Method of treatment of retinitis pigmentosa
Administering pyrvinium compositions to reduce nuclear speckle sphericity addresses the limited efficacy of current treatments for proteinopathies by rejuvenating nuclear speckles and treating retinitis pigmentosa effectively.
Patent Information
- Application Number
- PCT/IB2025/057969
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-08-07
- Filing Date
- 2025-08-05
- Publication Date
- 2026-02-12
AI Technical Summary
Current treatments targeting individual protein quality control pathways have limited efficacy in alleviating proteinopathies such as Alzheimer’s Disease, frontotemporal dementia, Parkinson’s Disease, and retinitis pigmentosa, highlighting the need for a common upstream druggable target capable of global proteostasis modulation.
Administering a composition including pyrvinium or a pharmaceutically-acceptable salt or derivative thereof to reduce nuclear speckle sphericity, thereby increasing the expression of SON and/or SRRM2, which rejuvenates nuclear speckles and treats conditions like retinitis pigmentosa.
The method effectively treats retinitis pigmentosa by reducing nuclear speckle sphericity and improving nuclear speckle function, leading to therapeutic benefits for patients with mutations in the RHO gene.
Smart Images

Figure IB2025057969_12022026_PF_FP_ABST
Abstract
Description
Attorney Docket No. 06527-2501864METHOD OF TREATMENT OF RETINITIS PIGMENTOSACROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 680,223, filed August 7, 2024, the disclosure of which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under GM140924 and AG071893 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO A SEQUENCING LISTING
[0003] The Sequence Listing associated with this application is filed in electronic format via Patent Center and is hereby incorporated by reference into the specification in its entirety. The name of the file containing the Sequence Listing is 25O1864.xml. The size of the file is 48,018 bytes, and the file was created on July 22, 2025.BACKGROUND OF THE INVENTIONField of the Invention
[0004] Provided herein are methods of treating conditions, and compositions for the same. In non-limiting embodiments, the condition is retinitis pigmentosa and the composition is pyrvinium or a salt or derivative thereof.Description of Related Art
[0005] Proteinopathies are diseases associated with the accumulation of misfolded proteins, which often arise from a decline in proteostasis pathways, including the ubiquitin-proteasome system (UPS), the ER-Golgi protein secretory pathways, and autophagy lysosomal pathway (ALP). However, therapies targeting singular pathways have limited efficacy, indicating an incomplete understanding of disease mechanisms.
[0006] Current treatments targeting individual protein quality control have limited efficacy in alleviating proteinopathies, highlighting the prerequisite for a common upstream druggable target capable of global proteostasis modulation. Accordingly, there is a need in the art for additional treatments for proteinopathies, including those associated with Alzheimer’s Disease (AD), frontotemporal dementia (FTD), Parkinson’s Disease (PD), and retinitis pigmentosa (RP).16693890. DOCXAttorney Docket No. 06527-2501864SUMMARY OF THE INVENTION
[0007] Provided herein is a method of treating a condition associated with nuclear speckle sphericity in a patient, including administering to the patient an amount of a composition including a nuclear speckle rejuvenator effective to reduce nuclear speckle sphericity in the patient.
[0008] Also provided herein is a method of treating retinitis pigmentosa in a patient, including administering to the patient a composition including pyrvinium or a pharmaceutically-acceptable salt or derivative thereof in an amount effective to treat retinitis pigmentosa in the patient.
[0009] Also provided herein is an ophthalmic or intravitreal preparation including pyrvinium or a pharmaceutically-acceptable salt or derivative thereof and a pharmaceutically-acceptable excipient.
[0010] Additional non-limiting embodiments are set forth in the following numbered clauses.
[0011] 1. A method of treating a condition associated with nuclear speckle sphericity in a patient, comprising administering to the patient an amount of a composition comprising a nuclear speckle rejuvenator effective to reduce nuclear speckle sphericity in the patient.
[0012] 2. The method of clause 1 , wherein the nuclear speckle rejuvenator is pyrvinium or a pharmaceutically acceptable salt or derivative thereof.
[0013] 3. The method of clause 1 or clause 2, wherein the nuclear speckle rejuvenator is pyrvinium pamoate.
[0014] 4. The method of any of clauses 1 -3, wherein the nuclear speckle rejuvenator increases expression of SON and / or serine / arginine repetitive matrix 2 (SRRM2) in the patient.
[0015] 5. The method of any of clauses 1 -4, wherein the nuclear speckle rejuvenator increases organization of nuclear speckles in the patient.
[0016] 6. The method of any of clauses 1 -5, wherein the condition is a proteinopathy.
[0017] 7. The method of any of clauses 1 -6, wherein the patient has Alzheimer’s Disease (AD), Parkinson’s Disease (PD), frontotemporal dementia (FTD), and / or retinitis pigmentosa (RP).
[0018] 8. The method of any of clauses 1 -7, wherein the patient has RP.26693890. DOCXAttorney Docket No. 06527-2501864
[0019] 9. The method of any of clauses 1 -8, wherein the patient has a mutation in in the RHO gene.
[0020] 10. The method of any of clauses 1 -9, wherein the mutation comprises aP23H substitution.
[0021] 1 1. The method of any of clauses 1 -10, wherein the nuclear speckle rejuvenator is administered by instillation.
[0022] 12. The method of any of clauses 1 -11 , wherein the composition comprises an ophthalmic preparation comprising pyrvinium or a pharmaceutically acceptable salt or derivative thereof.
[0023] 13. The method of any of clauses 1 -12, wherein the ophthalmic preparation comprises the pyrvinium or pharmaceutically-acceptable salt or derivative thereof at a concentration ranging from 10nM to 10pM.
[0024] 14. The method of any of clauses 1 -13, wherein the ophthalmic preparation comprises the pyrvinium or pharmaceutically-acceptable salt or derivative thereof at a concentration ranging from 0.2-0.5 pM.
[0025] 15. The method of any of clauses 1 -14, wherein the composition is administered to the patient intravitreally.
[0026] 16. A method of treating retinitis pigmentosa in a patient, comprising administering to the patient a composition comprising pyrvinium or a pharmaceutically- acceptable salt or derivative thereof in an amount effective to treat retinitis pigmentosa in the patient.
[0027] 17. The method of clause 16, wherein the patient has a mutation in in theRHO gene.
[0028] 18. The method of clause 16 or clause 17, wherein the mutation comprises a P23H substitution.
[0029] 19. The method of any of clauses 16-18, wherein the composition comprises pyrvinium pamoate.
[0030] 20. The method of any of clauses 16-19, wherein the composition comprises an ophthalmic preparation.
[0031] 21. The method of any of clauses 16-20, wherein the composition is administered to the patient intravitreally.
[0032] 22. An ophthalmic or intravitreal preparation comprising pyrvinium or a pharmaceutically-acceptable salt or derivative thereof and a pharmaceutically- acceptable excipient.36693890. DOCXAttorney Docket No. 06527-2501864
[0033] 23. The ophthalmic preparation of clause 22, wherein the pyrvinium or pharmaceutically-acceptable salt or derivative thereof is included at a concentration ranging from 10nM to 10pM.
[0034] 24. The ophthalmic preparation of clause 22 or clause 23 23, wherein the pyrvinium or pharmaceutically-acceptable salt or derivative thereof is included at a concentration ranging from 0.2-0.5 pM.BRIEF DESCRIPTION OF THE DRAWINGS
[0035] FIG. 1 shows dose-dependent effect on nuclear speckles morphology by PP, with a representative image of nuclear speckle under 1 pM of PP (n=10~ 16).
[0036] FIG. 2 shows quantification of total area-normalized perimeter of nuclear speckles in control and 1 pM PP condition per cell (n=26 for DMSO and n=35 for PP).
[0037] FIG. 3 shows a volcano plot showing fold change by PP versus log transformed p values. Genes induced or repressed by at least 1 .41 -fold with a p value smaller than 0.05 are boxed.
[0038] FIG. 4 shows GO analysis of differentially expressed genes by PP.
[0039] FIG. 5 shows representative images and quantification of sphericity of GFP signal from GFP::SRSF2 MEFs with scrambled or Son siRNA treated with DMSO or increasing concentration of PP for 24 hours.
[0040] FIG. 6 shows Iog2 normalized fold change in response to PP treatment (0.3 pm) for 24 hours in control and SON KD MEFs with p values shown for one tailed t- test (n=3). All data mean ± S.E.M.
[0041] FIG. 7 shows CETSA of SON with 3pM PP. Representative blot and quantification from independent replicates are shown. P value is calculated by mixed- effects analysis (SON: n=6 for DMSO and n=5 for PP; GFP::SRSF2: n=3 for both DMSO and PP).
[0042] FIG. 8 shows quantification of sphericity (n=12 for with NE and n=42 for without NE) during droplet formation (n=2) with NE-supplemented SON IDR2 with increasing concentration of PP in the time span of 20 minutes.
[0043] FIG. 9 shows area-normalized perimeter changes during droplet formation (n=2) with NE-supplemented SON IDR2 with increasing concentration of PP in the time span of 20 minutes.46693890. DOCXAttorney Docket No. 06527-2501864
[0044] FIG. 10 shows quantification of sphericity of droplet formation assay where SON IDR2 is expected to compartmentalize splicing factors, including GFP::SRSF2 into the nuclear speckle-like condensates.
[0045] FIGS. 11 and 12 show Western blot and quantification of LC3II and LC3II / LC3I ratio. MEFs were treated with vehicle control or 1 pM PP for ~24 hours (22 hours) and then co-treated with or without puromycin (10 pg / mL for 30 minutes), MG1 32 (1 OpM for 1 10 minutes) or Baf A (1 OOnM for 22 hours) (n=3 for all samples).
[0046] FIGS. 13-14 show NIH3T3 RHOP23H cells were treated with 0.1 pM PP for 24 hours and Western blot (G) and quantification (H) of RHOP23H level (n=3).
[0047] FIG. 15 shows morphology of retinae imaged and scanned before (Day 0) and after treatment (Day 10) by a webcam (top) and visible light optical coherence tomography (vis-OCT) with tissue thickness shown as a heatmap with a color legend indicating thickness from 0-300 pm (bottom).
[0048] FIGS. 16-17 shows bar plots of retinal thickness and volume measured from the vis-PCT scanning data, where **** indicates P<0.0001 by two-way ANOVA and Turkey multiple 1495 comparison. Data: Means ±SDs. N=4-5.
[0049] FIG. 18 shows representative retinal histology images of the retina explants cultured for 10 days with black bars showing the outer nuclear layer (ONL). Scale, 20 pm.
[0050] FIG. 19 shows the nuclei count in the outer nuclei layer (ONL) along six horizontal positions at peripheral-central-peripheral positions across each crosssection in FIG. 18.
[0051] FIGS. 20A-20B show non-limiting embodiments of useful compositions as described herein.DESCRIPTION OF THE INVENTION
[0052] The use of numerical values in the various ranges specified in this application, unless expressly indicated otherwise, are stated as approximations as though the minimum and maximum values within the stated ranges are both preceded by the word "about". In this manner, slight variations above and below the stated ranges can be used to achieve substantially the same results as values within the ranges. Also, unless indicated otherwise, the disclosure of these ranges is intended as a continuous range including every value between the minimum and maximum values. For definitions provided herein, those definitions refer to word forms, cognates56693890. DOCXAttorney Docket No. 06527-2501864 and grammatical variants of those words or phrases. As used herein "a" and "an" refer to one or more.
[0053] As used herein, the term "comprising" is open-ended and may be synonymous with "including", "containing", or "characterized by". As used herein, embodiments "comprising" one or more stated elements or steps also include but are not limited to embodiments "consisting essentially of" and "consisting of" these stated elements or steps.
[0054] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It is to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Unless otherwise indicated, polymer molecular weight is expressed as number-average molecular weight (Mn). Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below.
[0055] The term “contacting” refers to placement in direct physical association; includes both in solid and liquid form. “Contacting” is often used interchangeably with “exposed.” In some cases, “contacting” includes transfecting, such as transfecting a nucleic acid molecule into a cell. In other examples, “contacting” refers to incubating a molecule (such as an antibody) with a biological sample.
[0056] The term "therapeutically effective amount" as used herein means a dosage which is sufficient to be effective for the treatment of the patient compared with no treatment. As used herein, the term "patient" or "subject" refers to members of the animal kingdom including but not limited to human beings, and "mammal" refers to all mammals, including, but not limited to human beings.
[0057] As is known in the art, a therapeutically effective dose of an active agent can vary from patient to patient based on many different factors, including, but not limited to, age, weight, gender, genotype, other medical conditions, etc. A doctor or medical provider overseeing the treatment of a patient is best suited to determine the therapeutically effective dose based on their knowledge and experience working with that patient. A therapeutically-effective amount may be an amount of a therapeutic agent effective to improve one or more symptoms of the disease, or normalize one or66693890. DOCXAttorney Docket No. 06527-2501864 more markers of a disease in a patient. By normalize, it is meant to bring values of a marker in a patient towards or into a range considered as normal for a patient
[0058] A "therapeutically effective amount" may refer to an amount of a drug product or active agent effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. An “amount effective” for treatment of a condition is an amount of an active agent or dosage form, such as a single dose or multiple doses, effective to achieve a determinable end-point. The “amount effective” is preferably safe - at least to the extent the benefits of treatment outweighs the detriments, and / or the detriments are acceptable to one of ordinary skill and / or to an appropriate regulatory agency, such as the U.S. Food and Drug Administration. A therapeutically effective amount of an active agent may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the active agent to elicit a desired response in the individual. A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount may be less than the therapeutically effective amount.
[0059] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time, or the composition may be administered continuously or in a pulsed fashion with doses or partial doses being administered at regular intervals, for example, every 10, 15, 20, 30, 45, 60, 90, or 120 minutes, every 2 through 12 hours daily, or every other day, etc., be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. In some instances, it may be especially advantageous to formulate compositions, such as parenteral or inhaled compositions, in dosage unit form for ease of administration and uniformity of dosage. The specification for the dosage unit forms are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the art of compounding such an active compound for the treatment of sensitivity in individuals.
[0060] An “effective amount” or “amount effective” to achieve a desirable therapeutic, pharmacological, medicinal, or physiological effect is any amount that achieves the stated purpose, for example, an amount of a composition described76693890. DOCXAttorney Docket No. 06527-2501864 herein effective to treat a condition. Based on the teachings provided herein, one of ordinary skill can readily ascertain effective amounts of the elements of the described dosage form and produce a safe and effective dosage form and drug product. Examples of an effective amount of an active agent compounded in a delivery vehicle includes from 100 pg / kg of body weight to 1000 mg / kg of body weight, all values and subranges therebetween inclusive. In non-limiting embodiments, compositions disclosed herein, an amount effective may include 0.1 -100, 0.1 -10, 0.2-9, 0.3-8, 0.4- 7, 0.5-6, 0.6-5, 0.7-4, 0.7-3, and / or 0.7-2.5 mg / kg, all values and subranges therebetween inclusive. In non-limiting embodiments, such a dosage is administered 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, and or / more times per week. In non-limiting embodiments, an amount effective of a composition may be 1 -100, 1 -50, 2-40, 2-30, and / or 2-25 mg per dose, all values and subranges therebetween inclusive. In nonlimiting embodiments, such a dosage is administered 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, and or / more times per week. In non-limiting embodiments, an amount effective of a composition may be 10-1200, 100-1200, 200-1000, 300-900, 300-800, 300-700, and / or 300-600 mg per dose, all values and subranges therebetween inclusive. In non-limiting embodiments, such a dosage is administered 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, and or / more times per week. In non-limiting embodiments, an amount effective of a composition may be 10-500, 20-300, 50-200, and / or 100-150 mg per dose, all values and subranges therebetween inclusive. In non-limiting embodiments, such a dosage is administered 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, and or / more times per week. Those of skill in the art will appreciate that dosages may be adjusted as circumstances warrant, and that the foregoing is by no means limiting.
[0061] Drug products, or pharmaceutical compositions comprising an active agent (e.g., drug), may be prepared by any method known in the pharmaceutical arts, for example, by bringing into association the active ingredient with the carrier(s) or excipient(s). As used herein, a “pharmaceutically acceptable excipient”, “carrier”, or “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Examples of pharmaceutically acceptable excipients include one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, as well as combinations thereof. In many cases, it may be preferable to include isotonic agents, for example, sugars,86693890. DOCXAttorney Docket No. 06527-2501864 polyalcohol’s such as mannitol, sorbitol, or sodium chloride in the composition. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives, or buffers, which enhance the shelf life or effectiveness of the active agent. In certain aspects, the active compound may be prepared with a carrier that will protect the compound against rapid release, such as a controlled release formulation, including implants, transdermal patches, and microencapsulated delivery systems.
[0062] Biodegradable, biocompatible polymers can be used in delivery systems, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Many methods for the preparation of such formulations are broadly-known to those skilled in the art. The preferred form may depend on the intended mode of administration and therapeutic application, which will in turn dictate the types of carriers / excipients. Suitable forms include, but are not limited to, liquid, semi-solid, and solid dosage forms.
[0063] Pharmaceutical formulations adapted for oral administration may be presented, for example and without limitation, in capsules, tablets, oral solutions, or the like, and include suitable carriers and coatings as are broadly-known in the pharmaceutical arts.
[0064] Pharmaceutical formulations adapted for parenteral administration may be presented, for example and without limitation, in syringes, vials, bottles, IV / infusion bags, or the like, as are broadly-known to those of ordinary skill. Excipients include, for example and without limitation, water, saline, PBS, lactated Ringers, or any other injectable carriers. Suitable emulsifiers, lipids, surfactants, or the like may be utilized to maintain an active agent in solution.
[0065] Pharmaceutical formulations adapted for transdermal administration may be presented, for example and without limitation, as discrete patches intended to remain in intimate contact with the epidermis of the recipient for a prolonged period of time or electrodes for iontophoretic delivery.
[0066] Pharmaceutical formulations adapted for topical administration may be formulated, for example and without limitation, as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. Topical administration may include ocular administration, for example with eye drops.
[0067] Therapeutic compositions typically must be sterile and stable under the conditions of manufacture and storage. For example, sterile injectable solutions can96693890. DOCXAttorney Docket No. 06527-2501864 be prepared by incorporating the active agent in the required amount in an appropriate solvent with suitable carrier(s), followed by filter-sterilization. An appropriate fluidity of a solution can be maintained, for example, by the use of a rheology modifier. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, monostearate salts and gelatin.
[0068] The phrase “pharmaceutically-acceptable carrier” as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium, zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
[0069] The therapeutic agents described herein can be administered by any effective route. Examples of delivery routes include, without limitation: topical, for example, epicutaneous, inhalational, enema, ocular, otic, and intranasal delivery; enteral, for example, orally, by gastric feeding tube, and rectally; and parenteral, such as, intravenous, intraarterial, intrathecally, intramuscular, intracardiac, subcutaneous, intraosseous, intradermal, intrathecal, intraperitoneal, transdermal, iontophoretic, transmucosal, epidural, and intravitreal, with intrathecal and oral approaches being preferred in many instances. Suitable dosage forms may include single-dose, or multiple-dose vials or other containers, such as medical syringes, containing a composition comprising the therapeutic agent useful for treatment of a condition as described herein.
[0070] Provided herein are methods, and compositions useful in such methods, for treatment of various conditions. In non-limiting embodiments, the condition is one that results in or from, or relates to, nuclear speckle. As used herein, “nuclear speckle” refers to a nuclear domain enriched in pre-mRNA splicing factors. The terms “nuclear speckle,” “speckle,” and “interchromatin granule cluster” are used interchangeably herein. Speckles are believed to play a significant role in gene expression. In nonlimiting embodiments, the condition is one that results in or from a lack of diffuseness of speckles.
[0071] Accordingly, in non-limiting embodiments, a method of treating a condition associated with nuclear speckle sphericity in a patient is provided. The method may include administering to the patient an amount of a composition comprising a nuclear106693890. DOCXAttorney Docket No. 06527-2501864 speckle rejuvenator effective to reduce nuclear speckle sphericity in the patient. As used herein, the term “nuclear speckle rejuvenator” means a composition that restores normal structure and / or function of nuclear speckles. In non-limiting embodiments, the nuclear speckle rejuvenator improves diffuseness and / or increases the size of nuclear speckles. In non-limiting embodiments, the nuclear speckle rejuvenator is a composition that promotes the condensation of nuclear speckles. In non-limiting embodiments, the nuclear speckle rejuvenator is a composition that increases expression of SON and / or serine / arginine repetitive matrix 2 (SRRM2) in the patient.
[0072] Non-limiting embodiments of suitable nuclear speckle rejuvenators are shown in FIGS. 20A-20B. In non-limiting embodiments the nuclear speckle rejuvenator is pyrvinium, a derivative of pyrvinium, an analog of pyrvinium, and / or a pharmaceutically acceptable salt of any of the foregoing. In non-limiting embodiments, the nuclear speckle rejuvenator is pyrvinium pamoate. In non-limiting embodiments, the nuclear speckle rejuvenator is pyrvinium chloride, pyrvinium iodide, pyrvinium hydroxide, quinaldine red, pinacyanol iodide, and / or pyrantel, or an analog, derivative, and / or pharmaceutically acceptable salt of any of the foregoing. In non-limiting embodiments the nuclear speckle rejuvenator is ZC-001 , ZC-002, ZC-003, ZC-004, and / or ZC-005 (exemplary structures provided in FIG. 20B), or an analog, derivative, and / or pharmaceutically acceptable salt of any of the foregoing. In non-limiting embodiments the nuclear speckle rejuvenator is a compound containing one or more quinoline moieties.
[0073] In non-limiting embodiments, the patient is one who has been diagnosed with, exhibits one or more symptoms of, and / or or is at risk of developing a proteinopathy. In non-limiting embodiments, the patient has been diagnosed with, exhibits one or more symptoms of, and / or is at risk of developing Alzheimer’s Disease (AD), Parkinson’s Disease (PD), frontotemporal dementia (FTD), and / or retinitis pigmentosa (RP).
[0074] In non-limiting embodiments, the patient has RP, and, in non-limiting embodiments, has a mutation in in the RHOgene. The RHOgene encodes rhodopsin, a protein found in rod cells in the retina and involved in vision, including in low light conditions. In non-limiting embodiments, the mutation is a substitution mutation, in non-limiting embodiments a P23H substitution in a protein having a sequence having 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95%1 16693890. DOCXAttorney Docket No. 06527-2501864 or greater, 99% or greater, and / or 100% sequence identity to SEQ ID NO: 53, all values and subranges therebetween inclusive.
[0075] Those of skill in the art will appreciate that there may be many routes of administration for a composition that will fall under the scope of the present disclosure. In non-limiting embodiments, the nuclear speckle rejuvenator is administered in a composition (e.g., by itself or with one or more pharmaceutically-acceptable excipients) by instillation (e.g., directly to the eye, for example in eye drops). In nonlimiting embodiments, the composition is an ophthalmic preparation including pyrvinium, a derivative or analog thereof, and / or a pharmaceutically acceptable salt of any of the foregoing.
[0076] In non-limiting embodiments, the composition including a nuclear speckle rejuvenator is administered to the patient intravitreally (e.g., by injection to the vitreous humor), for example with one or more pharmaceutically acceptable excipients.
[0077] No matter the route of administration, in non-limiting embodiments, the composition may be an ophthalmic preparation. In non-limiting embodiments, the ophthalmic preparation may include the pyrvinium, analog or derivative thereof, and / or pharmaceutically-acceptable salt of any of the foregoing, at a concentration ranging from about 10nM to about 1 OpM, all values and subranges therebetween inclusive. In non-limiting embodiments the concentration is about 0.2 pM to about 0.5 pM, all values and subranges therebetween inclusive. In non-limiting embodiments, the concentration is about 0.2 pM, for example 0.2 pM. In non-limiting embodiments the concentration is about 0.5 pM, for example 0.5 pM. Those of skill in the art will appreciate that the composition may be administered for as long, and in as many doses, as may be required to provide relief from symptom(s) of the condition, improve functioning and / organization of nuclear speckles, improve diffuseness of nuclear speckles, and / or increase expression of SON and / or SRRM2 in the patient. In nonlimiting embodiments, only a single dose is administered and / or required.
[0078] Also provided herein is a method of treating retinitis pigmentosa in a patient, including administering to the patient a composition including pyrvinium, or an analog or derivative thereof, and / or a pharmaceutically-acceptable salt of any of the foregoing, in an amount effective to treat retinitis pigmentosa in the patient. In non-limiting embodiments the patient has a mutation in in the RHO gene. In non-limiting embodiments the mutation is a P23H substitution in a protein having a sequence having 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or126693890. DOCXAttorney Docket No. 06527-2501864 greater, 95% or greater, 99% or greater, and / or 100% sequence identity to SEQ ID NO: 53, all values and subranges therebetween inclusive.
[0079] In non-limiting embodiments, the composition includes pyrvinium pamoate. In non-limiting embodiments, the composition is an ophthalmic preparation. In nonlimiting embodiments, the concentration of the pyrvinium, pyrvinium analog, pyrvinium derivative, and / or pharmaceutically acceptable salt of any of the foregoing in the ophthalmic preparation is about 0.2 pM, for example 0.2 pM. In non-limiting embodiments the concentration is about 0.5 pM, for example 0.5 pM. Those of skill in the art will appreciate that the composition may be administered for as long, and in as many doses, as may be required to provide relief from symptom(s) of the condition, improve functioning and / organization of nuclear speckles, improve diffuseness of nuclear speckles, and / or increase expression of SON and / or SRRM2 in the patient. In non-limiting embodiments, only a single dose is administered and / or required. In non-limiting embodiments the composition is administered to the patient intravitreally.
[0080] Also provided herein is an ophthalmic preparation of pyrvinium, an analog or derivative thereof, and / or a pharmaceutically-acceptable salt of any of the foregoing, and a pharmaceutically-acceptable excipient useful and / or acceptable for instillation and / or intravitreal delivery. In non-limiting embodiments, the ophthalmic preparation may include the pyrvinium, analog or derivative thereof, and / or pharmaceutically- acceptable salt of any of the foregoing, at a concentration ranging from about 10nM to about 10pM, all values and subranges therebetween inclusive. In non-limiting embodiments the concentration is about 0.2 pM to about 0.5 pM, all values and subranges therebetween inclusive. In non-limiting embodiments, the concentration is about 0.2 pM, for example 0.2 pM. In non-limiting embodiments the concentration is about 0.5 pM, for example 0.5 pM.ExampleMaterials and Methods
[0081] Mice
[0082] For retinal explant studies, wildtype C57BL / 6J and RhoP23H / + knock-in mice (Jackson Laboratory Strain #017628) were euthanized by CO2 and retinae were isolated for culture. The animal studies were carried out in accordance with the National Institutes of Health guidelines and were granted formal approval by the University of Pittsburgh’s Institutional Animal Care and Use 641 Committee (approval numbers IS000131 19 and IS00023112).136693890. DOCXAttorney Docket No. 06527-2501864
[0083] Larva crawling assay
[0084] PP solubilized in DMSO were diluted directly into the fly medium at the final concentration of 25 pM and vortexed extensively to obtain homogeneous culture. Crawling assays were performed on 1.5% agarose plates made with a 2.3:1 combination of grape juice and water. A sample size of 10 to 15 larvae were selected for each genotype and assays were done using larvae in the third instar state. The larvae were first removed from vials and gently placed into a petri dish containing deionized water to allow for residual food to be washed off the body. After 15 seconds, the larvae were transferred to a petri dish containing the 1.5% agarose mixture and were given one minute to rest. They were then transferred to a second dish filled with the 1 .5% agarose mixture and timed immediately for one minute, during which their crawling performance was measured. A transparent plastic lid was placed on top of the plates and the crawling path of the larvae were traced. Observations of the crawling activity were done under a light microscope. The brightness and distance of the light source above the plates were kept constant across all trials and genotypes. The crawling paths of the larvae were measured using FIJI Imaged and the average distance traveled was taken for each genotype.
[0085] Adult fly climbing assay
[0086] Male adult Drosophila melanogaster flies at 14 and 21 days of age fed with a normal diet or diet supplemented with 25 pM PP were used for assessing climbing ability. Flies were grouped into cohorts of the same sex, pre-mated, and age-matched, with a maximum of 20 individuals per vial (usually 5-15). All flies used in each trial were hatched within a 3-day window. The evening prior to each assay, flies were gently transferred to fresh tubes to allow for grooming and access to food. To ensure consistent conditions, assays were conducted at approximately the same time of day with a consistent ambient light setting. A custom climbing vial was employed, divided into six compartments, each labeled with a number (1 to 6) to denote climbing speed. The vial was positioned against a white background to enhance visibility during photography. Flies were transferred from their housing vial to the climbing vial, which was covered with a plastic plate on top. To initiate the assay, the flies were gently tapped to the bottom of the vial and allowed 10 seconds to climb. A cell phone camera was used to capture a photograph of the vial. Care was taken to ensure the camera was level with the vial, all flies were visible, and the background was free from stains or spots. The number of flies in each compartment of the climbing vial was counted at146693890. DOCXAttorney Docket No. 06527-2501864 each time point and recorded on a dedicated worksheet. Each cohort of flies underwent five consecutive trials, with approximately 1 minute of rest between each trial. The average score of each cohort was determined by dividing the total score by the total number of flies.
[0087] Fibroblast cell culture and drug treatment
[0088] MEFs and NIH 3T3 cells were cultured at 37 °C and 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM, glucose 4.5 g / L with phenol red) and supplemented with 10% fetal bovine serum (FBS), 1 mM sodium pyruvate (Gibco), and penicillin (100 U / mL)-streptomycin (100 pg / mL) (Gibco). Methods for the manipulation of Son (transient knockdown or constitutive overexpression) and validation of changes to protein (SON) levels with regards to the mRNA-Seq data are previously described in 9. For Tu treatment, 100 ng / mL Tu (in DMSO) for six hours was used unless otherwise noted. NB (HY-50904), PB (HY-12047), PH (HY-B0883), PP (HY-A0293), MG-132 (HY-13259), and XMU-MP-1 (HY-100526) were purchased through MedChemExpress and BafA (1334) was purchased from Tocris. All drugs were handled per manufacturer instruction.
[0089] Primary neuron cell culture and P301 S-Tau virus infection.
[0090] The cerebral cortices of 3-4 neonate mice (P0) were dissected on ice, the meninges were removed, and placed in the cold dissection medium (DM), consisting of 6 mM MgCI2 (Sigma M1028-100 ml), 0.25 mM CaCI2 (Sigma C7902), 10 mM HEPEs (100X), 0.9% Glucose, 20 pM D-AP5 (Cayman, NC1368401 ), and 5 pM NBQX (Tocris Bioscience, 10-441 -0). After dissection, the brain tissues were washed with DM 1 ~2 times and incubated with 13mL of DM containing papain (Worthington, LK003176) in 37 °C water bath for 20 min. The suspension was shaken every 5 min. 10mL media containing 18 ml DM + 2 ml low OVO + 133 ul DNase I (dilute 10X low OVO and 150x DNase I to DM) were added into the suspension to stop the digestion in 37°C water bath for 5 min. The solution was taken off and 10 ml fresh solution was added in. Then the tissues were triturated until there were no visible chunks, and the solution was filtered through the 70 pm cell strainer. The cell solution was then centrifuged at 1000 rpm for 10 min and the supernatant was discarded. The cell pellet was gently resuspended in 20 ml B27 / NBM / High glucose media, and the suspension was centrifuged at 850 rpm for 5 min. After that, the supernatant was taken off and B27 / NBM (1 ml / mouse brain) was added to resuspend the cells until single cell solution. The cells were counted and plated onto the coverslips at 250k in 24-well156693890. DOCXAttorney Docket No. 06527-2501864 plates for imaging or 800k in 12-well plates for qRT-PCR or Western blots. AAV-P301 S hTau 702 (Viro-vek) were infected at DIV1 at 100 MOI.
[0091] Human iPSC-derived neurons culture
[0092] Human iPSC-derived neurons were pre-differentiated and differentiated as described. Briefly, iPSCs were pre-differentiated in Matrigel-coated plates or dishes in N2 Pre-Differentiation Medium containing the following: KnockOut DMEM / F12 as the base, 1 x MEM non-essential amino acids, 1 x N2 Supplement (Gibco / Thermo Fisher Scientific, cat. no. 17502-048), 10 ng / ml of NT-3 (PeproTech, cat. no. 450-03), 10 ng / ml of BDNF (PeproTech, cat. no. 450-02), 1 pg / ml of mouse laminin (Thermo Fisher Scientific, cat. no. 23017-015), 10 nM ROCK inhibitor and 2 pg / mlof doxycycline to induce expression of mNGN2. After 3 d, on the day referred to hereafter as Day 0, pre-differentiated cells were re-plated into BioCoat poly-D-lysine-coated plates or dishes (Corning, assorted cat. no.) in regular neuronal medium, which we refer to as +AO neuronal medium, containing the following: half DMEM / F12 (Gibco / Thermo Fisher Scientific, cat. no. 714 11320-033) and half neurobasal-A (Gibco / Thermo Fisher Scientific, cat. no. 10888-022) as the base, 1 x MEM non-essential amino acids, 0.5x GlutaMAX Supplement (Gibco / Thermo Fisher Scientific, cat. no. 35050-061 ), 0.5x N2 Supplement, 0.5x B27 Supplement (Gibco / Thermo Fisher Scientific, cat. no. 17504- 044), 10 ng / ml of NT-3, 10 ng / ml of BDNF and 1 pg / ml of mouse laminin. Neuronal medium was half-replaced every week.
[0093] Efficacy test of PP in Retina explant culture
[0094] Wild type and RhoP23H / + mice were euthanized at P15 and retina explants were isolated and cultured as previously described107,108. Briefly, eyeballs were enucleated and incubated in Ames solution containing 0.22 mM L-cysteine (Sigma- Aldrich) and 20 U papain (Worthington, Freehold NJ, USA) at 37 oC for 30 min. The digestion was stopped by transferring the eyes to Dulbecco’s modified Eagle’s medium (DMEM; Gibco) containing 10% fetal calf serum (FCS; Gibco) and penicillin &streptomycin antibiotics (1 x, GenClone) at 4 oC for 5 min. The eye cup was made by gently removing the cornea, iris and lens. Each eye cup was flattened by four radio cuts and the sclera was then carefully peeled off from the retina:RPE complex. The retina:RPE explant was transferred to a trans well insert with 0.4-micron pore polycarbonate membrane (ThermoFisher) sitting on the surface of 1.5 mL of neurobasal-A plus medium (Gibco) containing 2% B27 supplement (Gibco) in a 6-well cell culture plate, and the RPE layer was facing down the transwell membrane. The166693890. DOCXAttorney Docket No. 06527-2501864 retinal explants were cultured at 37 oC with 5% CO2.The medium was replaced with fresh medium containing 0.5 pM PP after 24 h, which was replaced again every 2 days until 10 days in culture (DIV). A visible light optical coherence tomography (vis-OCT) prototype 109 was utilized to monitor the explants noninvasively at day 0 and day 10. Retinal layers were segmented automatically using a deep learning method and then manually corrected by a customized software to calculate the retinal thickness (FIG. 16). Retina explants were collected at 10 DIV and processed for fixation, dehydration, paraffin embedding, cross-sections, dewaxing, rehydration and hematoxylin and eosin (H&E) staining. H&E-stained slides were imaged by regular light microscopy with a color camera, and the number of nuclei in the outer nuclear layer (ONL) was 740 calculated manually.
[0095] Autophagy reporter assay
[0096] To express the LC3 reporter in the neurons, the primary mouse neuronal cultures were infected with the homemade lentivirus-mCherry-GFP-LC3 for 7 days. The florescent signal from the vacuoles at different stages were acquired by confocal imaging. The mCherry-GFP-LC3 fluorescence images were acquired with a Leica TCS SP8 confocal system using 63x oil-immersion objective. 488 nm and 568 nm laser were used to excite the GFP and mCherry, respectively. Images were taken with the same confocal settings. Minor image adjustment (brightness and / or contrast) was performed in Imaged. The GFP and mCherry signal collected were merged into one image to quantify the red, green, and yellow vacuoles for quantification of different types of vacuoles. The different colored fluorescent signal was manually counted in each cell, and each point represents the average number of the specific vacuole for one cultured cell.
[0097] Scratch assay
[0098] Cells were grown until 100% confluent, ER stress was induced as previously described, and then a single scratch was performed with a pipette tip per well. Cells were imaged immediately after scratching (Ohr) and then after 23hr. The Cell Profiler 1 1 1 “Wound Healing” pipeline (https: / / cellprofiler.org / examples) was used to measure the “Percentage of Gap Filled”.
[0099] Immunoblot
[0100] Different cells were harvested and fractionated to produce cytosolic and nuclear lysates using the NE-PER kit (Thermo Fisher Scientific). For whole cell lysates, cells were lysed in RIPA buffer. Both protease and phosphatase inhibitors176693890. DOCXAttorney Docket No. 06527-2501864 were included in the respective lysis buffer. ~47 pg of protein was separated on a 4%- 15% gradient SDS-polyacrylamide gel (Bio-Rad) which were ransferred to nitrocellulose membranes, stained with Ponceau S stain, washed, blocked with 5% non-fat milk, and incubated overnight at 4°C with the following primary antibodies: anti- a-Tubulin (Cell Signaling Technology (C.S.T.) #2144), anti-Lamin A / C (C.S.T. #4777), anti-SON (Abeam #121033 and LSBio LS-C803664), anti-YAP1 (C.S.T. #12395), anti- GFP (C.S.T. #2956), anti-Tau (Sigma-Aldrich, #A0024), anti-p-Tau (a gift from Dr. Peters Davies), anti-|3-actin (C.S.T. #4970), anti-puromycin (BioLegend 381502), antiubiquitin (C.S.T. #58395), anti-LC3-l / ll (C.S.T. #2775), anti-p62 (C.S.T. #23214), anti- ATF4 (C.S.T. #1 1815), anti-ATF6 (Novus 70B1413.1 ), and anti-XBP1 s (BioLegend 658802). Membranes were treated with the appropriate secondary antibody conjugated to horseradish peroxidase the following day and then ECL Prime Western Blotting Detection Reagent (Cytiva) was applied. A Bio-Rad ChemiDoc MP Imaging System was used to visualize the signal, and signal intensities were determined with Imaged.
[0101] Cellular thermal shift assay (CETSA)
[0102] EGFP::SC35 MEFs with EGFP knocked into the N-terminal of mouse Srsf2 locus (previously described) were treated with either DMSO or 3pM PP for 50 minutes at 37°C. Cells were then trypsinized and resuspended in PBS with either DMSO or 3pM PP and 100 pL of the suspensions were distributed to PCR tubes for the thermal shift assay (three minutes at a range of temperatures). The temperatures used were: 42.0°C, 42.5°C, 43.9°C, 46.2°C, 49.3°C, 53.3°C, 57.9°C, 62.1 °C, 65.2°C, 67.8°C, 69.2 °C, and 70.0 °C. After the samples were heated, they sat at 20 °C for three minutes, were snap frozen in liquid nitrogen and thawed for three cycles to lyse the cells, and then spun at 20,000 x g for 20 minutes at 4°C. The supernatant was then removed, and immunoblotting was performed using anti-GFP (C.S.T. #2956), anti-ATF4 (C.S.T. #1 1815), and anti-SON (Lifespan Biosciences #LS-C803664-100), followed by appropriate secondary antibody. Band intensity on the blots were relative to the intensity of the 42 °C band and were normalized so that this band’s (42 °C) intensity was set equal to 1 .
[0103] Protein purification and in vitro droplet formation assay
[0104] Regions of SON and the entire SRSF2 protein were fused to mCherry. cDNA encoding the SON-IDR N terminal (region 1 ), SON-IDR C-terminal (region 2), and SRSF2 were each cloned into the expression vector pET21 a (+)-Histag-mCherry186693890. DOCXAttorney Docket No. 06527-2501864(Addgene plasmid # 70719). The plasmids obtained were transformed into C3013 E. Coli (NEB C3013I). Fresh bacterial colonies were inoculated into LB media containing ampicillin and grown overnight at 37°C. Overnight cultures were diluted in 500mL of LB broth with ampicillin and grown at 37°C until 793 reaching OD 0.6. IPTG was then added to 2mM, and growth continued for 3h at 37°C. The cells were pelleted and stored frozen at -80 °C. Bacterial pellets were resuspended in 15mL of Buffer A (50 mM Tris-HCI, 500 mM NaCI) containing protease inhibitors (Pierce, A32965) and 10mM imidazole. The suspension was sonicated on ice for 15 cycles of 30 sec on, 30 sec off. The lysate was centrifuged for 40 minutes at 15,000 RPM at 4°C to clear debris, then added to 2mL of preequilibrated Ni-NTA agarose beads (Qiagen cat no. 30210). The agarose lysate slurry incubated for 1.5hrs at 4°C with rocking, then allowed to flow through the column. The packed agarose was washed with 15mL of Buffer A with 10mM imidazole. Protein was eluted with 5mL of Buffer A containing 15mM imidazole, 10mL Buffer A containing 100mM imidazole, then 10mL Buffer A containing 200mM imidazole. All elutions were collected in 1 mL fractions. Aliquots of the collected fractions were run on an SDS-PAGE gel and stained with Imperial Protein Stain to verify amount and purity of the protein. Fractions containing protein were combined and dialyzed against Dialysis Buffer (50mM Tris-HCI, 500mM NaCI, 10% glycerol, 1 mM DTT). Recombinant mCherry fusion proteins were concentrated and desalted to 200uM protein concentration and 125mM NaCI using Amicon Ultra centrifugal filters (MilliporeSigma cat no. UFC801024) following manufacturer’s instructions. 20uM of recombinant protein was added to Droplet Buffer (50mM Tris- HCI, 10% glycerol. 1 mM DTT, 10% PEG) containing indicated final salt and pyrvinium concentrations. For droplet formation assay with Hela nuclear extract supplementation, NE was added to different concentration of SON IDR2 at the final concentration of 1.5mg / ml in Droplet buffer (20mM HEPES, pH 7.9, 20% glycerol, 125mM KCI, 0.2mM EDTA, 0.5mM DTT, 10% DEG). For droplet formation assay with GFP::SRSF2 MEF nuclear extract supplementation, NE was added to 10uM SON IDR2 at the final concentration of 0.6mg / ml in Droplet buffer. A custom imaging chamber was created by placing strips of tape on a glass coverslip, forming a square. The protein solution was immediately loaded onto the center of the square and covered with a second glass coverslip. Slides were then imaged with a Leica confocal microscope with a 63x oil objective. Image series were taken over a 20-minute time span with 1 image every 30 seconds.196693890. DOCXAttorney Docket No. 06527-2501864
[0105] Mass spectrometry to profile condensates composition
[0106] Hela nuclear extract samples were thawed at room temperature, vortexed for 10 minutes, bath sonicated for 5 minutes and centrifuged at 13000g for 10 minutes at room temperature prior to quantification of total protein by a Pierce 660 Protein Assay (Thermo Scientific #22660). Condensates were obtained by centrifuging at 10,000xg for 10 minutes and resuspended in 5%SDS in 50 mM TEAB prior to total protein quantification. Protein digestion was carried out on 10 pg of protein from each sample on S-trap micro columns (Protifi) according to the manufacturer’s protocol. Following digestion, peptide samples were then dried in a speedvac and resuspended in a solution of 3% acetonitrile and 0.1 % TFA and desalted using Pierce Peptide Desalting Spin Columns (Thermo Scientific # 89851 ). Eluants were dried in a speedvac and resusupended in a solution of 3% acetonitrile and 0.1 % formic acid to a final concentration of 0.5 pg / pL. Mass spectrometry analysis was conducted on a Thermo Fisher QE-HFX coupled to a Vanquish Neo UHPLC. Approximately 1 pg of each sample was loaded onto an EASY-Spray PepMap RSLC C18 column (2 pm, 100A, 75pm x 50 cm) and eluted at 300 nl / min over a 120-minute gradient. MS1 Inspectra were collected at 120,000 resolution with a full scan range of 350 - 1400 m / z, a maximum injection time of 50ms and the automatic gain control (AGC) set to 3e6. The precursor selection window was 1 .4 m / z and fragmentation were carried out with HCD at 28% NCE. MS2 were collected with a resolution of 30,000, a maximum injection time of 50ms and the AGC set to 1 e5 and the dynamic exclusion time set to 90s. The collected MS data were analyzed using MSFragger V4.0
[0001] and searched against the human SwissProt database. The search parameters were set as follows: strict trypsin digestion, missing cleavage up to 2, carbamidomethylation of cysteine as static modification, oxidization of methionine and protein N-terminal acetylation as variable modification, a maximal mass tolerance of 20 ppm for the precursor ions and 20ppm for the fragment ions, and false detection rate (FDR) was set to be 1 %.
[0107] 1 ,6-hexanediol treatment to examine effects of PP on LLPS
[0108] A 10% (w / v) 1 ,6-hexanediol (1 ,6-HD, MilliporeSigma) solution was prepared in Dulbecco’s Modified Eagle’s Medium (DMEM, glucose 4.5 g / L with phenol red) supplemented with 10% fetal bovine serum (FBS), 1 mM sodium pyruvate (Gibco), and penicillin (100 U / mL)-streptomycin (100 pg / mL) (Gibco). To examine NS LLPS dynamics, EGFP::SC35 MEFs (previously described) were treated with DMSO or 1 pM PP for 30 minutes and then treated with 0, 1 , 2, or 10% 1 ,6-HD for 20 minutes.206693890. DOCXAttorney Docket No. 06527-2501864Cells were fixed in 2% paraformaldehyde, stained with bisBenzimide H 33258 (Hoechst), and then imaged. Image analysis was completed in Cell Profiler; briefly, the process was to image the cells in the 405 (Hoescht), 488 (GFP), and 555 (high intensity to image whole cells) and then use the 405 channel to determine the nuclei boundaries, 488 to determine EGFP::SC35, and 555 to determine the area of the whole cells. We differentiated nuclear and cytosolic areas by subtracting the 405 signals from the 555 signals. 488 signal was then quantified in the aforementioned nuclear area and cytosolic area and compared. 20+ cells were measured for each condition. The average Manders coefficient was determine with Imaged by averaging the tM1 and tM2 values.
[0109] This same process was used to examine the effects of PP on GW182 and MED1 except in wildtype MEFs. The signal was identified by immunofluorescence (IF). Briefly, IF was performed by fixing cells with 4% paraformaldehyde in PBS, permeabilizing with 0.2% Triton X-100 in PBS, blocked with 2% bovine serum albumin in PBS, and then incubated with primary antibody (GW182 (ab156173, Abeam) or MED1 (ab60950, Abeam)) diluted per manufacturer’s recommendation overnight at 4°C. Cells were then treated with the appropriate 1 :1000 secondary antibody overnight at 4°C, stained with Hoechst the following day, and then mounted with Prolong Gold Antifade (Invitrogen). Signal (either IF or endogenous GFP) sphericity was determined as previously described. 20+ cells were measured for each condition. Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
[0110] For Reverse transcription-quantitative polymerase chain reaction (RT- qPCR), cDNA was produced using the Superscript III (Thermo Fisher) kit and qPCR was completed using the SYBR Green system (Thermo Fisher) in a CFX384 Real- Time System (Bio-Rad). Endogenous p-actin levels were used as controls. The qPCR primer sequences were as follows:
[0111] p-actin forward: AAGGCCAACCGTGAAAAGAT (SEQ ID NO: 1 )
[0112] p-actin reverse: GTGGTACGACCAGAGGCATAC (SEQ ID NO: 2)
[0113] Arnot forward: CTGGAAGCAGATATGACCAAGT (SEQ ID NO: 3)
[0114] Arnot reverse: GGTGTTAGGAGAGTGGCTAATG (SEQ ID NO: 4)
[0115] Atf4 forward: CCACTCCAGAGCATTCCTTTAG (SEQ ID NO: 5)
[0116] Atf4 reverse: CTCCTTTACACATGGAGGGATTAG (SEQ ID NO: 6)
[0117] Atg4c forward: GTGCGGAATGAGGCTTATCA (SEQ ID NO: 7)
[0118] Atg4c reverse: CCAGACTTCTTCCCAAACTCTATC (SEQ ID NO: 8)216693890. DOCXAttorney Docket No. 06527-2501864
[0119] Bmp4 forward: AACGTAGTCCCAAGCATCAC (SEQ ID NO: 9)
[0120] Bmp4 reverse: CGTCACTGAAGTCCACGTATAG (SEQ ID NO: 10)
[0121] Ern1 forward: TCCTAACAACCTGCCCAAAC (SEQ ID NO: 11 )
[0122] Ern1 reverse: TCTCCTCCACATCCTGAGATAC (SEQ ID NO: 12)
[0123] Fdz1 forward: GAGATCCACCTTCCAGCTTTAT (SEQ ID NO: 13)
[0124] Fzd1 reverse: CACTCCCTCTGAACAACTTAGG (SEQ ID NO: 14)
[0125] Hyoul forward: GAGGCGAAACCCATTTTAGA (SEQ ID NO: 15)
[0126] Hyoul reverse: GCTCTTCCTGTTCAGGTCCA (SEQ ID NO: 16)
[0127] Manf forward: GACAGCCAGATCTGTGAACTAAAA (SEQ ID NO: 17)
[0128] Manf reverse: TTTCACCCGGAGCTTCTTC (SEQ ID NO: 18)
[0129] Rnf166 forward: GAAGACACACTCCCGCTTTA (SEQ ID NO: 19)
[0130] Rnf166 reverse: CTGAGACCAACTCTCCTTGTG (SEQ ID NO: 20)
[0131] Sirt2 forward: CATAGCCTCTAACCACCATAGC (SEQ ID NO: 21 )
[0132] Sirt2 reverse: GTAGCCTGTTGTCTGGGAATAA (SEQ ID NO: 22)
[0133] Sqstml forward: AACAGATGGAGTCGGGAAAC (SEQ ID NO: 23)
[0134] Sqstml reverse: AGACTGGAGTTCACCTGTAGA (SEQ ID NO: 24)
[0135] Tgfb3 forward: CCACGAACCTAAGGGTTACTATG (SEQ ID NO: 25)
[0136] Tgfb3 reverse: CTGGGTTCAGGGTGTTGTATAG (SEQ ID NO: 26)
[0137] Ube2q2 forward: TTCCTAAGCACCTGGATGTTG (SEQ ID NO: 27)
[0138] Ube2q2 reverse: CTCCTCCTCTTCCTCTTCTTCT (SEQ ID NO: 28)
[0139] Xbp1 forward: GGGTCTGCTGAGTCC (SEQ ID NO: 29)
[0140] Xbp1 reverse: CAGACTCAGAATCTGAAGAGG (SEQ ID NO: 30)
[0141] Cul5 forward: GAACACAGGCACCCTCATATT (SEQ ID NO: 31 )
[0142] Cul5 reverse: AGTTACACTCTCGTCGTGTTTC (SEQ ID NO: 32)
[0143] Psmgl forward: CCAGTGGTTGGAGAAGGTTT (SEQ ID NO: 33)
[0144] Psgml reverse: GGGTCTTGTAGTCTGTGATGTG (SEQ ID NO: 34)
[0145] Atg14 forward: CATTCCCTGGATGGGCTAAA (SEQ ID NO: 35)
[0146] Atg14 reverse: CCTCAGGAACAAGAAGGAAGAG (SEQ ID NO: 36)
[0147] Yap1 forward: CCAATAGTTCCGATCCCTTTCT (SEQ ID NO: 37)
[0148] Yap1 reverse: TGGTGTCTCCTGTATCCATTTC (SEQ ID NO: 38)
[0149] Chromatin Immunoprecipitation (ChIP)
[0150] ChIP for SC35 was performed using anti-SC35 antibody (ab11826, Abeam) as previously described. Briefly, mouse liver samples were submerged in PBS + 1% formaldehyde, cut into small (~1 mm3) pieces with a razor blade and incubated at226693890. DOCXAttorney Docket No. 06527-2501864 room temperature for 15 minutes. Fixation was stopped by the addition of 0.125 M glycine (final concentration). The tissue pieces were then treated with a TissueTearer and finally spun down and washed twice in PBS. Chromatin was isolated by the addition of lysis buffer, followed by disruption with a Dounce homogenizer. The chromatin was enzymatically digested with MNase. Genomic DNA (Input) was prepared by treating aliquots of chromatin with RNase, Proteinase K and heated for reverse-crosslinking, followed by ethanol precipitation. Pellets were resuspended and the resulting DNA was quantified on a NanoDrop spectrophotometer. An aliquot of chromatin (10 pg) was precleared with protein A agarose beads (Invitrogen). Genomic DNA regions of interest were isolated using 4 pg of antibody. Complexes were washed, eluted from the beads with SDS buffer, and subjected to RNase and proteinase K treatment. Crosslinking was reversed by incubation overnight at 65 °C, and ChIP DNA was purified by phenol-chloroform extraction and ethanol precipitation. ChlP-qPCR for MEFs were essentially performed the same way as previously described with anti-SC35 (ab1 1826, Abeam) and anti-XBP1 s antibody (Biolegend 658802), except that the MEFs were directly fixed with 1 % formaldehyde before subject to nuclei isolation and chromatin immunoprecipitation. The primers used for ChlP-qPCR are as follows:
[0151] Gene desert forward primer: GCAACAACAACAGCAACAATAAC (SEQ ID NO: 39)
[0152] Gene desert reverse primer: CATGGCACCTAGAGTTGGATAA (SEQ ID NO: 40)
[0153] Xbp1 promoter region forward primer: GGCCACGACCCTAGAAAG (SEQ ID NO: 41 )
[0154] Xbp1 promoter region reverse primer: GGCTGGCCAGATAAGAGTAG (SEQ ID NO: 42)
[0155] Xbp1 gene body region forward primer: CTTTCTCCACTCTCTGCTTCC (SEQ ID NO: 43)
[0156] Xbp1 gene body region reverse primer: ACACTAGCAAGAAGATCCATCAA (SEQ ID NO: 44)
[0157] Manf promoter region forward primer: ACAGCAGCAGCCAATGA (SEQ ID NO: 45)
[0158] Manf promoter region reverse primer: CAGAAACCTGAGCTTCCCAT (SEQ ID NO: 46)236693890. DOCXAttorney Docket No. 06527-2501864
[0159] Manf gene body region forward primer: CAACCTGCCACTAGATTGAAGA (SEQ ID NO: 47)
[0160] Manf gene body region reverse primer: AGGCATCCTTGTGTGTCTATTT (SEQ ID NO: 48)
[0161] Hyoul promoter region forward primer: GACTTCGCAATCCACGAGAG (SEQ ID NO: 49)
[0162] Hyoul promoter region reverse primer: GACTTCTGCCAGCATCGG (SEQ ID NO: 50)
[0163] Hyoul gene body region forward primer:TGGAAGAGAAAGGTGGCTAAAG (SEQ ID NO: 51 )
[0164] Hyoul gene body region reverse primer: TCCCAAGTGCTGGGATTAAAG (SEQ ID NO: 52)
[0165] HTS of FDA-approved drugs and quantitative imaging analysis
[0166] EGFP::SC35 MEFs were seeded in black well plate with glass bottom (Cellvis). The FDA-945 approved compound library (100nL per drug) was stamped to 384-well tissue culture plates using CyBio Well vario (Analytik Jena). Compound solutions were then added to the cell plate at the final concentrations of 10 pM using a BRAVO liquid handler. After 18 hours of treatment, culture 948 media was removed, and cells were fixed with 4% PFA followed by DAPI staining. Cells were imaged using a GE INCELL 2200 with 60x lens. Maximum intensity projection images were captured, and nuclear speckles sphericity was quantified with CellProfiler as previously described. Briefly, for speckle i the sphericity is defined as equation 1 :Sphericity f =area i e circumference i
[0167] so that a perfect circle will have a sphericity of 1 , and a line will have a sphericity of 0. To calculate 954 the average sphericity of a given image that has k total speckles, we calculated the area-weighted average as described in equation 2.:
[0168] For the secondary screening to determine if compounds affected nuclear speckles morphology in a dose-dependent manner, specific compounds were selected using a TTP Mosquito X1 followed by serial dilutions of compounds that were prepared using a Bravo automated liquid handling platform (Agilent). Cells were treated, imaged, and analyzed according to the same protocol described above. For246693890. DOCXAttorney Docket No. 06527-2501864 the tertiary screen we used MEFs with a Perk promoter-driven dGFP as previously described . Cells were treated with drugs of interest and either DMSO or Tu at the same time as described above and both GFP / cell and cell number were determined with CellProfiler as previously described 3. For both dose-response and Perk promoter-driven dGFP experiments, eight biological replicates were performed per drug per dose.
[0169] mRNA-seq and transcriptome analysis
[0170] For all mRNA-seq or RT-qPCR, total mRNA was isolated and purified from MEFs using the PureLink RNA Mini Kit (Thermo Fisher). For mRNA-seq, samples were submitted to the UPMC Genome Center for quality control, mRNA library preparation (Truseq Stranded mRNA (poly-A pulldown), and sequencing (paired-end 101 bp reads and ~40 million reads per sample). Sequencing was performed on a NextSeq 2000 sequencer.
[0171] For the Son overexpression or knockdown (OE / KD) sequencing data, the raw RNA-seq FASTQ 973 files were analyzed by FastQC for quality control. Adaptors and low-quality reads were filtered by Trimmomatic. Then the processed reads were aligned by HISAT2 against mouse reference mm10. For gene-level intron / exon quantification, bedtools software was used to collect and count reads that aligned to any intron / exon of the given gene. If one read spans across multiple exons of the same gene, it will only be counted once. If one read spans intron / exon junction, it will only be counted as intron. The intron / exon count were normalized by gene length and total reads for FPKM normalization.
[0172] The analysis of drug-treated samples was done using Galaxy: Trim Galore was used for quality control and trimming and Salmon was used to normalize the paired-end reads (TPM method). The online 3D RNA-Seq pipeline was used to determine upregulated and downregulated genes, in addition to generating the PCA plot.
[0173] For RNA-seq of RhoP23H / + and wild-type mice, total RNA was isolated from retinae isolated from mice at 1 , 3, and 6 months of age using TRIzol organic extraction. RNA-seq was performed by QuickBiology Inc. RNA integrity was checked by Agilent Bioanalyzer. Libraries for RNA-seq were prepared with KAPA Stranded mRNA-Seq poly(A) selected kit (KAPA Biosystems, Wilmington, MA) using 250 ng toal RNAs for each sample. Paired end sequencing was performed on Illumina HighSeq 4000 (Illumina Inc., San Diego, CA).256693890. DOCXAttorney Docket No. 06527-2501864
[0174] The reads were first mapped to the latest UCSC transcript set using Bowtie2 version 2.1.0122 and the gene expression level was estimated using RSEM v1 .2.15123. TMM (trimmed mean of M-values) was used to normalize the gene expression. Differentially expressed genes were identified using the edgeR programi 24. Genes showing altered expression with p < 0.05 and more than 1 .5-fold changes were considered differentially expressed. Goseq was uesd to perform the GO enrichment analysis and Kobas was used to perform the pathway analysis.
[0175] mRNA splicing rates analysis
[0176] The mRNA processing rate was estimated by the simple kinetic model (equation 3) where pre-m RNA was converted to mature mRNA with the mRNA processing rate Kp and the mature mRNA is subject to decay with a constant decay rate Kd.Pre
[0177] Under basal condition (DMSO), we assume a steady state of mature mRNA expression whose level does not change over time; thus, we have:
[0178] Under Son overexpression or knocking down condition (condition 2), if we assume the mature 1006 mRNA degradation rate does not change with Son OE / KD (K1 d=K2d), then the ratio of splicing 1007 rates between basal condition 1 and Son OE / KD condition 2 is given by:
[0179] Gene set enrichment analysis (GSEA)
[0180] GSEA was performed with software version 4.1.0. TPM quantification of transcriptome under different drugs or DMSO control was used as input for gene expression. Parameters used for the analysis: 1000 permutations, permutation type: gene set.266693890. DOCXAttorney Docket No. 06527-2501864
[0181] Intron retention detection
[0182] Intron retention events were detected by iREAD 34. Intron retention events are selected with default settings T>=20, J>=1 , FPKM>=2.
[0183] Gene ontology analysis
[0184] DAVID (Version 2021 ) 125 (https: / / david.ncifcrf.gov) was used to perform Gene Ontology analyses. Briefly, gene names were first converted to DAVID- recognizable IDs using Gene Accession Conversion Tool. The updated gene list was then subject to GO analysis using all Homo Sapiens as background and with Functional Annotation Chart function. GO_BP_DIRECT, KEGG_PATHWAY or UP_KW_BIOLOGICAL_PROCESS was used as GO categories. Only GO terms with a p value less than 0.05 were included for further analysis.
[0185] Motif analysis
[0186] Motif analysis was performed with the SeqPos motif tool (version 0.590) 126 embedded in Galaxy Cistrome using all motifs within the homo sapiens reference genome hg19 as background. LISA analysis was performed using webtool (http: / / lisa.cistrome.org / ).
[0187] Statistical Analysis
[0188] Data were analyzed and presented with Graph Pad Prism software. Plots show individual data 1029 points and bars at the mean and ± the standard error of the mean (SEM). One-tailed t-tests were used to compare means between groups, with significance set at p < 0.05. In instances where the p value is not shown, *, **, ***, and **** represent p < 0.05, 0.01 , 0.001 , and 0.0001 , respectively.Results
[0189] Genetic rejuvenation of nuclear speckle transcriptionally reprograms global proteostasis and YAP1 activity in an opposing manner.
[0190] To determine the extent by which SON transcriptionally reprograms gene expression under both basal and proteotoxic stress conditions, we performed bulk mRNA-Seq on immortalized mouse embryonic fibroblasts (MEFs) with either SON knockdown (KD) by siRNA or overexpression (OE) via CRISPRa24, in the absence or presence of the ER stress inducer tunicamycin (Tu) as previously described. Principal component analysis (PCA) on total mRNA level indicated that while SON manipulation has little effects on global gene expression 106 under basal condition, SON OE and KD significantly amplified and dampened the global transcriptional response to ER stress, respectively. These include 461 genes that are normally induced, and 901276693890. DOCXAttorney Docket No. 06527-2501864 genes repressed by Tu under normal SON expression condition. For both groups of genes, we further observed a strong correlation between the relative fold induction or repression for each gene under SON OE and KD conditions, further demonstrating the robustness of bidirectional control on proteostasis gene expression by SON. As expected, gene ontology (GO) analysis revealed that those ER stress-induced 461 genes are strongly enriched in protein quality control pathways, including protein folding (such as Pdia3, Dnajbl 1 and Manf), ER / Golgi quality control (such as Sec23b, Hyoul and Hspa5), tRNA aminoacylation (such as Gars, lars and Eprs), ER- associated protein degradation (ERAD) (such as Edeml , Syvnl , Sell I and Ube2g2), and autophagy (such as Sqstml and Atg13). To shed light on the mechanisms by which SON transcriptionally amplifies gene activation in response to ER stress, we performed both Landscape In Silico deletion Analysis (LISA) 25 and motif analysis to infer the transcriptional regulators that may recruit nuclear speckles to chromatin. Both analyses revealed basic leucine zipper (bZIP) transcription factors (TFs), including ATF6, XBP1 , ATF4 and CREB1 as the top candidates. ChlP-qPCR further showed increased recruitment of nuclear speckles to the 3’ regions of selective proteostasis genes in response to SON OE under both basal and ER stress conditions, concomitant with increased XBP1 s recruitment to the promoter regions of the same genes. To corroborate our in vitro findings, we further examined a recently published murine in vivo hepatic XBP1 s interactome dataset, and found proteins involved in mRNA splicing and processing are very strongly enriched in the XBP1 s interactome at CT8, a time when hepatic SON expression peaks, with PRPF8, SNRNP200 and DHX9 being the top three most abundant proteins detected in the entire XBP1 s interactome at CT8. By contrast, at CTO when SON expression is the lowest, the amount of splicing proteins that XBP1 s interacts with is markedly reduced. The observed decreased recruitment of splicing proteins to XBP1 s at CTO is not due to reduced XBP1 s level itself, as the hepatic XBP1 s expression at CTO is in fact higher compared to CT8. These results thus reinforce the notion that nuclear speckles rejuvenation by SON OE is sufficient to amplify the global proteostasis transcriptional activation, likely via facilitating physical interactions between nuclear speckles and UPR TF like XBP1 s.
[0191] Compared to induced genes, much less is known about the gene programs that are repressed under ER stress. GO analysis indicate that those 901 repressed genes are strongly enriched in Hippo-YAP1 signaling that regulates the diverse biological processes of angiogenesis, axon guidance, epithelial to mesenchymal286693890. DOCXAttorney Docket No. 06527-2501864 transition (EMT), wound healing, cell adhesion, cell migration, and extra cellular matrix organization, with examples of canonical YAP1 target genes Bmp4, Tubal a, Fzd2, Tgfb3 and Yap1 itself and its transcriptional partner Tead2. YAP1 and TEAD2 were further predicted to be transcriptional regulators of these 901 genes via both LISA and motif analysis and nuclear YAP1 level was significantly reduced in response to either Tu or SON OE and further decreased upon the combination of the two. Scratch assays further confirmed that both SON OE and Tu significantly reduced cell migration in MEFs, with the lowest observed in SON OE cells under ER stress. To rule out the possibility that the global repression of YAP1 transcriptional output during ER stress is specific to MEFs or Tu, we further analyzed a recent transcriptome dataset in the human astrocytoma-derived LN-308 cell line in response to both Tu and thapsigargin (Thap) (another ER stress inducer) treatments, and observed a strong downregulation of genes involved in YAP1 signaling under both treatments that progressed with time. Together, our data indicates that the downregulation of YAP1 transcriptional output is an integral component of the global transcriptional response to proteotoxic stress, and it is also under nuclear speckles control.
[0192] Given the established roles of nuclear speckles in mRNA processing, we next investigated whether SON also regulates mRNA splicing dynamics. While SON manipulation has no effects on the overall transcriptional state of mature mRNA under basal DMSO condition (consistent with total mRNA), it exerted profound effects on the pre-mRNA level, indicating a change in splicing dynamics. By either estimating the relative splicing rates among different groups under basal condition using a simple first-order kinetic model of transcription (see Materials and Methods) or quantifying global intron retention events using the iRead algorithm, we found that SON increases the splicing rates and improves the splicing fidelity of genes involved in proteostasis and RNA metabolism, and negatively regulates those involved in YAP1 -related processes of cell migration, axon guidance, cell adhesion and EMT. The significant enrichment in mRNA processing genes themselves under SON control is consistent with known potent autoregulation of splicing factors. Furthermore, we also found that SON can activate and repress the mature mRNA expression of a select set of proteostasis (albeit very modestly) and YAP1 target genes, respectively, under basal DMSO conditions. Finally, we observed that SON can also activate an anti-viral response gene signature under basal DMSO condition, suggesting a potential broader implication of nuclear speckle rejuvenation in boosting innate immunity. Collectively,296693890. DOCXAttorney Docket No. 06527-2501864 our results demonstrated that genetically rejuvenating nuclear speckles reprograms global proteostasis and YAP1 transcriptional output in an opposing manner, under both basal and proteotoxic stress conditions in vitro.
[0193] An expanded proteostasis framework includes nuclear speckle and YAP1 .
[0194] To further confirm that the opposing dynamics of proteostasis gene expression and YAP1 transcriptional output also occur in vivo, we examined their temporal gene expression rhythms in mouse liver. In addition to proteostasis genes, which exhibit prevalent ~12h ultradian rhythms of expression as previously reported, we further identified fifty-three hepatic ~12h-cycling genes involved in Hippo-YAP1 signaling, including Yap1 , Bmp4, Axin2, and Fzd6 / 7 / 8. More importantly, while proteostasis genes (including XBP1 s itself) peak almost exclusively at CT2 and CT 14, many Hippo-YAP1 controlled genes, including nuclear YAP1 level itself, exhibit opposite phases peaking around CT6 and CT18. The anti-phase relationship between proteostasis and YAP1 target genes under physiological condition in vivo is in line with their opposing transcriptional responses to acute ER stress in vitro.
[0195] Our results thus far demonstrated a tripartite network where nuclear speckle rejuvenation by SON boosts proteostasis and suppresses YAP1. Two possible topologies of the network exist. In model one, nuclear speckles can signal both proteostasis and YAP1 signaling directly, while in model 2, nuclear speckles repress YAP1 downstream of increased proteostasis gene program. To distinguish between the two models, we examined a recently published RNA-seq dataset in HEK293T cells treated with DMSO, Thap or a very specific XBP1 s small molecule activator IXA4. While IXA4 can induce a robust proteostasis gene signature similar to that of Thap, it failed to repress YAP1 transcriptional output genes as Thap did. Collectively these results support the first model where nuclear speckles can program proteostasis gene expression and YAP1 transcriptional output in parallel, likely via promoting physical interaction between nuclear speckles and XBP1 s for the former, and triggering YAP1 nuclear exclusion for the latter. We speculate the opposing changes in proteostasis and YAP1 signaling may reflect an energetic trade-off between proteostasis and the control of cell dynamics, which could be essential for maintaining cellular functions in the presence of a fluctuating environment.
[0196] High-throughput screen (HTS) identified pyrvinium pamoate (PP) as a small-molecule rejuvenator of the nuclear speckle.306693890. DOCXAttorney Docket No. 06527-2501864
[0197] Having established the proof-of-principle of nuclear rejuvenation via SON OE, we next explore the feasibility of rejuvenating nuclear speckles pharmacologically, for two reasons. First, compared to the challenging implementation of SON-based gene therapy, which faces obstacles due to the considerable size (~7kb) of SON'S open reading frame, using small molecules to boost nuclear speckle activity may offer superior therapeutic potential. Secondly, we wanted to utilize an orthogonal approach to further demonstrate the opposing transcriptional changes of proteostasis and YAP1 signaling following nuclear speckle rejuvenation. Since SON OE and KD reduced and increased the sphericity of nuclear speckles 19, respectively, putative nuclear speckle rejuvenators are expected to reduce the sphericity (and increase the diffuseness or irregularity) of speckles.
[0198] We started with a library of over 2500 FDA-approved drugs and ran a primary HTS on our previously described EGFP::SC35 (SRSF2) MEFs (EGFP was knocked in to the N-terminus of endogenous Srsf2 locus, which is a well-established marker for nuclear speckles) to identify compounds that could alter nuclear speckles sphericity. As a quality control, our primary screen successfully identified four histone deacetylase inhibitors that produced much more spherical nuclear speckles approaching and / or exceeding r=0.9, in alignment with a previous study 40. In the end, we identified five compounds - the tyrosine kinase inhibitors nintedanib (NB) and ponatinib (PB), the anti-microbial proflavine hemisulfate (PH) and proflavine, and the anthelmintic pyrvinium pamoate (PP) - having the ability to both decrease nuclear speckles sphericity and amplify Perk-promoter driven dGFP expression (Perk is a UPR target and exhibits 12h rhythms of expression 3) in a dose-dependent manner (FIG. 1). For PP, the reduced sphericity (more irregularity) is also further associated with increased perimeter of nuclear speckles (FIG. 2), suggestive of a large surface area of nuclear speckles in the 3D space of the nucleus.
[0199] To determine which of these drugs are bona fide nuclear rejuvenators, we performed mRNA-232 Seq on MEFs treated with NB, PB, PH or PP for 24 hours and compared the transcriptome signature of each drug with those of SON OE and KD under both DMSO and Tu conditions. Gene set enrichment analysis (GSEA) using either those 461 Tu-induced or 901 Tu-repressed genes revealed PP as the only drug triggering a transcriptional response with strong resemblance to SON OE cells in response to ER stress. These included both upregulated genes implicated in protein quality control and downregulated genes involved in the regulation of cell dynamics316693890. DOCXAttorney Docket No. 06527-2501864(FIGS. 3-4). LISA analysis on differentially expressed genes by PP revealed bZIP TFs ATF4 and YAP1 among top transcriptional regulators of upregulated and downregulated genes, respectively. PP increased the expression of UPR and integrated stress response (ISR) TFs - XBP1 s and ATF4 - at both the mRNA and protein level and induced nuclear exclusion of YAP1 , while not affecting SON level.
[0200] Our analysis so far suggested the PP induced a transcriptional signature that resembles a mixture of responding to SON OE and Tu treatment. We performed additional comparative transcriptome analysis to further validate this conclusion. First, when comparing the fold induction or repression of gene expression by PP and Tu, the signature of PP is more similar to that of Tu under SON OE compared to under SON KD condition (p= 0.00195 by Chow tests). Secondly, similar to SON OE, PP also induced expression of genes involved in anti-viral response, distinct from those induced under ER stress. Thirdly, GSEA indicated a strong resemblance of gene signatures repressed by PP and SON OE that are enriched in the control of cell dynamics, under basal condition in the absence of ER stress. Lastly, like SON, PP also improves the splicing fidelity of splicing genes themselves, again reflecting autoregulation of splicing factors. Taken together, these results indicate that PP is a bona fide nuclear speckle rejuvenator that induces a transcriptional signature in MEFs highly similar to that of SON OE cells under both basal and proteotoxic stress conditions.
[0201] PP reduces the surface tension of nuclear speckle condensates via targeting SON IDR.
[0202] To confirm that PP rejuvenates nuclear speckles in an SON-dependent manner, we knocked down Son via siRNA in MEFs. Son knockdown leads to smaller and more spherical speckles, consistent with our previous study (FIG. 5). Importantly, PP’s ability to reduce nuclear speckle sphericity is abolished in Son knockdown MEFs (FIG. 5). Subsequently, Son knockdown impaired PP’s capacity to both activate protein quality control gene expression and repress YAP1 transcriptional output (FIG. 6). To determine whether PP can physically interact with SON in MEFs, we performed cellular thermal shift assay (CETSA), which is based on ligand-induced thermal stabilization of target proteins, whereas unbound proteins denature, aggregate and precipitate at elevated temperatures, ligand-bound proteins remain soluble due to increased stability. Using a SON-specific antibody, we found that PP induced a thermal shift of SON with a direction consistent with stabilization (FIG. 7). As negative326693890. DOCXAttorney Docket No. 06527-2501864 controls, we found that PP does not stabilize SRSF2 (SC35), another nuclear speckle protein, or the ISR / UPR TF ATF4, whose expression is nonetheless significantly increased by PP.
[0203] SON is the central scaffold protein of nuclear speckles, and its ~12h rhythmic concentration fluctuation drives ~12h rhythmic nuclear speckles LLPS dynamics and chromatin binding alternating between either a diffuse and chromatin- associated state or a punctate and chromatin-dissociated state. By contrast, SRSF2(SC35) is one of the critical subunits of the spliceosomes, which have a broader spatial distribution also occupying the periphery of nuclear speckles, particularly at the interface between nuclear speckles and the nucleoplasm or chromatin and is not essential for speckle formation. In MEFs, PP generated a more diffuse and irregular (less spherical) nuclear speckles with larger surface area (FIGS. 1-2), suggesting that PP could influence nuclear speckle LLPS dynamics, likely via reducing the surface tension of speckle condensates (surface tension is the tendency of liquid droplets to minimize the total surface area, therefore an increased surface area is suggestive of reduced surface tension). Given the CETSA data indicating PP can bind to SON directly, we next tested whether PP can directly impact the condensates formation of two nuclear speckle protein, SRSF2 and SON, using an in vitro droplet formation assay. Using different computational algorithms to search for intrinsically disordered domain (IDR), we identified two IDRs at the N and C terminals of mouse SON, and long stretches of IDRs spanning two-thirds of mouse SRSF2. We separately cloned the regions encoding both SON IDRs and the full-length SRSF2 into the C-terminal of mCherry and purified recombinant proteins from E. coli. Purified recombinant proteins were added to buffers containing 10% crowding reagents PEG-8000 as previously described. Confocal fluorescence microscopy of the different protein solutions revealed mCherry positive, micron-sized spherical droplets freely moving in solution and wetting the surface of the glass coverslip. All proteins droplets were highly spherical, exhibited fusion / coalescence behaviors, and scaled in size and number positively with increasing concentration of proteins and negatively with increasing salt concentration, all properties expected for liquid-like droplets.
[0204] Due to surface tension, small droplets will eventually morph into a fewer number of large droplets, resulting in a net decrease of surface area, either via coalescence or Ostwald ripening, which was seen for all protein droplets after 20 minutes of time lapse imaging. Addition of PP to SON IDR2, but not SON IDR1 and336693890. DOCXAttorney Docket No. 06527-2501864SRSF2 protein solutions, significantly reduced the kinetics of this process in a dosedependent manner, resulting in a negligible decrease of relative surface area after 20 minutes. The significance of SON IDR2 is reinforced by the substantial evolutionary conservation of its sequences across seven distinct species spanning wide phylogenetic distances from zebra fish to humans.
[0205] To better recapitulate the complex compositions of nuclear speckles, we further supplemented recombinant mCherry-SON IDR2 with nuclear extract (NE) from Hela cells that include all active components of transcription and splicing factors. Mass spectrometry confirmed that Hela NE-supplemented mCherry-SON IDR2 condensates preferentially compartmentalized splicing factors (including SRSF2), but not other nuclear proteins like proteasome subunits, DNA repair factors or general transcription factors. These condensates further exhibited less spherical morphology, had increased number and total size, features expected from nuclear speckle-like condensates with inhomogeneous viscoelastic properties. Importantly, addition of PP reduced both the sphericity and surface tension of Hela NE-supplemented SON IDR2 condensates in a dose-dependent manner (FIGS. 8-9), consistent with the effects of PP on nuclear speckle morphology in cells. Together, these data suggest that PP can reduce the surface tension to stabilize both homotypic and heterotypical NE- supplemented SON condensates in a cell-free system, via interacting with SON C- terminal IDR2.
[0206] To investigate whether PP may affect the relative spatial distribution of SON and SRSF2 within nuclear speckles, we further supplemented recombinant mCherry-SON IDR2 with NE from GFP::SRSF2-expressing MEFs. The resulting nuclear speckle-like condensates recapitulated the anticipated spatial distribution of SON and SRSF2 proteins, with the former located at the center, and the latter exhibiting a broader distribution with its highest concentration often observed at 350nm away from the SON IDR2 center. While PP does not alter the relative spatial distribution of SON IDR2 and SRSF2, it reduced their sphericity, and markedly increased SRSF2 content at the periphery of nuclear speckle-like condensates (FIG. 10). To determine whether PP may also influence the wetting of genomic DNA by nuclear speckles, we further added mouse genomic DNA into the droplet solution. In accordance with observations in intact cells, nuclear speckle condensates largely don’t mix with, but can wet the DNA. Interestingly, the addition of PP more than doubled the wetting of genomic DNA by the reconstituted nuclear speckles.346693890. DOCXAttorney Docket No. 06527-2501864
[0207] To validate that PP can alter the nuclear speckle LLPS properties in vitro in the context of intact cells, we further performed 1 ,6 hexanediol sensitivity assay using the same EGFP::SRSF2 MEFs. A short term 1 ,6 hexanediol treatment preferentially dissolves liquid but not solid condensates, thus a change in the sensitivity to 1 ,6 hexanediol reflects an alteration in the LLPS property of a given condensates. As demonstrated, PP desensitized SRSF2 to increasing concentrations of 1 ,6 hexanediol. This effect was not observed on two other biomolecular condensates, the nuclear MED1 50 and cytosolic GW182 present in P-345 bodies. Taken together, these results suggest a mechanism where PP can reduce the surface / interfacial tension of nuclear speckles via targeting SON IDR, leading to larger surface areas with increased SRSF2 content at the periphery, increased wetting of genomic DNA and subsequently a higher portion of spliceosomes stably engaging in active RNA processing and transcription elongation of proteostasis genes. Since no active transcription occurs in the in vitro droplet formation assay, these results demonstrate that PP-mediated nuclear speckle LLPS change is a cause, rather than a consequence of or response to, global transcriptional reprogramming.
[0208] PP reduces both pathological Tau and rhodopsin levels by boosting ALP and UPS, at the expense of YAP1 signaling.
[0209] Since PP treatment leads to a global increase of protein quality control gene expression, we went on to determine the effects of PP on global protein synthesis, and degradation via ALP and UPS in MEFs. Using puromycin incorporation assay, we found that in spite of increased expression of many mRNAs involved in ribosome biogenesis and translation (FIG. 4), PP elicited a repression of global protein synthesis, an observation consistent with the activation of the ISR. To quantify the UPS activity, we treated MEFs with PP alone or in combination with the proteasome inhibitor MG132 and blotted for high molecular weight poly-ubiquitinated proteins. PP led to a significant reduction of poly-ubiquitinated protein levels, and co-treatment with MG1 32 caused a one-fold increase of their level, while under vehicle condition, only a very small (statistically not significant) increase was observed. These data collectively indicated that PP increases UPS-mediated degradation of poly-ubiquitinated protein. To measure autophagic flux, we blocked autophagy at the late stage autophagosomelysosome fusion step using Bafilomycin A1 (BafA), and quantified the level of LC3I and LC3II with or without PP. PP treatment resulted in an increased ratio of LC3II / I and reduced level of LC3II, both of which were significantly increased by BafA co-356693890. DOCXAttorney Docket No. 06527-2501864 treatment to a level similar or higher than what was observed under DMSO condition (FIGS. 11-12). These results indicate that PP also augments autophagic flux. In sum, these results revealed that PP represses global protein synthesis while promoting both ALP and UPS.
[0210] Decline of both ALP and UPS are associated with proteinopathies such as Alzheimer's disease (AD), frontotemporal dementia (FTD), Parkinson’s disease (PD) and a subtype of Retinitis pigmentosa (RP) with RHODOPSIN (RHO) mutations. To determine whether PP can protect against proteinopathies via boosting UPS and / or ALP, we focused on two different diseases, a genetic form of RP with a mutant RHO, and tauopathy common in both AD and FTD. RP causes blindness via the primary loss of rods and secondary loss of cones. Proline to histidine at codon 23 (P23H) is the most common mutation in RHO protein, resulting in autosomal dominant RP in humans. The heterozygous RhoP23H / + knock-in mouse develops progressive retinal degeneration that resembles the RP phenotype in patients. Recently, several studies suggested that boosting ERAD can protect against mouse models of RP by increased elimination of the mutant RHOP23H protein. To determine if PP can also reduce RHOP23H level, we used a NIH3T3 cell line ectopically expressing RHOP23H protein 69. Treating this cell line with 0.1 pM of PP for 24 hours led to a reduction of both monomer and dimer forms of RHOP23H protein in an SON-dependent manner (FIGS. 13-14. Blocking the UPS, and to a lesser degree autophagy, abolished the effect of PP on reducing RHOP23H protein level, suggesting that increased ERAD / UPS is likely mainly responsible for the increased elimination of RHOP23H by PP.
[0211] Both UPS and ALP are involved in the degradation of tau protein in tauopathies. To test the effect of PP on tau proteostasis in mouse primary neuronal cultures, we overexpressed human Tau carrying P301 S mutation - an FTD-causing mutation in the human MAPT gene (Tau). After treatment with increasing concentrations of PP for 24 hours, a decline in both total and phosphorylated Tau (Ser396 / 404) was observed in a dose-dependent manner, with approximately 50% and 65% reduction in total and p-Tau, respectively, detected at 100nM PP. It is noteworthy that these reductions in Tau level occurred without any observable signs of cellular toxicity. PP also promoted autophagic flux in neurons, as demonstrated by an increase of LC3 ll / l ratio, decreased level of p62 / SQSTM1 and increased autolysosome formation assayed with a duo-fluorescent autophagy reporter. Blocking autophagic flux with BafA dampened the effects of PP on reducing cellular Tau level.366693890. DOCXAttorney Docket No. 06527-2501864As observed in fibroblasts, PP also promoted UPS activity in neurons; however, inhibiting proteasome activity with MG132 has minimal effects on PP’s ability to reduce Tau level. Consistent with PP’s ability to boost UPS and ALP, PP increased the expression of genes involved in both pathways in P301 S hTau-expressing neurons. Collectively, these results indicate that increased autophagy flux largely underlies PP’s effect in reducing Tau burden in neurons. 407
[0212] Nuclear speckle rejuvenation by SON OE or PP increases global protein quality control at the cost of reduced YAP1 signaling in both MEFs (FIG. 6) and neurons, raising an interesting question of whether the downregulation of YAP1 signaling also contributed to PP’s efficacy in alleviating proteinopathy. To address this question, we restored YAP1 signaling with previously published YAP1 activators XMU- MP-1 and / or TRULL We found that while XMU-412 MP-1 antagonized the downregulation of YAP1 target genes by PP as expected, it also potently dampened the upregulation of proteostasis genes. In addition, XMU-MP-1 negated PP’s effect on reducing RHOP23H level in NIH3T3 cells. Similarly, TRULI also dampens PP’s effect on reducing Tau level in primary neurons. These results suggest that for nuclear speckle rejuvenation to achieve the maximum effectiveness in alleviating proteinopathy, it is essential to simultaneously uphold heightened protein quality control and reduced YAP1 activity.
[0213] PP protects against mouse retina degeneration ex vivo and alleviates tauopathy in Drosophila.
[0214] Next, we assessed the effectiveness of PP in ameliorating proteinopathies by utilizing animal models of RP and tauopathy. To determine whether PP has the potential to restore gene expression changes in the retina of RhoP23H / + mice, we performed RNA-seq in the retina of one and three months old wild-type and RhoP23H / + mice and compared the gene signatures of RhoP23H / + retina with that of PP. In the retina of one month-old RhoP23H / + mice, we observed a significant downregulation of protein transport and autophagy gene expression that showed large convergence with those upregulated by PP. This includes Reep6 gene, which regulates protein trafficking in the ER and its loss-of-function mutation causes autosomal-recessive RP in both humans and mice. By three months, the downregulation of proteostasis gene expression persists in RhoP23H / + mice retina, concomitant with a significant increase of YAP1 -mediated cell dynamics gene expression that also overlaps with PP-downregulated genes. To directly tested the376693890. DOCXAttorney Docket No. 06527-2501864 efficacy of PP in protecting against RP, we treated retina explants isolated from RhoP23H / + mice with nanomolar range of PP for 10 days, and visible light optical coherence tomography (vis-OCT) imaging revealed a remarkable efficacy of PP in safeguarding the mouse RhoP23H / + retina explants from degeneration. Notably, the cell counts in the outer nuclear layer closely resembled that of the WT retina explant control (FIGS. 15-19), indicating the protective potential of PP against degenerative processes. Moreover, no noticeable indications of toxicity were observed throughout the entire duration of the experiment, further highlighting the safety profile of PP as a promising therapeutic candidate.
[0215] Pan-neuronal expression of wildtype human MAPT gene in Drosophila recapitulates essential features of tauopathies, including hyperphosphorylated and misfolded tau, age-dependent neuron loss, and reduced life span, and SON IDR2 is also conserved in flies. Thus, we next tested the efficacy of PP in ameliorating tauopathy in flies that express 2N4R 444 isoform of human Tau (MAPT) pan- neuronally [elavc155-Gal4: UAS-hTau1.13 (C155>UAS-hTau1 .13)] as well as in control elav c155-Gal4 (C155) flies. Both C155>UAS-hTau1 .13 and C155 flies were fed with either standard diet or diet supplemented with 25pM PP, which did not affect the normal development and growth of flies despite its effect in attenuating WNT and YAP1 signaling. We quantified disease progression at different stages of fly development with both larval crawling and adult fly climbing assay at 14 and 21 days of age. PP feeding preserved motor function in C155>UAS-hTau1 .13 third instar larvae and adult flies, with their locomotor performance restored to a level similar to or even slightly higher than control C155 flies fed with a standard diet. Notably, PP also enhanced the motor function of adult wild-type control (C155) flies at 21 days of age. This improvement is likely linked to PP's ability to promote overall proteostasis, particularly protein turnover rates, a process known to prolong health and lifespan in flies. Consistent with the overall phenotypes, PP significantly reduced the level of p- Tau and to a lesser extent total Tau in the brains of C155>UAS-hTau1 .13 flies. Since p-Tau are prone to misfolding and aggregation, it supports the notion that PP is increasing the overall capacity of protein quality control to remove misfolded and aggregated proteins, while having negligible effects on normal protein functions.
[0216] PP has the potential for treating tauopathy in humans.
[0217] To determine the potential of PP for treating tauopathy in humans, we studied whether gene expression signatures that are opposite of PP can be observed386693890. DOCXAttorney Docket No. 06527-2501864 in brain regions of human subjects with AD. We initially performed a post-hoc analysis of a total of nineteen bulk RNA-seq datasets encompassing hippocampus, entorhinal cortex, temporal cortex and frontal cortex regions in control and AD human subjects, and found that genes repressed by PP have increased expression in all four brain regions of human subjects with AD (such as YAP1 , TEAD1 and AMOT). By contrast, genes that were upregulated by PP displayed significantly decreased expression in temporal cortex (such as genes involved in ERAD: EDEM1 , SEL1 L, autophagy: ATG1 3, protein folding: HYOU1 , and tRNA aminoacylation: GARS, IARS). To validate these findings, we further analyzed an independent single-nucleus RNA-seq (snRNA- Seq) dataset in the prefrontal cortex regions of human individuals with varying degrees of AD pathology. We found that proteostasis genes upregulated by PP are consistently downregulated in all cell types with strong prominence in neurons and oligodendrocytes in both early and late-stage human AD subjects. Genes that are downregulated by PP (those enriched in regulation of cell dynamics by YAP1 ) are initially downregulated in all cell types in the early stage but significantly upregulated during the late stage of AD in all cell types but inhibitory neurons. This early to late AD progression is concomitant with strong increase of tauopathy, but not amyloid burden in these individuals. Consistent with in vivo data, we also observed a significant decrease of proteostasis gene expression as well as an increase of YAP1 -TEAD2 target gene expression in human induced pluripotent stem cells (iPSC)-derived neurons that express the P301 S 4R-Tau when compared to wild-type 4R-Tau control cells. These upregulated YAP1 -TEAD2 target genes also overlap with those repressed by PP.
[0218] Finally, to directly test the efficacy of PP in reducing tauopathy in human, we utilized human iPSC-neurons harboring homozygous FTD-causing MAPT V337M mutation (herein referred to as V337M) and isogenic wild-type control cells and treated both cell lines with nanomolar range of PP for 12 hours. Immunofluorescence against nuclear speckles marker SRRM2 revealed that compared to controls, V337M iPSC- neurons exhibited aberrant nuclear speckle morphology characterized by smaller size and more spherical shape, and PP treatment fully restored nuclear speckle morphology to normal size and diffuseness. Consequently, PP markedly reduced the level of p-V337M Tau via boosting the autophagic flux. Together, these findings indicate that PP treatment has great potential to normalize gene expression patterns and reduce Tau burden in AD / ADRD-affected humans with severe tauopathy. Further,396693890. DOCXAttorney Docket No. 06527-2501864 these results provide strong support for the decline of nuclear speckles LLPS dynamics (becoming smaller and more spherical) as a driver of tauopathy.
[0219] PP is a HORMINAM.
[0220] Taken together, our results indicate that the effects of PP are two-pronged. First, PP can induce modest stress to cells, likely due to its reported ability to trigger mitochondrial stress by increasing ROS levels and impeding mitochondrial functions. Mitochondria stress can activate the ISR and ATF4 activation, which likely explains the strong induction of ATF4 protein level by PP. Secondly, our new data showed that by directly binding to SON and reducing the surface / interfacial tension of nuclear speckles and promoting their wetting of DNA, PP is a bona fide nuclear speckle rejuvenator capable of amplifying the stress response at the transcriptional level, entailing both the upregulation of global protein quality control gene expression and downregulation of YAP1 -mediated genes underlying cellular dynamics. In light of the dual effects of PP, we tentatively name it as a Hormesis Initiator and Amplifier (HORMINAM), a new class of compounds capable of both initiating and amplifying the hormetic response. A key characteristic of HORMINAM is its capacity to trigger a significantly stronger stress response relative to the actual stress it exerts, similar to the effect of SON OE in the presence of Tu. Our reclassification of PP as a HORMINAM thus reconciles the two previously known effects of PP: inducing mitochondrial stress and inhibiting YAP / WNT signaling. Intriguingly, a recent study using unbiased whole genome CRISPR screen to identify pyrvinium-genetic interactions revealed that knocking out spliceosome genes sensitized cells to pyrvinium-induced cell death. Although the underlying mechanism for this observation was not addressed, our study herein provides a scientifically sound rationale for this observation: knocking out spliceosome genes abolishes the stress responseamplifying effect of pyrvinium without affecting its stress-inducing ability. The absence of a robust stress response following exposure to stress is anticipated to render cells more susceptible to cell death. It is important to recognize that while pyrvinium acts as both a nuclear rejuvenator and HORMINAM, these concepts are independent of each other. It is conceivable that novel compounds could function solely as a HORMINAM without affecting nuclear speckle LLPS, or vice versa.Discussion
[0221] Several recent studies indicate that both the decline of nuclear speckle functions and dysregulated mRNA splicing are associated with proteinopathies in406693890. DOCXAttorney Docket No. 06527-2501864 humans, including both tauopathy and RP. For example, two studies showed that elevated Tau aggregates have the capability to relocate to the nucleus, thereby directly modifying the characteristics of nuclear speckles. In agreement with this study, a recently published Tau interactome in human iPSC neurons also revealed strong enrichment of Tau-interacting proteins involved in regulating RNA splicing and RNA stability. Additionally, it was previously shown that cryptic splicing errors is associated with neurofibrillary tangle burden in human AD subjects. In humans, among the 12 autosomal dominant RP genes identified, four encode ubiquitously expressed proteins involved in pre-mRNA splicing (including PRPF31 , PRPF8, PRPF3 and RP9), demonstrating the important roles of RNA processing in the pathogenesis of retinal degeneration. These studies thus provide the rationale for nuclear speckle rejuvenation as a strategy for counteracting various proteinpathies.
[0222] Exploring the therapeutic potential of targeting biomolecule condensates represents an exciting avenue for research and drug development. Our study serves as a proof-of-principle showing that nuclear speckle LLPS can also be therapeutically targeted. Manipulating nuclear speckle LLPS through SON overexpression is a conceptually viable approach. However, the practical implementation of this strategy presents significant challenges due to the large size of the human SON open reading frame, making it technically difficult to design gene therapy targeting SON. That said, we cannot rule out the possibility that overexpression of specific truncated SON domains, such as SON IDR2, may be sufficient to rejuvenate nuclear speckles, and future efforts will be directed toward exploring such possibilities.
[0223] Through a high-throughput drug screen, we identified PP as a small nuclear speckle rejuvenator by directly interacting with SON and modulating nuclear speckle LLPS dynamics. Interestingly, pyrvinium is enriched with cationic amines and aromatic motifs, chemical features that were predicted to partition into various nuclear condensates. PP was originally developed as an anthelmintic drug effective for treating pinworm infections. Moreover, it has gained strong recent interest as an anticancer reagent due to its ability to inhibit WNT signaling. Our current study further expands its therapeutic values to proteinopathies, including both reducing tauopathy in neurons and flies and protecting against retina degeneration in an ex vivo mouse RP model. Future efforts should be directed toward testing the toxicity and efficacy of this drug in mouse models of neurodegenerative diseases. The possibility for the latter is made even more tantalizing due to its ability to cross blood brain barriers in mice.416693890. DOCXAttorney Docket No. 06527-2501864
[0224] While we don’t yet know the full detailed mechanisms by which PP modulates nuclear speckles dynamics and boost proteostasis gene transcription, several lines of evidence suggest that it does so in part by reducing the surface tension and consequently increasing the surface areas of nuclear speckles via an SON- dependent manner. Our in vitro reconstitution system further showed that reduced nuclear speckles surface tension by PP further facilitates nuclear speckles wetting of chromatin. Thus, since spliceosomes reside at the interfacial boundary between nuclear speckles and nucleoplasm / chromatin, larger surface areas also entails a higher probability of spliceosome stably engaging in mRNA processing and transcription elongation. The mechanism by which PP reduces the surface tension of nuclear speckles is not yet fully understood. While the straightforward explanation would be that PP acts as a surfactant, this seems unlikely due to its lack of hydrophilic moieties. Alternatively, it is plausible that by interacting with SON, PP weakens the intermolecular attractive interactions among different SON proteins, and / or SON and IDRs of other nuclear speckle proteins due to screening effects, leading to an overall reduction of surface tension of nuclear speckles, similar to what is previously described for the effect of increasing salt concentration on reducing surface tension for protein condensates. The positive charge carried by pyrvinium adds to the allure of this hypothesis. Further research is needed to elucidate the precise mechanisms by which PP influences the surface tension of nuclear speckles.
[0225] Genetic and pharmacological rejuvenation of nuclear speckles by SON and pyrvinium share similar transcriptome signatures, including upregulation of extensive protein quality control gene expression, and intriguingly, downregulation of YAP1 - regulated genes involved in cell migration, cell proliferation, would healing, and extracellular matrix organization. The contrasting changes in proteostasis and YAP1 - mediated cell dynamics gene expression are observed in various cell lines under proteostatic stress. Consequently, both SON overexpression and ER stress impeded cell migration. Additionally, the expressions of these genes follow anti-phasic ~12h ultradian rhythms in mouse liver under normal physiological conditions. These findings demonstrate that YAP1 signaling is an inherent component of global transcriptional control of proteostasis. One possible explanation for this phenomenon is that cells need to allocate their energy towards enhancing overall proteostasis, which may come at the cost of cell proliferation, migration, and extracellular matrix organization. Therefore, an energetic trade-off between proteostasis and cell dynamics control could426693890. DOCXAttorney Docket No. 06527-2501864 be crucial for maintaining cellular functions when faced with fluctuating environments, such as proteotoxic and ER stress.
[0226] Nuclear speckles play a vital role in coordinating the opposing changes observed in proteostasis and cell dynamics regulation. Elevated SON expression facilitates increased physical interactions between nuclear speckles and XBP1 s, leading to augmented transcription of proteostasis genes. Since the number of proteostasis genes under the control of SON surpasses those directly regulated by XBP1 s, we postulate that nuclear speckles can be recruited to additional proteostasis bZIP TFs upon rejuvenation, possibly via increased wetting between nuclear speckle and TF-mediated condensates. Future work with unbiased profiling of nuclear speckle composition (via proximity labeling for example) can unveil the detailed molecular mechanisms through which nuclear speckle rejuvenation globally activates the proteostasis gene program. On the other hand, much less is clear on how nuclear speckle rejuvenation represses YAP1 transcription activity. Upon SON overexpression and pyrvinium treatment, we found significantly reduced level of nuclear YAP1 protein and a lower nucleus / cytosol ratio, indicating an active nuclear exclusion of YAP1 protein. Like nuclear speckles, YAP1 can also form biomolecular condensates, and a recent study reported that YAP1 nuclear condensates and the nuclear speckles showed limited nuclear co-localization, suggesting a low level of wetting of these two condensates under normal physiological conditions. Pending further investigation, we speculate herein that nuclear speckle rejuvenation may further reduce the wetting of these two condensates, resulting in the alteration of YAP condensate composition, and ultimately its nuclear exclusion.
[0227] While both proteostasis and YAP1 signaling are downstream of nuclear speckles, direct antagonistic reciprocal interactions between these two are likely to be present as well. A recent study reported that in Drosophila, the proteostasis output gene Bip can sequester the fly YAP1 ortholog Yorkie, in the cytoplasm to restrict Yorkie transcription output. Conversely, in undifferentiated pleomorphic sarcoma, YAP1 can suppress PERK and ATF6-mediated UPR target expression, and treatment with the YAP1 inhibitor Verteporfin upregulated the UPR and autophagy. The latter is further consistent with our findings showing that restoring YAP1 activity dampened the efficacy of PP on activating protein quality control gene expression and reducing proteinopathies. These findings indicate that in order to maximize the effectiveness of nuclear speckle rejuvenation, it is crucial to maintain elevated levels of protein quality436693890. DOCXAttorney Docket No. 06527-2501864 control while simultaneously reducing YAP1 activity. Thus, a delicate balance between protein quality control and YAP1 activity appears essential for effective nuclear speckle rejuvenation. This observation may also explain why therapies merely aimed at activating protein quality control pathways often have limited efficacies. Supporting this notion, while reduced expression of genes involved in ERAD and autophagy are observed in the brains of individuals with AD, these subjects also exhibit elevated gene expression of YAP1 , TEAD1 , and other YAP1 target genes, consistent with previous studies. Increased YAP1 target gene expression was further observed in human iPSC tauopathy model as well as in the retina of Rho P23H / + mice. These results collectively highlight the importance of suppressing YAP1 signaling as a potential strategy for managing both AD and RP.
[0228] In conclusion, our study makes substantial conceptual contributions to the broader proteostasis framework by incorporating nuclear speckle LLPS and YAP1 signaling as critical components. From a translational perspective, our research unveils the promising therapeutic potential of nuclear speckle rejuvenation in tackling proteinopathies, achieved by simultaneous activation of protein quality control and inhibition of YAP1 activity. Additionally, our findings underscore the significance of harnessing the 12-hour oscillator to unveil hidden principles of proteostasis control.
[0229] The present invention has been described with reference to certain exemplary embodiments, dispersible compositions and uses thereof. However, it will be recognized by those of ordinary skill in the art that various substitutions, modifications or combinations of any of the exemplary embodiments may be made without departing from the spirit and scope of the invention. Thus, the invention is not limited by the description of the exemplary embodiments.446693890. DOCX
Claims
Attorney Docket No. 06527-2501864THE INVENTION CLAIMED IS1 . A method of treating a condition associated with nuclear speckle sphericity in a patient, comprising administering to the patient an amount of a composition comprising a nuclear speckle rejuvenator effective to reduce nuclear speckle sphericity in the patient.
2. The method of claim 1 , wherein the nuclear speckle rejuvenator is pyrvinium or a pharmaceutically acceptable salt or derivative thereof.
3. The method of claim 2, wherein the nuclear speckle rejuvenator is pyrvinium pamoate.
4. The method of claim 1 , wherein the nuclear speckle rejuvenator increases expression of SON and / or serine / arginine repetitive matrix 2 (SRRM2) in the patient.
5. The method of claim 1 , wherein the nuclear speckle rejuvenator increases organization of nuclear speckles in the patient.
6. The method of claim 1 , wherein the condition is a proteinopathy.
7. The method of claim 1 , wherein the patient has Alzheimer’s Disease (AD), Parkinson’s Disease (PD), frontotemporal dementia (FTD), and / or retinitis pigmentosa (RP).
8. The method of claim 1 , wherein the patient has RP.
9. The method of claim 8, wherein the patient has a mutation in in the RHO ene.
10. The method of claim 9, wherein the mutation comprises a P23H substitution.11 . The method of claim 7, wherein the nuclear speckle rejuvenator is administered by instillation.456693890. DOCXAttorney Docket No. 06527-250186412. The method of claim 1 1 , wherein the composition comprises an ophthalmic preparation comprising pyrvinium or a pharmaceutically acceptable salt or derivative thereof.
13. The method of claim 12, wherein the ophthalmic preparation comprises the pyrvinium or pharmaceutically-acceptable salt or derivative thereof at a concentration ranging from 10nM to 10pM.
14. The method of claim 13, wherein the ophthalmic preparation comprises the pyrvinium or pharmaceutically-acceptable salt or derivative thereof at a concentration ranging from 0.2-0.5 pM.
15. The method of claim 1 , wherein the composition is administered to the patient intravitreally.
16. A method of treating retinitis pigmentosa in a patient, comprising administering to the patient a composition comprising pyrvinium or a pharmaceutically- acceptable salt or derivative thereof in an amount effective to treat retinitis pigmentosa in the patient.
17. The method of claim 16, wherein the patient has a mutation in in the RHO ene.
18. The method of claim 17, wherein the mutation comprises a P23H substitution.
19. The method of claim 16, wherein the composition comprises pyrvinium pamoate.
20. The method of claim 19, wherein the composition comprises an ophthalmic preparation.21 . The method of claim 16, wherein the composition is administered to the patient intravitreally.
22. An ophthalmic or intravitreal preparation comprising pyrvinium or a pharmaceutically-acceptable salt or derivative thereof and a pharmaceutically- acceptable excipient.466693890. DOCXAttorney Docket No. 06527-250186423. The ophthalmic preparation of claim 22, wherein the pyrvinium or pharmaceutically-acceptable salt or derivative thereof is included at a concentration ranging from 10nM to 10pM.
24. The ophthalmic preparation of claim 23, wherein the pyrvinium or pharmaceutically-acceptable salt or derivative thereof is included at a concentration ranging from 0.2-0.5 pM.476693890. DOCX