to 80 adenosine nucleotides, or about 50 to 70 adenosine nucleotides. Examples of other 5' modifications that may be utilized for stabilization include, without limitation, inverted deoxythymidine bases, addition of a linker sequence such as C6, addition of a cholesterol, and addition of a reactive linker sequence which could be conjugated to another moiety such as a PEG. Examples of other 3' modifications that may be utilized for stabilization include, without limitation, inverted deoxythymidine bases and inverted abasic residues.
[0060] Alternatively, RNA stabilization can be achieved via modification to the backbone, nucleoside (i.e., sugar and / or base), and / or G / C-content of the RNA. Examples of suitable backbone modifications include, but are not limited to, anionic intemucleoside linkages, N3'^P5' modifications, replacement of non-bridging oxygen atoms with borane or sulfur (e.g., phosphorothioate (PS) bond), neutral internucleoside linkages, amide linkage of the nucleosides, methylene(methylimino) linkages, mesylphosphoramidate (MsPA) linkages, formacetal and thioformacetal linkages, stereodefined backbone configurations, and the like. Examples of nucleoside modifications include, but are not limited to, 2'-O-methyl modified ribose (2'-0Me), 2'-O-methoxy ethyl modified ribose (2'-M0E), 2'fluoro (2'-F), locked nucleic acid (LNA), constrained ethyl (cEt), tricyclo-DNA (tcDNA), phosphorodiamidate morpholino oligos (PMO), peptide nucleic acid (PNA), 5-methyl-cytosine (m5C), and N-acetylgalactosamine (GalNAc) modifications. RNA sequences having high G (guanosine)ZC (cytosine) content are more stable than RNA sequences having high A (adenosine) / U (uracil) content. Thus, the sequence of the RNA may have been modified to have an increased amount of G / C nucleotides.
[0061] In the Examples, the inventors utilized a carrier (i.e., lipid nanoparticles) to deliver their NA-F2A-HA polynucleotides into cells in a subject. Thus, in some embodiments, the compositions further comprise a carrier. As used herein, the term “carrier” refers to a substance that is used to deliver an agent to a targeted site within the body. In preferred embodiments, the carrier is a “pharmaceutically acceptable carrier”, i.e., a carrier that is compatible with the other ingredients of the composition and that is not deleterious to the subject to which the composition is to be administered. Pharmaceutically acceptable carriers include, but are not limited to, excipients, diluents (e.g., Tris-HCl, acetate, phosphate), preservatives (e.g., thimerosal, benzyl alcohol, parabens), solubilizing agents (e.g., glycerol, polyethylene glycerol), emulsifiers, liposomes, nanoparticles, and adjuvants. Pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, or emulsions.
[0062] In preferred embodiments, the carrier is a lipid nanoparticle (LNP). A “lipid nanoparticle” is a spherical vesicle made of lipids. A lipid nanoparticle may be comprised of cationic lipids and / or ionizable lipids, and may include components such as phospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine), cholesterol, and polyethylene glycol (PEG)- functionalized lipids.
[0063] Methods:
[0064] In a second aspect, the present invention provides methods for inducing an immune response to influenza in a subject. The methods comprise administering a composition described herein to the subject.
[0065] Influenza is a contagious respiratory illness caused by influenza viruses. Influenza viruses are negative-sense, single-stranded RNA viruses that can be divided into four distinct subtypes (influenza A, influenza B, influenza C, and influenza D) based on their nucleoproteins and the antigen determinants of their matrix proteins. The influenza virus against which the methods of the present invention generate an immune response may be any strain of influenza. However, it is influenza A and influenza B viruses that are responsible for the seasonal flu. Thus, in some embodiments, the methods of the present invention generate an immune response against influenza A and / or influenza B.
[0066] An “immune response” is the reaction of the body to the presence of a foreign substance (i.e., an antigen). The immune response induced by the methods may comprise a humoral immune response, a cell-mediated immune response, or both a humoral and cell-mediated immune response. The immune response of a subject may be evaluated indirectly, e.g., through measurement of antibody titers, neutralization assays or lymphocyte proliferation assays, or directly, e.g., by monitoring signs and symptoms after challenge with the corresponding pathogen. An “immune response against influenza” is an immune response that’s directed against one or more influenza antigens. The immune response may be a protective immune response. A protective immune response is capable of reducing or eliminating mortality or morbidity caused by an infectious agent such as Influenza. A protective immune response may be an immune response in which viral replication or entry is inhibited or blocked, e.g. by a neutralizing antibody titer in the subject.
[0067] In the Examples, the inventors demonstrate that their compositions generate a protective effect against influenza challenge in ferrets and mice. Thus, in some embodiments, the immune response reduces morbidity associated with a subsequent infection with influenza in the subject. The protective immunity conferred by the present methods may be evaluated by measuring a reduction in clinical signs, e.g., the mortality, morbidity, temperature, physical condition, or overall health of the subject.
[0068] In some embodiments, the methods prevent or reduce the symptoms of influenza in the subject. The symptoms of influenza are well-known in the art and include, without limitation, headaches, chest discomfort, cough, sore throat, fever, aches, chills, fatigue, weakness, sneezing, and stuffy nose.
[0069] As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Suitable routes of administration include, without limitation, intramuscular, intradermal, intranasal, oral, topical, parenteral, intravenous, subcutaneous, intrathecal, transcutaneous, nasopharyngeal, and transmucosal routes. In some embodiments, the composition is administered intramuscularly. The compositions can be administered as a single dose or in multiple doses. For example, the compositions may be administered two or more times separated by 4 hours, 6 hours, 8 hours, 12 hours, a day, two days, three days, four days, one week, two weeks, or by three or more weeks.
[0070] In preferred embodiments, the methods comprise administering a therapeutically effective amount of the composition to the subject. As used herein, the term “therapeutically effective amount” refers to an amount that is sufficient to induce an immune response to influenza in a subject receiving the composition.
[0071] The “subject” to which the present methods are applied may any vertebrate. Suitable vertebrates include, but are not limited to, humans, cows, horses, sheep, pigs, goats, rabbits, dogs, cats, bats, mice, and rats. In certain embodiments, the methods may be performed on lab animals (e.g., mice and rats) for research purposes. In other embodiments, the methods are used to treat commercially important farm animals (e.g., cows, horses, pigs, rabbits, goats, sheep, and chickens) or companion animals (e.g., cats and dogs). In preferred embodiments, the subject is a poultry, cow, pig, or human.
[0072] The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of’ and “consisting of’ those certain elements.
[0073] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise.
[0074] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or descriptions found in the cited references.
[0075] The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims.
[0076] EXAMPLES
[0077] Example 1:
[0078] In the following example, the inventors describe novel mRNA-based influenza vaccines that encode both a hemagglutinin (HA) protein and a neuraminidase (NA) protein in a single open reading frame. Within this construct, the encoded antigens are separated by a furin cleavage site and a 2A ribosome-skipping sequence. Thus, these constructs are referred to herein as “NA- F2A-HA”.
[0079] Influenza viruses cause substantial morbidity and mortality every year despite seasonal vaccination. mRNA-based vaccines have the potential to elicit more protective immune responses, but for maximal breadth and durability, it is desirable to deliver both the viral hemagglutinin and neuraminidase glycoproteins. Delivering multiple antigens individually, however, complicates manufacturing, increases cost, and thus it would be beneficial to express both proteins from a single mRNA. Here, we develop an mRNA genetic configuration that allows the simultaneous expression of unmodified, full-length NA and HA proteins from a single open reading frame. We apply this approach to glycoproteins from contemporary influenza A and B viruses and, after vaccination, observe high levels of functional antibodies and protection from disease in female mouse and male ferret challenge models. This approach may further efforts to utilize mRNA technology to improve seasonal vaccine efficacy by efficiently delivering multiple viral antigens simultaneously and in their native state.
[0080] Introduction:
[0081] Seasonal influenza virus infection causes significant disease and economic burden globally every year. In the 2022-23 season, it was estimated there were over 30 million cases in the United States alone, and worldwide there can be between 250,000 and 500,000 deaths from influenza illness in a given season1’2. Seasonal influenza viruses also contribute to a significant economic burden of an estimated $25 billion USD in a typical flu season3. One of the main tools in battling seasonal influenza burden are vaccines. These vaccines typically induce a highly focused response to antigenic domains of the viral hemagglutinin (HA) and to a lesser extent, the viral neuraminidase (NA)4’6. The HA-directed antibodies elicited typically block host receptor engagement and thus, mediate virus neutralization7-9. The strong effect of these antibodies, however, places a significant selective pressure on antigenic sites in the head domain of HA, leading to rapid viral antigenic drift10’12. These changes necessitate seasonal influenza vaccine reformulation every year to target three or four virus strains that are expected to be circulating, typically an H1N1 and an H3N2 Influenza A virus (IAV) and a Victoria-lineage and a Yamagata-lineage Influenza B virus (IBV). While subunit, recombinant protein, and live-attenuated FDA-approved influenza vaccines exist, the most widely administered seasonal influenza vaccines consist of influenza viral particles that are grown to scale in eggs then inactivated with detergents13. This process ‘splits’ the viral particles and subsequently exposes the immune system to multiple antigenic viral proteins, such as NA and HA, upon vaccination. Split inactivated vaccines are normalized only on HA content, leaving the amount and integrity of the other major glycoprotein, NA, uncertain. Indeed, it has been shown that NA-specific human antibodies poorly recognize NA within split inactivated vaccines and the NA-directed vaccine responses themselves can be highly variable14,15. Additionally, relatively long manufacturing pipelines necessitate 6-8 months between strain selection and vaccine administration, allowing time for mutations to arise in circulating strains that change the antigenicity relative to vaccine strains16. Egg-adapted mutations acquired by vaccine strains during production can also significantly alter antigenicity. These issues can lead to extreme examples where the vaccines end up being ineffective against certain subtypes of influenza viruses, shown recently in the 2014-15, 2016-17 and 2017-18 influenza seasons13,16'21. Even under more normal conditions, seasonal influenza vaccines still elicit only -20-60% vaccine efficacy22. mRNA-based vaccines may represent a practical path to improved influenza vaccines. These vaccines consist of mRNA transcripts that encode for a particular antigen, encapsulated in lipid nanoparticles (LNPs). They can mediate extremely high vaccine efficacy rates (>90% for COVID-19) through induction of both robust humoral and cellular immunity23’30. Since they do not produce infectious viruses, these vaccines are considered safe to administer in immunocompromised and elderly individuals as well as children31-33. To make mRNA-LNPs, researchers only require the sequence of the intended antigen and then corresponding oligonucleotides can be synthesized without heavy reliance on external production factors such as egg availability. This relatively simple production process allows for more rapid updates in the event of viral mutations or changes in circulating strain prevalence34The question of what influenza virus antigen(s) mRNA vaccine formulations should include to maximize vaccine-mediated protection, however, remains an open area of debate.
[0082] While the inclusion of an HA protein as an antigen is a forgone conclusion as vaccination with HA is essential for generating neutralizing antibodies, the inclusion of neuraminidase in the vaccine may also be beneficial as NA-directed responses have been shown to boost the breadth of protectivity and limit disease H15*35NA-directed antibodies have been shown to be important controllers of infection that limit disease in animal models?’36’37Additionally, NA is a more conserved viral protein that accumulates slower antigenic drift than HA, therefore broadly reactive NA antibodies have been shown to confer cross-reaction protection both within and across NA subtypes38'42. Thus, it may be that the simultaneous delivery of multiple viral glycoproteins (as per natural infection), could allow for maximal vaccine-induced protection. Indeed, vaccination with non-HA or multiple influenza antigens via mRNA-LNPs is currently being investigated by numerous groups and companies43'51. For mRNA approaches delivering multiple antigens, viral proteins are often encoded in separate mRNA-LNPs, which are then mixed prior to vaccination. This method of vaccine production and delivery, while at least partially effective in eliciting antibody responses, is more complex, costly, and cannot control which transfected cells express which glycoprotein and fails to control the relative expression of viral proteins in cells that express both. This lack of coordinated co-expression of the glycoproteins ultimately fails to reconstitute the biological landscape of an infected cell and limits meaningful biological interactions between NA and HA52‘55. While expressing multiple antigens from a single mRNA could potentially solve many of the problems of co-delivery of multiple antigens, a technical solution for our goal of creating such an mRNA vaccine, and one that would also more closely recapitulate an infected cell, remained unclear.
[0083] In this work, we develop an mRNA vaccine platform that delivers NA and HA as a single open reading frame (ORF) to enable expression of multiple unmodified antigens from a single mRNA, using a unique glycoprotein organization with an artificial furin cleavage site and 2A ribosome-skipping sequences. We find that this design is able to induce robust immune responses to both antigens and at levels consistent with vaccination of mRNA-LNPs encoding either viral protein alone. Furthermore, we show that this technology can be used to deliver the NA and HA of four different influenza viruses as a quadrivalent mRNA vaccine that delivers eight distinct antigens while only using four mRNA encapsulated in individual LNPs. In a single dose, this quadrivalent mRNA vaccine is effective and in some cases superior to a current inactivated industry standard vaccine comparator in immunogenicity against all four vaccine strains, in both mouse and ferret models. We find that our vaccine induces antibodies targeting not only the conserved stalk region of vaccine strain HAs, but also to antigenically diverse group 1 and 2 HAs, suggesting broader immunity against diverse influenza virus strains. Together, these data present the strategy suggested here as an effective and efficient way to improve current seasonal as well as broadly protective influenza vaccine strategies.
[0084] Results:
[0085] NA and HA can be efficiently expressed from a single ORF
[0086] Our goal was to express completely native HA and NA glycoproteins from a single mRNA. While viral 2A sites have been widely utilized to facilitate expression of multiple individual proteins from the same transcript, they leave residual amino acids on the termini of the separated proteins56’57. It is known that some furin cleavage sequences (such as RKRR (SEQ ID NO: 39)) preceding a porcine teschovirus 2A (PTV-2A) site allow the furin protease to remove most of the residual PTV-2A amino acids, and carboxypeptidases can then eliminate the residual furin cleavage motif58. We previously demonstrated that we could adapt this approach to influenza viral glycoproteins in the context of an infectious virus by encoding NA followed by HA59. We therefore hypothesized that a similar approach could be used to generate unmodified NA and HA proteins in the context of an mRNA vaccine (FIG. 1A). To test this hypothesis, we first designed DNA plasmids that encoded for either the expression of NA, HA, or both proteins through the NA-F2A-HA construct using viral sequences from the contemporary H3N2 virus, A / Tasmania / 503 / 2020, which was a component of the 2021-22 seasonal influenza vaccine. After validating that we had the proper tools to detect the A / Tasmania / 503 / 2020 viral proteins (FIG. 6A-D), we used cell-based ELISAs and microscopy to demonstrate that NA and HA were expressed from cells transfected with the NA-F2A-HA plasmid to similar levels as those transfected with plasmids encoding either antigen alone or as a mixture (FIG. 1B-E). Similarly, confocal microscopy revealed proper expression and trafficking of each of these proteins to the surface of cells transfected with our NA-F2A-HA plasmid (FIG. IF). We also wanted to confirm that the NA and HA expressed from our NA-F2A-HA plasmid were functional. NA expressed from our NA-F2A-HA construct was found to mediate sialic-acid removal in a lectin-based activity assay to the same degree as NA individually expressed from a plasmid or in combination with an HA-expressing plasmid (FIG. 1G). Similarly, HA expressed from the NA-F2A-HA plasmid was found to mediate similar membrane fusion activity as HA individually expressed from a plasmid or in combination with an NA-expressing plasmid under low pH conditions (FIG. 1H). These results suggested that indeed, the NA-F2A-HA design could be applied to vaccine design to express two functional, native viral proteins from a single ORF. NA-F2A-HA mRNA-LNP is immunogenic in mice
[0087] We next wanted to investigate the immune response that an mRNA-LNP with this design would elicit compared to vaccination with mRNA-LNPs encoding either glycoprotein alone. Therefore, we generated mRNA-LNPs that encoded for either the NA, HA, or the NA-F2A-HA proteins. The LNP carriers themselves have been shown to act as strong adjuvants, therefore no additional adjuvants were included60. These mRNA-LNPs were delivered to mice, as well as control groups that included an mRNA-LNP encoding luciferase, a group where the individual HA and NA mRNA-LNPs were mixed prior to vaccination, as well as the 2021-22 split inactivated Flulaval vaccine and a matched bovine serum albumin (BSA) control (FIG. 2A). For the mRNA vaccines, equal moles of RNA were delivered, and the dose given was scaled to 1 / 6 of a human dose for both the mRNA-LNPs and Flulaval vaccine. Post-vaccination sera revealed that the mRNA-LNP vaccines that encoded for NA or HA (as well as the Flulaval control) elicited robust antibody responses against the targeted A / Tasmania / 503 / 2020 protein (FIG. 2B- E). Importantly, mice vaccinated with the NA-F2A-HA mRNA-LNP vaccine elicited a similar, or in the case of HA, better, antibody response to both viral proteins than mice vaccinated with mRNA-LNPs expressing either antigen alone or when the NA mRNA-LNPs and HA mRNA- LNPs vaccines were mixed (FIG. 2B-E). Thus, although we didn’t monitor protein expression from this mRNA in vivo, it is likely that both HA and NA were appropriately expressed as per our in vitro DNA-based expression experiments.
[0088] Next, we performed a series of experiments to assess if the antibodies elicited were functional. Indeed, the HA mRNA-LNPs, NA+HA mixture mRNA-LNPs, NA-F2A-HA mRNA- LNPs, and Flulaval vaccines elicited hemagglutinin-specific neutralizing antibodies (FIG. 2F), and the HA mRNA-LNP, NA+HA mixture mRNA-LNPs, and NA-F2A-HA mRNA-LNP vaccines also elicited antibodies with detectible neuraminidase inhibition activity above the background level of naive mouse sera (FIG. 2G). We also performed multicycle microneutralization assays (MNso) and plaque-reduction assays (PRNT50). These assays, which principally measure the activity of HA-directed antibody responses, both revealed that the HA mRNA-LNP, NA+HA mixture mRNA-LNPs, and NA-F2A-HA mRNA-LNP vaccines elicited equally higher levels of neutralizing antibodies than other groups (FIG. 2H-I). Notably, each of these assays showed noninferiority of delivering both antigens through our NA-F2A-HA mRNA construct compared to vaccinating with each antigen alone or via a mixture of HA and NA mRNA-LNPs. Finally, we challenged vaccinated mice with a lethal dose of a mouse-adapted antigenically similar H3N2 virus (A / Switzerland / 9175293 / 2013) to assess protection from disease (FIG. 2J). Luciferase mRNA-LNP-, BSA-, and Flulaval-vaccinated controls experienced severe weight loss and generally died by day 8 post infection, with some protection mediated by Flulaval where 3 / 5 vaccinated mice were able to recover from infection. Mice vaccinated with NA mRNA-LNPs, HA mRNA-LNPs, NA+HA mixture mRNA-LNPs, and NA-F2A-HA mRNA- LNPs all survived infection and displayed marked bodyweight loss (FIG. 2K-L). Therefore, the NA-F2A-HA mRNA-LNP vaccine elicited an immune response against both NA and HA similar to that generated following vaccination with mRNA-LNPs encoding for either antigen alone or mixed. Further, vaccination with our NA-F2A-HA mRNA-LNP vaccine is protective against lethal challenge and, at least in this model of disease, provides improved protection relative to current industry standard vaccines.
[0089] NA-F2A-HA mRNA-LNP vaccines targeting non-H3N2 viral strains are immunogenic in mice
[0090] We next wanted to see if we could apply the NA-F2A-HA mRNA design to other strains of influenza A and influenza B viruses. We therefore generated NA-F2A-HA mRNA-LNP vaccines targeting the remaining three strains included in the 2021-22 influenza vaccine: H1N1 A / Victoria / 2570 / 2019, IBV_V B / Washington / 02 / 2019 and IBV_Y B / Phuket / 3073 / 2013. These vaccines were then independently administered to mice as per our previous experiments with the H3N2-based vaccine (FIG. 3A). Analysis of the post-vaccination sera revealed that the NA- F2A-HA mRNA-LNP vaccines encoding for the H1N1 antigens (FIG. 3B-E), the IBV_V antigens (FIG. 3G-J), and IBV_Y antigens (FIG. 3L-O) all elicited significantly higher antibody responses against their respective NAs and HAs compared to luciferase mRNA-LNPs and Flulaval. Further, these antibodies were found to be neutralizing against antigenically matched (in the case of IBV Y) or with as antigenically similar viruses as we could acquire and culture in the lab, A / Hawaii / 70 / 2019 for the H1N1 and B / Colorado / 06 / 2017 for the IBV_V (FIG. 3F, K, P)
[0091] A four NA-F2A-HA mRNA-LNP mixture is immunogenic and provides protection from H1N1, H3N2, and IBV-Yamagata challenge.
[0092] Once we confirmed that NA-F2A-HA mRNA-LNP vaccines encoding for the NAs and HAs of four distinct influenza viruses generated strong immune responses when delivered individually, we next wanted to test if we could protect against all four strains of influenza virus with a single four mRNA, but “octavalent” vaccination. Mice were vaccinated with a mixture of equal parts of the NA-F2A-HA mRNA-LNP vaccines targeting either the H1N1, H3N2, IBV-Y or IBV-V strains of influenza virus at half the dosage as when they were administered individually (FIG. 4A). This ‘four mRNA-LNP’ vaccine was found to generate strong antibody responses against the NAs and HAs of all four vaccine strains, non-inferiorly to those elicited following Flulaval vaccination (FIG. 4B-E). To test if our vaccine was able to boost pre-existing immunity similar to what would be found in a human population, we performed a study in which pre-immunity was first established via either BSA control or one of two “pre-immune mixes”. “Pre-immune mix 1” consisted of inactivated A / California / 04 / 2009, A / Wyoming / 03 / 2003, B / Malaysia / 2506 / 2004, B / Yamagata / 16 / 1988 viral particles, and “Pre-immune mix 2” was Flulaval. Once these different pre-immune profiles were established (FIG. 7A-B), we then vaccinated mice with the four mRNA-LNP vaccine and found that our vaccine was able to successfully boost anti-NA and anti-HA antibody levels in both pre-existing immune backgrounds (FIG. 7C-F).
[0093] To assess the functional neutralization capability of these antibodies, we performed PRNT50 assays (using the same viruses as in the separate vaccination experiments) and found that the four mRNA-LNP vaccine elicited significantly higher levels of neutralizing H1N1, H3N2, IBV_V and IBV_Y antibodies compared to the luciferase mRNA-LNP controls and generally higher responses than animals that received Flulaval (FIG. 4F-I). Finally, we wanted to determine if the four mRNA-LNP vaccine was protective against lethal challenge. Although we were unable to identify a contemporary IBV V that caused disease in mice, we challenged the quadrivalent vaccine group (and controls) with a contemporary H1N1 (A / Hawaii / 70 / 2019) (FIG. 4J), H3N2 (A / Switzerland / 9175293 / 2013) virus (FIG. 4K), or matched IBV_Y virus (B / Phuket / 3073 / 2013) (FIG. 4L). All mice vaccinated with the four mRNA-LNP or Flulaval were found to be completely protected against lethal challenge with all three viruses, while luciferase mRNA-LNP -vaccinated mice died between days 7-10 post infection (FIG. 4M-O). Despite complete protection from mortality, we did observe a trend for less bodyweight loss in the four mRNA-LNP -vaccinated mice after the H3N2 and IBV_Y viral challenges. The four NA-F2A-HA mRNA-LNP vaccine mixture elicits protective immunity in ferrets.
[0094] Finally, we wanted to confirm that our four mRNA-LNP vaccine would behave similarly in a ferret model to what we had previously observed in mice. We therefore vaccinated ferrets with either luciferase mRNA-LNP, our four mRNA-LNP vaccine, or Flulaval (FIG. 5A). As expected, animals vaccinated with our four mRNA-LNP vaccine elicited robust antibody responses against all four vaccine strain antigens (FIG. 5B-E), with higher responses relative to Flulaval for H1N1, H3N2, and IBV Y antigens and similar levels as Flulaval for IBV V antigens. We also found that our four mRNA-LNP vaccine elicited significantly higher levels of neutralizing antibodies post-vaccination, and similar levels compared to Flulaval-vaccinated animals against all four influenza strains (FIG. 5 F-I). We then challenged with the contemporary H1N1 strain, A / Hawaii / 66 / 2019 (98.41% A / Hawaii / 70 / 2019 HA sequence homology to A / Victoria / 2570 / 2019 HA) (FIG. 5A). While ferrets are good models of the human clinical course of disease during influenza virus infection, their susceptibility to contemporary influenza viruses is variable61. As expected, we saw little change in body weight over the course of infection between groups (FIG. 5J) but were able to see a modest decrease in viral RNA from four mRNA-LNP -vaccinated animals at days 2, 4, and 7 of infection (FIG. 5K). Importantly, viral titer determined from oral swabs indicated that infection was less likely to be established in our four mRNA-LNP vaccinated ferrets, and if they were infected, they were able to clear the virus more efficiently than luciferase mRNA-LNP- or Flulaval-vaccinated ferrets (FIG. 5L). Thus, despite being a sub-optimal challenge model for this contemporary H1N1 strain, the ferret challenge data is consistent with the antibody analyses showing enhanced vaccine responses in the four mRNA-LNP vaccine group.
[0095] It has been previously suggested that mRNA-LNP vaccination itself can elicit higher levels of antibodies that recognize the conserved stalk of HA, which can increase protection through non-neutralizing mechanisms50>62-63. Using this knowledge, taken in combination with our findings that four mRNA-LNP -vaccinated ferrets had increased antibody binding but similar viral neutralization activities relative to Flulaval-vaccinated ferrets, we wanted to test if our four mRNA-LNP vaccine elicited non-neutralizing antibodies against epitopes other than the HA head. We therefore performed cell-based ELIS As against the stalk domain of the vaccine- matched Hl and H3 HAs using headless, stalk-only HA expression plasmids that were previously validated using conformation-specific antibodies (FIG. 8). Interestingly, we found that indeed, our four mRNA-LNP vaccine elicited higher levels of HA stalk-specific antibodies than luciferase mRNA-LNPs or Flulaval in ferrets (FIG. 5M-N). To test if this enhanced antibody response to a more conserved HA domain would allow for increased binding to heterologous HAs, we performed a Luminex -based purified HA binding assay using group 1 and 2 HAs from 1933-2021. Within group 1 HAs (FIG. 50) we found that our four mRNA-LNP vaccine elicited higher magnitude responses compared to Flulaval to both older and contemporary His and, to a lesser degree, the H2, H5, H6 and H9 HAs. Within the group 2 HAs (FIG. 5P), our vaccine elicited similar antibody responses as Flulaval to older H3 HAs, but significantly higher responses to more contemporary H3 and H7 HAs. These findings suggest that our four mRNA-LNP vaccine elicits not only a strong response against vaccine-matched strains, but also a generally more cross-reactive antibody profile against heterologous viruses.
[0096] Discussion:
[0097] While inactivated seasonal influenza vaccines elicit protective immunogenicity, their overall efficacy is limited13 16>18-22Advancements in mRNA-based technologies in the recent years now make this a practical vaccine modality; however, questions remain regarding the antigen composition and the best configurations to express those antigens. In this study, we present a method of improving seasonal influenza vaccination using a dual antigen-expressing mRNA-LNP strategy. Using only four mRNA-LNPs, we can express eight individual NA and HA proteins by separating the glycoprotein ORFs with furin and 2A cleavage motifs. This NA- F2A-HA mRNA design can be broadly applied to influenza A and influenza B viral glycoproteins, and individual mRNA-LNPs can be mixed to recapitulate the breadth of a typical quadrivalent, virion-based, seasonal vaccine. Further, the four mRNA-LNP vaccine was found to elicit fully protective, and in some cases superior, immune responses to the NA and HA of all four vaccine strains compared to the current inactivated industry standard vaccine in both mice and ferrets.
[0098] In addition to its ability to act as an improved seasonal influenza vaccine, our four mRNA-LNP also demonstrated an ability to induce higher responses to the relatively conserved stalk of the HA protein. This ability was likely responsible for the increased binding we observed after mRNA-LNP vaccination to highly drifted HA variants. Although stalk-specific antibodies are non-neutralizing, they have been shown to confer protection through alternate immune pathways, such as the antibody-dependent cytotoxicity (ADCC) pathway62. While these data are promising, future studies will be needed to demonstrate that this increased binding translates to functional activity. Further work will also be required to define which specific epitopes are being uniquely or disproportionately targeted after mRNA-LNP vaccination. mRNA vaccines have also been shown to induce superior cellular immune responses that are critical in viral control and clearance, i.e. antigen-specific CD8+ T-cell responses64-66and potentially improved mucosal IgA responses. We did not formally measure such responses however, and future work understanding the full breadth of mechanisms that mediate the protection afforded by our vaccine will be required.
[0099] Future studies will also be required to understand the relative contributions and mechanisms of NA-mediated immunity after vaccination. Our results, consistent with previous literature42-67’7(showed that current inactivated vaccines elicit little NA-specific immunity. It is estimated that inactivated vaccines only elicit -30% seroconversion against NA, and it is suggested this is due to a lack of normalization of NA amounts or NA epitope disruption during vaccine production14>15>42>67-69Thus, while improved HA-directed responses (both in magnitude and breadth) will almost certainly contribute to improved vaccine-mediated protection, the ability of this vaccine to express NA in stochiometric equivalent to HA may also improve protection via elicitation of strong-NA directed responses. Furthermore, it will also be necessary to dissect any potential impacts of expressing NA and HA together through the NA-F2A-HA construct on the immunogenicity of the viral proteins themselves. It has been suggested that for some antigens, removal of sialic acids specifically can increase their antigenicity71. Thus, in addition to simply expressing HA and NA viral proteins simultaneously, the phenomena of NA removing sialic acid from HA-linked glycans52,53may also modulate antigenicity of the protein itself. Future studies, however, will be required to determine if this is indeed the case.
[0100] While the vaccine approach described in this study appears promising, there are several limitations that should be considered. Despite the NA-F2A-HA construct design halving the number of mRNAs to be made, our mRNAs are longer than those encoding for a single antigen. This might leave them more vulnerable to human RNAses upon vaccination, leading to more rapid degradation in vivo compared to their smaller counterparts. Therefore, studies on mRNA half-life and the length of antigen expression in vivo, as well as the consequences of any changes, will be necessary future steps. Furthermore, in addition to the NA-F2A-HA mRNA-LNP simplifying the manufacturing process by reducing production time and cost, we initially hypothesized that coordinated expression of HA and NA could affect antigenicity of the proteins. We ultimately did not perform any studies to directly test this hypothesis in this work, but additional studies looking at differences in the antibody composition elicited by different vaccines will be important future studies. Finally, while we attempted to model pre-existing influenza immunity in mice, the immune history of humans is much more complicated and nuanced. For this reason, our vaccine will need to be carefully assessed for its ability to boost immune responses in other pre-existing immunity animal models and ultimately in humans.
[0101] In conclusion, mRNA vaccines have the potential to eliminate many of the limitations that plague current vaccine platforms. By incorporating multiple antigens into a single formulation, our vaccine offers a promising strategy to improve vaccine effectiveness without increasing manufacturing complexity. Moving forward, application of the advances in mRNA technology such as those that we propose here, will allow for improved influenza vaccines which will ultimately help to mitigate the burden of influenza globally. Outside of influenza vaccines, our approach for delivering multiple antigens at once can potentially be applied to other fields of mRNA delivery research, such as for cancer, rare genetic disorder therapies, and other infectious diseases.
[0102] Materials and Methods:
[0103] In vitro transcription and mRNA-LNP production. The HA and NA constructs were codon optimized to enhance protein expression and reduce immunogenicity. The codon optimized sequences were gene synthetized at GenScript (New Jersey, USA) and cloned into an in vitro transcription template plasmid containing a T7 promoter, 5’ and 3’UTR regions, and a 100-nucleotide poly (A) tail. mRNA was synthetized and co-transcriptionally capped using the Megascript transcription kit™ (ThermoFisher, Cat# AMB 1334) and the CleanCap™ dinucleotide system (TriLink Biotechnologies), precipitated, and purified using a modified cellulose based chromatography method72. Length and mRNA integrity were assessed using the native agarose gel (1.4%). Removal of double stranded RNA (dsRNA) contaminants was confirmed using dot blot and endotoxin levels were measured using the Genscript Toxisensor chromogenic assay (<0.05 EU / mL). The different HA and NA mRNA were stored frozen (1 mg / mL) at -20°C in nuclease and pyrogen free water until use. mRNA was encapsulated into lipid nanoparticles as previously described73. A mixture of an ionizable lipid (proprietary to Acuitas Therapeutics), cholesterol, DSPC, and PEG-Lipid in an ethanolic solution was rapidly mixed with an aqueous phase containing the mRNA, dialyzed, concentrated to 1 mg / mL and stored at -80°C until used. The ionizable lipid and LNP composition are described in international patent application WO 2017 / 004143. mRNA-LNP were characterized for their hydrodynamic size, and polydispersity index (PDI) using dynamic light scattering (DLS), and the encapsulation efficiency and concentration measured using the RiboGreen™ RNA Assay (Invitrogen, Cat# R11490).
[0104] Cell lines. 293 T (CRL-3216) and Madin-Darby canine kidney (MDCK, CCL-34) cells were obtained from American Type Culture Collection (ATCC) and grown at 37°C in 5% CO2. 293T cells were maintained in Dulbecco’s modified Eagles medium (DMEM, Gibco™) supplemented with 5% fetal bovine serum (FBS), GlutaMAX™ (Gibco™), and penicillinstreptomycin (P / S), and MDCKs were maintained in minimal essential medium supplemented with 5% FBS, HEPES, sodium bicarbonate, GlutaMAX™ and penicillin-streptomycin. All media was supplemented with Plasmocin prophylactic (Invitrogen, ANT-MPP) to prevent mycoplasma contamination.
[0105] Plasmids. For plasmids used for experiments in FIG. 1 and cell-based ELISAs, all viral protein sequences were obtained through NCBI and cloned into pCAGGs expression plasmids using human-codon optimized gBlocks with an artificial Kozak sequence (IDT) (Protein accession numbers: A / Victoria / 2570 / 2019 NA, WEY08939; A / Victoria / 2570 / 2019 HA, WEY08940; A / Tasmania / 503 / 2020 NA, WMW30851; A / Tasmania / 503 / 2020 HA, WMW30850, T176K, S202R; B / Washington / 02 / 2019 NA, QCG86179; B / Washington / 02 / 2019 HA, QCG86180; B / Phuket / 3073 / 2013 NA, EPI544263; B / Phuket / 3073 / 2013 HA, EPI544264). PCR products were inserted into the pCAGGs expression vector using the EcoRI and Nhel restriction sites and HiFi DNA Assembly (New England BioLabs [NEB], Cat #E5520). DNA products were transformed into chemically competent NEB 5-alpha high-efficiency cells (NEB, Cat. C2987H) and purified plasmids were then confirmed using Sanger sequencing.
[0106] HA stalk design and expression. Our HA stalk constructs were designed to express the viral stalk ectodomain, anchored by the transmembrane domain and cytoplasmic tail. H1N1 A / Victoria / 2570 / 2019 HA (accession: WEY08940) stalk-only design was based on the Gen6 HA-SS design used in Yassine et al., 201574, and H3N2 A / Tasmania / 503 / 2020 HA (accession: WMW30850: T176K, S202R) stalk-only design was based on the ‘H3ssF_C’ design used in Corbett, K. S., et al., 201975. For both designs, amino acid (aa) numbering began at the initiator methionine. Briefly, for H1N1 design, the region between aaL49 and L328 was replaced with a GSG linker domain, and region between aaM402 and T436 was replaced with a GSGGSG linker. Four additional mutations were added to promote correct folding of the stalk: K394M, Y437D, N438L, E446L. Briefly, for H3N2 stalk-only design, aa66-329, aa407-408, and aa412-436 were deleted. The following mutations were also inserted: aa60-65 (QNSSIG to FPGCGV), K396M, L397V, L400V, G402E, K403L, T404M, N405E, E406Q, H409G, Q410G, 141 IP, W437D, S438C, N440L, E448L, and N461R. Human codon-optimized gBlocks (IDT) were designed according to the A / Victoria / 2570 / 2019 and A / Tasmania / 503 / 2020 sequences and used to clone into the pCAGGs expression vector using Gibson assembly. These constructs were validated to have the correct trimeric structure using conformation-specific monoclonal antibodies, CR9114 (produced by the Moody laboratory at Duke University) (FIG. 8).
[0107] Confocal microscopy. 293T cells were seeded onto poly-L-lysine treated coverslips in 24- well plates and then transfected with the indicated plasmid in OptiMeM™ (Gibco™, #31985070) using Trans-IT-LTl (MIR #2304) transfection reagent and allowed to incubate at 37°C for 24 hours. Cells were then fixed with 4% paraformaldehyde (PF A) and blocked with 3% BSA in phosphate-buffered saline (PBS) (w / v) for two hours at room temperature and stained with 9H10 (10 pg / mL) or anti-N2 antibody (Sino Biological, #40017-RP01-100, 1 : 1000) in PBS / BSA overnight at 4°C. Cells were washed with PBS then incubated with secondary antibody (goat anti-mouse AF488 (Invitrogen, #A11001) and goat anti-rabbit AF647 (Invitrogen, # A21245)) diluted 1 : 1,000 in 3% BSA in PBS for 2 hours at room temperature. Coverslips were finally washed again, stained for nuclei using Hoechst 33342 (Life Technologies, Cat. #H3570, 1 :2500), then mounted onto slides (Prolong Diamond #P36961). Slides were imaged using an inverted 1X83 Olympus microscope with a motorized XY-stage (Prior) and images were processed identically using Imaged (NTH).
[0108] HA fusion assay. 293T cells were seeded onto poly-L-lysine treated coverslips in 24-well plates to reach high confluency the next day. Cells were then transfected with the indicated plasmid in OptiMeM™ using Lipofectamine™ (Invitrogen, #L3000001) and incubated at 37°C for 24 hours. Medium was replaced with OptiMeM™ supplemented with 0.35% BSA, 0.01% FBS and 5% P / S with 1 pg / mL TPCK-trypsin for 20 minutes, and then cells were treated with either DMEM at pH=7.4 or DMEM acidified using citric acid at pH=5 for 20 minutes. All medium was then replaced with fresh DMEM at pH=7.4 and cells were allowed to recover at 37°C for 4 hours. Cells were then fixed with 2% PFA and stained with 20 pg / mL Wheat Germ Agglutinin (WGA) (Vector Laboratories, #FL-1021-5) fluorescent lectin in PBS for 1 hr at room temperature and Hoescht 33342, according to the above described confocal microscopy protocol. Slides were then imaged on a confocal microscope according to the above described protocol.
[0109] Vaccine doses. Vaccine doses for mRNA-LNP vaccination were determined based on pre-existing vaccine doses used in Phase 3 clinical trials. Pfizer delivered 30 pg of mRNA-LNP vaccine to humans, so we decided to initially test l / 6thof this dose for mice, ~5 pg, and a similar l / 6th(10 pg) of the human dose of inactivated vaccine, Flulaval76-77. For the experiments in FIG. 2, mice were vaccinated with doses as follows: BSA, 10 pg; luciferase mRNA-LNP, 5.1 pg; NA mRNA-LNP, 2.275 pg; HA mRNA-LNP, 2.725 pg; NA mRNA-LNP, 2.275 and HA mRNA- LNP, 2.725 pg; NA-F2A-HA mRNA-LNP 5.1 pg; Flulaval, 10 pg. Size of mRNA transcript length were taken into account for the NA and HA proteins and roughly scaled accordingly. For the experiments in FIG. 3, mice were vaccinated with doses as follows: luciferase mRNA-LNPs, 5 pg; NA-F2A-HA mRNA-LNP, 5 pg; Flulaval, 10 pg. For the mouse experiments in FIG. 4, mice were vaccinated with doses as follows: luciferase mRNA-LNP, 10 pg; four mRNA-LNP, 10 pg (2.5 pg of each H1N1, H3N2, IBV_V and IBV_Y NA-F2A-HA mRNA-LNPs; Flulaval, 10 pg. For the ferret experiments in FIG. 5, six-month old male ferrets (n=4) were intramuscularly vaccinated with 30 pg of either luciferase mRNA-LNP or the four NA-F2A-HA mRNA-LNP mixture (7.5 pg of each NA-F2A-HA mRNA-LNP) or 60 pg of Flulaval in 500 pL PBS. In FIG. 7, mice were first primed with either 10 pg of BSA, 10 pg of inactivated A / California / 04 / 2009, A / Wyoming / 03 / 2003, B / Malaysia / 2506 / 2004, and B / Yamagata / 16 / 1988 (2.5 pg of each virus) mix for ‘Pre-immune mix 1’ group, or 10 pg of Flulaval for ‘Pre-immune mix 2’ group, intramuscularly. Mice were then boosted with either 10 pg of BSA or 10 pg of the four mRNA-LNP mix (2.5 pg of each H1N1, H3N2, IBV-V and IBV-Y NA-F2A-HA mRNA- LNPs). In FIG. 9, mice received 10 pg of BSA or 10 pg of Flulaval.
[0110] Vaccination and challenge. Six- to ten-week-old female mice from the Jackson Laboratory (#000671) were used for all experiments involving mice (n = 5 for all experiments shown). Mice were vaccinated intradermally (except for prime in FIG. 7) with all vaccines to maintain consistency, unless otherwise noted. To confirm that Flulaval did not induce different immunogenicity when administered intradermally, we vaccinated mice both intradermally and intramuscularly with the same dose of Flulaval (10 pg) and saw no difference in antibody levels between groups (FIG. 9). Three weeks post-vaccination, mice were bled via a cheek bleed to collect serum. Mice were allowed to recover for 2-3 days and then were challenged with virus. For viral infections, mice were anesthetized with 100 pF of ketamine / xylazine and infected intranasally with 40 pL of vims diluted in pharmaceutical grade PBS (Coming, 21-040-CV). Mice were challenged with the following doses of vims: FIG. 2, H3N2 dose=l,000 PFU; FIG.
[0111] 4, H1N1 dose= 200 PFU, H3N2 dose= 100 PFU, and IBV_Y dose= 396,000 PFU. After infection, mouse body weight was recorded daily for 14 days and mice were sacrificed if body weight fell below the predetermined humane endpoint (75% of starting body weight). For ferret experiments, six-month old male ferrets were first bled three days prior to vaccination, then were intramuscularly vaccinated with the intended vaccines. At 28 days post-vaccination, ferrets were bled again, and oral swabs were taken. Ferrets were then infected with 500 pL of vims (intended dose = 1000 PFU of A / Hawaii / 66 / 2019) intranasally after inhalation of isoflurane at 31 days post-vaccination. Ferrets were monitored for change in bodyweight, and oral swabs were obtained at days 2, 4, and 7 post-infection. Animal viral titer was determined using standard plaque assays on MDCK cells using oral swabs in duplicate dilution series.
[0112] Ethics statement. All experiments involving animals were approved by Duke Univeristy IACUC under the protocol numbers A142-21-07 (mouse) and A077-23-03 (ferret). Animals were housed in ambient temperature and humidity with free access to food and water and with a 12 hour light / dark cycle.
[0113] Viruses. IAV vimses were propagated on MDCK cells or in eggs at 37°C, and IBV viruses were grown at 33°C on MDCK cells or in eggs. All viral stocks were then titered using standard plaque assays on MDCK cells. The A / Tasmania / 503 / 2020, B / Phuket / 3073 / 2013, B / Colorado / 06 / 2017 vimses were obtained from BEI resources. To generate the “pre-immune” vaccine, IAV and IBV vimses (A / California / 04 / 2009, A / Wyoming / 03 / 2003, B / Malaysia / 2506 / 2004 and B / Yamagata / 16 / 1988) were propagated on eggs at either 37°C or 33°C and then viral stocks were concentrated using a 30% sucrose cushion via ultracentrifugation (27,500 rpm for 1 hour). Concentrated vimses were resuspended in pharmaceutical grade PBS (Corning, 21-040-CV) and inactivated with 0.02% formalin at 4°C for 48 hours. Inactivated vimses were then dialyzed using Slide-A-Lyzer cassettes (Thermo Fisher, #66370) and quantified using Pierce Rapid Gold BCA Protein Assay Kit (Thermo Fisher #A53226) and stored at -80°C for future use. All viral stocks were sequence confirmed using reverse-transcription followed by sanger sequencing of the HA, NA, and NP or PA proteins. Sequence alignments for HA percent homology were aligned using Clustal Omega vl .2.4. software. For viruses that did not induce robust clinical disease in mice or were not available, similar viral strains with HA sequence homology >95% were chosen to be used (FIGs. 10-12).
[0114] Enzyme-linked immunosorbent assays (ELISAs). For cell-based ELISAs, 293T cells were plated in poly-L-lysine-treated 96-well plates and then transfected with the indicated plasmid in OptiMeM™ using Trans-IT LT1 and left to incubate for 24 hours at 37°C with 5% CO2. Cells were then fixed with PFA washed with PBS and then blocked in 3-5%% nonfat milk in PBS (w / v). Serial dilutions of sera in 3% nonfat milk in PBS were then added and allowed to incubate, followed by secondary antibody staining (goat anti-mouse HRP (Invitrogen, #A 16072, 1 : 10,000), goat anti -human HRP (Invitrogen, # Al 8805, 1 :10,000) or goat anti-ferret HRP (Novus Biologicals, NB7224, 1 : 10,000). Plates were finally washed again before 1-Step TMB ELISA Substrate Solutions (Fisher Scientific, PI34028) was added. Signal was allowed to develop until the reaction was stopped with IM H2SO4. Absorbance of signal at 450nm was then read on a Varioskan LUX plate reader. The area under the curve (AUC) for each ELISA was calculated using the average of wells with no primary antibody added as the baseline cutoff, using Prism 9 (GraphPad). For non cell-based ELISAs, ImmunoGrade 96-well plates (BrandTech, #781722) were coated with 0.2 pg / ell of the target antigen or LOxlO5PFU / well whole virus in coating buffer (PBS with NaCHO. and Na2COa) overnight at 4°C. Plates were then blocked and signal developed using the same protocol described above. For ELISAs using ferret sera, initial sera dilutions in 3% milk were briefly incubated with 293T cells to reduce background reactivity. Cells were pelleted, then mixed with sera dilutions for 10 minutes, pelleted again, and the supernatant was then used in the rest of the ELISA protocol as described above.
[0115] Hemagglutination inhibition assays (HAIs). Sera from vaccinated mice was diluted 1 :4 with receptor-destroying enzyme (RDE, Denka Seiken #370013) and incubated for 16-20 hours at 37°C, followed by inactivation of the RDE with incubation at 56°C for 45 minutes. Sera was serially diluted in PBS in 96-well V-bottom microplates (Corning, #CLS3897, then mixed with equal volume of standardized virus dilution (2 HA units) and allowed to incubate at room temperature for 15 minutes. Turkey red blood cells were then diluted 1 :40 in PBS and added to each well of sera / virus mixture. Plates were covered and left to incubate at 4°C overnight before HAI titers were recorded. HAI titers were calculated as the reciprocal of the last dilution of sera that inhibited hemagglutination, indicated by a clear red blood cell pellet.
[0116] Enzyme-linked lectin assays (ELLAs) and neuraminidase inhibition assays (NAIs). For both ELLA assays and NAI assays, immuno-grade 96-well plates were coated with 100 pL 25 mg / mL fetuin (Sigma #F3385) in lx coating buffer (KPL coating buffer #50-84-10) for at least 24 hours at 4°C before the experiment was conducted. Fetuin-coated plates which were thoroughly washed with PBS-T (0.05% Tween-20). For ELLA assays to detect neuraminidase activity, 293T cells were transfected with plasmids using Lipofectamine™ 3000 and left to incubate at 37°C. At 24 hours post transfection, cells were resuspended in OptiMeM™ supplemented with 0.35% BSA, 0.01% FBS and 5% penicillin / streptomycin. Cells were counted and all samples were normalized to the same cell concentration. Samples were added to fetuin- coated plates, firmly sealed, and incubated at 37°C for 18 hours. Plates were thoroughly washed with PBS-T, then peanut agglutinin-HRPO (1 mg / mL, Sigma #A8327, 1 : 1000) was diluted in sample buffer and added to each well and left to incubate for 2 hours in the dark at room temperature. Plates were washed again with PBS-T then signal was developed as previously described for ELISAs. To assess NAI using ELLAs, RDE-treated sera from vaccinated mice were serially diluted in sample buffer (Dulbecco’s PBS with CaCh and MgCh with 0.5% Tween-20) and added to fetuin-coated plates. Recombinant N2 (Sino Biologicals, #40017- VNAHC-800) was diluted in sample buffer and added to each well (except for a no N2 control). Plates were incubated at 37°C for 18 hours, and signal was developed as previously described for ELLAs. NA activity was calculated as the following percentage: ((serum absorbance-mean background absorbance) / (mean positive control absorbance-mean background absorbance))* 100. NAI titer is reported as the reciprocal of the lowest dilution of sera that inhibited greater than or equal to 50% NA activity.
[0117] Microneutralization assays (MNso). RDE-treated sera from vaccinated mice were serially diluted in 96-well microplates in sample diluent (PBS / BSA with 0.1% TPCK-trypsin (Thermo #20233)). Each plate also included virus positive control wells and uninfected negative control wells. Virus suspension was prepared in sample diluent and an equal volume (containing 32,000 PFU virus) was added to each well containing sera dilutions except the uninfected control wells. The virus-serum mixtures were allowed to incubate at 37°C with 5% CO2 for 1 hour, before an equal volume of MDCK cells (containing IxlO4cells) was added to each well on top of the virus-serum mixtures. Plates were incubated for 20 hours at 37°C with 5% CO2, and then were fixed with 4% PFA. Plates were thoroughly washed with wash buffer (PBS+0.3% Tween-20), then monoclonal human-anti influenza HA-stalk antibody (CR9114) was diluted 1:4,000 in antibody diluent (wash buffer + 5% nonfat milk) and added to each well for overnight incubation at 4°C. Plates were washed with wash buffer then goat-anti human-HRP secondary antibody (1 : 10,000) was diluted 1 : 5,000 in antibody diluent and added to each well for 1 hour at room temperature. Plates were washed with wash buffer a final time, and signal was developed as previously described for ELISAs. The reaction was stopped using 1 M H2SO4 and plates’ absorbances at 450 nm were read using a Varioskan LUX plate reader. In calculating the half- maximal inhibitory titer (MN50), the virus control wells for each plate were set to 100% and the uninfected negative controls were set to 0%. A four-parameter nonlinear regression was then applied to each plate individually using Prism 9 (GraphPad), and the MN50 was interpreted as the log 10 of the lowest dilution of sera that inhibited virus greater than or equal to 50% of control viral infection.
[0118] Plaque-reduction neutralization assays (PRNT50). RDE-treated sera were serially diluted in PBS / BSA, then each dilution was mixed with standardized virus suspension and allowed to incubate for 45 minutes at room temperature. Confluent 6-well plates of MDCK cells were washed with PBS then infected with the virus / sera mixtures for 1 hour at 37°C and 5% CO2. Virus / sera mixtures were then removed and replaced with an agar overlay supplemented with TPCK-trypsin. PRNTs were left to incubate for 48-72 hours at 37°C with 5% CO2 until plaques were visible. PRNTs were then fixed for at least 3 hours at room temperature with 4% PFA, before the agar overlay was removed and replaced with CR9114 antibody diluted in antibody dilution buffer (5% nonfat dried milk, 0.05% Tween-20 in PBS, 1 : 1000) overnight at 4°C. PRNTs were then washed with PBS and incubated with goat anti -human HRP diluted in antibody dilution buffer for 1 hour at room temperature (1 :4000). Finally, PRNTs were washed again and stained with KPL TrueBlue™ peroxidase substrate (SeraCare, #95059-168). PRNTs were then dried, and plaques were counted. PRNT50 titer is reported as the reciprocal of the lowest dilution of sera that inhibited greater than or equal to 50% the number of plaques as the no antibody, infected control. qRT-PCR. Viral RNA was isolated from ferret oral swabs throughout infection using the Qiagen QIAmp Viral RNA Mini Kit (Cat #52904). Purified RNA extracted from 140 LIL of oral swab was then stored at -80°C until further use. For samples with limited oral swab volume, RNA was extracted from 70 pL of sample and then 2x the measured RNA value was used in subsequent analyses. One-step qRT-PCR was then performed using EXPRESS One-Step Superscript qRT-PCR kit (Invitrogen, #11781200) on an Applied Biosystems QuantStudio 3 Real-Time PCR System. Custom TaqMan probes synthesized by IDT were used to target the viral RNA of the A / Hawaii / 70 / 2019 NP segment (Forward primer: 5'- CAGTGAGTACCCTTCCCTTTC-3' (SEQ ID NO: 44), reverse primer: 5'- CTGAGAGGATCAGTTGC AC ATA-3' (SEQ ID NO: 45), probe: 5'- / 56- FAM / TGTGTGTAT / ZEN / GGGCTTGCAGTAGCA / 3IABkFQ / -3' (SEQ ID NO: 46)). Endogenous eukaryotic 18S rRNA (Applied Biosystems, #4319413E) was also targeted as an endogenous control.
[0119] Influenza HA Production. Recombinant HA (rHA) were purchased from Sino Biological, the IRR, the Duke CIVICs Reagent Core, or produced by GenScript as indicated in Table 2. For rHA produced by Genscript, the soluble full-length ectodomains for the HAs of the influenza strains cloned into pFastBac expression constructs containing a T3-fribitin (FoldOn) trimerization domain and C-terminal hexa-His tag as described78. Baculoviruses from SI9- transfected cells were used to infect Sf9 cells cultured in Sf-900™II SFM medium (Life Technologies, #10902104). Three days post-infection, the rHA were purified by Ni-NTA column.
[0120] Table 2. Recombinant HA proteins used for Luminex binding assays
[0121] Multiplex HA binding assays. rHA or BSA (Sigma - negative control) were conjugated to magnetic microspheres (Luminex Corp.) by carbodiimide coupling using the manufacturer’s protocol. rHA- and BSA-conjugated microspheres (1,500 of each) were mixed with 10-fold serially-diluted samples diluted 1: 100 to 1: 10,000,000 in PBS, 1% BSA pH=7.4 (assay buffer; bioWorld), incubated for 60 minutes at room temperature on an orbital shaker and then washed in assay buffer. Microspheres were incubated with 10 pg / mL phycoerythrin (PE)-conjugated goat anti-ferret IgG heavy & light chains (Abeam #abl 12768 conjugated to PE using a Lightning-Link labelling kit (Abeam)) for 30 minutes, washed in assay buffer, and the PE median fluorescence intensity (MFI) of each microsphere population measured using an Intelliflex DR-SE bead reader (Luminex). Data were analyzed using Bio-Plex Manager v.6.2. Different HAs exhibited parallelism and dilutional linearity at different sample dilutions, and so for each HA, the raw result was calculated as the average background-corrected MFI from duplicate wells at the first dilution at which the data appeared parallel and linear for all samples. These MFI values were then each normalized to the values of luciferase mRNA-LNP vaccinated animals within each HA, then log transformed to obtain the reported values. These normalized MFI values are shown individually for each animal. HAs for which neither four mRNA-LNP - nor Flulaval-vaccinated animals had a statistically significantly higher normalized MFI value compared to luciferase mRNA-LNP-vaccinated animals are not reported.
[0122] Graphing and statistical analyses. Experiments were graphed using Prism 9 (GraphPad Software) and all statistical analysis was performed using R statistical software (R Foundation for Statistical Computing, Vienna, Austria). Initially, comparisons of more than two groups were performed using a Kruskal -Wallis test. If the resulting p-value was <0.05, a Wilcoxon rank-sum test was performed to compare each pairs of groups. The Benjamini -Hochberg procedure was applied within each figure panel to control the false discovery rate (FDR) for multiple comparisons. All tests were two-sided, with an alpha level of 0.05. All experiments were performed in two independent experiments unless otherwise noted. For data in which groups were overlapping over the same values, groups were nudged apart vertically or horizontally to help distinguish groups. For sample groups that yielded values below / above the LOD in their assays, groups were assigned an arbitrary value below the LOD to be included in the graph and in statistical analysis. Schematics featured in figures were created using BioRender.
[0123] References:
[0124] 1. Thompson, W.W., et al. Influenza-associated hospitalizations in the United States. JAMA 292, 1333-1340 (2004).
[0125] 2. Prevention, C.f.D.C.a. Preliminary Estimated Influenza Illnesses, Medical Visits, Hospitalizations, and Deaths in the United States — 2022-2023 Influenza Season. Vol. 2024 (2023).
[0126] 3. Putri, W., Muscatello, D.J., Stockwell, M.S. & Newall, A.T. Economic burden of seasonal influenza in the United States. Vaccine 36, 3960-3966 (2018).
[0127] 4. Hobson, D., Curry, R.L., Beare, A.S. & Ward-Gardner, A. The role of serum haemagglutination-inhibiting antibody in protection against challenge infection with influenza A2 and B viruses. J Hyg (Land) 70, 767-777 (1972).
[0128] 5. Chen, Y.Q., et al. Influenza Infection in Humans Induces Broadly Cross-Reactive and Protective Neuraminidase-Reactive Antibodies. Cell 173, 417-429 e410 (2018). 6. Wei, C.J., et al. Next-generation influenza vaccines: opportunities and challenges. Nat Rev Drug Discov 19, 239-252 (2020).
[0129] 7. Fleury, D., Wharton, S.A., Skehel, J.J., Knossow, M. & Bizebard, T. Antigen distortion allows influenza virus to escape neutralization. Nat Struct Biol 5, 119-123 (1998).
[0130] 8. Guthmiller, J. J., et al. First exposure to the pandemic H1N1 virus induced broadly neutralizing antibodies targeting hemagglutinin head epitopes. Sci TranslMed 13(2021).
[0131] 9. Yamazaki, T., Chiba, J. & Akashi-Takamura, S. Neutralizing Anti-Hemagglutinin Monoclonal Antibodies Induced by Gene-Based Transfer Have Prophylactic and Therapeutic Effects on Influenza Virus Infection. Vaccines (Basel) 6(2018).
[0132] 10. Medina, R.A., et al. Glycosylations in the globular head of the hemagglutinin protein modulate the virulence and antigenic properties of the H1N1 influenza viruses. Sci Transl Med 5, 187ral70 (2013).
[0133] 11. Heaton, N.S., Sachs, D., Chen, C.J., Hai, R. & Palese, P. Genome-wide mutagenesis of influenza virus reveals unique plasticity of the hemagglutinin and NS1 proteins. Proc Natl Acad Sci USA 110, 20248-20253 (2013).
[0134] 12. Krammer, F. The human antibody response to influenza A virus infection and vaccination. Nat Rev Immunol 19, 383-397 (2019).
[0135] 13. Gouma, S., Anderson, E.M. & Hensley, S.E. Challenges of Making Effective Influenza Vaccines. Annu Rev Virol 7, 495-512 (2020).
[0136] 14. Krammer, F., et al. NAction! How Can Neuraminidase-Based Immunity Contribute to Better Influenza Virus Vaccines? mBio 9(2018).
[0137] 15. Wu, N.C. & Ellebedy, A.H. Targeting neuraminidase: the next frontier for broadly protective influenza vaccines. Trends Immunol 45, 11-19 (2024).
[0138] 16. Chen, J.R., Liu, Y.M., Tseng, YC. & Ma, C. Better influenza vaccines: an industry perspective. J Biomed Sci 27, 33 (2020).
[0139] 17. Gouma, S., et al. Nucleoside-Modified mRNA-Based Influenza Vaccines Circumvent Problems Associated with H3N2 Vaccine Strain Egg Adaptation. J Virol 97, eO 172322 (2023).
[0140] 18. Tricco, A.C., et al. Comparing influenza vaccine efficacy against mismatched and matched strains: a systematic review and meta-analysis. BMC Med 11, 153 (2013). Zost, S.J., et al. Contemporary H3N2 influenza viruses have a glycosylation site that alters binding of antibodies elicited by egg-adapted vaccine strains. Proc Natl Acad Sci U SA 114, 12578-12583 (2017). Nayak, J.L. & Caserta, M.T. Cell-Culture-Based Influenza Vaccines: Don't Put All of Your Influenza Vaccines in the Egg Basket. Pediatrics 150(2022). Chambers, B.S., Parkhouse, K., Ross, T.M., Alby, K. & Hensley, S.E. Identification of Hemagglutinin Residues Responsible for H3N2 Antigenic Drift during the 2014-2015 Influenza Season. Cell Rep 12, 1-6 (2015). Prevention, C.f.D.C.a. CDC Seasonal Flu Vaccine Effectiveness Studies. Vol. 2024 (2024). Goel, R.R., et al. mRNA vaccines induce durable immune memory to SARS-CoV-2 and variants of concern. Science 374, abm0829 (2021). Goel, R.R., et al. mRNA Vaccination Induces Durable Immune Memory to SARS-CoV-2 with Continued Evolution to Variants of Concern. bioRxiv (2021). Painter, M.M., et al. Rapid induction of antigen-specific CD4(+) T cells is associated with coordinated humoral and cellular immunity to SARS-CoV-2 mRNA vaccination. Immunity 54, 2133-2142 e2133 (2021). Chaudhary, N., Weissman, D. & Whitehead, K.A. mRNA vaccines for infectious diseases: principles, delivery and clinical translation. Nat Rev Drug Discov 20, 817-838 (2021). Zhang, G., Tang, T., Chen, Y, Huang, X. & Liang, T. mRNA vaccines in disease prevention and treatment. Signal Transduct Target Ther 8, 365 (2023). Baden, L.R., et al. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N Engl JMed384, 403-416 (2021). Polack, F.P, et al. Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine. N Engl J Med 383, 2603-2615 (2020). Wilson, E., et al. Efficacy and Safety of an mRNA-Based RSV PreF Vaccine in Older Adults. N Engl J Med 389, 2233-2244 (2023). Creech, C.B., et al. Evaluation of mRNA-1273 Covid-19 Vaccine in Children 6 to 11 Years of Age. N Engl J Med 386, 2011-2023 (2022). Furer, V., et al. Immunogenicity and safety of the BNT162b2 mRNA COVID-19 vaccine in adult patients with autoimmune inflammatory rheumatic diseases and in the general population: a multicentre study. Ann Rheum Dis 80, 1330-1338 (2021). famous, Y.F. & Alhomoud, D.A. The Safety and Effectiveness of mRNA Vaccines Against SARS-CoV-2. Cureus 15, e45602 (2023). Sahin, U., Kariko, K. & Tureci, O. mRNA-based therapeutics-developing a new class of drugs. Nat Rev Drug Discov 13, 759-780 (2014). Eichelberger, M.C., Morens, D M. & Taubenberger, J.K. Neuraminidase as an influenza vaccine antigen: a low hanging fruit, ready for picking to improve vaccine effectiveness. Curr Opin Immunol 53, 38-44 (2018). Monto, A.S., et al. Antibody to Influenza Virus Neuraminidase: An Independent Correlate of Protection. J Infect Dis 212, 1191-1199 (2015). Giurgea, L.T., Morens, D.M., Taubenberger, J.K. & Memoli, M.J. Influenza Neuraminidase: A Neglected Protein and Its Potential for a Better Influenza Vaccine. Vaccines (Basel) 8(2020). Hansen, L., et al. Human anti-Nl monoclonal antibodies elicited by pandemic H1N1 virus infection broadly inhibit HxNl viruses in vitro and in vivo. Immunity 56, 1927- 1938 el928 (2023). Jiang, H., et al. Structure-Based Modification of an Anti-neuraminidase Human Antibody Restores Protection Efficacy against the Drifted Influenza Virus. mBio 11(2020). Kilbourne, E.D., Johansson, B.E. & Grajower, B. Independent and disparate evolution in nature of influenza A virus hemagglutinin and neuraminidase glycoproteins. Proc Natl Acad Sci USA 87, 786-790 (1990). Stadlbauer, D., et al. Broadly protective human antibodies that target the active site of influenza virus neuraminidase. Science 366, 499-504 (2019). Wohlbold, T. J., et al. Vaccination with adjuvanted recombinant neuraminidase induces broad heterologous, but not heterosubtypic, cross-protection against influenza virus infection in mice. mBio 6, e02556 (2015). McMahon, M., et al. Assessment of a quadrivalent nucleoside-modified mRNA vaccine that protects against group 2 influenza viruses. Proc Natl Acad Sci USA 119, e2206333119 (2022). 44. Rcheulishvili, N., et al. Designing multi-epitope mRNA construct as a universal influenza vaccine candidate for future epidemic / pandemic preparedness. Int J Biol Macromol 226, 885-899 (2023).
[0141] 45. Rijnink, W.F., et al. Characterization of non-neutralizing human monoclonal antibodies that target the Ml and NP of influenza A viruses. J Virol 97, eO 164622 (2023).
[0142] 46. Modema, I. Modema Announces Interim Phase 3 Safety and Immunogenicity Results for mRNA-1010, a Seasonal Influenza Vaccine Candidate. (2023).
[0143] 47. Modema, I. Moderna Announces First Participants Dosed in Phase 1 / 2 Study with mRNA-1020 and mRNA-1030 Seasonal Influenza Vaccine Candidates. (2022).
[0144] 48. Li, M., et al. Influenza a Neuraminidase-Based Bivalent mRNA Vaccine Induces Thl- Type Immune Response and Provides Protective Effects in Mice. Vaccines (Basel) 12(2024).
[0145] 49. Freyn, A.W., et al. A Multi-Targeting, Nucleoside-Modified mRNA Influenza Virus Vaccine Provides Broad Protection in Mice. Mol Ther 28, 1569-1584 (2020).
[0146] 50. Arevalo, C.P., etal. A multivalent nucleoside-modified mRNA vaccine against all known influenza virus subtypes. Science 378, 899-904 (2022).
[0147] 51. Pardi, N„ et al. Development of a pentavalent broadly protective nucleoside-modified mRNA vaccine against influenza B viruses. Nat Commun 13, 4677 (2022).
[0148] 52. Basak, S., Tomana, M. & Compans, R.W. Sialic acid is incorporated into influenza hemagglutinin glycoproteins in the absence of viral neuraminidase. Virus Res 2, 61-68 (1985).
[0149] 53. Palese, P, Tobita, K., Ueda, M. & Compans, R.W. Characterization of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397-410 (1974).
[0150] 54. McAuley, J.L., Gilbertson, B.P, Trifkovic, S., Brown, L.E. & McKimm-Breschkin, J.L. Influenza Virus Neuraminidase Structure and Functions. Front Microbiol 10, 39 (2019).
[0151] 55. Su, B., et al. Enhancement of the influenza A hemagglutinin (HA)-mediated cell-cell fusion and virus entry by the viral neuraminidase (NA). PLoS One 4, e8495 (2009).
[0152] 56. Li, F., et al. Generation of replication-competent recombinant influenza A viruses carrying a reporter gene harbored in the neuraminidase segment. J Virol 84, 12075-12081 (2010). 57. Pan, W., et al. Visualizing influenza virus infection in living mice. Nat Commun 4, 2369 (2013).
[0153] 58. Fang, J., et al. An antibody delivery system for regulated expression of therapeutic levels of monoclonal antibodies in vivo. Mol Ther 15, 1153-1159 (2007).
[0154] 59. Harding, A.T., Heaton, B E , Dumm, R.E. & Heaton, N.S. Rationally Designed Influenza Virus Vaccines That Are Antigenically Stable during Growth in Eggs. mBio 8(2017).
[0155] 60. Alameh, M.G., et al. Lipid nanoparticles enhance the efficacy of mRNA and protein subunit vaccines by inducing robust T follicular helper cell and humoral responses. Immunity 54, 2877-2892 e2877 (2021).
[0156] 61. Belser, J. A., Katz, J.M. & Tumpey, T.M. The ferret as a model organism to study influenza A virus infection. Dis Model Meeh 4, 575-579 (2011).
[0157] 62. DiLillo, D.J., Palese, P, Wilson, PC. & Ravetch, J.V Broadly neutralizing anti -influenza antibodies require Fc receptor engagement for in vivo protection. J Clin Invest 126, 605- 610 (2016).
[0158] 63. Pardi, N., et al. Nucleoside-modified mRNA immunization elicits influenza virus hemagglutinin stalk-specific antibodies. Nat Commun 9, 3361 (2018).
[0159] 64. Lim, J.M.E., et al. A comparative characterization of SARS-CoV-2-specific T cells induced by mRNA or inactive virus COVID- 19 vaccines. Cell Rep Med 3, 100793 (2022).
[0160] 65. Knudson, C.J., et al. Lipid-nanoparticle-encapsulated mRNA vaccines induce protective memory CD8 T cells against a lethal viral infection. Mol Ther 29, 2769-2781 (2021).
[0161] 66. Brasu, N., et al. Memory CD8(+) T cell diversity and B cell responses correlate with protection against SARS-CoV-2 following mRNA vaccination. Nat Immunol 23, 1445- 1456 (2022).
[0162] 67. Powers, D.C., Kilbourne, E.D. & Johansson, B.E. Neuraminidase-specific antibody responses to inactivated influenza virus vaccine in young and elderly adults. Clin Diagn Lab Immunol 3, 511-516 (1996).
[0163] 68. Couch, R.B., et al. Randomized comparative study of the serum antihemagglutinin and antineuraminidase antibody responses to six licensed trivalent influenza vaccines. Vaccine 31, 190-195 (2012). 69. Sandbulte, M.R., et al. Discordant antigenic drift of neuraminidase and hemagglutinin in H1N1 and H3N2 influenza viruses. Proc Natl Acad Sci USA 108, 20748-20753 (2011).
[0164] 70. Laguio-Vila, M.R., et al. Comparison of serum hemagglutinin and neuraminidase inhibition antibodies after 2010-2011 trivalent inactivated influenza vaccination in healthcare personnel. Open Forum Infect Dis 2, ofull5 (2015).
[0165] 71. Schauer, R. Sialic acids as antigenic determinants of complex carbohydrates. Adv Exp Med Biol 228, 47-72 (1988).
[0166] 72. Baiersdorfer, M., et al. A Facile Method for the Removal of dsRNA Contaminant from In Vitro-Transcribed mRNA. Mol Ther Nucleic Acids 15, 26-35 (2019).
[0167] 73. Maier, M.A., et al. Biodegradable lipids enabling rapidly eliminated lipid nanoparticles for systemic delivery of RNAi therapeutics. Mol Ther 21, 1570-1578 (2013).
[0168] 74. Yassine, H.M., et al. Hemagglutinin-stem nanoparticles generate heterosubtypic influenza protection. Nat Med 21, 1065-1070 (2015).
[0169] 75. Corbett, K.S., et al. Design of Nanoparticulate Group 2 Influenza Virus Hemagglutinin Stem Antigens That Activate Unmutated Ancestor B Cell Receptors of Broadly Neutralizing Antibody Lineages. mBio 10(2019).
[0170] 76. Park, J.W., Lagniton, P.N.P., Liu, Y. & Xu, R.H. mRNA vaccines for COVID-19: what, why and how. Int J Biol Sci 17, 1446-1460 (2021).
[0171] 77. Vogel, A.B., et al. BNT162b vaccines protect rhesus macaques from SARS-CoV-2. Nature 592, 283-289 (2021).
[0172] 78. Whittle, J.R., et al Broadly neutralizing human antibody that recognizes the receptorbinding pocket of influenza virus hemagglutinin. Proc Natl Acad Sci USA 108, 14216- 14221 (2011).
[0173] Example 2:
[0174] In the following example, the inventors demonstrate that the NA-F2A-HA vaccine strategy described in Example 1 can be applied to a highly pathogenic avian influenza (HP Al) H5N1 virus and that it can be used effectively in both DNA- and mRNA-based vaccines.
[0175] Effective vaccines are an important public health tool for combating the emerging, highly pathogenic H5N1 avian influenza viruses currently circulating in cattle and poultry in the United States. While nucleic acid-based vaccines such as mRNA-LNPs have several potential advantages during a viral epidemic when compared to traditional seasonal influenza vaccines, their utility and efficacy against H5N1 viruses remains incompletely defined. Here, we developed novel DNA- and mRNA-LNP-based vaccines encoding both hemagglutinin (HA) and neuraminidase (NA) proteins from the human isolated highly pathogenic avian influenza (HP Al) H5N1 strain, A / Texas / 37 / 2024, in a single open reading frame. This dual-antigen expression approach elicited strong protective immune responses targeting both the HA and NA proteins and provided complete protection against lethal viral challenge in a murine model. The pre- clinical data described in this work suggest that these multi-valent, adaptable and scalable vaccine approaches may represent practical and rapid solutions to mediate robust protection from emerging zoonotic influenza virus threats.
[0176] Vaccines capable of protecting from infection with the H5N1 influenza viruses actively circulating in dairy cattle are urgently needed to protect livestock and humans in the event of zoonotic spillover. Here we describe the development of protective DNA and mRNA-LNP vaccines targeting HA and NA proteins from the HP Al H5N1 A / Texas / 37 / 2024 virus and show that they are both protective against severe morbidity and mortality in a mouse model. Thus, the vaccines described in this work represent effective approaches to limit the current circulation of H5N1 viruses in animals and may represent a practical solution for human vaccination in the event of sustained human transmission of HP Al H5N1 viruses.
[0177] Introduction:
[0178] Since early 2024, highly pathogenic H5N1 avian influenzas viruses of the 2.3.4.4b clade have been widely circulating in dairy cattle, poultry, and wild birds (1). While similar viruses have previously been detected in North American birds, their sustained transmission in livestock represents a concerning evolutionary shift (2, 3). The B3.13 genotype 2.3.4.4b virus, exemplified by the A / Texas / 37 / 2024 strain, has infected over 950 cattle herds across 17 states, leading to viral shedding in milk and reduced milk production (1, 4, 5). Meanwhile, Dl. l genotype H5N1 viruses have been spreading in poultry flocks, threatening egg supplies and displaying increased human exposure among farm workers (1, 4, 5). Alarmingly, 70 human cases of 2.3.4.4b H5N1 infection have been confirmed, primarily in individuals with prior exposure to infected animals, but notably, three cases had no known exposure (6). While most infections have resulted in mild respiratory symptoms or conjunctivitis, one patient in Louisiana, infected after contact with a backyard flock, developed severe disease and later died (7-9). Although human-to-human transmission has not been observed, the virus's continued spread in animals heightens the risk of mutations that could facilitate sustained transmission among humans. Thus, there is a critical need for effective interventions to limit H5N1 viral transmission and mitigate the risk of a future influenza pandemic.
[0179] One of the most effective tools for controlling emerging viral threats is vaccination, yet traditional vaccine platforms face limitations in their ability to rapidly respond to novel pathogens. Platforms used for seasonal influenza vaccines, such as inactivated and live- attenuated vaccines, require extensive development time, complex production pipelines, and large-scale manufacturing, all which delay deployment during outbreaks (10, 11). In contrast, nucleic acid-based vaccines, including DNA and mRNA platforms, offer an adaptable and scalable solution for pandemic preparedness due to their adaptability to varied genetic sequences. Sequence agnostic mRNA vaccines, formulated with lipids to generate lipid nanoparticles (LNPs), generally enable faster production, stronger immune responses, and more efficient delivery, making them ideal candidates for human delivery during real-world outbreak response, as was exemplified during the COVID-19 pandemic (12-14).
[0180] Seasonal influenza vaccines primarily focus on inducing hemagglutinin (HA)-specific immune responses, as HA-targeted antibodies are crucial for viral neutralization and protection (15-17). A singular focus on HA often overlooks the impactful contributions of neuraminidase (NA)-directed immune responses, which have been shown to lower viral loads, reduced transmission, and milder disease outcomes (18-20). As is described in Example 1, to address this limitation and balance immune responses to both HA and NA, we developed an improved seasonal mRNA-LNP vaccine platform capable of expressing multiple viral glycoproteins from a single mRNA molecule. Application of this technology to seasonal influenza subtypes (Influenza A (IAV) H1N1 and H3N2, Influenza B (IBV) Yamagata and Victoria) in a quadrivalent vaccine format elicited robust immune responses, however the approach has not been tested with emerging or zoonotic influenza viruses. Given the continued spread and evolution of H5N1 in mammals, a dual-glycoprotein vaccine strategy could be a crucial step in developing more effective countermeasures against emerging influenza pandemic threats.
[0181] In the present Example, we develop novel nucleic acid-based vaccines against the zoonotic H5N1 strain, A / Texas / 37 / 2024, which was isolated from an infected dairy worker in Texas and thus represents a H5N1 strain with a demonstrated ability to cause disease in humans (21). Both DNA- and mRNA-LNP -based vaccines make use of a single ORF genetic configuration to deliver the genetic material of both the influenza HA and NA proteins from a single molecule of either DNA or RNA. After validating that the configuration allows for proper delivery and expression of both proteins in cells, we showed that the DNA-based vaccines are immunogenic and protective in mice, conferring full protection from viral challenge and disease. We then translated this design into an mRNA-LNP vaccine, which was shown to elicit functionally neutralizing antibodies and provide complete protection against lethal H5N1 challenge in mice. These findings show that both DNA and RNA-based nucleic acid vaccine platforms represent promising approaches for rapidly countering emerging zoonotic influenza viruses both in their animal hosts and in preparation for possible human adaptation.
[0182] Results:
[0183] We have previously shown that expression of both NA and HA influenza virus glycoproteins from typical seasonal strains of influenza (H1N1, H3N2, IBV-Y and IBV-V) in a single open reading frame can be an effective vaccine approach that elicits improved immune responses compared to split inactivated influenza vaccine platforms (22, 23). To understand if this approach could be useful as an H5N1 vaccine, we first generated a plasmid encoding for both the A / Texas / 37 / 2024 NA and HA proteins from the same open reading frame by separating the two coding sequences via furin and PTV-2A cleavage sites (FIG. 13A). Following transfection of this NA-F2A-HA plasmid or a mixture of plasmids encoding for either protein alone into cells (NA+HA), alongside a luciferase-expressing control plasmid (FIG. 13B), we found that both NA and HA were expressed from the NA-F2A-HA plasmid (FIG. 13C, E) and detected on the surface of cells (FIG. 13D) to similar levels as when expressed individually (luciferase sequences are available from Promega). We also showed that the NA and HA expressed from our dual glycoprotein plasmid were not only detectable but also functionally active in NA-mediated removal of sialic acid from target proteins (FIG. 13F) and HA-mediated fusion of cell membranes under low pH conditions (FIG. 13G). These results suggest that this genetic approach can be used to deliver multiple H5N1 viral antigens to cells efficiently and effectively.
[0184] To investigate the immunogenicity of the A / Texas / 37 / 2024 NA-F2A-HA vaccine, we electroporated either a luciferase control plasmid, a mixture of plasmids expressing either NA or HA, or our dual glycoprotein plasmid (FIG. 14A). We rationalized that this approach would allow for rapid evaluation of the utility of the H5N1 NA-F2A-HA genomic configuration as a vaccine in vivo; in addition, DNA-vaccination approaches are currently used in several livestock vaccines (24-26), and therefore if immunogenic, the DNA-based vaccines themselves could have utility in animal vaccination. Following both prime and boost, we found that our NA-F2A-HA vaccine elicited robust antibodies that recognized the A / Texas / 37 / 2024 HA (FIG. 14B) or NA (FIG. 14C) antigens, in both cases to similar extents as a mixture of plasmids encoding for either protein. To test the functional neutralization capacity afforded by delivery of NA in our plasmid, we performed neuraminidase inhibition assays and found that antibodies generated by both our dual glycoprotein plasmid and a mixture of NA and HA-expressing plasmids were able to neutralize A / Texas / 37 / 2024 NA activity in vitro (FIG. 14D). We also performed microneutralization assays using a A / Texas / 37 / 2024 reporter virus (A / Texas / 37 / 2024 NanoLuc) to assess the function of HA-specific antibodies. We found that antibodies generated by both our dual glycoprotein plasmid and a mixture of NA and HA-expressing plasmids were able to efficiently neutralize multicycle A / Texas / 37 / 2024 NanoLuc viral infection in MDCK cells (FIG. 14E).
[0185] To assess the protection from disease in vivo afforded by our NA-F2A-HA DNA plasmid, we challenged prime / boosted mice with WT A / Texas / 37 / 2024 virus in a BSL-3 biocontainment facility and followed bodyweight, clinical scores, and viral load in tissues over the course of infection (FIG. 15A). We found significantly decreased levels of viral RNA in the lung homogenates of both the plasmid mixture and NA-F2A-HA-vaccinated mice compared to luciferase control-vaccinated animals at three days post-infection (FIG. 15B). Levels of cytokines and chemokines known to be associated with H5N1 infection in humans (C-X-C motif chemokine ligand 10 (CXCL-10), interferon beta (IFN-P), and tumor necrosis factor-alpha (TNF-a))(27, 28) were also found to be significantly decreased in the NA-F2A-HA- and NA+HA-vaccinated mice compared to luciferase controls (FIG. 15C-E). This decreased inflammation was also reflected in clinical scores of mice over the course of infection, which revealed that our vaccine mitigated all signs of clinical disease compared to luciferase controls (FIG. 15F). Plaque assays using lung homogenates three days post-infection revealed that the viral replication in lungs was significantly decreased in both the NA-F2A-HA- and NA+HA- vaccinated groups, with multiple animals per group negative for infectious virus (FIG. 15G), suggesting that these vaccine-generated immune responses efficiently neutralized initial viral replication during early infection. Importantly, over the entire course of infection, NA-F2A-HA- and NA+HA-vaccinated mice were completely protected from severe morbidity and mortality with no noticeable weight loss, and NA-F2A-HA-vaccinated mice displayed a slight trend for faster weight gain (FIG. 15H-I).
[0186] We next wanted to adapt this genetic configuration to an mRNA-LNP -based vaccine as this nucleic acid vaccine formulation has been successfully used in humans and is the mostly likely path forward for H5N1 vaccines. We also developed our mRNA-LNP vaccine using generic LNPs using commercially available kits to ensure that results would not be dependent on any specific proprietary LNP formulations. NA-F2A-HA mRNA-LNPs were designed in the same way as with the DNA vectors (FIG. 16A) and delivered to mice in a prime / boost regimen to assess immunogenicity. The NA-F2A-HA mRNA-LNP was found to induce robust antibody responses to both NA and HA following both prime and boost (FIG. 16B-C), and these antibodies were found to have strong neutralizing activity against both proteins individually in HAI (FIG. 16D) and NAI assays (FIG. 16E). To assess their capacity for overall viral neutralization of A / Texas / 37 / 2024, we performed cell-based microneutralization assays and found that the elicited antibodies were able to efficiently neutralize viral infection following both prime and boost (FIG. 16F).
[0187] To understand the protection from disease conferred by the NA-F2A-HA mRNA-LNP vaccine, we then challenged boosted mice with A / Texas / 37 / 2024 in a BSL-3 containment facility and again followed multiple measures of disease progression (FIG. 17A). We found that the amount of viral RNA was significantly decreased in the lungs of NA-F2A-HA mRNA-LNP- vaccinated mice compared to luciferase mRNA-LNP control vaccinated mice (FIG. 17B). Furthermore, in terms of infectious viral load, plaque assays revealed that while luciferase mRNA-LNP control vaccinated mice had high titers of virus in their lungs, NA-F2A-HA mRNA-LNP vaccinated mice all had no viral replication detected, suggesting the possible induction of neutralizing immunity (FIG. 17C). Additionally, the cytokines and chemokines CXCL-10, IFN-P, and TNF-a were found to be drastically reduced in NA-F2A-HA mRNA-LNP vaccinated mouse lungs, suggesting little lung pathology and damage (FIG. 17D-F). Lung pathology of infected mice was examined using H&E staining, which showed similar levels of inflammation and immune cell infiltrate between both the luciferase mRNA-LNP and NA-F2A- HA mRNA-LNP-vaccinated animals (FIG. 17G). These trends in pathology indicate the cause of death early in infection in control vaccinated animals may be related to wider-spread organ damage, which has been reported by multiple groups (29-32). Despite these similarities in pathology, luciferase mRNA-LNP control vaccinated animals experienced high clinical scores early during infection while all signs of clinical disease were mitigated in NA-F2A-HA mRNA- LNP -vaccinated animals, further supporting the possibility of wider spread damage beyond the lungs (FIG. 17H). Ultimately, NA-F2A-HA mRNA-LNP vaccinated mice were found to be completely protected from bodyweight loss or morbidity during infection, while luciferase mRNA-LNP -vaccinated mice succumbed to infection by day 5 (FIG. 17I-J).
[0188] Discussion:
[0189] In this study, we report the development of effective DNA and mRNA-LNP -based vaccines that encode the HA and NA glycoproteins of A / Texas / 37 / 2024 (H5N1) and induce robust immune responses and protection against lethal viral challenge in a murine model. Our data show that both versions of the vaccines elicit high levels of HA- and NA-specific antibodies, functionally neutralizing activities, and effective viral clearance in the lungs, thereby preventing severe disease. This genetic configuration for expression of both major viral glycoproteins and the demonstrated adaptability to different nucleic acid platforms suggests that this approach may be broadly useful for rapid vaccine development against emerging zoonotic influenza viruses with the potential to infect humans.
[0190] While our DNA-based experiments provided a rapid proof-of-concept approach for the unique genetic configuration of our vaccine, DNA-based vaccines themselves may represent a path forward for animal vaccination to help curb the circulation in both cattle and poultry. DNA vaccines are cost-effective, stable at ambient temperatures, and can be rapidly produced at scale, making them well-suited for deployment in agricultural settings (33-36). Moreover, they have been found to induce robust humoral and cellular immune responses in multiple different animals, including chickens against H5N1 avian influenza viruses, and up to animals as large as horses, and lack the risk of reversion to virulence, making them a safe alternative to traditional live-attenuated or inactivated vaccines (24, 26, 37, 38). By effectively preventing viral transmission among livestock, an effective DNA vaccine platform such as the one described here could limit zoonotic spillover and reduce the risk of human infection, ultimately safeguarding both the agricultural industry and public health. The mRNA-LNP platform is highly likely to be utilized for human H5N1 vaccines as they already been proven to be highly effective during the COVID-19 pandemic response; they produce both humoral and cellular immune responses and resulting in protection rates of over 90% (14, 39, 40). This efficacy has prompted the development of mRNA-LNP vaccines against both seasonal and emerging influenza viruses. In fact, several clinical trials have already been performed with seasonal influenza virus antigens demonstrating safety in humans as well as manufacturers’ commitment to the platform (41-43). The development of mRNA-LNP vaccines against pandemic influenza strains has also been of interest, with multiple groups reporting positive preclinical and clinical trial data of effective vaccines against H5 and H7 influenza viruses (44-51). While most of these studies have focused on HA-directed immunity only, those that have elicited NA-directed responses have seen improved protection against vaccine and drifted strains, strengthening the case for the inclusion of NA in vaccine designs to maximize and broaden protection (45, 46). The unique antigenic design of our vaccine represents an efficient and cost-effective way to deliver both NA and HA in future vaccine formulations designed to protection against H5N1 or other emerging viruses, streamlining the production of LNPs and affording maximal protection from disease. Furthermore, the platforms presented here represent highly adaptable strategies to quickly respond to novel emergent viral strains with the capacity to infect humans.
[0191] While the apparent efficacy of the vaccines described in this work is encouraging, our study has several limitations that should be noted. First, while mice provide a useful initial model for evaluating vaccine efficacy, they do not fully recapitulate immune responses observed in humans (52). For this reason, our findings should be validated in a more clinically relevant animal models, such as ferrets, which more closely mimic the human course of influenza disease and have ability to transmit the virus via respiratory droplets (53, 54). Additionally, our experiments were conducted in specific-pathogen free (SPF) mice, which do not account for the potential effects of pre-existing immunity from prior influenza exposure or vaccination, as well as the effects of previous or chronic non-influenza infections — immune statuses that are known to influence vaccine immunogenicity in real-world settings (55-58). Another important consideration to be explored is the long-term durability of responses induced by the mRNA vaccines . While influenza mRNA vaccines have been found to induce noninferior, and in some cases, superior, immune responses through six months in humans compared to inactivated vaccines, their longer term durability remains incompletely understood (41). For SARS-CoV-2, mRNA vaccine-induced responses have been shown to wane substantially six months postvaccination (59, 60). For this reason, it will be important in the future to perform long-term studies elucidating the durability of mRNA vaccine-induced responses to ensure protective antibody levels through an entire influenza season. Finally, while our vaccine provides robust protection against A / Texas / 37 / 2024, it remains to be determined whether it confers crossprotection against antigenically distinct H5N1 strains that may pose future threats to both livestock and human populations.
[0192] Looking ahead, several key steps are necessary to translate these vaccines into viable countermeasures against emerging zoonotic influenza threats. A major advantage of our mRNA- LNP platform is its versatility and broad applicability. By using a generic LNP formulation, our platform has the potential to be rapidly adapted to combat emerging viral strains worldwide, regardless of regional manufacturing capabilities. Furthermore, our antigen configuration is compatible and effective with multiple LNP formulations, as demonstrated by the success of our previously published vaccine that utilized a different LNP platform. This adaptability broadens production possibilities to a variety of manufacturers and countries, facilitating more equitable and scalable vaccine distribution during global health crises. Additionally, the lipids used in our formulation are GMP -compatible and readily scalable, ensuring that large-scale production can be quickly achieved during outbreak response scenarios. Our DNA-based vaccine similarly represents a scalable strategy for preventing viral spread within cattle and poultry, mitigating zoonotic spillover risks. By integrating these strategies, both vaccine platforms presented here offer scalable and globally accessible solutions for mitigating the threat of the next influenza pandemic and equipping ourselves with effective tools to combat it.
[0193] Materials and Methods:
[0194] Cells. 293T (CRL-3216) cells and MDCK (CCL-34) cells were both obtained from American Type Culture Collection (ATCC) and cultured at 37°C with 5% CO2. 293T cells were maintained with Dulbecco’s Modified Eagle Medium (DMEM, Gibco™) that was supplemented with 5% fetal bovine serum (FBS) and GlutaMAX™ (Gibco™), and MDCK cells were grown in Minimum Essential Medium (MEM Gibco™) with 5% FBS, GlutaMAX, sodium bicarbonate (Gibco™), and HEPES (Gibco™). All media used for cells was also supplemented with penicillin / streptomycin and Plasmocin prophylactic (Invitrogen, ANT-MPP). Viral strains. Wild-type A / Texas / 37 / 2024 and reporter A / Texas / 37 / 2024 NanoLuciferase viruses were rescued as previously described (61) under BSL-3 biocontainment conditions. Virus was then propagated on 10-day old embryonated chicken eggs for 24 hours, then harvested, aliquoted, and frozen at -80°C. Virus was then titered on MDCK cells using plaque assays. All live virus work was approved by the institutional biosafety committee at Duke University. All segments from both viruses were amplified via SuperScript III One-Step RT-PCR systems (Thermo, 12574026) and cDNA was purified via gel purification. Viral cDNA was then Sanger sequenced to validate viral identity.
[0195] Mouse vaccination. C57BL / 6 mice (The Jackson Laboratory, #000664) were used in the study. DNA vaccination experiments, on Day 0, the animals were anesthetized with ketamine and xylazine; and fur on the right hind leg was removed by shaving and treatment with hair removal cream. For initial vaccination, a solution of plasmid DNA (1 pg / pL, 50 pL) or an empty vector control plasmid solution (50 pL) was injected into the gastrocnemius muscle of the prepared leg using a syringe pump (PHD 2000, Harvard Apparatus), followed by percutaneous application of 8 electric pulses (70 V, 100 msec, 1 Hz) to the same muscle. The pulses were generated by the Square Wave Electroporation System (BTX ECM 830, Harvard Apparatus) and applied via a pair of platinum Tweezertrodes electrodes (BTX) that were pre-coated with an electric conductive gel and separated by 4 mm distance. On Day 21, the same procedures above were repeated on the left hind leg for the boost dose. For both prime and boost, vaccine doses were as follows to deliver similar copies of DNA plasmids per group: pCAGGs-Luciferase, 50pg; pCAGGs-Texas / 24 NA, 23 pg and pCAGGs-Texas / 24 HA, 27pg; pCAGGs-Texas / 24 NA- F2A-HA, 50pg. The serum from animals was collected on Days 19 (post-prime sera) and 35 (post-boost sera) for measurement of immune responses. For mRNA-LNP vaccination, mice were vaccinated intramuscularly with 5 pg of each indicated mRNA-LNP, diluted in pharmaceutical grade PBS. Mice were primed, boosted, and bled for sera in the same design as for DNA vaccinations.
[0196] Mouse viral challenge. For viral challenge, between ~2.5-8 weeks post-boost, mice were anesthetized with ketamine / xylazine and intranasally inoculated with 200 PFU of WT A / Texas / 37 / 2024 diluted in pharmaceutical grade PBS. Bodyweight and clinical score were monitored for 14 days post-infection, or for groups in which lungs were obtained, lungs were harvested according to protocol at three days post-infection, homogenized in ImL pharmaceutical-grade PBS and aliquoted. Clinical scores were defined as the following: 0 = normal activity, no signs of illness; 1 = mild lethargy and hunched body posture; 2 = moderate lethargy, hunched body posture, ears pointed back, mouse still mobile if provoked or unprovoked; 4 = severe lethargy, hunched posture with ears pointed back and eyes squinted, little to low movement (even if provoked). If mice fell below the predetermined humane endpoint of 25% bodyweight loss from pre-challenge weights, they were sacrificed according to Duke University Institutional Animal Care and Use Committee (lACUC)-approved protocols.
[0197] Animal ethics. All experiments involving animals were approved by Duke University IACUC under the protocol numbers A142-21-07-24 and Al 13-24-06. Animals were housed in ambient temperature and humidity facilities in 12-hour light / dark cycles, with free access to food and water. All mouse infections were performed in the Duke University BSL-3 biocontainment facility.
[0198] Plasmids. The A / Texas / 37 / 2024 HA and NA sequences were obtained from the following accession numbers through GISAID: NA, EPI3171486; HA, EPI3171488. In the case that single nucleotides were missing from entries, they were inferred from other H5N1 strains. Nucleotide sequences were human codon-optimized and ordered as complete genomic segments from Integrated DNA Technologies (IDT) that were then cloned into pCAGGS expression vectors as previously described (22), and sequence identity was confirmed using Sanger sequencing for DNA vaccines studies.
[0199] In vitro mRNA transcription. The NA-F2A-HA DNA construct containing a T7 promoter, 5' and 3' UTR regions, and a 110-nucleotide poly (A) tail was codon optimized and synthetized at GenScript (Singapore) and subcloned into pUC based plasmid with kanamycin resistant gene. The capped nucleoside-modified (N1 -methylpseudouridine, mlT) mRNA was synthetized using co-transcriptional capping method with CleanCap AG trimer and mlT (TriLink, USA) by Trilink protocol (Cat No. N-7113). The mRNA was purified using oligo-dT affinity monolith chromatography (Sartorius, Germany). Length and mRNA integrity were assessed using the native agarose gel. The mRNA was stored frozen (1 mg / mL) at -80 °C in nuclease-free water. mRNA-l.NP vaccine formulation. The mRNA-LNP vaccines were formulated by encapsulation using a GenVoy ionizable lipid mixture (GenVoy-ILM™) and NanoAssemblr Ignite™ machine (Precision NanoSystems (PNI), CA, USA). All procedures follow the manufacturer’s instruction. GenVoy-ILM lipid mixture consists of PNI Ionizable Lipid: DSPC: Choi esterol NI stabilizer at 50: 10:37.5:2.5 mol%. Formulation was prepared on the Ignite™ machine with a program set for a mixing of GenVoy-ILM™ and mRNA at a molar ratio of 4: 1 with a total flow rate of 12 mL / min and a flow ratio of 3 : 1. The LNP encapsulated mRNA was buffer exchanged to phosphate buffered saline (PBS) using 30 kDa, Amicon® ultra centrifugal fdters (Merck, Germany). Particle size was measured by Dynamic Light Scattering using Zetasizer Ultra machine (Malvern Panalytical, UK). Encapsulation efficiency and mRNA concentration were determined using Quant-iT™ RiboGreen™ RNA Assay (Thermo Fisher, USA). The encapsulation efficiency (EE) was calculated according to the following formula: EE% = (total RNA-free RNA) / total RNA.
[0200] Cell-based enzyme-linked immunosorbent assays (ELISAs). For cell-based ELISAs, 293T cells were first plated in poly-L-lysine treated 96-well plates. Cells were then transfected with the indicated plasmid in OptiMeM™ (Gibco™) using Trans-IT-LTl™ (Minis Bio, #2304) and left to incubate at 37°C with 5% CO2. After 24 hours, cells were fixed using 2% paraformaldehyde (PFA) and washed twice with IX PBS. Cells were blocked in 3% non-fat milk in IX PBS for at least 2 hours, then dilutions of sera / antibody in the blocking solution were added and allowed to incubate overnight at 4°C. Cells were washed four times with IX PBS, then secondary antibody (goat anti -mouse HRP (Invitrogen, #A16072) or goat anti-human HRP (Invitrogen, #A18805)) diluted 1 : 10,000 was added to each well. Plates were finally washed again four times with IX PBS before 1-Step TMB ELISA Substrate Solutions (Fisher Scientific, #PI34028) was added to each well to allow signal to develop. The reaction was then stopped with IM H2SO4 and absorbance was read at 450nm on a Varioskan LUX plate reader. Data was analyzed using Prism 9 (GraphPad), and area under the curve analyses were calculated based on dilutions up to the point of reaching signal plateau.
[0201] Confocal microscopy. For confocal microscopy, 293T cells were plated onto poly-L- lysine treated coverslips in 24-well plates, then transfected with the indicated plasmid in OptiMEM using Trans-IT-LTl transfection reagent and left to incubate overnight at 37°C with 5% CO2. Coverslips were then gently washed once with IX PBS, then fixed using 4% PFA. Coverslips were washed twice with IX PBS, then blocked with 5% bovine serum albumin (BSA) in IX PBS for at least one hour at room temperature. Primary antibody (anti -HA CR9114, generated by the Moody lab at Duke University School of Medicine, 10 pg / mL; and anti- A / Texas / 37 / 2024 NA mouse polyclonal sera, 1 :500) was then diluted in 0.5% BSA in PBS and added to coverslips, which were then left to incubate at 4°C overnight. Coverslips were washed three times with IX PBS, then secondary antibody (goat-anti human Alexa Fluor488™ (Invitrogen, #A11013) or goat-anti mouse Alexa Fluor647™ (Invitrogen, A21235)) was diluted 1 : 10,000 and added to coverslips and allowed to incubate for 1 hour at room temperature. Coverslips were washed three times again with PBS, then stained for nuclei with Hoescht 3342 (Life Technologies, 1 :2,500) and mounted onto slides (Prolong Diamond). Slides were imaged using an inverted 1X83 Olympus confocal microscope with a motorized XY-stage (Prior) and images were processed identically using ImageJ software (NIH).
[0202] HA fusion assay. For HA fusion assays, 293T cells were plated onto poly-L-lysine treated coverslips in 24-well plates, then transfected with the indicated plasmid in OptiMEM using TransIT-LTl and allowed to incubate at 37°C with 5% CO2 for 24 hours. The next day, the cell medium was replaced with OptiMEM supplemented with 0.35% BSA, 0.01% FBS and 5% penicillin / streptomycin with 1 mg / mL TPCK -trypsin for 20 minutes at 37°C with 5% CO2. Cells were then treated with either DMEM at physiological pH= 7.4, or DMEM acidified with citric acid at pH=5 for 20 minutes at 37°C with 5% CO2. All medium was then replaced with fresh DMEM at physiological pH and allowed to recover at 37°C for four hours. Coverslips were then fixed with 4% PFA and stained with 20 pg / mL Wheat Germ Agglutinin (WGA, Vector Laboratories) fluorescent lectin and Hoescht 33342 in PBS for 1 hour at room temperature. Coverslips were then mounted onto slides and imaged as described for confocal microscopy.
[0203] Enzyme-linked lectin assays (ELLAs). For ELLA assays to determine neuraminidase activity, wells of immunograde 96-well plates were coated with 25 pg / mL fetuin (Sigma, F3385) in IX coating buffer (KPL) for at least 24 hours at 4°C. 293T cells were plated and transfected with the indicated plasmids in OptiMEM using TransIT-LTl and left to incubate at 37°C. After 24 hours, cells were resuspended in OptiMEM supplemented with 0.35% BSA, 0.01% FBS and 5% penicillin / streptomycin, counted, and normalized across samples. Fetuin-coated plates were washed three times with IX PBS-T, and cell suspensions were added. Plates were firmly sealed and left to incubate at 37°C with 5% CO2 for 18 hours. Plates were then washed three times with IX PBS-T before peanut agglutinin-HRPO (1 pg / mL, Sigma) was diluted in sample PBS with 0.5% Tween-20 and added to plates for 2 hours in the dark at room temperature. Plates were washed three times again with IX PBS-T, and signal was developed as previously described for ELISAs. Neuraminidase activity inhibition (NAI) assays. For NAI assays, a similar protocol to ELLA assays was followed. To generate recombinant A / Texas / 37 / 2024 neuraminidase, 293T cells were transfected with pCAGGs-A / Texas / 37 / 2024 NA plasmid in OptiMEM using Lipofectamine 3000™, and at 24 hours post-transfection cells were harvested using IX PBS and counted. Cells were brought to a concentration of 1.2 xlO5cells / mL, spun down, and resuspended in equal volume PBS with 0.5% Tween-20 to lyse the cells. Sera from mice was treated 1 :4 dilution with receptor-destroying enzyme (RDE, Denka Seiken #370013) for 18 hours at 37°C, followed by inactivation of RDE enzyme with treatment at 56°C for 45 minutes. Sera was then serially diluted in PBS and added to fetuin-coated plates that had been washed three times with PBS / 0.01%Tween-20 (PBS-T). Cell lysates were then thoroughly mixed and added equally to each well and plates were left to incubate at 37°C for 18 hours. Wells including only cell lysate were included as positive controls. Plates were then developed using peanut agglutinin-HRPO secondary antibody and 1-Step TMB Substrate as described for ELLA assays. NA activity was calculated as the following percentage: ((Serum absorbance-mean background absorbance) / (mean positive control absorbance-mean background absorbance))* 100, and NAI titer is reported as the reciprocal of the lowest dilution of sera that inhibited greater than or equal to 50% of NA-only positive control activity.
[0204] Microneiitralization assays (MNso). All MNso assays were performed in the BSL-3 biocontainment facility. RDE-treated sera was serially diluted in complete MEM media, and an equal volume of a dilution of A / Texas / 37 / 2024 NanoLuc virus was added to each well except negative control wells. The virus-serum mixtures were left to incubate for 1 hour at 37°C with 5% CO2, and were then added to 96-well plates containing plated MDCK cells. Cells with sera / virus dilutions were then left to incubate for 24 hours at 37°C with 5% CO2. The next day, cells were washed once with IX PBS, and then were lysed in Luciferase Cell Culture Lysis Reagent (Promega, El 531) for 10 minutes at room temperature. Cell lysates were then added to a white 96-well plate, and signal was developed using the Nano-Gio® Luciferase Assay System (Promega, N1130) and bioluminescence was quantified using a BioTek Synergy LX plate reader. To calculate the MN50 titer, nonlinear regressions based on sera dilutions were calculated for each sample and the dilution at which each sample reached a 50% value of the positive control infected well value was reported as the MNso value (Prism 9, GraphPad). Hemagglutination inhibition (H Al assays). For HAI assays, RDE-treated sera was diluted 1 : 10 in PBS, then serially diluted 1:2 in 96-well V-bottom microplates. Equal amounts of standardized dilutions of A / Texas / 37 / 2024 virus (4 HA units (HAU)) was then added to each sera dilution and allowed to incubate at room temperature for 15 minutes. A standardized solution of 1% Horse red blood cells (RBCs) (Lampire Biological Laboratories, #7203401) in PBS was then added on top of the virus / sera mixtures, and the plates were covered and allowed to settle at 4°C overnight. The next day, HAI titers were calculated as the reciprocal of the last dilution of sera that inhibited hemagglutination, which was indicated by a clear red blood cell pellet.
[0205] Plaque assays. All plaque assays were performed in the BSL-3 biocontainment facility. For plaque assays, MDCK cells were plated in complete MEM in 6-well plates. After 24 hours, cells were washed once with IX PBS, and lung homogenates from infected mice were diluted in PBS / 5%BSA and then added to plates for 1 hour at 37°C with 5% CO2. After 1 hour, virus dilutions were aspirated and replaced with an agar overlay (MEM, GlutaMAX, sodium bicarbonate, HEPES, penicillin / streptomycin, BSA, DEAE-dextran, 1.2% cellulose colloidal microcrystalline (Sigma, 43244) with Ipg / mL TPCK-treated trypsin). After 48 hours postinfection, overlays were aspirated, and wells were stained with 0.1% crystal violet in 10% neutral buffered formalin before plaques were counted to determine titer.
[0206] RNA extraction and qRT-PCR. Viral RNA was extracted using TRIzol Reagent (Invitrogen, 15596026) in Phasemaker™ tubes (Thermo, A33248). qRT-PCR was then performed using the following probes: a custom primer / probe set ordered from IDT targeting the A / Texas / 37 / 2024 HA RNA (Forward: TTACACATGCCCAAGACATACT (SEQ ID NO: 47), Reverse: CAGCTACACTGCAGTCCTTTA (SEQ ID NO: 48), Probe: / 56- FAM / AACACACAA / ZEN / CGGGAAGCTATGCGA / 3IABkFQ (SEQ ID NO: 49)); commercial TaqMan probes for CXCL-10 (Mm00445235_ml), IFN-0 (Mm00439552_sl), and TNF-a (Mm00443258_ml) and normalized to endogenous 18S RNA (Applied Biosystems 4318839). qRT-PCR was performed using EXPRESS One- Step Superscript qRT-PCR kit (Invitrogen, 11781200). Samples were analyzed on an Applied Biosystems QuantStudio 3 Real-Time PCR System.
[0207] Lung histology. Mouse lungs were obtained from mice at 3 days post-infection in accordance with Duke IACUC protocols and were fixed in 4% PFAZPBS for at least 48 hours. Samples were then sent to HistoWiz Laboratories where they were paraffin embedded and sectioned onto slides before being stained with hematoxylin and eosin for imaging.
[0208] Graphing and statistics. Experimental data were graphed using Prism 9 (GraphPad Software), and statistical analysis was performed using R statistical software (R Foundation for Statistical Computing, Vienna, Austria). Comparisons between two groups was determined using a Mann-Whitney U-test and if there were mas more than one comparison being made, a Benjamini-Hochberg false discovery rate (FDR) correction was applied. Comparisons between more than 2 groups were first performed using a Kruskal-Wallis test, and if the resulting p value was < 0.05, a Mann-Whitney U test was performed to compare pairs of groups. The Benjamini- Hochberg procedure was then applied within each figure panel to control for the FDR for multiple comparisons. All tests were two-sided, with an alpha level of 0.05. All experiments were performed at least twice as separate, independent replicates. Values not detected in an assay are indicated as not detected (ND) and were assigned arbitrary values below the limit of detection for inclusion in graph and statistical analysis. Schematics in figures were created using BioRender.
[0209] References:
[0210] 1. Burrough ER, Magstadt DR, Petersen B, Timmermans SJ, Gauger PC, Zhang J, Siepker C, Mainenti M, Li G, Thompson AC, Gorden PJ, Plummer PJ, Main R. 2024. Highly Pathogenic Avian Influenza A(H5N1) Clade 2.3.4.4b Virus Infection in Domestic Dairy Cattle and Cats, United States, 2024. Emerg Infect Dis 30:1335-1343.
[0211] 2. Meade PS, Bandawane P, Bushfield K, Hoxie I, Azcona KR, Burgos D, Choudhury S, Diaby A, Diallo M, Gaynor K, Huang A, Kante K, Khan SN, Kim W, Ajayi PK, Roubidoux E, Nelson S, McMahon R, Albrecht RA, Krammer F, Marizzi C. 2024. Detection of clade 2.3.4.4b highly pathogenic H5N1 influenza virus in New York City. J Virol 98:e0062624.
[0212] 3. Guan L, Eisfeld AJ, Pattinson D, Gu C, Biswas A, Maemura T, Trifkovic S, Babujee L, Presler R, Jr., Dahn R, Halfmann PJ, Barnhardt T, Neumann G, Thompson A, Swinford AK, Dimitrov KM, Poulsen K, Kawaoka Y. 2024. Cow's Milk Containing Avian Influenza A(H5N1) Virus - Heat Inactivation and Infectivity in Mice. N Engl J Med 391 :87-90. 4. Prevention CfDCa. 2024. Current H5N1 Bird Flu Situation in Dairy Cows. www.cdc.gov / bird-flu / situation-summary / mammals.html.
[0213] 5. Caserta LC, Frye EA, Butt SL, Laverack M, Nooruzzaman M, Covaleda LM, Thompson AC, Koscielny MP, Cronk B, Johnson A, Kleinhenz K, Edwards EE, Gomez G, Hitchener G, Martins M, Kapczynski DR, Suarez DL, Alexander Morris ER, Hensley T, Beeby JS, Lejeune M, Swinford AK, Elvinger F, Dimitrov KM, Diel DG. 2024. Spillover of highly pathogenic avian influenza H5N1 virus to dairy cattle. Nature 634:669-676.
[0214] 6. Prevention CfDCa. 2025. H5 Bird Flu: Current Situation. Prevention CfDCa, www.cdc.gov / bird-flu / situation-summary / index.html.
[0215] 7. Garg S, Reed C, Davis CT, Uyeki TM, Behravesh CB, Kniss K, Budd A, Biggerstaff M, Adjemian J, Barnes JR, Kirby MK, Basler C, Szablewski CM, Richmond-Crum M, Bums E, Limbago B, Daskalakis DC, Armstrong K, Boucher D, Shimabukuro TT, Jhung MA, Olsen SJ, Dugan V. 2024. Outbreak of Highly Pathogenic Avian Influenza A(H5N1) Viruses in U.S. Dairy Cattle and Detection of Two Human Cases - United States, 2024. MMWR Morb Mortal Wkly Rep 73:501-505.
[0216] 8. Uyeki TM, Milton S, Abdul Hamid C, Reinoso Webb C, Presley SM, Shetty V, Rollo SN, Martinez DL, Rai S, Gonzales ER, Kniss KL, Jang Y, Frederick JC, De La Cruz JA, Liddell J, Di H, Kirby MK, Barnes JR, Davis CT. 2024. Highly Pathogenic Avian Influenza A(H5N1) Virus Infection in a Dairy Farm Worker. N Engl J Med 390:2028- 2029.
[0217] 9. Prevention CfDCa. 2024. CDC Reports Fourth Human Case of H5 Bird Flu Tied to Dairy Cow Outbreak, www.cdc.gov / media / releases / 2024 / p-0703-4th-human-case-h5.html.
[0218] 10. Chaudhary N, Weissman D, Whitehead KA. 2021. mRNA vaccines for infectious diseases: principles, delivery and clinical translation. Nat Rev Drug Discov 20:817-838.
[0219] 11. Chen JR, Liu YM, Tseng YC, Ma C. 2020. Better influenza vaccines: an industry perspective. J Biomed Sci 27:33.
[0220] 12. Goel RR, Painter MM, Apostolidis SA, Mathew D, Meng W, Rosenfeld AM, Lundgreen KA, Reynaldi A, Khoury DS, Pattekar A, Gouma S, Kuri-Cervantes L, Hicks P, Dysinger S, Hicks A, Sharma H, Herring S, Korte S, Baxter AE, Oldridge DA, Giles JR, Weirick ME, McAllister CM, Awofolaju M, Tanenbaum N, Drapeau EM, Dougherty J, Long S, D'Andrea K, Hamilton JT, McLaughlin M, Williams JC, Adamski S, Kuthuru O, dagger UPCPU, Frank I, Betts MR, Vella LA, Grifoni A, Weiskopf D, Sette A, Hensley SE, Davenport MP, Bates P, Luning Prak ET, Greenplate AR, Wherry EJ. 2021. mRNA vaccines induce durable immune memory to SARS-CoV-2 and variants of concern. Science 374:abm0829.
[0221] 13. Zhang G, Tang T, Chen Y, Huang X, Liang T. 2023. mRNA vaccines in disease prevention and treatment. Signal Transduct Target Ther 8:365.
[0222] 14. Baden LR, El Sahly HM, Essink B, Kotloff K, Frey S, Novak R, Diemert D, Spector SA, Rouphael N, Creech CB, McGettigan J, Khetan S, Segall N, Solis J, Brosz A, Fierro C, Schwartz H, Neuzil K, Corey L, Gilbert P, Janes H, Follmann D, Marovich M, Mascola J, Polakowski L, Ledgerwood J, Graham BS, Bennett H, Pajon R, Knightly C, Leav B, Deng W, Zhou H, Han S, Ivarsson M, Miller J, Zaks T, Group CS. 2021. Efficacy and Safety of the mRNA-1273 SARS-CoV-2 Vaccine. N Engl J Med 384:403-416.
[0223] 15. Ohmit SE, Petrie JG, Cross RT, Johnson E, Monto AS. 2011. Influenza hemagglutinationinhibition antibody titer as a correlate of vaccine-induced protection. J Infect Dis 204: 1879-85.
[0224] 16. Jacobsen H, Rajendran M, Choi A, Sjursen H, Brokstad KA, Cox RJ, Palese P, Krammer F, Nachbagauer R. 2017. Influenza Virus Hemagglutinin Stalk-Specific Antibodies in Human Serum are a Surrogate Marker for In Vivo Protection in a Serum Transfer Mouse Challenge Model. mBio 8.
[0225] 17. Nachbagauer R, Liu WC, Choi A, Wohlbold TJ, Atlas T, Rajendran M, Solorzano A, Berlanda-Scorza F, Garcia-Sastre A, Palese P, Albrecht RA, Krammer F. 2017. A universal influenza virus vaccine candidate confers protection against pandemic H1N1 infection in preclinical ferret studies. NPJ Vaccines 2:26.
[0226] 18. Monto AS, Petrie JG, Cross RT, Johnson E, Liu M, Zhong W, Levine M, Katz JM, Ohmit SE. 2015. Antibody to Influenza Virus Neuraminidase: An Independent Correlate of Protection. J Infect Dis 212: 1191-9.
[0227] 19. Memoli MJ, Shaw PA, Han A, Czajkowski L, Reed S, Athota R, Bristol T, Fargis S, Risos K, Powers JH, Davey RT, Jr., Taubenberger JK. 2016. Evaluation of Antihemagglutinin and Antineuraminidase Antibodies as Correlates of Protection in an Influenza A / H1N1 Virus Healthy Human Challenge Model. mBio 7:e00417-16. 20. Job ER, Schotsaert M, Ibanez LI, Smet A, Ysenbaert T, Roose K, Dai M, de Haan CAM, Kleanthous H, Vogel TU, Saelens X. 2018. Antibodies Directed toward Neuraminidase N1 Control Disease in a Mouse Model of Influenza. J Virol 92.
[0228] 21. Mostafa A, Naguib MM, Nogales A, Barre RS, Stewart JP, Garcia-Sastre A, Martinez- Sobrido L. 2024. Avian influenza A (H5N1) virus in dairy cattle: origin, evolution, and cross-species transmission. mBio 15:e0254224.
[0229] 22. Leonard RA, Burke KN, Spreng RL, Macintyre AN, Tam Y, Alameh MG, Weissman D, Heaton NS. 2024. Improved influenza vaccine responses after expression of multiple viral glycoproteins from a single mRNA. Nat Commun 15:8712.
[0230] 23. Harding AT, Heaton BE, Dumm RE, Heaton NS. 2017. Rationally Designed Influenza Virus Vaccines That Are Antigenically Stable during Growth in Eggs. Mbio 8.
[0231] 24. Davidson AH, Traub-Dargatz JL, Rodeheaver RM, Ostlund EN, Pedersen DD, Moorhead RG, Stricklin JB, Dewell RD, Roach SD, Long RE, Albers SJ, Callan RJ, Salman MD. 2005. Immunologic responses to West Nile virus in vaccinated and clinically affected horses. J Am Vet Med Assoc 226:240-5.
[0232] 25. Garver KA, LaPatra SE, Kurath G. 2005. Efficacy of an infectious hematopoietic necrosis (IHN) virus DNA vaccine in Chinook Oncorhynchus tshawytscha and sockeye O. nerka salmon. Dis Aquat Organ 64:13-22.
[0233] 26. Bergman PJ, Camps-Palau MA, McKnight JA, Leibman NF, Craft DM, Leung C, Liao J, Riviere I, Sadelain M, Hohenhaus AE, Gregor P, Houghton AN, Perales MA, Wolchok JD. 2006. Development of a xenogeneic DNA vaccine program for canine malignant melanoma at the Animal Medical Center. Vaccine 24:4582-5.
[0234] 27. Chan MC, Cheung CY, Chui WH, Tsao SW, Nicholls JM, Chan YO, Chan RW, Long HT, Poon LL, Guan Y, Peiris JS. 2005. Proinflammatory cytokine responses induced by influenza A (H5N1) viruses in primary human alveolar and bronchial epithelial cells. Respir Res 6:135.
[0235] 28. Cheung CY, Poon LL, Lau AS, Luk W, Lau YL, Shortridge KF, Gordon S, Guan Y, Peiris JS. 2002. Induction of proinflammatory cytokines in human macrophages by influenza A (H5N1) viruses: a mechanism for the unusual severity of human disease? Lancet 360: 1831-7. 29. Lean FZX, Vitores AG, Reid SM, Banyard AC, Brown TH, Nunez A, Hansen RDE. 2022. Gross pathology of high pathogenicity avian influenza virus H5N1 2021-2022 epizootic in naturally infected birds in the United Kingdom. One Health 14: 100392.
[0236] 30. Eisfeld AJ, Biswas A, Guan L, Gu C, Maemura T, Trifkovic S, Wang T, Babujee L, Dahn R, Halfmann PJ, Barnhardt T, Neumann G, Suzuki Y, Thompson A, Swinford AK, Dimitrov KM, Poulsen K, Kawaoka Y. 2024. Pathogenicity and transmissibility of bovine H5N1 influenza virus. Nature 633:426-432.
[0237] 31. Pulit-Penaloza JA, Brock N, Belser JA, Sun X, Pappas C, Kieran TJ, Basu Thakur P, Zeng H, Cui D, Frederick J, Fasce R, Tumpey TM, Maines TR. 2024. Highly pathogenic avian influenza A(H5N1) virus of clade 2.3.4.4b isolated from a human case in Chile causes fatal disease and transmits between co-housed ferrets. Emerg Microbes Infect 13:2332667.
[0238] 32. Belser JA, Sun X, Pulit-Penaloza JA, Maines TR. 2024. Fatal Infection in Ferrets after Ocular Inoculation with Highly Pathogenic Avian Influenza A(H5N1) Virus. Emerg Infect Dis 30: 1484-1487.
[0239] 33. Redding L, Weiner DB. 2009. DNA vaccines in veterinary use. Expert Rev Vaccines 8: 1251-76.
[0240] 34. Dhama K, Mahendran M, Gupta PK, Rai A. 2008. DNA vaccines and their applications in veterinary practice: current perspectives. Vet Res Commun 32:341-56.
[0241] 35. Lee CW, Senne DA, Suarez DL. 2004. Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine 22:3175-81.
[0242] 36. Francis MJ. 2018. Recent Advances in Vaccine Technologies. Vet Clin North Am Small Anim Pract 48:231 -241.
[0243] 37. Valentin J, Ingrao F, Rauw F, Lambrecht B. 2024. Protection conferred by an H5 DNA vaccine against highly pathogenic avian influenza in chickens: The effect of vaccination schedules. Vaccine 42: 1487-1497.
[0244] 38. Babuadze GG, Fausther-Bovendo H, deLaVega MA, Lillie B, Naghibosadat M, Shahhosseini N, Joyce MA, Saffran HA, Lome Tyrrell D, Falzarano D, Senthilkumaran C, Christie-Holmes N, Ahn S, Gray-Owen SD, Banerjee A, Mubareka S, Mossman K, Dupont C, Pedersen J, Lafrance MA, Kobinger GP, Kozak R. 2022. Two DNA vaccines protect against severe disease and pathology due to SARS-CoV-2 in Syrian hamsters. NPJ Vaccines 7:49.
[0245] 39. Painter MM, Mathew D, Goel RR, Apostolidis SA, Pattekar A, Kuthuru 0, Baxter AE, Herati RS, Oldridge DA, Gouma S, Hicks P, Dysinger S, Lundgreen KA, Kuri-Cervantes L, Adamski S, Hicks A, Korte S, Giles JR, Weirick ME, McAllister CM, Dougherty J, Long S, D'Andrea K, Hamilton JT, Betts MR, Bates P, Hensley SE, Grifoni A, Weiskopf D, Sette A, Greenplate AR, Wherry EJ. 2021. Rapid induction of antigen-specific CD4(+) T cells is associated with coordinated humoral and cellular immunity to SARS-CoV-2 mRNA vaccination. Immunity 54:2133-2142 e3.
[0246] 40. Polack FP, Thomas SJ, Kitchin N, Absalon J, Gurtman A, Lockhart S, Perez JL, Perez Marc G, Moreira ED, Zerbini C, Bailey R, Swanson KA, Roychoudhury S, Koury K, Li P, Kalina WV, Cooper D, Frenck RW, Jr., Hammitt LL, Tureci O, Nell H, Schaefer A, Unal S, Tresnan DB, Mather S, Dormitzer PR, Sahin U, Jansen KU, Gruber WC, Group CCT. 2020. Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine. N Engl J Med 383:2603-2615.
[0247] 41. Ananworanich J, Lee IT, Ensz D, Carmona L, Schaefers K, Avanesov A, Stadlbauer D, Choi A, Pucci A, McGrath S, Kuo HH, Henry C, Chen R, Huang W, Nachbagauer R, Paris R. 2025. Safety and Immunogenicity of mRNA-1010, an Investigational Seasonal Influenza Vaccine, in Healthy Adults: Final Results From a Phase 1 / 2 Randomized Trial. J Infect Dis 231 :ell3-el22.
[0248] 42. Pfizer I. 2024. A Study to Evaluate the Safety, Tolerability, and Immunogenicity of a Combined Modified RNA Vaccine Candidate Against COVID-19 and Influenz. clinicaltrials.gov / study / NCT06178991.
[0249] 43. Pfizer I. 2025. A Study About Modified RNA Vaccines Against Influenza in Healthy Adults. clinicaltrials.gov / study / NCT06436703.
[0250] 44. Furey C, Scher G, Ye N, Kercher L, DeBeauchamp J, Crumpton JC, Jeevan T, Patton C, Franks J, Rubrum A, Alameh MG, Fan SHY, Phan AT, Hunter CA, Webby RJ, Weissman D, Hensley SE. 2024. Development of a nucleoside-modified mRNA vaccine against clade 2.3.4.4b H5 highly pathogenic avian influenza virus. Nat Commun 15:4350.
[0251] 45. Hatta M, Hatta Y, Choi A, Hossain J, Feng C, Keller MW, Ritter JM, Huang Y, Fang E, Pusch EA, Rowe T, De La Cruz JA, Johnson MC, Liddell J, Jiang N, Stadlbauer D, Liu L, Bhattachaijee AK, Rouse JR, Currier M, Wang L, Levine MZ, Kirby MK, Steel J, Di H, Barnes JR, Henry C, Davis CT, Nachbagauer R, Wentworth DE, Zhou B. 2024. An influenza mRNA vaccine protects ferrets from lethal infection with highly pathogenic avian influenza A(H5N1) virus. Sci Transl Med 16:eadsl273.
[0252] 46. Chang C, Music N, Cheung M, Rossignol E, Bedi S, Patel H, Safari M, Lee C, Otten GR, Settembre EC, Palladino G, Wen Y. 2022. Self-amplifying mRNA bicistronic influenza vaccines raise cross-reactive immune responses in mice and prevent infection in ferrets. Mol Ther Methods Clin Dev 27:195-205.
[0253] 47. Modema I. 2024. A Study of mRNA-1018 Pandemic Influenza Candidate Vaccines in Healthy Adults. clinicaltrials.gov / study / NCT05972174?rank=l.
[0254] 48. Chiba S, Kiso M, Yamada S, Someya K, Onodera Y, Yamaguchi A, Matsunaga S, Jounai N, Yamayoshi S, Takeshita F, Kawaoka Y. 2024. Protective effects of an mRNA vaccine candidate encoding H5HA clade 2.3.4.4b against the newly emerged dairy cattle H5N1 virus. EBioMedicine 109: 105408.
[0255] 49. Wang Z, Tian C, Zhu J, Wang S, Ao X, He Y, Chen H, Liao X, Kong D, Zhou Y, Tai W, Liao M, Fan H. 2025. Avian influenza mRNA vaccine encoding hemagglutinin provides complete protection against divergent H5N1 viruses in specific-pathogen-free chickens. J Nanobiotechnology 23:55.
[0256] 50. Kawai A, Shimizu T, Tanaka H, Shichinohe S, Anindita J, Hirose M, Kawahara E, Senpuku K, Shimooka M, Quynh Mai LT, Suzuki R, Nogimori T, Yamamoto T, Hirai T, Kato T, Watanabe T, Akita H, Yoshioka Y. 2025. Low-inflammatory lipid nanoparticlebased mRNA vaccine elicits protective immunity against H5N1 influenza virus with reduced adverse reactions. Mol Ther 33:529-547.
[0257] 51. Tian Y, Deng Z, Chuai Z, Li C, Chang L, Sun F, Cao R, Yu H, Xiao R, Lu S, Xu Y, Yang P. 2024. A combination influenza mRNA vaccine candidate provided broad protection against diverse influenza virus challenge. Virology 596:110125.
[0258] 52. Nguyen TQ, Rollon R, Choi YK. 2021. Animal Models for Influenza Research: Strengths and Weaknesses. Viruses 13.
[0259] 53. Belser JA, Katz JM, Tumpey TM. 2011. The ferret as a model organism to study influenza A virus infection. Dis Model Meeh 4:575-9. 54. van Riel D, Munster VJ, de Wit E, Rimmelzwaan GF, Fouchier RA, Osterhaus AD, Kuiken T. 2007. Human and avian influenza viruses target different cells in the lower respiratory tract of humans and other mammals. Am J Pathol 171 : 1215-23.
[0260] 55. Le Sage V, Werner BD, Merrbach GA, Petnuch SE, O'Connell AK, Simmons HC, McCarthy KR, Reed DS, Moncla LH, Bhavsar D, Krammer F, Crossland NA, McElroy AK, Duprex WP, Lakdawala SS. 2024. Pre-existing H1N1 immunity reduces severe disease with bovine H5N1 influenza virus. bioRxiv doi: 10.1101 / 2024.10.23.619881.
[0261] 56. Moritzky SA, Richards KA, Glover MA, Krammer F, Chaves FA, Topham DJ, Branche A, Nayak JL, Sant AJ. 2023. The Negative Effect of Preexisting Immunity on Influenza Vaccine Responses Transcends the Impact of Vaccine Formulation Type and Vaccination History. J Infect Dis 227:381-390.
[0262] 57. Putri DS, Shepherd FK, Sanders AE, Roach SN, Jay S, Pierson MJ, Wieking G, Anderson JL, Meyerholz DK, Schacker TW, Langlois RA. 2025. Naturally transmitted mouse viruses highlight the heterogeneity of virus transmission dynamics in the dirty mouse model. J Virol doi:10.1128 / jvi.00187-25:e0018725.
[0263] 58. Reese TA, Bi K, Kambal A, Filali-Mouhim A, Beura LK, Burger MC, Pulendran B, Sekaly RP, Jameson SC, Masopust D, Haining WN, Virgin HW. 2016. Sequential Infection with Common Pathogens Promotes Human-like Immune Gene Expression and Altered Vaccine Response. Cell Host Microbe 19:713-9.
[0264] 59. Suthar MS, Arunachalam PS, Hu M, Reis N, Trisal M, Raeber O, Chinthrajah S, Davis- Gardner ME, Manning K, Mudvari P, Boritz E, Godbole S, Henry AR, Douek DC, Halfmann P, Kawaoka Y, Boyd SD, Davis MM, Zarnitsyna VI, Nadeau K, Pulendran B. 2022. Durability of immune responses to the BNT162b2 mRNA vaccine. Med 3:25-27.
[0265] 60. Pegu A, O'Connell SE, Schmidt SD, O'Dell S, Talana CA, Lai L, Albert J, Anderson E, Bennett H, Corbett KS, Flach B, Jackson L, Leav B, Ledgerwood JE, Luke CJ, Makowski M, Nason MC, Roberts PC, Roederer M, Rebolledo PA, Rostad CA, Rouphael NG, Shi W, Wang L, Widge AT, Yang ES, m RNASGss, Beigel JH, Graham BS, Mascola JR, Suthar MS, McDermott AB, Doria-Rose NA, Arega J, Beigel JH, Buchanan W, Elsafy M, Hoang B, Lampley R, Kolhekar A, Koo H, Luke C, Makhene M, Nayak S, Pikaart-Tautges R, Roberts PC, Russell J, Sindall E, Albert J, Kunwar P, et al. 2021. Durability of mRNA-1273 vaccine-induced antibodies against SARS-CoV-2 variants. Science 373:1372-1377.
[0266] 61. Trimarco JD, Spurrier MA, Skavicus S, Luo Z, Dutta M, Janowska K, Acharya P, Heaton BE, Heaton NS. 2024. Fluorescent and bioluminescent bovine H5N1 influenza viruses for evaluation of antiviral interventions. J Virol doi: 10.1128 / jvi.01385-24:e0138524.
[0267] Example 3:
[0268] In the following example, the inventors describe novel influenza vaccines that comprise one construct that encodes a full-length hemagglutinin (HA) protein and another construct that encodes both a neuraminidase (NA) protein and a headless hemagglutinin (hlHA) protein in a single open reading frame. Within this second construct, which is referred to herein as “NA- F2A-hlHA”, the encoded antigens are separated by a furin cleavage site and a 2A ribosomeskipping sequence. A schematic depiction of this vaccine strategy is provided in FIG. 18. This strategy is designed to increase the breadth of protection afforded by the vaccine by increasing the immune response generated against the HA stalk domain, which is more highly conserved than the HA head domain.
[0269] Three versions of the NA-F2A-hlHA construct were tested: one encoding antigens from the H5N1 strain A / Texas / 37 / 2024, one encoding antigens from the H7N9 strain A / Shanghai / 02 / 2013, and one encoding antigens from the H5N1 strain A / Louisiana / 12 / 2024. These constructs were made into DNA plasmids and were transfected into mammalian cells, and cell-based ELISAs were performed to confirm that NA and HA stalk were properly expressed from the plasmids (FIG. 19). Additionally, mice were vaccinated with the DNA plasmids and the antibody responses to NA and HA were measured in post-vaccination sera. These results demonstrates that the NA-F2A-hlHA constructs elicits robust immune responses in both the presence and absence of the full-length HA construct (FIG. 20).
Claims
1. CLAIMSWhat is claimed:
1. A composition comprising an NA-F2A-HA polynucleotide that encodes from 5’ to 3’ : a neuraminidase (NA) polypeptide, a furin cleavage site, a self-cleaving 2A polypeptide, and a hemagglutinin (HA) polypeptide.
2. The composition of claim 1, wherein the NA polypeptide comprises any one of SEQ ID NOs: 11-20 or a sequence having at least 95% identity to any one of SEQ ID Nos: 11-20.
3. The composition of claim 1 or 2, wherein the HA polypeptide is: a) a full-length HA polypeptide selected from SEQ ID NOs: 21-30; b) a headless HA polypeptide selected from SEQ ID NOs: 3 -38; or c) a polypeptide having at least 95% identity to any one of SEQ ID NOs: 21-30 and 35-38.
4. The composition of any one of the preceding claims, wherein the furin cleavage site comprises SEQ ID NO: 39.
5. The composition of any one of the preceding claims, wherein the self-cleaving 2A polypeptide comprises a porcine teschovirus 2A (PTV-2A) motif.
6. The composition of claim 5, wherein the PTV-2A motif comprises SEQ ID NO: 40.
7. The composition of any one of the preceding claims, wherein the NA-F2A-HA polynucleotide encodes a polypeptide construct selected from SEQ ID NOs: 1-10 and 31-34 and sequences having at least 95% identity to one of SEQ ID Nos: 1-10 and 31-34.
8. The composition of any one of the preceding claims, wherein the composition comprises two or more NA-F2A-HA polynucleotides, and wherein the NA polypeptide and the HA polypeptide in each of the two or more NA-F2A-HA polynucleotides are different.
9. The composition of claim 8, wherein the composition comprises four different NA-F2A-HA polynucleotides.
10. The composition of any one of claims 1-7 further comprising an HA polynucleotide that encodes an additional HA polypeptide.
11. The composition of claim 9, wherein the HA polypeptide encoded by the NA-F2A-HA polynucleotide is a headless HA polypeptide and the additional HA polypeptide encoded by the HA polynucleotide is a full-length HA polypeptide.
12. The composition of claim 11, wherein the full-length HA polypeptide is selected from SEQ ID NOs: 21-30 or a polypeptide having at least 95% identity to any one of SEQ ID NO: 21- 30.
13. The composition of any one of claims 1-12, wherein the NA-F2A-HA polynucleotide is mRNA.
14. The composition of any one of claims 1-12, wherein the NA-F2A-HA polynucleotide is DNA.
15. The composition of claim 14, wherein the NA-F2A-HA polynucleotide further comprises a promoter.
16. The composition of any one of the preceding claims further comprising a carrier.
17. The composition of claim 16, wherein the carrier is a lipid nanoparticle.
18. A method for inducing an immune response to influenza in a subject, the method comprising administering the composition of any one of the preceding claims to the subject.
19. The method of claim 18, wherein the subject is a poultry, cow, pig, or human.
20. The method of claim 18 or 19, wherein the influenza is influenza A or influenza B.
21. The method of any one of claims 18-20, wherein the immune response reduces morbidity associated with a subsequent infection with influenza in the subject.