gene editing drug for rho-r135w-adrp
By combining CRISPR/Cas9 technology with AAV vectors, the RHO-R135W mutation is specifically targeted, and only the mutated allele is knocked out, which solves the problem of retinitis pigmentosa caused by RHO gene mutation and achieves the restoration of rod cell function and therapeutic effect.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHIGENOVO CO LTD
- Filing Date
- 2022-08-04
- Publication Date
- 2026-04-24
AI Technical Summary
There is currently no effective treatment for retinitis pigmentosa caused by RHO gene mutations, especially the RHO-R135W mutation which is common in Chinese patients, and traditional drug and surgical treatments are ineffective.
Using CRISPR/Cas9 technology and AAV vectors, we designed specific sgRNAs to target the mutation hotspot c.403C>T;p.Arg135Trp in Chinese RHO-adRP patients. The sgRNAs and Cas9 proteins were delivered to the retina via AAV viral vectors, knocking out only the mutant alleles without affecting the expression of normal alleles. The use of a small Cas9 subtype ensures in vivo therapeutic efficiency and safety.
This study achieved efficient knockout of the RHO-R135W mutation, restored rod cell function, improved photoreceptor function, and provided an effective gene editing therapy for RHO gene mutations.
Smart Images

Figure BDA0003782247310000191 
Figure BDA0003782247310000201 
Figure BDA0003782247310000211
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedicine, specifically to a gene-editing drug based on CRISPR / Cas9 and AAV technologies for Chinese RHO-adRP patients. Background Technology
[0002] Retinitis Pigmentosa (RP) is a group of inherited blinding eye diseases characterized by progressive loss of function of photoreceptor cells and / or retinal pigment epithelial cells. The initial clinical manifestation of RP is night blindness. Most patients develop the disease in childhood or adolescence. As the disease progresses, the visual field gradually narrows, accompanied by a gradual decline in central vision. Most patients become legally blind around the age of 40-50. Currently, there is no effective treatment for RP (traditional drug and surgical treatments are largely ineffective). RHO (rhodopsin) is the earliest discovered RP-causing gene, responsible for approximately 25%-30% of autosomal dominant RP (adRP), making it the most prevalent causative gene for adRP.
[0003] The RHO gene encodes a G protein-coupled receptor with a seven-transmembrane structure. This 348-amino acid protein is primarily expressed on the outer segment discs of rod cells, existing as highly ordered dimers or multimers, accounting for over 85% of the total disc membrane protein. It plays a crucial role in photoelectric signal transduction by binding to opsins. Mutations in the RHO gene lead to the production of abnormal proteins, which cause disease through dominant-negative effects. Since one DNA strand in RHO-mutant patients remains the normal allele, and the protein encoded by that single strand is sufficient to maintain the normal function of the RHO protein, the ideal treatment for this gene is to specifically edit the mutation site, silencing the translation of the mutant strand, inhibiting the expression of the mutant protein, while maintaining the integrity of the normal allele.
[0004] Since early 2013, the third-generation artificial endonuclease CRISPR / Cas9 has brought a revolutionary leap to genome editing technology. Gene editing is a set of technologies used to modify the genome of organisms. It utilizes endonucleases to create double-strand breaks at specific locations in the genome, and then repairs these breaks through the endogenous DNA repair process. During this repair process, the genome can be modified to obtain the desired genotype. Compared with the first-generation artificial endonuclease ZFN and the second-generation artificial endonuclease TALEN, CRISPR / Cas9 has been widely used in cell line modification, disease animal model establishment, and gene therapy due to its advantages such as simple target design, ease of operation, low cost, and high editing efficiency.
[0005] As of March 2019, the HGMD database contained 219 RHO gene mutations, with missense mutations being the majority, primarily located in the transmembrane region. P23H and S334ter are hotspots for RHO mutations in Western countries, and multiple studies have demonstrated that gene editing technology can treat RP caused by single-base mutations in RHO. Latella et al. used gene editing therapy on a rat model carrying the P23H mutation, encoding two sgRNAs on a plasmid and co-injecting it with SpCas9 subretinally, resulting in decreased RHO protein expression and thus improving the function of photoreceptors in rod cells. Bakondi et al. used an adRP rat model carrying the Rho S334 point mutation, injecting a single sgRNA / Cas9 plasmid subretinally and using electroporation to stimulate photoreceptors to absorb the plasmid, selectively deleting the mutated allele. Previous studies have found significant differences in the gene mutation spectrum between China and Western countries; P23H and S334ter, hotspots for RHO mutations in Western countries, are not common in Chinese RP patients. In recent years, among more than a thousand patients with recurrent pulmonary erythematosus (RP) who have visited Peking University Third Hospital, several RP families with confirmed RHO gene mutations were collected. The mutation hotspots of the RHO gene c.403C>T and p.Arg135Trp were found. These mutation sites enhance the binding ability of RHO to rhodopsin repressor (V-Arrestin), causing RHO to accumulate in endocytic vesicles, resulting in abnormal cellular endocytosis and ultimately leading to a severe RP phenotype.
[0006] Adeno-associated virus (AAV) vectors, as gene transfer vectors, have become the most widely used vectors for retinal gene therapy due to their advantages such as non-pathogenicity, low immunogenicity, effective transfer of target genes, and long-term expression of carried therapeutic genes. However, the carrying capacity of AAV vectors is limited to a maximum of 4.7 kb, and typically, sgRNA and Cas9 must be packaged separately. In this case, both vectors must enter the target tissue or organ simultaneously to exert their effects, thus reducing targeting efficiency. If the sgRNA element and the Cas9 protein nucleic acid sequence are to be assembled into the same vector, the Cas9 protein with the shortest possible sequence must be used. Therefore, based on the reported smaller Cas9 PAM sequence, the inventors screened and functionally validated sgRNAs that can specifically knock out the mutant RHO gene, and finally obtained sgRNAs that can effectively edit the RHO-R135W mutation and knock out the RHO-R135W mutant protein both in vivo and in vitro. Summary of the Invention
[0007] This application provides a gene-editing drug based on CRISPR / Cas9 and AAV technologies for Chinese patients with RHO-adRP. In RP patients caused by the RHO-R135W mutation, one allele expresses normal RHO protein, while the other mutated allele produces a negative effector protein. Therefore, this invention selects a treatment strategy based on knocking out only the mutated RHO allele without affecting the expression of the normal allele.
[0008] The sgRNA of this invention can specifically target the mutation hotspots c.403C>T and p.Arg135Trp in the Chinese RHO-adRP population, knocking out the mutant alleles while retaining the normal alleles to achieve the therapeutic goal. In this application, a smaller Cas9 subtype is selected during the sgRNA screening process to ensure that only a single AAV virus needs to be injected during in vivo treatment, thus ensuring in vivo treatment efficiency and safety. This invention has verified the sgRNA editing efficiency and off-target effects using the 293T cell line in vitro, ensuring the high efficiency and safety of sgRNA editing. Furthermore, this invention has further verified the knockout effect of sgRNA on mutant RHO proteins, ensuring the functional effectiveness of sgRNA. This invention has further verified the editing efficiency of sgRNA using a humanized mouse model with patient mutation sites, ensuring the in vivo effectiveness of sgRNA.
[0009] On one hand, the present invention provides a vector comprising a sequence encoding gRNA, the sequence encoding gRNA comprising the nucleotide sequence shown in SEQ ID NO:3 or SEQ ID NO:5.
[0010] In some implementations, the vector also contains a sequence encoding the Cas protein.
[0011] In some implementations, the Cas protein includes the Cas9 protein.
[0012] In some implementations, the Cas9 protein includes KKH-SaCas9, SauriCas9, and SlugCas9 / SlugCas9-HF.
[0013] In some embodiments, the sequence encoding the Cas protein comprises the nucleotide sequence shown in any one of SEQ ID NOs:67-70.
[0014] In some implementations, when the Cas9 protein is KKH-SaCas9, the sequence encoding the gRNA contains the nucleotide sequence shown in SEQ ID NO:3.
[0015] In some implementations, when the Cas9 protein is SauriCas9 or SlugCas9 / SlugCas9-HF, the sequence encoding the gRNA contains the nucleotide sequence shown in SEQ ID NO:5.
[0016] In some implementations, the carrier also includes a core insertion signal. For example, the core insertion signal may be an SV40 core insertion signal, a BP core insertion signal, or a Nuc core insertion signal.
[0017] In some implementations, the nuclear insertion signal contains a nucleotide sequence shown in any one of SEQ ID NOs:71-73.
[0018] In some implementations, the vector sequentially comprises the following elements: a Cas protein sequence promoter, a Kozak sequence, a nuclear insertion signal, a BGH sequence, a sequence encoding the Cas protein, a nuclear insertion signal, a gRNA sequence promoter, and a sequence encoding the gRNA.
[0019] In some embodiments, the Cas protein sequence promoter is selected from the EFS promoter (SEQ ID NO:64), hGRK1 promoter (SEQ ID NO:65), CMV promoter, and Cag promoter. In a specific embodiment, the Cas protein sequence promoter comprises the nucleotide sequence shown in SEQ ID NO:64 or 65.
[0020] In some implementations, the Kozak sequence comprises the nucleotide sequence shown in SEQ ID NO:66.
[0021] In some implementations, the BGH sequence comprises the nucleotide sequence shown in SEQ ID NO:74.
[0022] In some embodiments, the gRNA sequence promoter is the U6 promoter. In a specific embodiment, the gRNA sequence promoter comprises the nucleotide sequence shown in SEQ ID NO:75.
[0023] In some implementations, the vector includes a viral vector.
[0024] In some implementations, the viral vector is an adenovirus-associated vector.
[0025] In some implementations, the adenovirus-associated vector is the AAV8 vector.
[0026] On the other hand, the present invention provides the use of the carrier in the preparation of a drug for treating retinitis pigmentosa caused by RHO-135 mutation. Attached Figure Description
[0027] Figure 1 The image of the editing carrier is shown.
[0028] Figure 2 The T7E1 assay was used to assess the editing efficiency of sgRNA in 293T cells.
[0029] Figure 3 The results show the efficiency of sgRNA editing in cells as detected by Hi-tom sequencing.
[0030] Figure 4 The following diagram illustrates the editing efficiency of the T7E1 for detecting different kernel input signals: A. Combination of kernel input signals; B. Cutting strips from a group of kernel input signals.
[0031] Figure 5 The Hi-tom test demonstrates the editing efficiency of different kernel input signals.
[0032] Figure 6 The effect of Western blot analysis on the expression level of RHO-135 mutant protein was shown.
[0033] Figure 7 The study demonstrates the changes in intracellular localization of the RHO-135 mutant protein detected by fluorescence.
[0034] Figure 8 A schematic diagram of sgRNA-edited RHO-135-GFP cells is shown.
[0035] Figure 9 The results show that sgRNA can effectively knock down RHO-135-GFP expression; A. Fluorescence signal detection by fluorescence imaging; B. Detection of cell fluorescence signal intensity by microplate reader.
[0036] Figure 10 The proportion of GFP-positive cells was detected by flow cytometry.
[0037] Figure 11 The results of sgRNA off-target efficiency detection are shown.
[0038] Figure 12 The comparison results of the in vitro editing efficiency of KKH-sg3, Sauri-sg2, Slug-sg2 and RHO135-sgRNA1 / 2 are shown.
[0039] Figure 13 A schematic diagram of the optimized carrier spectrum is shown.
[0040] Figure 14 The results show the T7E1 assay used to detect RHO gDNA editing in the retina of KKH-sg3, Sauri-sg2, and Slug-sg2 mice.
[0041] Figure 15The results show the T7E1 assay used to detect RHO gDNA editing in the retina of RHO135-sgRNA1 mice.
[0042] Figure 16 The results show the efficiency of mouse retinal RHO gDNA editing detected by Hi-tom sequencing of KKH-sg3, Sauri-sg2, and Slug-sg2.
[0043] Figure 17 The results show the efficiency of RHO gDNA editing in the retina of RHO135-sgRNA1 mice as detected by Hi-tom sequencing.
[0044] Figure 18 This demonstrates that editing the RHO mutant genome with ZVS203e-1 in mice can lead to the early formation of a stop codon; * indicates a stop codon. Detailed Implementation
[0045] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0046] Terminology Definition
[0047] In this application, the term "c.403C>T" generally refers to a mutation in the nucleotide sequence of the RHO gene, where position 403 (from the 5' end to the 3' end, with "A" in the start ATG of the coding sequence being the first position) is changed from cytosine (C) to thymine (T). This mutation can lead to a mutation in the amino acid encoded by the RHO gene, for example, causing the amino acid to change from arginine (Arg) to tryptophan (Trp). In this application, the term "p.Arg135Trp" generally refers to a mutation in the amino acid at position 135 of the RHO protein, where the amino acid is changed from arginine (Arg) to tryptophan (Trp).
[0048] In this application, the term "double-strand breaks (DSB)" generally refers to the phenomenon that occurs when the two single strands of a double-stranded DNA molecule are cut at the same location. Double-strand breaks can induce DNA repair, potentially leading to genetic recombination, and cellular systems also act on double-strand breaks that occur at other times. Double-strand breaks can occur regularly during the normal cell replication cycle and can be enhanced under certain conditions, such as ultraviolet light or DNA break inducers (e.g., various chemical inducers). Many inducers can cause DSBs to occur indiscriminately throughout the genome, and DSBs can be induced and repaired regularly in normal cells. During repair, the original sequence can be reconstructed with perfect fidelity; however, in some cases, small insertions or deletions (called "indels") are introduced at the DSB site. In some cases, double-strand breaks can also be induced specifically at a particular location, which can be used to induce directed or preferential gene modifications at selected chromosomal locations. In many cases, the tendency for homologous sequences to recombine during DNA repair (and replication) can be utilized, which is the basis for the application of gene editing systems such as CRISPR. This homology-guided repair is used to insert the target sequence, provided by using a "donor" polynucleotide, into the desired chromosomal location.
[0049] The term "knockout" refers to an alteration in the nucleic acid sequence of a gene that reduces the biological activity of the polypeptide normally encoded by the gene by at least 80% compared to the unaltered gene. For example, the alteration can be an insertion, substitution, deletion, frameshift mutation, or missense mutation of one or more nucleotides.
[0050] In this application, the terms “polypeptide,” “peptide,” “protein,” and “protein protein” are used interchangeably and generally refer to a polymer having amino acids of any length. The polymer may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acid components. These terms also cover polymers containing modified amino acids. These modifications may include: disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation (such as binding to a labeled component). The term “amino acid” includes natural and / or non-natural or synthetic amino acids, including glycine and its D and L optical isomers, as well as amino acid analogs and peptide mimics.
[0051] The terms “polynucleotide,” “nucleotide,” “nucleotide sequence,” “nucleic acid,” and “oligonucleotide” are used interchangeably and generally refer to a polymeric form of nucleotides of any length, such as deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, multiple loci (one locus) as defined by ligation analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. Polynucleotides may contain one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be made before or after polymer assembly. The sequence of nucleotides can be interrupted by non-nucleotide components. Polynucleotides can be further modified after polymerization, such as by conjugation with labeled components.
[0052] In this application, the term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host for transferring inserted nucleic acid molecules into host cells and / or between host cells. The vector may include vectors primarily for inserting DNA or RNA into cells, vectors primarily for replicating DNA or RNA, and expression vectors primarily for transcription and / or translation of DNA or RNA. The vector also includes vectors having multiple of the aforementioned functions. The vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, by culturing suitable host cells containing the vector, the vector can produce the desired expression product.
[0053] In this application, the term "plasmid" generally refers to a DNA molecule other than chromosomes or nucleoids in organisms such as bacteria and yeast, which exists in the cytoplasm, has the ability to replicate autonomously, maintain a constant copy number in daughter cells, and express the genetic information it carries. Plasmids are used as gene vectors in genetic engineering research.
[0054] In this application, the term "retroviral vector" generally refers to a virus that can controllably express exogenous genes but cannot self-package into viral particles capable of replication. Such viruses often possess reverse transcriptase. Retroviruses contain at least three genes: gag, containing the proteins that make up the viral core and structure; pol, containing the reverse transcriptase; and env, containing the genes that make up the viral capsid. Through retroviral transfection, a retroviral vector can randomly and stably integrate its own genome and the exogenous genes it carries into the host cell genome; for example, it can integrate CAR molecules into the host cell.
[0055] In this application, the term "lentiviral vector" generally refers to a diploid RNA virus vector belonging to the retrovirus family. A lentiviral vector is based on the genome of a lentivirus, with several sequences related to viral activity removed to ensure its biological safety. The sequence and expression structure of the target gene required for the experiment are then introduced into this genomic backbone, and the vector is prepared. Through lentiviral vector transfection, the retroviral vector can randomly and stably integrate its own genome and the foreign gene it carries into the host cell genome; for example, it can integrate CAR molecules into host cells.
[0056] In this application, the term "and / or" should be understood to mean any one of the options or both of the options.
[0057] In this application, the term "comprising" generally means including the explicitly specified features, but does not exclude other elements.
[0058] RP and RHO genes
[0059] On the one hand, this application provides a method for treating retinitis pigmentosa.
[0060] In this application, the term "retinitis pigmentosa (RP)" generally refers to a genetic disease that causes retinal degeneration. More than 80 genes have been identified as being associated with RP, and these genes are involved in autosomal recessive inheritance (50-60%), autosomal dominant inheritance (AD, 30-40%), and X-linked inheritance (5-15%). RP is characterized by progressive vision loss due to abnormal function of the retinal receptor cells (cones and rods) and / or retinal pigment epithelial cells. Clinical manifestations of RP may include night blindness, progressive visual field defects, central vision loss after macular involvement, and ultimately blindness. Electroretinogram (ERG) shows decreased or even extinguished rod cell function. The main fundus change in RP is equatorial retinal pigment disorder, with osteocyte-like pigmentation, gradually progressing towards the posterior pole and ora serrata. The retinal photoreceptor layer (RP) gradually atrophies, photoreceptor cells, and the choroidal capillary layer, revealing the large choroidal vessels. The retina appears bluish-gray, the retinal arteries become narrowed, and the optic disc becomes waxy yellow and atrophied. Retinal vascular stenosis, waxy yellow optic disc color, and osteocyte-like pigmentation are the typical triad of RP (Hartong D. et al., 2006). Methods for assessing retinal function and morphology may include best-corrected visual acuity (BCVA), fundus autofluorescence, visual field testing, ERG, fundus color photography, optical coherence tomography (OCT), and fluorescein angiography (FFA). Methods for assessing visual function may include BCVA and visual field testing.
[0061] The vector or method described in this application can enable subjects in need to have a functional RHO gene.
[0062] In some cases, the RP described in this application can be caused by mutations in the RHO gene. There are various RHO gene mutations associated with RP, which can lead to abnormally functioning rhodopsin encoded by the RHO gene. These mutations can include, but are not limited to, missense, nonsense, insertion, and deletion mutations. For example, the mutation site can include the c.C403T mutation site. As another example, the mutation site can cause amino acid changes, and the amino acid mutation can include changes in p.Arg135Trp. In this application, the method can include ensuring that the desired subject does not possess a heterozygous mutation site in the RHO gene, and the mutation site can be selected from c.C403T.
[0063] It can repair any one or more mutations that enable the RHO gene to function in subjects in need. For example, it can remove, restore, or correct pathological variants such as c.C403T.
[0064] In vivo or in vitro methods
[0065] The method described in this application may include knocking out the mutation site and / or reducing the expression level of the mutation site. Methods for knocking out genes or reducing gene expression levels may include gene knockout, conditional gene knockout (e.g., using Cre / LoxP and / or FLP-frt systems), inducible gene knockout (e.g., knockout based on the Cre / LoxP system, including tetracycline induction, interferon induction, hormone induction, adenovirus induction, etc.), gene knockout using random insertion mutations (e.g., gene capture), gene knockout induced by RNAi, zinc finger nuclease (ZNF)-mediated gene editing, transcription activator-like effector nuclease (TALEN)-mediated gene editing, clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated proteins (Cas) (CRISPR / Cas) system-mediated gene editing and / or NgAgo-gDNA gene editing. For any genome editing strategy, gene editing can be confirmed by sequencing or PCR analysis.
[0066] In some cases, the methods described in this application may be in vivo cell-based methods. In some cases, the methods include editing the genomic DNA of a subject's cells. For example, this may include editing mutations in the RHO gene in the subject's cells (e.g., photoreceptor cells and / or retinal progenitor cells). For example, the gene mutation may be the c.C403T mutation. While certain cells may be ideal targets for ex vivo methods or therapies, efficient delivery methods may also allow for the direct delivery of desired reagents to such cells in vivo. In some cases, the methods may include targeting and editing to relevant cells. The lysis of other cells may also be prevented by using promoters that are active only in certain cells and / or developmental stages.
[0067] The added promoter is inducible, therefore, if nucleic acid molecules are delivered in a plasmid vector, the delivery time can be controlled. The duration of intracellular residence of the delivered nucleic acid or protein can also be adjusted by altering its half-life. In vivo methods can save certain processing steps, but require high editing efficiency. In vivo therapy eliminates the problems and losses associated with ex vivo therapy and implantation.
[0068] In vivo methods facilitate the production and administration of therapeutic products. The same treatment method or therapy can potentially be used to treat more than one subject, for example, many subjects with the same or similar genotypes or alleles.
[0069] The methods described in this application may include in vitro methods. In some cases, subject-specific induced pluripotent stem cells (iPSCs) can be obtained. The genomic DNA of these iPSCs can then be edited using the methods described in this application. For example, the method may include editing within or near a mutation site in the RHO gene of the iPSC to eliminate the amino acid mutation of p.Arg135Trp, for example, the gene mutation could be the c.C403T mutation. Next, the gene-edited iPSCs can be differentiated into other cells, such as photoreceptor cells or retinal progenitor cells. Finally, the differentiated cells (e.g., photoreceptor cells or retinal progenitor cells) can be implanted into a subject.
[0070] In other cases, photoreceptor cells or retinal progenitor cells can be isolated from the subject. Next, the genomic DNA of these photoreceptor cells or retinal progenitor cells can be edited using the methods described in this application. For example, the method may include editing within or near a mutation site in the RHO gene of the photoreceptor cell or retinal progenitor cell to eliminate the amino acid mutation of p.Arg135Trp, for example, the gene mutation could be the c.C403T mutation. Finally, the gene-edited photoreceptor cells or retinal progenitor cells can be implanted into the subject.
[0071] In other cases, mesenchymal stem cells can be isolated from the body in some cases, or from bone marrow or peripheral blood in others. Next, the genomic DNA of these mesenchymal stem cells can be edited using the methods described in this application. For example, the method may include editing within or near a mutation site in the RHO gene of the mesenchymal stem cells to eliminate the amino acid mutation of p.Arg135Trp, for example, the gene mutation could be the c.C403T mutation. Next, the gene-edited mesenchymal stem cells can be differentiated into any type of cell, such as photoreceptor cells or retinal progenitor cells. Finally, the differentiated cells, such as photoreceptor cells or retinal progenitor cells, can be implanted into a subject.
[0072] The method may include a comprehensive analysis of the therapeutic agent prior to administration. For example, the entire genome of the calibration cells may be sequenced to ensure that no off-target effects, if any, are located at a genomic position that corresponds to minimal risk to the subject. Furthermore, specific cell populations, including clonal cell populations, may be isolated prior to implantation.
[0073] The method described in this application can be used without affecting the expression level and / or function of the wild-type RHO gene in the subject.
[0074] Gene editing
[0075] The methods described in this application may include methods for creating single-stranded or double-stranded DNA breaks at specific locations within the genome by using site-directed nucleases to cut DNA at precise target sites. Such breaks can be periodically repaired by endogenous cellular processes, such as HDR and non-homologous end joining (NHEJ). These two main DNA repair processes consist of a range of alternative pathways. NHEJ directly joins the DNA ends resulting from double-strand breaks, sometimes resulting in the loss or addition of nucleotide sequences, which may disrupt or enhance gene expression. HDR utilizes homologous or donor sequences as templates to insert specific DNA sequences at the break point. Homologous sequences can be in the endogenous genome, such as sister chromatids. Alternatively, the donor can be a foreign nucleic acid, such as a plasmid, single-stranded oligonucleotide, double-stranded oligonucleotide, or virus. These foreign nucleic acids may contain regions highly homologous to the loci cleaved by the nuclease, and may also contain additional sequences or sequence variations (including deletions of target loci that can be incorporated into the cleavage). The third repair mechanism can be microhomology-mediated end joining (MMEJ), also known as "alternative NHEJ (ANHEJ)," which involves small deletions and insertions at the cleavage site, with genetic outcomes similar to NHEJ. MMEJ can utilize homologous sequences of a few base pairs flanking the DNA break site to drive more favorable DNA end joining repair outcomes. In some cases, it is possible to predict potential repair outcomes based on analysis of the potential microhomology of the DNA break site.
[0076] These gene editing mechanisms can all be used to remove the gene mutation sites required in this application. The method described in this application may include creating one or two DNA breaks at a location near the expected mutation site in the target locus; the two DNA breaks may be double-strand breaks or two single-strand breaks. In some cases, the removal may include inducing a double-strand break in the RHO allele containing the mutation. The break can be achieved using a site-directed peptide. Site-directed peptides (e.g., DNA endonucleases) can introduce double-strand breaks or single-strand breaks into nucleic acids (e.g., genomic DNA). Double-strand breaks can stimulate endogenous DNA repair pathways in cells, such as HDR, NHEJ, or MMEJ. NHEJ can repair cleaved target nucleic acids without a homologous template.
[0077] In some cases, homologous recombination can be used to insert exogenous polynucleotide sequences into target nucleic acid cleavage sites. The exogenous polynucleotide sequence can be referred to as a donor polynucleotide (or donor, donor sequence, or polynucleotide donor template). A donor polynucleotide, a portion of a donor polynucleotide, a copy of a donor polynucleotide, or a portion of a copy of a donor polynucleotide can be inserted into the target nucleic acid cleavage site. The donor polynucleotide can be an exogenous polynucleotide sequence, i.e., a sequence that is not naturally present at the target nucleic acid cleavage site.
[0078] HDR occurs when a homologous repair template or donor is available. The homologous donor template may contain at least a portion of the wild-type RHO gene or cDNA. At least a portion of the wild-type RHO gene or cDNA may be fragments or combinations of exon 1, exon 2, exon 3, exon 4, exon 5, intron regions, or the complete RHO gene or cDNA. The donor template may be a single-stranded or double-stranded polynucleotide. The donor template may be delivered by AAV. The homologous donor template may contain sequences homologous to sequences flanking the target nucleic acid cleavage site. For example, the donor template may have an arm homologous to the 3q22.1 region. The donor template may also have an arm homologous to the pathological variant c.C403T. Sister chromatids may be used by the cell as repair templates. However, for gene editing purposes, the repair template may be provided as a foreign nucleic acid, such as a plasmid, double-stranded oligonucleotide, single-stranded oligonucleotide, or viral nucleic acid. Using exogenous donor templates, additional nucleic acid sequences (e.g., transgenes) or modifications (e.g., single or multiple base alterations or deletions) can be introduced between homologous flanking regions, thereby incorporating additional or altered nucleic acid sequences into the target locus. MMEJ can utilize homologous sequences located a few base pairs flanking the cleavage site to drive favorable end-joining DNA repair outcomes. In some cases, the likely repair outcome can be predicted based on analysis of potential microhomology in the nuclease target region.
[0079] CRISPR / Cas system
[0080] In this application, the term "CRISPR / Cas system" or "CRISPR-Cas system" generally refers to a nuclease system composed of clustered regularly spaced short palindromic repeats (CRISPR) and CRISPR-related proteins (i.e., Cas proteins) capable of cleaving almost all genomic sequences in eukaryotic cells that are adjacent to the protospacer-adjacent motif (PAM). "CRISPR / Cas system" can be used collectively to refer to transcripts involving CRISPR-related ("Cas") genes, as well as other elements involved in their expression or directing their activity, which may include sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or its active portion), tracr partner sequences (in the context of an endogenous CRISPR / Cas system, encompassing "homogeneous repeats" and processed partial holotypes), directing sequences (also referred to as "spacers" in the context of an endogenous CRISPR / Cas system), or other sequences and transcripts derived from CRISPR loci. Five types of CRISPR systems have been identified (e.g., type I, type II, type III, type U, and type V).
[0081] In this application, the term "Cas protein" also refers to "CRISPR-associated protein" and generally refers to a class of enzymes that are complementary to CRISPR sequences and are able to use CRISPR sequences as guides to recognize and cut specific DNA strands. Non-limiting examples of Cas proteins include: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csxl2), Cas1O, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csf1, Csf2, Csf3, Csf4, and / or their homologues or modified forms thereof. In some embodiments, the Cas protein is the Cas9 protein.
[0082] In this application, the term "Cas9 protein" or "Cas9 nuclease," also known as Csn1 or Csx12, generally refers to a class of proteins in the type II CRISPR / Cas system that are involved in both crRNA biosynthesis and the destruction of invading DNA. Cas9 proteins typically comprise a RuvC nuclease domain and an HNH nuclease domain, which cleave the two distinct strands of a double-stranded DNA molecule, respectively. Cas9 proteins have been described in various bacterial species such as *Streptococcus thermophilus*, *Listeria innocua* (Gasiunas, Barrangou et al. 2012; Jinek, Chylinski et al. 2012), and *Streptococcus pyogenes* (Deltcheva, Chylinski et al. 2011). For example, the amino acid sequence of the Cas9 protein of *Streptococcus pyogenes* can be found in the SwissProt database accession number Q99ZW2; the amino acid sequence of the Cas9 protein of *Neisseria meningitides* can be found in the UniProt database accession number A1IQ68; the amino acid sequence of the Cas9 protein of *Streptococcus thermophilus* can be found in the UniProt database accession number Q03LF7; and the amino acid sequence of the Cas9 protein of *Staphylococcus aureus* can be found in the UniProt database accession number J7RUA5.
[0083] The CRISPR / Cas system can include many short repetitive sequences called “repeat”. When expressed, repetitive sequences can form secondary structures (e.g., hairpins) and / or contain unstructured single-stranded sequences. Repetitive sequences often occur in clusters and frequently differ between species due to evolution. These repetitive sequences are regularly spaced with unique intermediate sequences called “spacers,” forming repeat-spacer-repeat loci. Spacers are identical to or highly homologous to known invasive alien sequences. The spacer-repeat unit encodes crispRNA (crRNA), which is processed into the mature form of the spacer-repeat unit. The crRNA contains a “seed” or spacer sequence (a naturally occurring form in prokaryotes that targets invasive alien nucleic acids) that targets the target nucleic acid. The spacer region sequence is located at the 5' or 3' end of the crRNA.
[0084] The CRISPR / Cas system may also include multinucleotide sequences encoding CRISPR-related proteins (Cas proteins). Cas genes encode nucleases involved in the biogenesis and interference phases of crRNA function in prokaryotes. Some Cas genes contain homologous secondary and / or tertiary structures.
[0085] In nature, the biosynthesis of crRNA in type II CRISPR systems requires trans-activated CRISPR RNA (tracrRNA). tracrRNA can be modified by endogenous RNase III and then hybridize with the crRNA repetitive sequence in pre-crRNA. Endogenous RNase III can be recruited to cleave the pre-crRNA. The cleaved crRNA can be trimmed by exonucleases to produce the mature crRNA form (e.g., 5' end trimming). tracrRNA can maintain hybridization with crRNA, and both tracrRNA and crRNA associate with site-directed peptides (e.g., Cas9). The crRNA in the crRNA-tracrRNA-Cas9 complex can guide the complex to a target nucleic acid that can hybridize with crRNA. Hybridization of crRNA with the target nucleic acid activates Cas9 for cleavage of the target nucleic acid. The target nucleic acid in type II CRISPR systems is called the protospacer adjacent motif (PAM). In fact, PAM is essential for facilitating the binding of site-directed peptides (e.g., Cas9) to the target nucleic acid. Type II systems (also known as Nmeni or CASS4) can be further subdivided into Type II-A (CASS4) and Type II-B (CASS4a). For examples of CRISPR / Cas9 systems that can be used for RNA programmable gene editing, see Jinek et al., Science, 337(6096): 816-821 (2012), International Patent Application Publication No. WO2013 / 176772, which provides numerous examples and applications of CRISPR / Cas endonuclease systems that can be used for site-specific gene editing.
[0086] gRNA
[0087] In this application, the term "sequence encoding gRNA" generally refers to the DNA sequence of said gRNA that can be obtained by transcription.
[0088] The gRNA described in this application can bind to sequences in target nucleic acids. Nucleic acids (or portions thereof) targeting the genome can interact with the target nucleic acid in a sequence-specific manner through hybridization (i.e., base pairing). The nucleotide sequence of the sgRNA can vary depending on the sequence of the target nucleic acid.
[0089] In the CRISPR / Cas system of this application, the gRNA sequence can be programmed to hybridize with a target nucleic acid adjacent to a PAM sequence recognizable by the Cas protein used in the system. The gRNA may or may not perfectly match the target sequence. Cas proteins typically have a specific PAM sequence that can be recognized in the target DNA.
[0090] For example, the Cas9 protein may be derived from *Streptococcus pyogenes*, which recognizes a PAM containing the sequence 5'-NRG-3' in the target nucleic acid, where R contains A or G, and N can be any nucleotide. As another example, the Cas9 protein may be derived from *Staphylococcus aureus*, which (SaCas9) recognizes a PAM containing the sequence 5'-NNGRR(T)-3' in the target nucleic acid, where R contains A or G, and N can be any nucleotide. In some more specific cases, the PAM sequence recognized by SaCas9 may contain 5'-NNGRR-3', where R contains A or G, and N can be any nucleotide. For example, the PAM described in this application may contain the nucleotide sequence shown in any of SEQ ID NOs:7-12.
[0091] For example, the sequence encoding the gRNA may contain the nucleotide sequence shown in any one of SEQ ID NOs:1-6.
[0092] The gRNAs used in the CRISPR system described in this application can be synthesized by chemical methods, such as high-performance liquid chromatography (HPLC). For example, two or more RNA molecules can be linked together. Longer RNAs (e.g., RNA encoding Cas9) can be obtained through enzymatic reactions. In the art, various types of RNA modifications can be introduced during or after the chemical and / or enzymatic synthesis of RNA, for example, modifications to enhance stability, reduce innate immune responses, and / or enhance other properties.
[0093] carrier
[0094] This application provides a vector. The vector described in this application may contain the nucleic acid molecule of this application (e.g., a sequence encoding gRNA and / or gRNA). Polynucleotides may be delivered by non-viral delivery vectors, including but not limited to nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small RNA conjugates, aptamer-RNA chimeras, and RNA fusion protein complexes.
[0095] The vector may also be a polynucleotide vector, such as a plasmid, cosmid, or transposon. Suitable vectors have been widely described and are well known in the art. Those skilled in the art will understand that vectors containing the nucleic acid molecules described in this application may also contain other sequences and elements necessary for the vector to replicate in prokaryotic and / or eukaryotic cells. For example, the vector described in this application may include a prokaryotic replicon, i.e., a nucleotide sequence having the ability to guide and maintain the replication of the host itself in a prokaryotic host cell (e.g., a bacterial host cell). Such replicons are well known in the art. In some cases, the vector may include a shuttle element that adapts the vector for replication and integration in prokaryotes and eukaryotes. Furthermore, the vector may also include a gene capable of expressing a detectable marker (e.g., a drug resistance gene). The vector may also have a reporter gene, such as a gene encoding a fluorescent or other detectable protein.
[0096] In some cases, the vector may include a viral vector, such as AAV, lentivirus, retrovirus, adenovirus, herpesvirus, and hepatitis virus. Methods for generating viral vectors containing nucleic acid molecules (e.g., the isolated nucleic acid molecules described in this application) as part of the vector genome are well known in the art and can be performed by those skilled in the art without extensive experimentation. In other cases, the vector may be a recombinant AAV viral particle packaged with the nucleic acid molecules described in this application. Methods for generating recombinant AAV may include introducing the nucleic acid molecules described in this application into a packaging cell line, generating AAV infection, auxiliary functions of the AAV cap and rep genes, and recovering the recombinant AAV from the supernatant of the packaging cell line. Various types of cells can be used as packaging cell lines. For example, usable packaging cell lines include, but are not limited to, HEK 293 cells, HeLa cells, and Vero cells.
[0097] In some cases, the vector may be an adenovirus-associated vector (AAV). In this application, the term "adenovirus-associated vector" generally refers to a vector derived from naturally occurring and available adeno-associated viruses (AAVs) and artificial AAVs. The AAVs may include different serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, as well as any AAV variants or mixtures. The AAV genome typically has terminal inverted repeats (ITRs) at both ends. The term "ITR" or "terminal inverted repeat" refers to a nucleic acid sequence segment present in AAVs and / or recombinant AAVs that forms a T-shaped palindromic structure required to complete the AAV lysis and latency life cycle. Techniques for generating AAV vectors are standard in the art, involving providing cells with the polynucleotides to be delivered, the rep and cap genes, and the AAV genome to be packaged for helper viral functions. Production of AAV vectors typically requires the presence of the following components within a single cell (referred to herein as a packaging cell): the rAAV genome, AAV rep and cap genes separated from (e.g., not present in) the rAAV genome, and a helper virus. The AAV rep and cap genes can originate from any AAV serotype, or from an AAV serotype with a different ITR from the AAV genome, including but not limited to the AAV serotypes described herein. The AAV vector in this application may contain gRNA targeting a mutation site in the RHO gene.
[0098] In some cases, the sequence encoding the gRNA may reside in the same vector as the nucleic acid encoding the Cas9 protein. In other cases, the sequence encoding the gRNA may reside in different vectors than the nucleic acid encoding the Cas9 protein.
[0099] The AAV vector of this application can be derived from various species. For example, the AAV can be avian AAV, bovine AAV, or goat AAV. In some embodiments, the vector is AAV8.
[0100] The method of this application may include generating packaging cells, i.e., generating cell lines that can be used to stably express all the essential components of AAV. For example, integrating the AAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes isolated from the AAV genome, and plasmids (or plasmids) carrying selection markers such as neomycin resistance genes into the genome of the cell. The AAV genome has been introduced into bacterial plasmids via methods such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. ETSA, 79: 2077-2081). The packaging cell lines can then be infected with helper viruses (e.g., adenoviruses). In addition to plasmids, adenoviruses or baculoviruses may also be used to introduce the AAV genome and / or the rep and cap genes into the packaging cells.
[0101] In this application, the term "subject" generally refers to any subject to whom a diagnosis, treatment, or therapy is desired. For example, in this application, the RHO gene of the subject in need contains the c.C403T mutation site. In some cases, the subject may include mammals. In some cases, the subject may include humans. In some cases, the subject may include East Asians.
[0102] In this application, the term "application" refers to the introduction of cells and / or vectors into a subject, or a desired site of the subject, via a method or route. The cells and / or vectors may express the nucleic acid molecules of this application (e.g., sequences encoding gRNAs and / or gRNAs) at the desired site (e.g., sites of damage or repair), thereby producing the desired effect. Cells (or their differentiated progeny) and / or vectors may be applied via any suitable route that delivers the cells (or their differentiated progeny) and / or vectors to the desired site in the subject, with at least a portion of the implanted cells (or cellular components) and / or vectors remaining viable. After application to the subject, cell survival can range from short periods of time, such as twenty-four hours, days, to long periods of time, even consistent with the patient's lifespan. In some cases, the application includes injection. For example, the vectors may be administered via systemic routes such as intraperitoneal or intravenous routes. For example, the application may include subretinal injection.
[0103] In patients with recurrent pneumonia (RP) caused by the RHO-R135W mutation, one allele expresses normal RHO protein, while the other mutated allele produces a negative effector protein. Therefore, the treatment strategy of this invention achieves the therapeutic goal by knocking out only the mutated RHO allele without affecting the expression of the normal allele. Since the CRISPR / Cas9 gene editing system targets specific sites using sgRNA sequences, the sgRNAs designed for this treatment strategy must include the mutation site. This invention first designs six sgRNAs targeting the patient's mutation site, namely the RHO gene c.403C>T; p.Arg135Trp mutation, with PAM sequences of NNGG (SauriCas9, SlugCas9) and NNNRRT (mutant SaCas9, KKH-SaCas9), respectively. These sgRNAs are then constructed into corresponding plasmids containing Cas9. Secondly, a cell line overexpressing wild-type RHO (RHO-WT) and a cell line overexpressing mutant RHO (RHO-135) were constructed in 293T cells, and the above plasmids were transfected to verify their editing efficiency and specificity in cells. sgRNAs that edit only the mutant RHO-135 sequence were obtained through T7E1 screening, and their editing efficiency was verified by Hi-tom sequencing. Finally, Sauri-sg2, Slug-sg2, and KKH-SaCas9-sg3 were selected as capable of specifically editing the mutant RHO sequence without affecting the normal RHO sequence. Furthermore, taking KKH-SaCas9-sg3 as an example, the nuclear entry signals flanking Cas9 were optimized, and nuclear entry signals with high editing efficiency were selected.
[0104] Furthermore, Western spectroscopy was used to verify whether the aforementioned effective sgRNAs could effectively knock down the expression level of mutant RHO. Experimental results showed that Sauri-sg2, Slug-sg2, and KKH-SaCas9-sg3 could all effectively knock down the expression of mutant RHO protein. To more directly verify the knockout effect of sgRNAs on mutant RHO, an RHO-135-GFP reporter cell line was constructed in 293T cells. The knockout effect of sgRNAs on mutant RHO protein was further verified by the fluorescence intensity of GFP. Immunofluorescence, ELISA reader detection of fluorescence intensity, and flow cytometry analysis showed that Sauri-sg2, Slug-sg2, and KKH-SaCas9-sg3 could effectively reduce the GFP fluorescence intensity and GFP positivity rate in cells, further indicating that the aforementioned sgRNAs can effectively knock out the RHO-135 mutant protein. In addition, in vitro off-target next-generation sequencing results showed that the aforementioned sgRNAs have good specificity and extremely low off-target rates.
[0105] To verify the therapeutic effect of sgRNA in vivo, a humanized mouse model with a mutant site was first constructed. Secondly, to ensure the safety of the drug in vivo, the broad-spectrum EFS promoter was replaced with the photoreceptor-specific promoter hGRK1, and the modified plasmid was packaged into an AAV2 / 8 vector expressing Cas9 and sgRNA for in vivo mouse experiments. In the mouse experiments, the viral vector containing the aforementioned Cas9 and sgRNA was injected subretinally into the model mice. Three months after the subretinal injection, retinal tissue was collected, gDNA was extracted, and PCR primers were designed near the editing site. The DNA sequence of the mouse retina after injection was obtained by PCR, and the effectiveness of sgRNA in vivo was verified by T7E1 and Hi-tom sequencing. The T7E1 assay results showed that Sauri-sg2, Slug-sg2, and KKH-SaCas9-sg3 could effectively edit the mutant RHO-135 DNA sequence in vivo. Further sequencing of the edited sites, including Hi-tom and TA cloning, revealed that Sauri-sg2 achieved an editing efficiency of 30% in mice, Slug-sg2 achieved 20%, and KKH-SaCas9-sg3 achieved 25%. Furthermore, functional assays demonstrated that Sauri-sg2 could effectively restore retinal function and structure in mouse models.
[0106] In summary, Sauri-sg2, Slug-sg2, and KKH-SaCas9-sg3 can effectively edit the RHO-135 mutant sequence both in vitro and in vivo, exhibiting good specificity. After sgRNA editing, the RHO-R135W mutant protein was effectively eliminated, and the disease phenotype in model mice was significantly alleviated. These results suggest that Sauri-sg2, Slug-sg2, and KKH-SaCas9-sg3 are potential therapeutic agents for retinitis pigmentosa caused by RHO-135 mutations.
[0107] Example
[0108] Example 1. sgRNA Design and Vector Construction
[0109] First, the editing efficiency of Cas9 subtypes with coding sequence lengths less than 4Kb reported in the current literature and the mutation sites of PAM sequences were screened. Based on the RHO-135 site of the PAM sequence identified by the screened Cas9 types, 6 sgRNAs were designed for the RHO-R135W mutation site. The specific information of the sgRNAs is shown in Table 1.
[0110] Table 1. sgRNA sequence information
[0111]
[0112]
[0113] sgRNA was synthesized in vitro and a plasmid vector capable of intracellular expression was constructed. The vector map is shown below. Figure 1 .
[0114] Example 2
[0115] Detection of intracellular DNA editing effects
[0116] To assess the editing effect of sgRNA, a 293T cell line overexpressing RHO-135 was first constructed using a lentivirus expressing RHO-135. The constructed vector was then transfected into the RHO-135 cell line via transient PEI transfection. Genomic DNA was collected from the cells 48 hours post-transfection. Primers were designed near the editing site to amplify the edited DNA, and the editing effect was assessed using T7E1 and Hi-tom sequencing.
[0117] The T7E1 endonuclease can recognize incompletely matched double-stranded DNA. Cas9, guided by sgRNA, cuts the target DNA, causing a DNA double-strand break (DSB). The cell repairs the DSB through the DNA repair mechanism of non-homologous end joining (NHEJ), eventually forming an Indel (Insertion and Deletion) mutation at the cleavage site. By designing PCR primers near the mutation site, gDNA-F1 / R1 can be used to detect RHO-gDNA sequences without mutation sites in 293T, and CDS-F1 / R1 can be used to detect exogenously overexpressed RHO-135 sequences with mutation sites (primer sequences are shown in Table 2). gDNA-F / R can PCR obtain an 835bp band, and CDS-F / R can PCR obtain a 1045bp band. After obtaining the edited target gDNA fragment by PCR, in vitro annealing is performed. If the WT gDNA fragment is edited, it can be digested by T7E1 into two DNA fragments of 280bp and 555bp. After the 135 mutant gDNA is edited, it can be digested by T7E1 into two DNA fragments of 395bp and 650bp.
[0118] Table 2. Primer sequence information for T7E1 detection
[0119]
[0120] The T7E1 experimental results showed that no cleavage bands were observed in the 135-mock group of mutant DNA without sgRNA transfection, while the target bands were observed in all 135-transfected sgRNA groups. Among the sgRNAs, the PCR fragments of the 135-KKH-sg2, 135-Sauri-sg1, 135-Sauri-sg3, 135-Slug / Slug-HF-sg1, and 135-Slug / Slug-HF-sg3 groups were effectively cleaved by T7E1, indicating that the above sgRNAs have no specificity for editing the mutant RHO genome. In contrast, no bands were detected after T7E1 cleavage in the WT-KKH-sg1, WT-KKH-sg3, WT-Sauri-sg2, and WT-Slug / Slug-HF-sg2 groups, indicating that they have specific cleavage effects on 135 mutant DNA. Among them, the cutting strips of KKH-sg3, Sauri-sg2, and Slug / Slug-HF-sg2 are relatively clear. Figure 2 The result indicates that it has high cleavage efficiency and can be used to specifically knock out mutant RHO.
[0121] Furthermore, the editing efficiency was verified by Hi-tom sequencing experiments. Primers were designed near the editing site (sequences shown in Table 3), and after obtaining the target fragment by PCR, Hi-tom sequencing was performed, achieving a sequencing depth of approximately 5000 reads.
[0122] Table 3. Primer sequences for detecting intracellular editing Hi-tom
[0123]
[0124] Sequencing results showed that the editing efficiency of KKH-sg3 was 18%, Sauri-sg2 was 17%, Slug-sg2 was 31%, and Slug-HF-sg2 was approximately 29%. Figure 3 Since Slug-HF is a variant of SlugCas9 and its editing efficiency is lower than that of Slug, KKH-sg3, Sauri-sg2, and Slug-sg2 were selected as the main candidate sgRNAs.
[0125] Example 3
[0126] Vector nuclear signal optimization
[0127] For the CRISPR / Cas9 editing system to function, Cas9 and sgRNA need to enter the cell nucleus and target the cellular gDNA. Therefore, the nuclear entry efficiency of Cas9 is closely related to the editing efficiency of the vector. To further improve the editing efficiency of the vector, using KKH-sg3 as an example, the effects of different nuclear entry signals on the editing efficiency of the vector were detected by T7E1 and Hi-tom sequencing. The combinations of nuclear entry signals are shown in [link to related study]. Figure 4 Experimental results from A.T7E1 show that cleavage bands can be detected in all of the above nuclear input signal groups. Figure 4 B) indicates that all of the above nuclear signal vectors can edit the 135 mutant DNA sequence.
[0128] To further determine the editing efficiency of different nuclear entry signals, the edited DNA sequence was sequenced using Hi-tom sequencing, and the Indel mutation rate formed after editing was analyzed. Experimental results showed that, except for bilateral BP-NLS, all other nuclear entry signals could achieve an editing efficiency of over 20% for KKH-sg3, with the SV40-Cas9-Nuc nuclear entry signal exhibiting the highest editing efficiency. Figure 5 Therefore, this nuclear insertion signal was used for subsequent functional testing and carrier construction.
[0129] Example 4
[0130] KKH-sg3, Sauri-sg2, and Slug-sg2 can effectively knock out the RHO-135 mutant protein.
[0131] The ultimate therapeutic goal of gene editing is to eliminate the RHO mutant protein. To further determine whether the Indel mutation formed after editing can effectively knock out the RHO protein, Western blot experiments were used to further examine the knockout effects of KKH-sg3, Sauri-sg2, and Slug-sg2 on the RHO-135 mutant protein. Western blot results showed that compared with the RHO-135-mock group, the RHO-135-KKH-sg3, Sauri-sg2, and Slug-sg2 groups showed a significant downregulation of RHO protein levels. Figure 6 This indicates that transfecting the RHO-135 cell line with a vector that can express sgRNA and Cas9 can effectively inhibit the expression of the RHO-135 mutant protein.
[0132] Example 5
[0133] KKH-sg3, Sauri-sg2, and Slug-sg2 can effectively reduce RHO-135-GFP positive signals.
[0134] To more directly examine the effect of sgRNA editing on the RHO-135 mutant protein, lentiviral vectors expressing RHO-WT-GFP and RHO-135-GFP fusion were constructed, and 293A cell lines overexpressing RHO-WT-GFP and RHO-135-GFP were established. Literature reports that the RHO-135 mutant protein binds to V-arrestin and accumulates in endocytic vesicles, affecting the endocytic pathway. Fluorescence detection confirmed these findings. Compared to the RHO-WT group, the RHO-135 protein showed significant aggregation in the cytoplasm and significant co-localization with V-arrestin. Figure 7 ).
[0135] Since RHO-135 and GFP are fusion proteins, the Indel mutation in the RHO-135 sequence after sgRNA editing leads to a Frameshift mutation in the GFP coding region, ultimately preventing normal expression of the GFP protein and resulting in a decrease in the intensity and proportion of cellular fluorescence signals. Figure 8 To further determine the effects of KKH-sg3, Sauri-sg2, and Slug-sg2 on the RHO-135 mutant protein, KKH-sg3, Sauri-sg2, and Slug-sg2 were transfected into the RHO-135-GFP cell line, respectively. The knockout efficiency of sgRNA on the RHO-135 protein was assessed 72 hours after transfection by measuring the intensity of the GFP fluorescence signal and the proportion of GFP-positive cells.
[0136] Fluorescence imaging results showed that, compared with the Mock group, the GFP-positive signal was significantly weaker in the KKH-sg3, Sauri-sg2, and Slug-sg2 groups. Figure 9 (A). Furthermore, the intensity of GFP fluorescence signal was detected using a microplate reader. The results showed that the fluorescence signal intensity of the KKH-sg3, Sauri-sg2, and Slug-sg2 groups was significantly lower than that of the mock group. Figure 9 (B). The above results indicate that KKH-sg3, Sauri-sg2, and Slug-sg2 can all effectively knock down RHO-135-GFP expression.
[0137] Furthermore, flow cytometry analysis was used to further examine the changes in the proportion of GFP-positive cells after KKH-sg3, Sauri-sg2, and Slug-sg2 editing. The flow cytometry results showed that the proportion of GFP-positive cells was significantly reduced in the KKH-sg3, Sauri-sg2, and Slug-sg2 groups, decreasing to as low as 65%. Figure 10 ).
[0138] In summary, KKH-sg3, Sauri-sg2, and Slug-sg2 can effectively play an editing role in cells and can effectively reduce the expression of RHO-135 mutant protein.
[0139] Example 6
[0140] KKH-sg3, Sauri-sg2, and Slug-sg2 do not have off-target sites within the human genome.
[0141] To assess the off-target risks of KKH-sg3, Sauri-sg2, and Slug-sg2, off-target efficiency was detected by amplicon deep sequencing. First, off-target sites of the aforementioned sgRNA sequences were predicted using off-finder online off-target site prediction software (target information is shown in Tables 4 and 5). Second, in the off-target detection experiment, high concentrations of KKH-sg3, Sauri-sg2, and Slug-sg2 plasmids were transfected into HEK-293T cells to achieve efficient expression of Cas9 and sgRNA in the cells. Three days after transfection, cellular gDNA was collected, and potential off-target site sequences were amplified by PCR. The amplified products were then subjected to next-generation high-throughput sequencing.
[0142] Table 4. Off-target site information for KKH-sg3.
[0143]
[0144]
[0145] Table 5. Off-target site information for Sauri / Slug-sg2
[0146]
[0147]
[0148]
[0149] Sequencing results showed that, compared with the mock group sequencing results, the sequence differences in the KKH-sg3, Sauri-sg2, and Slug-sg2 groups were less than 0.015%. Figure 11 This indicates that all three sgRNAs have good specificity and safety.
[0150] Example 7
[0151] KKH-sg3, Sauri-sg2, and Slug-sg2 showed significantly higher editing efficiency than RHO135-sgRNA1 and superior specificity compared to RHO135-sgRNA2.
[0152] Previous studies have shown that RHO135-sgRNA1 (sequence: CACCACGTACCACTCGATGGC, SEQ ID NO:76) and RHO135-sgRNA2 (sequence: CACTCGATGGCCAGGACCACC, SEQ ID NO:77) designed based on SaCas9 targeting the RHO-R135W mutation can effectively edit the mutated RHO sequence in patients, and RHO135-sgRNA1 does not affect the RHO-WT sequence. To further determine whether the editing efficiency of KKH-sg3, Sauri-sg2, and Slug-sg2 is superior to that of RHO135-sgRNA1 and RHO135-sgRNA2, in vivo experiments in cells and mice were conducted simultaneously.
[0153] In cell experiments, plasmids expressing KKH-sg3, Sauri-sg2, Slug-sg2, RHO135-sgRNA1, and RHO135-sgRNA2 were transfected into 293T cell lines overexpressing RHO-135. Genomic DNA was collected 48 hours after transfection. Primers were designed near the editing sites to amplify the edited DNA, and the editing effect was detected by T7E1 and Hi-tom sequencing. The T7E1 results showed that KKH-sg3, Sauri-sg2, and RHO135-sgRNA1 only edited the RHO-R135W mutant sequence, while RHO135-sgRNA2 edited both the RHO-WT and RHO-R135W sequences. This indicates that the editing specificity of KKH-sg3, Sauri-sg2, Slug-sg2, and RHO135-sgRNA1 is higher than that of RHO135-sgRNA2. Furthermore, Hi-tom sequencing results showed that the editing efficiency of KKH-sg3 was approximately 20%, Sauri-sg2 approximately 21%, and Slug-sg2 approximately 30%, all higher than that of RHO135-sgRNA1 (see results). Figure 12 ).
[0154] Example 8
[0155] KKH-sg3, Sauri-sg2, and Slug-sg2 effectively edited RHO-135 mutant DNA in vivo with significantly higher efficiency than RHO135-sgRNA1.
[0156] To further examine the in vivo editing effect of sgRNA, a humanized disease mouse model was constructed by replacing the mouse RHO sequence with a human RHO gene sequence containing the R135W mutation site. The editing efficiencies of KKH-sg3, Sauri-sg2, and Slug-sg2 were then tested in mice and compared with the editing efficiency of the more specific RHO135-sgRNA1.
[0157] RHO protein is mainly expressed in photoreceptor cells. To reduce the drug risks of sgRNA in vivo, the Cas9 expression cassette promoter was optimized to a human G protein-coupled receptor kinase 1 promoter (hGRK1 promoter). The hGRK1 promoter can specifically initiate the expression of downstream genes in photoreceptor cells. The optimized sgRNA vector was packaged into AAV8 in HEK 293 cells (see diagram). Figure 13 ).
[0158] In the efficacy study of the humanized mouse model, 1-month-old mice were injected subretinally with AAV8 viral vectors expressing KKH-sg3, Sauri-sg2, Slug-sg2, and Cas9 (AAV8-KKH-sg3, AAV8-Sauri-sg2, and AAV8-Slug-sg2). Each sgRNA viral injection dose included two groups: 1×10⁹ vg (1E⁹) / eye and 3×10⁹ vg (3E⁹) / eye. An RHO135-sgRNA1 group was also included for comparison, with an injection dose of 3×10⁹ vg (3E⁹) / eye. All treatment groups were simultaneously injected with an equal volume of EGFP-expressing virus as an indicator, with a total injection volume of 1 μL / eye. The control group received an equal volume of viral solvent. Two months after drug injection, mouse retinal tissue was collected, and gDNA was extracted from GFP-positive regions. The cleavage efficiency was assessed using T7E1 and Hi-tom sequencing. The T7E1 experimental results showed that, two months after drug injection, KKH-sg3, Sauri-sg2, and Slug-sg2 injection doses of 1E9 and 3E9 all exhibited significant cleavage bands. Figure 14 The cleavage band of the RHO135-sgRNA1 group was weaker compared to that of KKH-sg3, Sauri-sg2, and Slug-sg2. Figure 15 The above results indicate that KKH-sg3, Sauri-sg2, Slug-sg2, and RHO135-sgRNA1 can effectively edit the RHO mutant gene in mice, and the in vivo editing effects of KKH-sg3, Sauri-sg2, and Slug-sg2 are better than those of RHO135-sgRNA1.
[0159] Furthermore, the cleavage efficiency was detected by Hi-tom sequencing (primer information is shown in Table 6). The results showed that after 2 months of treatment, the KKH-sg3, Sauri-sg2, and Slug-sg2 1E9 injection groups all achieved effective editing of over 10%, and the 3E9 editing efficiency reached over 20%. Figure 16 The editing efficiency of RHO135-sgRNA13E9 injection dose is only about 5%. Figure 17 In summary, KKH-sg3, Sauri-sg2, and Slug-sg2 can effectively edit the RHO-R135W sequence in mice, and their editing efficiency is significantly higher than that of RHO135-sgRNA1.
[0160] Table 6. Primer sequences for detecting Hi-tom editing in model mice.
[0161]
[0162] Furthermore, protein translation prediction of the edited mutant RHO gene was performed using nucleotide sequence analysis software. The results showed that the edited sequence could lead to the premature formation of multiple stop codons in the mutant sequence. Figure 18 This leads to the termination of protein translation.
[0163] RHO-R135W mutation-induced RP is caused by the negative function of the RHO-R135W protein. The sgRNA invented in this application can effectively edit the RHO-R135W mutation sequence and knock down its protein expression in vitro and in vivo. Therefore, AAV8 carrying KKH-sg3, Sauri-sg2, and Slug-sg2 may be a potential therapeutic drug for RHO-R135W mutation-induced RP.
Claims
1. A vector comprising a sequence encoding a Cas protein and a sequence encoding a gRNA, wherein... When the Cas protein is KKH-SaCas9, the sequence encoding the gRNA is the nucleotide sequence shown in SEQ ID NO: 3; or When the Cas protein is SauriCas9, SlugCas9, or SlugCas9-HF, the sequence encoding the gRNA is the nucleotide sequence shown in SEQ ID NO:
5.
2. The vector according to claim 1, wherein when the Cas protein is KKH-SaCas9, the sequence encoding the Cas protein comprises the nucleotide sequence shown in SEQ ID NO: 67; and When the Cas protein is SauriCas9, SlugCas9, or SlugCas9-HF, the sequence encoding the Cas protein contains the nucleotide sequence shown in SEQ ID NO: 68, SEQ ID NO: 69, or SEQ ID NO:
70.
3. The carrier according to claim 1 or 2, wherein the carrier further comprises a nucleus insertion signal.
4. The vector according to claim 3, wherein the nuclear insertion signal comprises the nucleotide sequence shown in any one of SEQ ID NOs: 71-73.
5. The vector according to claim 1 or 2, wherein the vector sequentially comprises the following elements: a Cas protein sequence promoter, a Kozak sequence, a nuclear insertion signal, a BGH sequence, a sequence encoding the Cas protein, a nuclear insertion signal, a gRNA sequence promoter, and a sequence encoding gRNA.
6. The vector according to claim 5, wherein the Cas protein sequence promoter is selected from EFS, hGRK1, CMV and Cag promoters.
7. The vector according to claim 5, wherein the Cas protein sequence promoter comprises the nucleotide sequence shown in SEQ ID NO: 64 or 65.
8. The vector according to claim 5, wherein the gRNA sequence promoter is the U6 promoter.
9. The vector according to claim 8, wherein the U6 promoter comprises the nucleotide sequence shown in SEQ ID NO:
75.
10. The carrier according to claim 5, wherein The Kozak sequence comprises the nucleotide sequence shown in SEQ ID NO: 66; The BGH sequence contains the nucleotide sequence shown in SEQ ID NO:
74.
11. The vector according to claim 1 or 2, wherein the vector comprises a viral vector.
12. The vector according to claim 11, wherein the viral vector is an adenovirus-associated vector.
13. The vector according to claim 12, wherein the adenovirus-associated vector is an AAV8 vector.
14. Use of the carrier according to any one of claims 1-13 in the preparation of a medicament for treating retinitis pigmentosa caused by RHO-135 mutation.
Citation Information
Patent Citations
Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
WO2013176772A1
Methods and compositions for RHO-adRP based gene editing
CN113038971A