Agents for treatment of optic conditions

Abstract

The present disclosure provides a method of treating retinitis pigmentosa type 11 (RP11) comprising administering to the eye of a subject a conjugate comprising a cell penetrating peptide (CPP) and an antisense oligonucleotide that modifies pre-mRNA splicing in the CNOT3 gene transcript and / or increases expression of a PRPF31 protein. Also disclosed are related pharmaceutical compositions and formulations thereof.

Description

[0001] AGENTS FOR TREATMENT OF OPTIC CONDITIONS RELATED APPLICATION DATA

[0002] This application claims priority to Australian Provisional Patent Application 2024903392 filed on 21 October 2025, the contents of which are incorporated by reference in their entirety herein.

[0003] TECHNICAL FIELD

[0004] The present invention relates to methods of treating optic conditions using a conjugate comprising a cell-penetrating peptide (CPP) and an antisense oligonucleotide that modifies pre-mRN A splicing in the CNOT3 gene transcript and / or increases expression of a PRPF31 protein.

[0005] BACKGROUND

[0006] Retinitis pigmentosa (RP) is degenerative eye disease that causes severe vision impairment due to the progressive degeneration of the rod photoreceptor cells in the retina; most cases of RP are inherited. This form of retinal dystrophy manifests initial symptoms independent of age; thus, RP diagnosis occurs anywhere from early infancy to late adulthood. RP is a rare disease that affects approximately one out of 4000 individuals (more than 1.5 million people worldwide). Of the familial RP cases, 30%-40% show autosomal-dominant genetic inheritance (Hartong et al. 2006). There is currently no treatment for RP.

[0007] RP is caused by mutations in more than 50 genes. Heterozy gous mutations in the PRPF31 gene cause autosomal dominant retinitis pigmentosa (adRP). In some cases, such mutations display incomplete penetrance, wherein certain carriers develop retinal degeneration while others have no symptoms at all. Asymptomatic carriers are protected from the disease by a higher than average expression of the PRPF31 allele that is not mutated.

[0008] At the present time, AAV mediated gene replacement and CRISPR / Cas9 gene editing are being explored as therapies for retinal disease. While the coding sequence of PRPF31 is within the capacity of AAV vectors, the consequences of unregulated or over-expression of PRPF31 are unknown. In addition, it is not known if ocular viral mediated gene therapies could be re-administered, since seroconversion as a consequence of intraocular viral vector injection has been reported. Furthermore, CRISPR / Cas9 gene correction will require a different product for each family’s PRPF31 mutation. In addition, both the gene replacement and gene editing approaches require subretinal injection of viral vectors to achieve adequate transfection. Based on the foregoing it will be apparent to the skilled person that there is a need to provide new treatments or preventative measures for treating eye conditions such as retinitis pigmentosa.

[0009] SUMMARY

[0010] In producing the present invention, the inventors administered a conjugate comprising a CPP linked to an antisense oligonucleotide (ASO) that modifies pre-mRNA splicing in the CNOT3 gene transcript and / or increases expression of a PRPF31 protein to a subject and demonstrated a lasting therapeutic benefit to the subject in treatment of an optic condition.

[0011] For example, the inventors administered the conjugate intraocularly, such as, intravitreally to subjects thereby treating the optic condition.

[0012] For example, the inventors administered the conjugate every 2-8 months, for example, every' 2-6 months, such as every' 3 months to subjects thereby treating the optic condition.

[0013] For example, the inventors administered the conjugate at a fixed dose. For example, the inventors administered 20pg to 80pg, for example 30pg or 75pg to each eye of the subject, thereby treating the optic condition.

[0014] As exemplified herein, the inventors demonstrated that intravitreal administration of 30pg or 75pg of the conjugate is sufficient to improve the symptoms of RP, e.g., RP type 11 (RP11).

[0015] The present disclosure provides a method of treating retinitis pigmentosa type 11 (RP11) comprising administering to the eye of a subject a conjugate comprising a cell penetrating peptide (CPP) and an antisense oligonucleotide that modifies pre-mRNA splicing in the CNOT3 gene transcript and / or increases expression of a PRPF31 protein.

[0016] For example, the method comprises administering the conjugate to intravitreally. For example, the method comprises administering a fixed dose of the conjugate to the eye of the subject.

[0017] For example, the method comprises administering between 20pg-80pg of the conjugate to the eye of the subject. For example, the method comprises administering 30pg or 75 pg of the conjugate to the eye of the subject.

[0018] In one example, the method comprises administering multiple doses of the conjugate to the subject. For example, each dose of the multiple doses is administered at least 2 weeks apart. For example, each dose of the multiple doses is administered between 2 and 8 weeks apart. For example, each dose of the multiple doses is administered 2 weeks apart. For example, each dose of the multiple doses is administered 3 weeks apart. In one example, the CPP in the conjugate comprises or consists of the sequence set forth in SEQ ID NO: 1. For example, each amino acid in the CPP (other than glycine) is a D amino acid.

[0019] In one example, the ASO in the conjugate comprises or consists of the sequence set forth in SEQ ID NO: 2. For example, the ASO comprises a backbone modification comprising a phosphorothioate linkage or a phosphorodiamidate linkage or wherein the antisense oligonucleotide comprises a phosphorodiamidate morpholino linkage.

[0020] In one example, the ASO is a phosphorodiamidate morpholino oligonucleotide.

[0021] In one example, retinitis pigmentosa, e.g., RP11.

[0022] In one example, following administration of the conjugate, the subject shows improved low luminance visual acuity and / or improved microperimetry and / or a reduced number of scotomas. For example, the subject shows improved low luminance visual acuity and / or improved microperimetry and / or a reduced number of scotomas for at least 2 to 8 weeks following each administration of the conjugate.

[0023] The present disclosure also provides a method of treating retinitis pigmentosa, the method comprising administering intravitreally administering to the eye a subject 30pg or 75 pg of a conjugate comprising a cell penetrating peptide comprising or consisting of a sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide comprising the sequence set for in SEQ ID NO: 2.

[0024] The present disclosure also provides a method of treating retinitis pigmentosa, the method comprising administering intravitreally administering to the eye of a subject multiple doses of a conjugate comprising a cell penetrating peptide comprising or consisting of a sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide comprising the sequence set for in SEQ ID NO: 2, wherein each dose comprises 30pg or 75pg of the conjugate and wherein each dose of the multiple doses is administered between 2 to 6 weeks apart.

[0025] The present disclosure also provides a container comprising an amount of a conjugate comprising a cell penetrating peptide comprising or consisting of a sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide comprising the sequence set for in SEQ ID NO: 2 sufficient to administer 30pg or 75pg of the conjugate to the subject.

[0026] In one example, the container is a vial or a prefilled syringe.

[0027] The present disclosure also provides a pharmaceutical composition comprising: (i) a conjugate comprising a cell penetrating peptide the amino acid sequence of which comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which comprises or consists of the sequence set forth in SEQ ID NO: 2; and (ii) a physiological buffer effective to maintain the pharmaceutical composition at pH within a pH range of 6.0 to 7.0.

[0028] The present disclosure also provides a pharmaceutical composition comprising: i) a conjugate comprising a cell penetrating peptide the amino acid sequence of which comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is aD amino acid and a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which comprises or consists of the sequence set forth in SEQ ID NO: 2; and

[0029] (ii) a phosphate buffer effective to maintain the pharmaceutical composition at pH within a pH range of 6.0 to 7.0.

[0030] In some examples a pharmaceutical composition disclosed herein has an osmolality from 288 to 292 mOsm / kg.

[0031] In some examples the pharmaceutical composition has a purity when stored at 5 °C for between 1 month to 24 months of 99% or greater as determined by high performance liquid chromatography with ultraviolet detection (HPLC-UV).

[0032] In some examples the pharmaceutical composition also includes a tonicity modifier. In one example the tonicity modifier is sodium chloride.

[0033] In some examples the amino acid sequence of the cell penetrating peptide consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and the nucleotide sequence of the phosphorodiamidate morpholino oligonucleotide consists of the nucleotide sequence set forth in SEQ ID NO: 2.

[0034] The present disclosure also provides a lyophilized composition comprising a cell penetrating peptide the amino acid sequence of which comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which comprises or consists of the sequence set forth in SEQ ID NO: 2. In some examples examples the amino acid sequence of the cell penetrating peptide consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and the nucleotide sequence of the phosphorodiamidate morpholino oligonucleotide consists of the nucleotide sequence set forth in SEQ ID NO: 2. In some examples of a method, pharmaceutical composition, or lyophilized composition of the disclosure the conjugate corresponds to the structure of formula VP-001 as set forth in figure 5.

[0035] In some examples of a method, pharmaceutical composition, or lyophilized composition of the disclosure the conjugate comprises a flexible linker linking the CPP to the phosphorodiamidate morpholino oligonucleotide, preferably wherein the amino acid sequence of the flexible linker only includes D-amino acids. In some examples the C-terminus of the CPP is linked to the 3' end of the phosphorodiamidate morpholino oligonucleotide via the flexible linker. In some examples the amino acid sequence of the flexible linker comprises or consists of an amino acid sequence selected from the group consisting of: GGGGS, GGGGSGGGGS (SEQ ID NO: 3), GAS, GGG, GSG, GTG, GGTAGSTGG (SEQ ID NO: 4), GASGGASG (SEQ ID NO: 5) and GASG. In some examples the amino acid sequence of the flexible linker consists of the amino acid sequence set forth in SEQ ID NO: 5.

[0036] In some examples a pharmaceutical composition or a lyophilized composition of the disclosure is provided in a vial. In some examples the vial is a glass vial. In some examples the vial includes a chlorobutyl rubber stopper.

[0037] BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1A is a graphical representation showing results of low luminance visual acuity (LEVA) assessment of treated vs untreated eyes following one treatment with a conjugate of the disclosure. Results show an improvement in treated eyes with statistical significance marked.

[0039] Figure IB is a graphical representation showing number of eyes showing a 5 letter improvement (left graph) or 10 letter improvement (right graph) in LEVA assessment of treated vs untreated eyes following one treatment with a conjugate of the disclosure.

[0040] Figure 2 is a graphical representation showing results of retinal sensitivity' as determined by microperimetry following one dose of the conjugate of the disclosure compared to the natural progression in the eye without treatment.

[0041] Figure 3 is a graphical representation showing results of assessment of the number of scotomas (nonfunctional area of retina) in eyes treated with the conjugate of the disclosure.

[0042] Figure 4 is a graphical representation showing improved sensitivity at the edge of scotomas following a single treatment with a conjugate of the disclosure.

[0043] Figure 5 is a graphical illustration of the structural formula of VP-001 conjugate. DETAILED DESCRIPTION

[0044] General

[0045] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter. Thus, as used herein, the singular forms “a”, "an" and "the” include plural aspects unless the context clearly dictates otherwise. For example, reference to “a” includes a single as well as two or more; reference to "an" includes a single as well as two or more; reference to “the” includes a single as well as two or more and so forth.

[0046] Those skilled in the art will appreciate that the present disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

[0047] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the present disclosure.

[0048] Any example of the present disclosure herein shall be taken to apply mutatis mutandis to any other example of the disclosure unless specifically stated otherwise. Stated another way, any specific example of the present disclosure may be combined with any other specific example of the disclosure (except where mutually exclusive).

[0049] Any example of the present disclosure disclosing a specific feature or group of features or method or method steps will be taken to provide explicit support for disclaiming the specific feature or group of features or method or method steps.

[0050] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary’ skill in the art (for example, optometry, opthamology, molecular biology', microbiology, virology, recombinant DNA technology, peptide synthesis in solution, solid phase peptide synthesis, and immunology).

[0051] Unless otherwise indicated, the conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology’, peptide synthesis in solution, solid phase peptide synthesis, and immunology utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology': A Practical Approach, Volumes 1 and 2, IRL Press (1991), D M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors). Current Protocols in Molecular Biology. Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory'. (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0052] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

[0053] The term “about”, unless stated to the contrary, refers to + / - 20%, more preferably + / -10%, of the designated value. For the avoidance of doubt, the term “about” followed by a designated value is to be interpreted as also encompassing the exact designated value itself (for example, “about 10” also encompasses 10 exactly).

[0054] Throughout this specification the yvord “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0055] Selected Definitions

[0056] The term “antisense oligonucleotide” “antisense oligomer” or "ASO.” as used herein, encompasses oligonucleotides and any other oligomeric molecule that comprises nucleobases capable of hybridizing to a complementary sequence on a target RNA transcript, but may or may not comprise a sugar moiety, such as in the case of a peptide nucleic acid (PNA). Preferably, the ASO is an ASO that is resistant to nuclease cleavage or degradation.

[0057] The phrase “binds to a targeted portion” or “binds within a targeted portion,” in reference to an ASO, as used herein, refers to specific hybridization between the ASO nucleotide sequence and a target nucleotide sequence that is complementary within the ranges set forth herein. In some examples, specific hybridization occurs where, under ex vivo conditions, the hybridization occurs under high stringency conditions. By "high stringency conditions" is meant that the ASO, under such ex vivo conditions, hybridize to a target sequence in an amount that is detectably stronger than non-specific hybridization. High stringency conditions, then, are conditions that distinguish a polynucleotide with an exact complementary sequence, or one containing only a few scattered mismatches from a random sequence that happened to have a few small regions (e.g., 1-5 bases) that matched the probe. Such small regions of complementarity are more easily melted than a full-length complement of 12-17 or more bases, and moderate stringency hybridization makes them easily distinguishable. In one example, high stringency conditions include, for example, low salt and / or high temperature conditions, such as provided by about 0.02-0.1 M NaCl or the equivalent, at temperatures of about 50-70 °C. The skilled person will appreciate that under in vivo conditions, the specificity of hybridization between an ASO and its target sequence is defined in terms of the level of complementarity between the ASO and the target sequence to which it hybridizes within a cell.

[0058] The term “nonsense-mediated RNA decay-inducing (NMD) exon’’ or “NMD exon” refers to an exon or a pseudo-exon that is a region within an intron and can activate the NMD pathway if included in a mature RNA transcript. In the constitutive splicing events, the intron containing an NMD exon is usually spliced out, but the intron or a portion of it can be retained during alternative or aberrant splicing events. Mature mRNA transcripts containing such an NMD exon can be non-productive due to a frame shift which induces the NMD pathway. Inclusion of an NMD exon in mature OPA1 RNA transcripts can downregulate overall OPA1 mRNA and OPA1 protein expression.

[0059] The term “precursor mRNA” or “pre-mRNA” refers to the primary transcript and is the single-stranded RNA product synthesized by transcription of the genomic DNA sequence of the transcription unit for a particular gene, which generally encompasses the nucleotide sequence between a transcription start site and a termination signal.

[0060] The term “peptide” is intended to include compounds composed of amino acid residues linked by amide bonds. A peptide may be natural or unnatural, ribosome encoded or synthetically derived. Typically, a peptide will consist of between 2 and 200 amino acids. For example, the peptide may have a length in the range of 10 to 20 amino acids or 10 to 30 amino acids or 10 to 40 amino acids or 10 to 50 amino acids or 10 to 60 amino acids or 10 to 70 amino acids or 10 to 80 amino acids or 10 to 90 amino acids or 10 to 100 amino acids, including any length within said range(s). The peptide may comprise or consist of fewer than about 150 amino acids or fewer than about 125 amino acids or fewer than about 100 amino acids or fewer than about 90 amino acids or fewer than about 80 amino acids or fewer than about 70 amino acids or fewer than about 60 amino acids or fewer than about 50 amino acids. Peptides, as referred to herein, include "inverso" peptides in which all L-amino acids are substituted with the corresponding D-amino acids, "retro-inverso" peptides in which the sequence of amino acids is reversed and all L-amino acids are replaced with D-amino acids.

[0061] Peptides may comprise amino acids in both L- and / or D-form. For example, both L- and D-forms may be used for different amino acids within the same peptide sequence. In some examples the amino acids within the peptide sequence are in L-form, such as natural amino acids. In some examples the amino acids within the peptide sequence are a combination of L-and D-form. Further, peptides may comprise unusual, but naturally occurring, amino acids including, but not limited to, hydroxyproline (Hyp), beta-alanine, citrulline (Cit), ornithine (Om), norleucine (Nle), 3-nitrotyrosine, nitroarginine, pyroglutamic acid (Pyr). Peptides may also incorporate unnatural amino acids including, but not limited to, homo amino acids. N-methyl amino acids, alpha-methyl amino acids, beta (homo) amino acids, gamma amino acids, and N-substituted glycines. Peptides may be linear peptides or cyclic peptides.

[0062] The term “protein” shall be taken to include a single polypeptide chain, i.e., a series of contiguous amino acids linked by peptide bonds or a series of polypeptide chains covalently or non-covalently linked to one another (i.e., a polypeptide complex). For example, the series of polypeptide chains can be covalently linked using a suitable chemical bond or a disulfide bond. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, Van der Waals forces, and hydrophobic interactions

[0063] Cell Penetrating Peptides (CPP)

[0064] The conjugate of the present disclosure comprises a CPP comprising a sequence set forth in SEQ ID NO: 1. The CPP can consist of a sequence set forth in SEQ ID NO: 1.

[0065] The term “cell penetrating peptide” (CPP) refers to a peptide that is capable of crossing a cellular membrane. In one example, a CPP is capable of translocating across a mammalian cell membrane and entering into a cell. In another example, a CPP may direct a conjugate to a desired subcellular compartment. Thus, a CPP may direct or facilitate penetration of a molecule of interest across a phospholipid, mitochondrial, endosomal, lysosomal, vesicular, or nuclear membrane. A CPP may be translocated across the membrane with its amino acid sequence complete and intact, or alternatively partially degraded.

[0066] In some examples the amino acid sequence of a CPP provided herein includes at least one D-amino acid. In some examples the amino acid sequence of a CPP includes only D-amino acids (other than glycine, for which there is no D form). For example, the amino acid sequence of the CPP is D-argnyl-D-arginyl-D-Seryl-D-arginyl-D-tyrosynil-D-alanyl-D-arginyl-D- alanyl-glycine-d-arginyl-D-prolyl-glycine-D-arginyl-D-asparaginyl-S-seryl-D-seryl-D-arginyl-D-prolyl-D-seryl-D-alanyl-D-prolyl-D-arginyl.

[0067] In other examples, a CPP includes at least one L-amino acid. In some examples, the CPP includes only L-amino acids. In some examples the amino acid sequence of a CPP provided herein is the retro-inverso sequence of any of the CPP amino acid sequence enumerated herein.

[0068] A CPP may direct a molecule of interest, such as an antisense oligonucleotide disclosed herein, from outside a cell through the plasma membrane, and into the cytoplasm or a desired subcellular compartment. Alternatively, or in addition, a CPP may direct a molecule of interest across the blood-brain, trans-mucosal, hematoretinal, skin, gastrointestinal and / or pulmonary barriers.

[0069] CPP Conjugates

[0070] The term “conjugate,” as used herein, refers to a CPP that is linked (covalently or non-covalently) to a polynucleotide as described herein.

[0071] In some examples, a CPP conjugate protein comprises a flexible linker linking the CPP and a heterologous amino acid sequence such a peptide or protein. Examples of flexible linkers include, but are not limited to, GGGGS, GGGGSGGGGS (SEQ ID NO: 3), GAS, GGG, GSG, GTG, GGTAGSTGG (SEQ ID NO: 4), GASGGASG (SEQ ID NO: 5) and GASG. Other examples of such flexible linkers are known in the art as described in, e.g., Chen et al (2013), Adv Drug Deliv Rev., 65(10): 1357-1369. In one example, the amino acid sequence of the linker only includes D-amino acids.

[0072] In one example, the carboxylic acid C-terminus of the CPP is linked to the 3' end of the antisense oligonucleotide via a linker.

[0073] The present disclosure provides a CPP conjugate comprising a sequence set forth in SEQ ID NO: 1 linked to an antisense oligonucleotide as described herein.

[0074] The present disclosure also provides a CPP conjugate comprising a sequence set forth in SEQ ID NO: 1 , linked to an antisense oligonucleotide comprising or consisting of a sequence set forth in SEQ ID NO: 2.

[0075] The present disclosure further provides a CPP conjugate comprising a sequence set forth in SEQ ID NO: 1, linked to an antisense oligonucleotide that binds to a targeted portion of CNOT3 in a cell and increases the level of PRPF31 gene transcripts encoding full length, functional PRPF31 by reducing expression of functional CNOT3 protein in the cell. The present disclosure also provides a CPP conjugate comprising a sequence set forth in SEQ ID NO: 1 , linked to an antisense oligonucleotide comprising or consisting of a sequence set forth in SEQ ID NO: 2.

[0076] The present disclosure provides a CPP conjugate consisting of:

[0077] (i) a CPP consisting of a sequence set forth in SEQ ID NO: 1

[0078] (ii) an antisense oligonucleotide consisting of a sequence set forth in SEQ ID NO: 2, wherein the C-terminus of the CPP is linked to the 3' end of the antisense oligonucleotide.

[0079] In one example, the C-terminus of the CPP is linked to the secondary amine at the 3' end of the antisense oligonucleotide. For example, the carboxylic acid C-terminus of the CPP is linked to the secondary' amino at the 3' end of the antisense oligonucleotide via a linker.

[0080] The present disclosure further provides a CPP conjugate consisting of:

[0081] (i) a CPP consisting of a sequence set forth in SEQ ID NO: 1, wherein the amino acid sequence of the CPP includes only D-amino acids;

[0082] (ii) an antisense oligonucleotide consisting of a sequence set forth in SEQ ID NO: 2, wherein the C-terminus of the CPP is linked to the 3' end of the antisense oligonucleotide.

[0083] For the avoidance of doubt, a conjugate of the disclosure that "comprises” (i) a CPP “consisting” of an amino acid sequence and (ii) an antisense oligonucleotide (e.g., a phosphorodiamidate morpholino oligonucleotide) “consisting” of a nucleotide sequence, in some examples, includes an intervening flexible linker comprising or consisting of an amino acid sequence (e.g., SEQ ID NO:5) distinct from the amino acid sequence of the CPP (SEQ ID NO: 1), that links the CPP to the nucleotide sequence (SEQ ID NO:2) of the conjugate. In some examples, the conjugate consists of: (i) a CPP the amino acid sequence of which consists of the amino acid sequence set forth in SEQ ID NO: 1; (ii) a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which consists of the nucleotide sequence set forth in SEQ ID NO: 2; and (iii) a flexible linker linking (i) and (ii) the amino acid sequence of which consists of an amino acid sequence selected from among: GGGGS, GGGGSGGGGS (SEQ ID NO: 3), GAS, GGG, GSG, GTG, GGTAGSTGG (SEQ ID NO: 4), GASGGASG (SEQ ID NO: 5) and GASG. In some preferred examples, the amino acid sequence of the flexible linker consists of the amino acid sequence set forth in SEQ ID NO:5.

[0084] In some examples the CPP conjugate comprises the structure corresponding to formula VP -001 as shown in Figure 5.

[0085] Antisense oligonucleotides PRPF31 (also known as hPRP31) encodes an essential pre-mRNA splicing factor required for the assembly and recycling of the U4 / U6 RNA complex. Several studies have demonstrated reduced amounts of total PRPF31 mRNA in patients with RP11, as well as delayed rate of spliceosome assembly and pre-mRNA processing. This indicates that the disease occurs via a haplo insufficiency mechanism. In comparison to other tissues, the retina expresses seven times more major spliceosomal small nuclear RNAs (snRNAs).

[0086] CCR4-NOT transcription complex subunit 3 (CNOT3, one of the five NOT proteins of the CCR4-NOT deadenylase complex) has been identified as the main modifier gene determining penetrance of PRPF31 mutations, via a mechanism of transcriptional repression; modulating PRPF31 transcription by directly binding to its promoter. The expression level of the wild-type PRPF31 allele determines whether carriers of the mutated PRPF31 allele are symptomatic. In asymptomatic carriers, CNOT3 is expressed at low levels, allowing higher amounts of wild-type PRPF31 transcripts to be produced and preventing manifestation of retinal degeneration.

[0087] Human CNOT3 is an 18-exon gene that codes for a protein with 753 amino acids. Exclusion of exon 2 removes the translation initiation codon from the transcript. Removal of exon 4, 5, 6, 7, 10 or 17 may disrupt functional domains of CNOT3. Exclusion of any of exons 3, 8, 9, and 11-16 disrupts the open reading frame.

[0088] Knocking out the CNOT3 gene is embryonically lethal, as it is vital for cell cycle progression through the regulation of mRNA turnover, and the regulation of mRNA decay in various physiological processes. However, if the levels of CNOT3 could be reduced or eliminated locally in the eye of subjects at risk of or suffering from RP, then the progression of the disease would be affected as increased amounts of PRPF31 protein could be produced, mimicking an incomplete penetrance model wherein asymptomatic carriers are protected from the disease by a higher than average expression of PRPF31 from an unmodified gene.

[0089] The present invention provides antisense oligonucleotides to induce non-productive splicing or functionally impaired protein of CNOT3 (the negative regulator of PRPF3P) to lower (but preferably not ablate) levels of CNOT3 and therefore increase transcription and translation from the normal PRPF31 allele.

[0090] The antisense oligonucleotides of the disclosure are used to modify pre-mRNA splicing in a CNOT3 gene transcript or part thereof and induce exon "skipping" and / or terminal intron retention. The strategy preferably reduces total protein expression or generates proteins which lack functional domains, leading to reduced protein function. Accordingly the disclosure provides an ASO capable of binding to a selected target on a CNOT3 gene transcript to modify pre-mRNA splicing in a CNOT3 gene transcript or part thereof. Broadly, there is provided an isolated or purified ASO for inducing targeted exon exclusion and / or terminal intron retention in a CNOT3 gene transcript or part thereof.

[0091] An antisense oligomer can be said to be “directed to” or “targeted against” a target sequence with which it hybridizes. In certain examples, the target sequence includes a region including a 3’ or 5’ splice site of a pre-processed mRNA, a branch point, or other sequences involved in the regulation of splicing. The target sequence may be within an exon or within an intron or spanning an intron / exon junction.

[0092] In certain examples, the antisense oligomer has sufficient sequence complementarity to a target RNA (i.e.. the RNA for which splice site selection is modulated) to block a region of a target RNA (e.g., pre-mRNA) in an effective manner. In some examples, such blocking of CNOT3 pre-mRNA serves to modulate splicing, either by masking a binding site for a native protein that would otherwise modulate splicing and / or by altering the structure of the targeted RNA. In some examples, the target RNA is target pre-mRNA (e.g., CNOT3 gene pre-mRNA).

[0093] In one example, the ASO comprises or consists of the sequence ATGGTCTTGGGCTCCTCGTGCCTCT (SEQ ID NO: 2).

[0094] In some examples, the degree of complementarity between the target sequence and antisense oligomer is sufficient to form a stable duplex. The region of complementarity of the antisense oligomers with the target RNA sequence may be as short as 8-11 bases, but can be 12-15 bases or more, e.g., 10-50 bases, 10-40 bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20 bases, including all integers in between these ranges. An antisense oligomer of about 16-17 bases is generally long enough to have a unique complementary sequence. In certain embodiments, a minimum length of complementary bases may be required to achieve the requisite binding Tm, as discussed herein.

[0095] As described herein, the AS Os according to any example bind to a targeted portion of human CNOT3 pre-mRNA and which decrease expression of CNOT3 protein thereby increasing expression of PRPF31 protein in mammalian cells.

[0096] In some examples of the ASOs, compositions and methods described herein, ASOs have a sequence that is completely complementary across its length to the target sequence or a sequence near complementarity (e.g., sufficient complementarity to bind the target sequence to promote exon splicing). ASOs are designed so that they bind (hybridize) to a target RNA sequence (e.g.. a targeted portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Selection of suitable sequences for ASOs generally avoids, where possible, similar nucleic acid sequences in other (i.e., off-target) locations in the genome or in cellular mRNAs or miRNAs, such that the likelihood the ASO will hybridize at such sites is limited.

[0097] In some examples, ASOs “specifically hybridize’’ to or are “specific” to a target nucleic acid or a targeted portion of the CNOT3 mRNA.

[0098] ASO sequences are “complementary” to their target sequences when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. Complementarity is quantifiable in terms of the proportion (e.g., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules. The nucleotide sequence of an ASO need not be 100% complementary to that of its target nucleic acid to hybridize. In certain examples, the nucleotide sequences of ASOs in the compositions disclosed herein can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleotide sequence of the targeted portion of an RNA transcript over the length of the ASO nucleotide sequence. For example, an ASO in which 18 of 20 nucleotides of ASO sequence are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In such an example, the remaining non-complementary nucleotides of the ASO could be clustered together or interspersed with complementary nucleotides and need not be contiguous. Complementarity of an ASO sequence to a target nucleotide sequence (expressed as “percent complementarity ’ to its target sequence; or “percent identity” to its reverse complement sequence) can be determined routinely using algorithms know n in the art, as exemplified in the BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul, et al., 1990, J. Mol. Biol.. 215:403-410; Zhang et al., 1997, Genome Res., 7:649-656).

[0099] In some examples, an ASO does not hybridize to all nucleotides in a target sequence and the nucleotide positions at which it does hybridize may be contiguous or noncontiguous. ASOs may hybridize over one or more segments of a mRNA, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed).

[0100] The ASOs described herein may be of any length suitable for specific hybridization to a target sequence. In some examples, the nucleotide sequence of the ASOs consist of 8 to 50 nucleotides. For example, the ASO sequence can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32. 33. 34. 35, 40, 45, or 50 nucleotides in length. In some examples, the ASOs consist of more than 50 nucleotides, but no more than 100 nucleotides in length.

[0101] In some examples, the ASO nucleotide sequence is from 8 to 50 nucleotides, 8 to 40 nucleotides, 8 to 35 nucleotides, 8 to 30 nucleotides, 8 to 25 nucleotides, 8 to 20 nucleotides, 8 to 15 nucleotides, 9 to 50 nucleotides, 9 to 40 nucleotides, 9 to 35 nucleotides, 9 to 30 nucleotides, 9 to 25 nucleotides, 9 to 20 nucleotides, 9 to 15 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 35 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, 10 to 20 nucleotides, 10 to 15 nucleotides, 11 to 50 nucleotides, 11 to 40 nucleotides, 11 to 35 nucleotides, 11 to 30 nucleotides, 11 to 25 nucleotides, 11 to 20 nucleotides, 11 to 15 nucleotides, 12 to 50 nucleotides, 12 to 40 nucleotides, 12 to 35 nucleotides, 12 to 30 nucleotides, 12 to 25 nucleotides, 12 to 20 nucleotides. 12 to 15 nucleotides, 13 to 50 nucleotides, 13 to 40 nucleotides, 13 to 35 nucleotides, 13 to 30 nucleotides, 13 to 25 nucleotides, 13 to 20 nucleotides, 14 to 50 nucleotides, 14 to 40 nucleotides, 14 to 35 nucleotides, 14 to 30 nucleotides, 14 to 25 nucleotides, 14 to 20 nucleotides, 15 to 50 nucleotides, 15 to 40 nucleotides, 15 to 35 nucleotides. 15 to 30 nucleotides, 15 to 25 nucleotides, 15 to 20 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, 20 to 35 nucleotides, 20 to 30 nucleotides, 20 to 25 nucleotides, 25 to 50 nucleotides, 25 to 40 nucleotides, 25 to 35 nucleotides, or 25 to 30 nucleotides in length. In some examples, the ASOs are 17 nucleotides in length. In some preferred examples, the nucleotide sequence of the ASO nucleotide is 25 nucleotides in length.

[0102] ASO Chemistry and Modifications

[0103] The ASOs described herein may comprise naturally-occurring nucleotides, nucleotide analogues, modified nucleotides, or any combination thereof. The term “naturally occurring nucleotides” includes deoxyribonucleotides and ribonucleotides. The term “modified nucleotides” includes nucleotides with modified or substituted sugar groups and / or having a modified backbone. In some examples, all the nucleotides of an ASO are modified nucleotides. Chemical modifications of ASOs or components of ASOs that are compatible with the compositions and methods described herein are known in the art as disclosed in, e.g., in U.S. Patent No. 8,258,109, U.S. Patent No. 5,656,612, U.S. Patent Publication No. 2012 / 0190728, and Roberts et al., 2020, Nature Rev. Drug Disc., 19:673-694.

[0104] One or more nucleotides of an ASO may be any naturally occurring, unmodified nucleobase such as adenine, guanine, cytosine, thymine, uracil and inosine, or any synthetic or modified nucleobase that is sufficiently similar to an unmodified nucleobase such that it is capable of hydrogen bonding with a nucleobase present on a target RNA transcript. Examples of suitable modified nucleobases include, but are not limited to, hypoxanthine, xanthine, 7-methylguanine, 5, 6-dihydrouracil, 5-methylcytosine, and 5 hydroxymethoylcytosine.

[0105] ASOs include a “backbone” structure that refers to the connection between nucleotides / monomers of the ASO. In naturally occurring oligonucleotides, the backbone comprises a 3'-5' phosphodiester linkage connecting sugar moieties of adjacent nucleotides. Suitable types of backbone linkages for the ASOs described herein include, but are not limited to, phosphodiester, phosphorothioate, phosphorodithioate, phosphorodiamidate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoramidate, and the like. In some examples, the backbone modification is a phosphorothioate linkage. In other examples, the backbone modification is a phosphorodiamidate linkage. See, e.g., Roberts et al. supra; and Agrawal (2021), Biomedicines, 9:503. In some examples, the backbone structure of the ASO does not contain phosphorous-based linkages, but rather contains peptide bonds, for example in a peptide nucleic acid (PNA), or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups.

[0106] In some examples, the stereochemistry at each of the phosphorus intemucleotide linkages of the ASO backbone is random. In other examples, the stereochemistry at each of the phosphorus intemucleotide linkages of the ASO backbone is controlled and is not random. For example, U.S. Pat. No. 9.605.019 describes methods for independently selecting the handedness of chirality at each phosphorous atom in an oligonucleotide. In some examples, a composition or composition used in the methods disclosed herein comprises a pure diastereomeric ASO. In other examples, the composition comprises an ASO that has diastereomeric purity of at least about 90%, at least about 91%. at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, about 100%, about 90% to about 100%, about 91% to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to about 100%.

[0107] In some examples, the ASO has a non-random mixture of Rp and Sp configurations at its phosphorus intemucleotide linkages. In some examples, an ASO used in the compositions and methods disclosed herein, comprises about 5-100% Rp, at least about 5% Rp, at least about 10% Rp, at least about 15% Rp. at least about 20% Rp, at least about 25% Rp, at least about 30% Rp, at least about 35% Rp, at least about 40% Rp, at least about 45% Rp, at least about 50% Rp, at least about 55% Rp, at least about 60% Rp, at least about 65% Rp, at least about 70% Rp, at least about 75% Rp. at least about 80% Rp, at least about 85% Rp, at least about 90% Rp, or at least about 95% Rp, with the remainder Sp, or about 100% Rp.

[0108] In some examples, the ASOs described herein contain a sugar moiety that comprises ribose or deoxyribose, or a modified sugar moiety or sugar analog, including a morpholine ring. Suitable examples of modified sugar moieties include, but are not limited to, 2' substitutions such as 2'-t?-modifications, 2'-(?-methyl (2'-(?-Me), 2'-(9-methoxy ethyl (2'MOE), 2'-(9-aminoethyl, 2'F, N3'->P5' phosphoramidate, 2'dimethylaminooxyethoxy, 2'dimethylaminoethoxy ethoxy, 2'-guanidinidium, 2'-O-guanidinium ethyl, carbamate modified sugars, and bicyclic modified sugars. In some examples, the sugar moiety modification is selected from among 2'-( -Me, 2'F, and 2'MOE. In other examples, the sugar moiety modification is an extra bridge bond, such as in a locked nucleic acid (LNA). In some examples the sugar analogue contains a morpholine ring, such as phosphorodiamidate morpholino (PMO). In some examples, the sugar moiety7comprises a ribofuransyl or 2'deoxyribofuransyl modification. In some examples, the sugar moiety comprises 2'4' -constrained 2'-O-methyl oxy ethyl (cMOE) modifications. In some examples, the sugar moiety comprises cEt 2', 4' constrained 2'-O ethyl BNA modifications. In other examples, the sugar moiety comprises tricycloDNA (tcDNA) modifications. In some examples, the sugar moiety7comprises ethylene nucleic acid (ENA) modifications. In some examples, the sugar moiety comprises 2'-<9-(2-N-methylcarbamoylethyl) (MCE). Modifications are known in the art as exemplified in Jarver, et al.. 2014, Nucleic Acid Therapeutics, 24(1): 3747.

[0109] In some examples, each constituent nucleotide of the ASO is modified in the same way, e.g., every linkage of the backbone of the ASO comprises a phosphorothioate linkage, or each ribose sugar moiety comprises a 2'-< -methyl modification. In other examples, a combination of different modifications is used, e.g., an ASO comprising a combination of phosphorodiamidate linkages and sugar moieties comprising morpholine rings (morpholinos).

[0110] In some examples, the ASO comprises one or more backbone modifications. In some examples, the ASO comprises one or more sugar moiety7modification. In some examples, the ASO comprises one or more backbone modifications and one or more sugar moiety modifications. In some examples, the ASO comprises a 2'MOE modification and a phosphorothioate backbone. In some examples, the ASO comprises a peptide nucleic acid (PNA).

[0111] In some examples, the ASO comprises a phosphorodiamidate morpholino (PMO). The skilled person in the art will appreciate that ASOs may be modified in order to achieve desired properties or activities of the ASO or reduce undesired properties or activities of the ASO. In some examples, an ASO is modified to alter one or more properties. For example, such modifications can: enhance binding affinity to a target sequence on a pre-mRNA transcript; reduce binding to any non-target sequence; reduce degradation by cellular nucleases (e.g., RNase H); improve uptake of an ASO into a cell and / or particular subcellular compartments; alter the pharmacokinetics or pharmacodynamics of the ASO; and / or modulate the half-life of the ASO in vivo.

[0112] In some examples, the ASOs comprise one or more 2'-<9-(2-methoxyethyl) (MOE) phosphorothioate-modified nucleotides, which have been shown to confer significantly enhanced resistance of ASOs to nuclease degradation and increased bioavailability.

[0113] Methods for synthesis and chemical modification of ASOs, as well as synthesis of ASO conjugates is well known in the art, and such ASOs are available commercially.

[0114] In some examples, a pharmaceutical composition comprises a dose of ASO conjugate ranging from about 20pg to about 80pg of the conjugate, e.g., 25pg, 30pg, 35pg, 40pg, 50pg, 55 pg, 60pg, 65 g, 70pg. 75 pg or another dose of conjugate ranging from about 20pg to about 80pg.

[0115] In some examples, a pharmaceutical composition comprises multiple ASOs. In some examples, a pharmaceutical composition comprises, in addition to ASOs, another drug or therapeutic agent suitable for treatment of a subject suffering from an ocular condition.

[0116] Methods of Treating Ocular Conditions

[0117] The present disclosure provides, for example, a method of treating, preventing and / or delaying progression of an ocular condition, e.g., RP11. The methods described herein include amethod for treating, preventing and / or delaying progression of an ocular condition in asubject in need thereof by administering to the subject a therapeutically effective amount of a conjugate of the present disclosure or a pharmaceutical composition comprising the conjugate disclosed herein. Likewise, in some examples, the conjugate is used in the manufacture of a medicament for treating and / or delaying progression of an ocular condition.

[0118] In one example, the subject to be treated is suffering from an ocular condition, such as RP11. For example, the subject has been diagnosed as having or suffering from an ocular condition, such as RP11. For example, the subject is in need of treatment. Such subjects can be administered the conjugate as described here to treat the progression of an ocular condition, such as RP 11. In one example, administration of the conjugate or pharmaceutical composition as described herein slows progression of an ocular condition, such as RP11.

[0119] Also provided herein is a method for increasing the PRPF31 transcript or PRPF31 protein in a cell, the method comprising contacting the cell with a conjugate pharmaceutical composition, as disclosed herein, whereby the amount of CNOT3 protein in the cell is decreased and the amount of PRPF31 transcript or PRPF31 protein in the cell is increased.

[0120] In some examples, administration to a subject or contact with cells with the conjugate or pharmaceutical compositions disclosed herein increases the level of PRPF31 transcript or PRPF31 protein about 1.1 to about 10-fold, e.g., 1.5 to about 10-fold, about 2 to about 10-fold, about 3 to about 10-fold, about 4 to about 10-fold, about 1.1 to about 5 -fold, about 1.1 to about 6-fold, about 1.1 to about 7-fold, about 1.1 to about 8-fold, about 1.1 to about 9-fold, about 2 to about 5-fold, about 2 to about 6-fold, about 2 to about 7-fold, about 2 to about 8-fold, about 2 to about 9-fold, about 3 to about 6-fold, about 3 to about 7-fold, about 3 to about 8-fold, about 3 to about 9-fold, about 4 to about 7-fold, about 4 to about 8-fold, about 4 to about 9-fold, at least about 1.1 -fold, at least about 1.5-fold, at least about 2-fold, at least about 2.5-fold, at least about 3-fold, at least about 3.5-fold, at least about 4-fold, at least about 5-fold, or at least about 10-fold compared to the level in the tissue prior to the administration or contact.

[0121] Suitable routes of administration for treatment with the compositions, pharmaceutical compositions, or medicaments disclosed herein include, but are not limited to intraocular, such as intravitreal, suprachoroidal or subretinal. For example the conjugate or pharmaceutical composition is administered intravitreal ly.

[0122] In some examples administration is into the eye by an intravitreal, suprachoroidal, or sub-retinal route. For example, administration to the eye is by intravitreal administration. In another example, administration to the eye is by suprachoroidal administration. In a further example, administration to the eye is by sub-retinal administration. In one example, administration to the eye is by a topical administration.

[0123] As the skilled person will understand, the treatment methods disclosed herein include administration of the conjugate or pharmaceutical compositions disclosed herein in a therapeutically effective amount to a subject (e.g., a human subject). The terms "effective amount" or "therapeutically effective amount," as used herein, refer to a sufficient amount of a disclosed ASO being administered to relieve to some extent one or more of the symptoms and / or clinical indicia associated with pathological inflammation in a particular disease or health condition. In some examples, an "effective amount" for therapeutic uses is the amount of one of the foregoing agents required to provide a clinically significant decrease in disease symptoms and / or inflammatory' markers or to prevent disease symptoms without undue adverse side effects.

[0124] In one example, the conjugate is administered at a fixed dose. The term '‘fixed dose” means the dose administered is not varied based on weight of a subject or severity of disease.

[0125] In one example, the conjugate is administered at a dose between 20pg to 80pg per eye in a subject.

[0126] In one example, the conjugate is administered at a dose between 30pg to 75pg per eye in a subject.

[0127] In one example, the conjugate is administered at a dose between 25pg to 35pg per eye in a subject.

[0128] In one example, the conjugate is administered at a dose of 30pg per eye in a subject. In one example, the conjugate is administered at a dose between 70pg to 80pg per eye in a subject.

[0129] In one example, the conjugate is administered at a dose of 75pg per eye in a subject. In some examples, the conjugate is administered multiple times to the eye of a subject. In some examples, there is between 2 and 6 months between each dose.

[0130] In some examples, there is 2 months between each dose.

[0131] In some examples, there is 3 months between each dose.

[0132] In some examples, there is 4 months between each dose.

[0133] In one example, administration of the conjugate of the disclosure results in improved low luminance visual acuity and / or improved microperimetry’ and / or a reduced number of scotomas. For example, administration of the conjugate results in improved low luminance visual acuity and / or improved microperimetry and / or a reduced number of scotomas for at least 2 to 8 weeks following each administration of the conjugate.

[0134] For example, low luminance visual acuity (LLVA) is measured by adding a neutral density7(ND) filter to the refraction for best corrected visual acuity7(BCVA) whilst keeping a vision chart and lighting conditions of the room stable so that luminance is reduced by 2.0 log units. Alternatively, the vision chart can be dimmed by a ND to provide the same effect. In one example, following administration of the conjugate of the disclosure LLVA is improved by at least 5 letters or by at least 10 letters. For example, LLVA is improved by at 5 letters. For example, LLVA is improved by at least 10 letters.

[0135] For example, retinal sensitivity as assessed by microperimetry' is improved. For example, retinal sensitivity is improved 0.25 fold, or 0.5 fold or 1 fold following administration of the conjugate (e.g., 1 month or 3 months or 6 months) compared to retinal sensitivity’ before administration of the conjugate. For example, retinal sensitivity is improved 0.25 fold following administration of the conjugate (e.g., 1 month) compared to retinal sensitivity before administration of the conjugate. For example, retinal sensitivity is improved 0.5 fold following administration of the conjugate (e.g., 1 month) compared to retinal sensitivity before administration of the conjugate. For example, retinal sensitivity is improved 0.25 fold following administration of the conjugate (e.g., 3 months) compared to retinal sensitivity before administration of the conjugate. For example, retinal sensitivity is improved 0.5 fold following administration of the conjugate (e.g., 3 months) compared to retinal sensitivity before administration of the conjugate.

[0136] For example, the number of scotomas in the eye of the subject is reduced 1 month or 3 months or 4 months following administration of the conjugate. For example, the number of scotomas is reduced by 1, 1 month after administration of the conjugate. For example, the number of scotomas is reduced by 1, 3 months after administration of the conjugate. For example, the number of scotomas is reduced by 1, 4 months after administration of the conjugate. For example, the number of scotomas is reduced by 2, 4 month after administration of the conjugate.

[0137] Medical products

[0138] The present disclosure also provides an article of manufacture, e.g.. a container comprising a conjugate or pharmaceutical composition.

[0139] For example, the container is a vial.

[0140] For example, the container is a prefilled syringe.

[0141] In one example, the container comprises sufficient conjugate for administration at a dose between 20pg to 80pg per eye in a subject.

[0142] In one example, the container comprises sufficient conjugate for administration at a dose between 30pg to 75pg per eye in a subject.

[0143] In one example, the container comprises sufficient conjugate for administration at a dose between 25pg to 35pg per eye in a subject.

[0144] In one example, the container comprises sufficient conjugate for administration at a dose of 30pg per eye in a subject.

[0145] In one example, the container comprises sufficient conjugate for administration at a dose between 70pg to 80pg per eye in a subject.

[0146] In one example, the container comprises sufficient conjugate for administration at a dose of 75 pg per eye in a subject. In the discussion above, reference to “a dose sufficient’' will be understood that the container comprises slightly more than (e.g., no more than 10% more) the recited amount to account for the component of conjugate that is not or cannot be removed from the container during dosing.

[0147] The conjugate can be in dried, lyophilized or liquid form.

[0148] In one example a container comprises a VP-001 conjugate formulation as set forth in Table 1 or Table 2.

[0149] Tabic 1 - Exemplary VP-001 Formulation (Formulation I)

[0150] Quantity per vial Reference to Quality Components Function

[0151] 0.18mg / 0.3mL Standard

[0152] VP-001 0.18 mg Active ingredient In-house Specification

[0153] Sodium dihydrogen

[0154] phosphate 0.159 mg Buffer component USP / BP

[0155] monohydrate

[0156] Di-Sodium hydrogen

[0157] phosphate 0.4953 mg Buffer component USP

[0158] heptahydrate

[0159] Sodium Chloride 2.55 mg Tonicity agent USP / Ph.Eur / ChP / BP / JP

[0160] Water for injection Q.s. to 0.3mL Solvent In-house Specification

[0161]

[0162] Table 2 - Exemplary VP-001 Formulation (Formulation II)

[0163] Quantity per vial Reference to Quality Components Function

[0164] 0.45mg / 0.3mL Standard

[0165] VP-001 0.45 mg Active ingredient In-house Specification

[0166] Sodium dihydrogen

[0167] phosphate 0.159 mg Buffer component USP / BP

[0168] monohydrate

[0169] Di-Sodium hydrogen

[0170] phosphate 0.4953 mg Buffer component USP

[0171] heptahydrate

[0172] Sodium Chloride 2.55 mg Tonicity agent USP / Ph.Eur / ChP / BP / JP

[0173] Water for injection Q.s. to 0.3mL Solvent In-house Specification

[0174]

[0175] The present disclosure is not to be limited by the following non-limiting examples. EXAMPLES

[0176] Example 1 - Treatment of patients suffering from RP 11 with a conjugate of the disclosure.

[0177] Patients suffering from RP11 are administered 30pg or 75gg of a conjugate comprising a CPP comprising the sequence set forth in SEQ ID NO: 1 and an ASO (PMO) comprising a sequence set forth in SEQ ID NO: 2 in one eye. The other eye is administered vehicle as a negative control.

[0178] Figures 1A-B show the treated eye in the subjects shows increased LLVA compared to baseline, which exceeds the same measure in the control eye.

[0179] Figure 2 shows an improvement in retinal sensitivity as assessed using microperimetery following a single dose of the conjugate for at least 4 months, whereas this measure naturally decreases in subjects suffering from RP11.

[0180] Figure 3 shows a reduced number of scotomas for at least 4 months after a single dose of the conjugate. Sensitivity' at the edge of the scotoma was also increased 4 months after a single dose of the conjugate (Figure 4).

[0181] Table 3 below shows data from three patients who have received two doses eight weeks apart.

[0182] Table 3 - Patient vision parameters following treatment with VP-001 Patient 1 Patient 2 Patient 3 Change from

[0183] baseline at Treated Untreated Treated Untreated Treated Untreated Month 3

[0184] Microperimetry

[0185] Mean +1.04 +0.63 +1.21 +1.03 +0.34 +0.42 sensitivity (dB)

[0186] Number of -13 -4 -2 0 +5 0 scotomas

[0187] LLVA 0 + 1 +6 +2 -1 -5

[0188]

[0189] Example 2 - VP-001 formulation pH stability testing and buffer optimization

[0190] Stability of VP-001 in buffered solution of different pH The goal of this study was to determine the optimal pH value for buffered solutions of VP-001. Solutions of VP-001 at 1 mg / mL were prepared in 25 mM buffer solutions, as below. Solutions were incubated under accelerated testing conditions (40 °C) for one week and appearance and purity were evaluated. It was found that a pH range 6.0-7.0 was suitably stable for a VP-001 formulation pH. Changes in peak shapes that yielded decreases in purity values over the measured time period (7 days) for pH 5.0 and pH 8.0 rendered these formulation pH values unsuitable for future exploration.

[0191] Table 4 - pH Testing for VP-001 (1 mg / ml)

[0192]

[0193] Buffer Time (d) Purity (%) 25 mM sodium citrate, 110 0 91.6

[0194] mMNaCl, pH 4.0 7 83.0

[0195] 25 mM sodium acetate, 120 0 93.0

[0196] mMNaCl, pH 5.0 7 98.7

[0197] 25 mM sodium phosphate, 0 92.2

[0198] HO mM NaCl, pH 6.0 7 92.4

[0199] 25 mM sodium phosphate, 0 92.3

[0200] HO mM NaCl, pH 7.0 7 93.0

[0201] 25 mM sodium phosphate, 0 92.5

[0202] HO mM NaCl, pH 8.0 7 98.4

[0203]

[0204] VP-001 drug product buffer composition

[0205] VP-001 was formulated at a strength of 0.6 mg / mL or 1.5 mg / mL, and packaged in Type I size 2R glass vials, with chlorobutyl rubber stoppers. The composition of these formulations was as set out in Table 5. Table 5 - VP-001 Formulation including buffer composition Components Content (mg / mL) Function Quality Standard VP-001 Drug Substance 0.6 or 1.5 (free base) Active Ingredient In-house

[0206] Sodium dihydrogen

[0207] 0.53 Buffer component USP

[0208] phosphate dihydrate

[0209] Disodium hydrogen

[0210] 1.651 Buffer component USP

[0211] phosphate heptahydrate

[0212] Sodium chloride 8.5 Tonicity agent USP

[0213] Water for injection Q.S to 1 mL Solvent / vehicle NF

[0214] 0.1 N Sodium hydroxide

[0215] N / A pH adjustment NF

[0216] (NaOH)

[0217] 0.1 N Hydrochloric Acid

[0218] N / A pH adjustment USP, Ch. P.

[0219] (HCl)

[0220]

[0221] VP-001 Drug Product - Stability?

[0222] The stability of the VP-001 drug product formulation (0.6 mg / ml VP-001 drug) listed in Table 5 was tested for stability by storage in Type I size 2R glass vials with chlorobutyl rubber stoppers at 5 °C ± 3 °C and assayed for purity at time points ranging from one month to 24 months. The results are shown in Table 6.

[0223] Table 6 - VP-001 Drug Product Stability

[0224] Test Item IM 3M 6M 9M 12M 18M 24M Appearance Clear, colorless solution free from visible particulates

[0225] Assay (%) 100.5 99.3 100.5 100.9 98.8 99.2 96.6 Purity by 99.1

[0226] 99.7 99.5 99.6 100.0 100.0 99.6 UPLC-UV (%)

[0227] Total impurities

[0228] by HPLC-UV 0.3 0.5 0.4 0.0 0.9 0.0 0.4 (%)

[0229] pH 7.0 6.9 6.9 6.9 6.9 7.0 6.9 Osmolality

[0230] 292 294 288 291 290 291 290 (mOsm / kg)

[0231]

[0232] APPENDIX SEQUENCES SEQ ID NO: 1 - CPP RRSRTARAGRPGRNSSRPSAPR SEQ ID NO: 2 - PMO targeting CN0T3 ATGGTCTTGGGCTCCTCGTGCCTCT SEQ D NO: 3 - Flexible peptide linker GGGGSGGGGS SEQ D NO: 4 - Flexible peptide linker GGTAGSTGG SEQ D NO: 5 - Flexible peptide linker

[0233] GASGGASG

Claims

CLAIMS1. A method of treating retinitis pigmentosa type 11 (RP11) comprising administering to the eye of a subject a conjugate comprising a cell penetrating peptide (CPP) and an antisense oligonucleotide that modifies pre-mRNA splicing in the CNOT3 gene transcript and / or increases expression of a PRPF31 protein.

2. The method of claim 1 comprising administering the conjugate intravitreally.

3. The method of claim 1 or claim 2 comprising administering a fixed dose of the conjugate to the eye of the subject.

4. The method of any one of claims 1 to 3 comprising administering between 20pg-80pg of the conjugate to the eye of the subject.

5. The method of claim 4. comprising administering 30pg or 75pg of the conjugate to the eye of the subject.

6. The method of any one of claims 1 to 5, comprising administering multiple doses of the conjugate to the subject.

7. The method of claim 6, wherein each dose of the multiple doses is administered at least 2 weeks apart.

8. The method of claim 6, wherein each dose of the multiple doses is administered between 2 and 8 weeks apart.

9. The method of claim 6, wherein each dose of the multiple doses is administered 2 weeks apart.

10. The method of claim 6, wherein each dose of the multiple doses is administered 3 weeks apart.

11. The method of any one of claims 1 to 10, wherein the amino acid sequence of the CPP in the conjugate comprises the sequence set forth in SEQ ID NO: 1.

12. The method of any one of claims 1 to 10. wherein the amino acid sequence of the CPP in the conjugate consists of the sequence set forth in SEQ ID NO: 1.

13. The method of claim 11 or claim 12. wherein each amino acid in the CPP is a D amino acid.

14. The method of any one of claims 1 to 13, wherein the nucleotide sequence of the ASO in the conjugate comprises the sequence set forth in SEQ ID NO: 2.

15. The method of any one of claims 1 to 13, wherein the nucleotide sequence of the ASO in the conjugate consists of the sequence set forth in SEQ ID NO: 2.

16. The method of any one of claims 1 to 15, wherein the antisense oligonucleotide comprises a backbone modification comprising a phosphorothioate linkage or a phosphorodiamidate linkage or wherein the antisense oligonucleotide comprises a phosphorodiamidate morpholino linkage.

17. The method of claim 16, wherein the antisense oligonucleotide is a phosphorodiamidate morpholino oligonucleotide.

18. The method of any one of claims 1 to 17, wherein following administration of the conjugate, the subject shows improved low luminance visual acuity7and / or improved microperimetry and / or a reduced number of scotomas.

19. The method of any one of claims 1 to 17, wherein the subject shows improved low luminance visual acuity and / or improved microperimetry and / or a reduced number of scotomas for at least 2 to 8 weeks following each administration of the conjugate.

20. A method of treating retinitis pigmentosa, the method comprising administering intravitreally to the eye of a subject in need thereof 30pg or 75pg of a conjugate comprising a cell penetrating peptide comprising the amino sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide comprising the sequence set forth in SEQ ID NO: 2.

21. A method of treating retinitis pigmentosa, the method comprising administering intravitreally to the eye of a subject in need thereof multiple doses of a conjugate comprising a cell penetrating peptide comprising the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide comprising the nucleotide sequence set forth in SEQ ID NO: 2, wherein eachdose comprises 30pg or 75pg of the conjugate and wherein each dose of the multiple doses is administered 2 to 6 weeks apart.

22. The method of claim 20 or claim 21 , wherein the amino acid sequence consists of SEQ ID NO:1.

23. The method of any one of claims 20 to 22, wherein the nucleotide sequence consists of SEQ ID NO:2.

24. A container comprising an amount of a conjugate comprising a cell penetrating peptide comprising or consisting of a sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide comprising or consisting of the sequence set forth in SEQ ID NO: 2 sufficient to administer 30pg or 75pg of the conjugate to the subject.

25. The container of claim 24, which is a vial or a prefilled syringe.

26. A pharmaceutical composition comprising:(i) a conjugate comprising a cell penetrating peptide the amino acid sequence of which comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which comprises or consists of the sequence set forth in SEQ ID NO: 2; and(ii) a physiological buffer effective to maintain the pharmaceutical composition at pH within a pH range of 6.0 to 7.0.

27. A pharmaceutical composition comprising:(i) a conjugate comprising a cell penetrating peptide the amino acid sequence of which comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which comprises or consists of the sequence set forth in SEQ ID NO: 2; and(ii) a phosphate buffer effective to maintain the pharmaceutical composition at pH within a pH range of 6.0 to 7.0.

28. The pharmaceutical composition according to claim 26 or claim 27, having osmolality from 288 to 292 mOsm / kg.

29. The pharmaceutical composition according to any one of claims 26 to 28, having a purity when stored at 5 °C for between 1 month to 24 months of 99% or greater as determined by high performance liquid chromatography with ultraviolet detection (HPLC-UV).

30. The pharmaceutical composition according to any one of claims 26 to 29, further comprising a tonicity modifier.

31. The pharmaceutical composition according to claim 30, wherein the tonicity modifier is sodium chloride.

32. The pharmaceutical composition according to any one of claims 26 to 31 , wherein the amino acid sequence of the cell penetrating peptide consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and the nucleotide sequence of the phosphorodiamidate morpholino oligonucleotide consists of the nucleotide sequence set forth in SEQ ID NO:

233. A lyophilized composition comprising a cell penetrating peptide the amino acid sequence of which comprises or consists of the amino acid sequence set forth in SEQ ID NO: 1 in which each amino acid is a D amino acid and a phosphorodiamidate morpholino oligonucleotide the nucleotide sequence of which comprises or consists of the sequence set forth in SEQ ID NO: 2.

34. The lyophilized composition according to claim 33, wherein the amino acid sequence of the cell penetrating peptide consists of the amino acid sequence set forth in SEQ NO: 1 in which each amino acid is a D amino acid and the nucleotide sequence of the phosphorodiamidate morpholino oligonucleotide consists of the nucleotide sequence set forth in SEQ ID NO:2.

35. The method according to any one of claims 1 to 23, the pharmaceutical composition according to any one of claims 26 to 32; or the lyophilized composition according to claim 33 or claim 34, wherein the conjugate corresponds to formula VP-001 set forth in figure 5.

36. The method according to any one of claims 1 to 23, the pharmaceutical composition according to any one of claims 26 to 32; or the lyophilized composition according to claim 33 or claim 34, wherein the conjugate comprises a flexible linker linking the CPP to the phosphorodiamidate morpholino oligonucleotide, preferably wherein the amino acid sequence of the flexible linker only includes D-amino acids.

37. The method, the pharmaceutical composition, or the lyophilized composition according to claim 36, wherein the C-terminus of the CPP is linked to the 3' end of the phosphorodiamidate morpholino oligonucleotide via the flexible linker.

38. The method, the pharmaceutical composition, or the lyophilized composition according to claim 36 or claim 37, wherein the amino acid sequence of the flexible linker comprises or consists of an amino acid sequence selected from the group consisting of: GGGGS, GGGGSGGGGS (SEQ ID NO: 3), GAS, GGG, GSG, GTG, GGTAGSTGG (SEQ ID NO: 4), GASGGASG (SEQ ID NO: 5) and GASG.

39. The method, the pharmaceutical composition, or the lyophilized composition according to claim 38, wherein the amino acid sequence of the flexible linker consists of the amino acid sequence set forth in SEQ ID NO:5.

40. A vial comprising the pharmaceutical composition according to any one of claims 26 to 32 or 35 to 39; or the lyophilized composition according to any one of claims 33 to 39.

41. The vial according to claim 40, wherein the vial is a glass vial.

42. The vial according to claim 40 or 41, comprising a chlorobutyl rubber stopper.

Images