Tuberculosis mRNA vaccine, and preparation method therefor and use thereof

By combining mRNA vaccines containing Mycobacterium tuberculosis early secretory antigens, PE/PPE family antigens, and latent-associated antigens, the problem of insufficient protective efficacy of existing vaccines has been solved, achieving effective prevention and treatment of tuberculosis, especially significant inhibition of latent and active tuberculosis.

WO2026037379A1PCT designated stage Publication Date: 2026-02-19BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV +4
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/114779
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-14
Filing Date
2025-08-14
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Existing tuberculosis vaccines, such as BCG, offer limited protection for children and adults and are ineffective in preventing primary infection and the spread of tuberculosis. The protective effect of existing vaccines declines over time, and there is a lack of more effective alternatives.

Method used

By employing a combination of multiple Mycobacterium tuberculosis antigens, including early secretory antigens, PE/PPE family antigens, and latent-associated antigens, mRNA vaccines are prepared and lipid nanoparticle carriers are used to form prophylactic and therapeutic vaccines that can elicit strong cellular and humoral immune responses.

Benefits of technology

It significantly inhibits the proliferation of Mycobacterium tuberculosis, providing effective protection against and treating tuberculosis, especially effective against latent and active tuberculosis, and enhances the immune response to tuberculosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025114779-FTAPPB-I100001
    Figure PCTCN2025114779-FTAPPB-I100001
  • Figure PCTCN2025114779-FTAPPB-I100002
    Figure PCTCN2025114779-FTAPPB-I100002
  • Figure PCTCN2025114779-FTAPPB-I100003
    Figure PCTCN2025114779-FTAPPB-I100003
Patent Text Reader

Abstract

Provided are a tuberculosis mRNA vaccine, and a preparation method therefor and the use thereof. Provided is an antigen, comprising the following antigen components: at least one Mycobacterium tuberculosis early-secreted antigen or an immunologically active fragment thereof, at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, and at least one Mycobacterium tuberculosis antigen latency-associated antigen or an immunologically active fragment thereof. Optionally, two or more of the antigens or immunologically active fragments thereof may form a fusion protein and / or a chimeric protein as an antigen component. The mRNA vaccine having various antigen components provides more effective preventive effects against tuberculosis.
Need to check novelty before this filing date? Find Prior Art

Description

Tuberculosis mRNA vaccine, preparation method and application thereof TECHNICAL FIELD

[0001] The present application relates to a tuberculosis mRNA vaccine, a preparation method and application thereof, and belongs to the technical field of biological products. BACKGROUND

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (MTB) complex. The disease can cause both pulmonary tuberculosis and extrapulmonary tuberculosis by invading organs such as liver, kidney, brain, and lymph nodes. The clinical symptoms of pulmonary tuberculosis mainly include cough and sputum, which may be accompanied by low fever, night sweats, weight loss, weakness, and other systemic symptoms; while the symptoms of extrapulmonary tuberculosis depend on the location of the organ.

[0003] For the treatment of tuberculosis, symptomatic treatment and specific treatment are usually included, mainly anti-tuberculosis drug treatment. For prevention, the tuberculin skin test is an important means for screening tuberculosis infection, and vaccination is an effective way of prevention.

[0004] So far, Bacillus Calmette-Guerin (BCG) is the only approved vaccine for preventing tuberculosis in the world. BCG is a live vaccine made of attenuated bovine MTB, which can effectively prevent tuberculous meningitis and miliary tuberculosis in infants and young children, but provides limited protection for children and adults, and the protective effect decreases with time. In addition, it is generally believed that BCG cannot prevent primary infection and has limited effect on preventing the spread of tuberculosis. The protective effect of other vaccines developed by the prior art, such as auxotrophic live attenuated tuberculosis vaccine, BCG recombinant vaccine, tuberculosis subunit vaccine and DNA vaccine, is also not ideal, and there is currently no new vaccine that can completely replace BCG.

[0005] Therefore, it is necessary to develop a new anti-TB vaccine. SUMMARY

[0006] One object of the present application is to provide a new vaccine for preventing and treating tuberculosis.

[0007] In the present application, a plurality of antigens are combined to prepare a tuberculosis vaccine.

[0008] In one aspect, the present application provides an antigen (single antigen molecule or composition) comprising the following antigen components:

[0009] at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0010] at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0011] at least one Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof;

[0012] In this case, two or more of the Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, and the Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof can be formed as a fusion protein and / or a chimeric protein as the antigen component.

[0013] According to a specific embodiment of the present application, the antigen of the present application can be a combination of a plurality of antigen molecules, or can be an antigen molecule in the form of a single molecule formed by fusion and / or chimerization of the plurality of antigen components.

[0014] According to a specific embodiment of the present application, the Mycobacterium tuberculosis early secretory antigen can be one or more selected from the group consisting of Ag85A, Ag85B, ESAT6, EspC (Rv3615c), EsxH (TB10.4), CFP10, and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0015] According to a specific embodiment of the present application, the Mycobacterium tuberculosis PE / PPE family antigen can be one or more selected from the group consisting of PPE18, Rv2770c (PPE44), Rv1806 (PE20), Rv3812 (PE_PGRS62), PE63, Rv1759c (PE-PGRS family protein WAG22), PPE14, Rv1818c (PE-PGRS33), Rv2608 (PPE42), Rv3872 (PE35), Rv1196 (PPE18), and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0016] According to a specific embodiment of the present application, the Mycobacterium tuberculosis latency associated antigen can be one or more selected from the group consisting of Rv1285 (cysD), Rv1813c, Rv2029c, Rv2031c, Rv2624c, Rv2628, Rv2660c, and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0017] In the present application, by combining multiple antigens for preparing a tuberculosis vaccine, the prepared tuberculosis vaccine can be used as a preventive vaccine for preventing latent activation, and also can be used as a therapeutic drug for treating active tuberculosis. In specific embodiments of the present application, the inhibitory effect on Mycobacterium tuberculosis is verified by experiments.

[0018] According to specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen comprises one or more of the following antigen components: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof.

[0019] Ag85A and Ag85B: A major component of secreted proteins in the culture filtrate of Mycobacterium tuberculosis is the Ag85 complex, which is a protein family with a relative molecular mass of 38000 composed of Ag85A, Ag85B, and Ag85C. Ag85A, 295 amino acids in length, is a key enzyme in the synthesis of the cell wall of Mycobacterium tuberculosis, responsible for catalyzing the acyl transfer reaction in the antigen 85 complex, transferring long-chain fatty acid esters to the coryne fatty acid of the cell wall. Ag85A can stimulate the body to produce humoral immunity, and also can stimulate Th1-type cellular immunity, inducing CD8+ T cell proliferation and the rise of IL-2 and IFN-γ. Ag85B, 285 amino acids in length, with a molecular weight of 34.6KD, also known as MPT59, Rv1886, is a Mycobacterium transferase related to bacterial cell wall synthesis, with multiple T cell epitopes, capable of inducing Th1 response and the production of IFN-γ.

[0020] In some specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B.

[0021] In some specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen has an amino acid sequence as shown in SEQ ID NO: 5.

[0022] According to specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis PE / PPE family antigen comprises PPE44.

[0023] Rv2770c (PPE44) is a predicted virulence factor that is expressed upregulated on infected guinea pig lungs. Yu Z et al. heterologously expressed PPE44 in a non-pathogenic, fast-growing M. smegmatis strain. Subcellular localization analysis indicated that Rv2770c is a cell wall-associated protein, which is postulated to be a candidate protein involved in host-pathogen interactions. Rv2770c also increased the survival of M. smegmatis within macrophages. Romano M et al. vaccinated mice with a plasmid DNA vaccine encoding PPE44 or with an adjuvanted recombinant PPE44 protein, which elicited strong cellular and humoral immune responses. A PPE44-based subunit vaccine provided protection against intracellular challenge with virulent M. tuberculosis, with efficacy comparable to that of Bacille Calmette-Guerin (BCG).

[0024] According to a specific embodiment of the present application, the antigen of the present application, wherein the Mycobacterium tuberculosis latency-associated antigen comprises Rv1813c.

[0025] Rv1813c: Protein expressed by MTB under hypoxic conditions, associated with the latent growth of the bacteria. Although Rv1813c is not required for in vitro survival of M. tuberculosis, the M. tuberculosis ΔRv1813c mutant was attenuated in a low-dose aerosol model of tuberculosis in mice, showing lower bacterial burden, delayed time to death, and reduced ability to stimulate the proinflammatory cytokines interleukin-1 beta (IL-1 beta) and IL-12.

[0026] In another aspect, the present application also provides a nucleic acid molecule, which can encode the antigen of the present application.

[0027] According to a specific embodiment of the present application, the nucleic acid molecule of the present application can be a combination of a plurality of nucleic acid molecules, or a single nucleic acid molecule form which can encode the plurality of antigen components.

[0028] According to a specific embodiment of the present application, the nucleic acid molecule of the present application comprises:

[0029] a nucleic acid molecule encoding at least one Mycobacterium tuberculosis early secreted antigen or an immunologically active fragment thereof;

[0030] a nucleic acid molecule encoding at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0031] a nucleic acid molecule encoding at least one Mycobacterium tuberculosis latency-associated antigen or an immunologically active fragment thereof.

[0032] According to a specific embodiment of the present application, when the antigen of the present application comprises a fusion protein and / or a chimeric protein antigen component, the nucleic acid molecule of the present application comprises a nucleic acid molecule encoding the fusion protein and / or the chimeric protein antigen component.

[0033] According to specific embodiments of the application, the nucleic acid molecule of the application can be DNA or RNA.

[0034] In another aspect, the application also provides an mRNA comprising an mRNA molecule encoding an antigen according to the application. The mRNA of the application can be used for the preparation of a Mycobacterium tuberculosis mRNA vaccine.

[0035] According to specific embodiments of the application, the mRNA of the application can be a composition of a plurality of mRNA molecules, or a single mRNA molecule that can encode a plurality of antigen components.

[0036] According to specific embodiments of the application, the mRNA of the application comprises:

[0037] an mRNA molecule encoding at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0038] an mRNA molecule encoding at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0039] an mRNA molecule encoding at least one Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof.

[0040] According to specific embodiments of the application, when the antigen according to the application comprises a fusion protein and / or a chimeric protein antigen component, the mRNA of the application comprises an mRNA encoding the fusion protein and / or the chimeric protein antigen component.

[0041] In some embodiments of the application, when the antigen according to the application comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B, the mRNA of the application comprises an mRNA encoding the chimeric protein. In some more specific embodiments, the chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B has an amino acid sequence as set forth in SEQ ID NO: 5, and the mRNA of the application comprises an mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments of the application, the coding region sequence of the mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 5 has a sequence as set forth in SEQ ID NO: 6.

[0042] In some embodiments of the application, the antigen of the application comprises PPE44, and the mRNA of the application comprises an mRNA molecule encoding PPE44. In some more specific embodiments, PPE44 has an amino acid sequence as set forth in SEQ ID NO: 9, and the mRNA of the application comprises an mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 9. In some embodiments of the application, the coding region sequence of the mRNA molecule encoding PPE44 is as set forth in SEQ ID NO: 10.

[0043] In some embodiments of the application, the antigen of the application comprises Rv1813c, and the mRNA of the application comprises an mRNA molecule encoding Rv1813c. In some more specific embodiments, Rv1813c has an amino acid sequence as set forth in SEQ ID NO: 7, and the mRNA of the application comprises an mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments of the application, the coding region sequence of the mRNA molecule encoding Rv1813c is as set forth in SEQ ID NO: 8.

[0044] According to some embodiments of the application, the mRNA molecule of the application has any one or more of the following modifications:

[0045] modified by 1-methylpseudouridine;

[0046] modified by 3' tailing (e.g. PloyA tail sequence);

[0047] modified by at least one 5' capping;

[0048] comprises at least one 5' UTR sequence;

[0049] comprises at least one 3' UTR sequence.

[0050] In some embodiments of the present application, the 5' cap modification in the mRNA of the present application can be selected from one of m7G, Cap0, Cap1, Cap2, modified Cap0, modified Cap1 and modified Cap2 structure, more specifically, can be Cap0, Cap1, Cap2, ARCA, Inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, any of the 5' cap structures mentioned in patent applications CN202310091020.3 and CN202310391954.9. The entire contents of CN202310091020.3 and CN202310391954.9 are hereby incorporated by reference.

[0051] In some embodiments of the present application, the PolyA tail sequence can be any of the PolyA tails mentioned in patent applications WO2024041641A1 and CN202311309226.5. The entire contents of WO2024041641A1 and CN202311309226.5 are hereby incorporated by reference.

[0052] The mRNA of the present application can be used to prepare a vaccine in the form of a lipid nanoparticle. Thus, in another aspect, the present application also provides a lipid nanoparticle loaded with the mRNA of the present application.

[0053] In another aspect, the present application also provides a pharmaceutical composition comprising: the mRNA of the present application, and a pharmaceutically acceptable excipient.

[0054] In another aspect, the present application also provides the use of the mRNA, the lipid nanoparticle or the pharmaceutical composition in the preparation of a tuberculosis mRNA vaccine.

[0055] In another aspect, the present application also provides a tuberculosis mRNA vaccine comprising the mRNA of the present application.

[0056] In some embodiments of the present application, the vaccine of the present application is in the form of a lipid nanoparticle.

[0057] In some more specific embodiments of the present application, the lipid nanoparticle comprises mRNA and lipid LNP, wherein: the lipid LNP comprises one or more of cationic lipids, supporting lipids, sterol substances and polymer-conjugated lipids.

[0058] According to a specific embodiment of the present application, the cationic lipid comprises one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azanediyl)bis(hexan-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 9-heptadecanol 8-((7-((3-(octylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amino)octanoate (T19), 9-heptadecanol 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amino)octanoate (T13).

[0059] According to a specific embodiment of the present application, the structure of T19 is:

[0060] According to a specific embodiment of the present application, the structure of T13 is:

[0061] According to a specific embodiment of the present application, the polymer-conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, PEG-DSG.

[0062] According to a specific embodiment of the present application, the supporting phospholipid comprises one or more of DSPC, DOPE, DOPC, DOPS.

[0063] According to a specific embodiment of the present application, the solid sterol comprises one or more of cholesterol, beta-sitosterol.

[0064] According to a specific embodiment of the present application, the molar ratio of each lipid component in the lipid LNP is: cationic lipid 35%-57.5%, supporting lipid 0%-16% or 5%-16%, solid sterol 27.5%-55%, polymer-conjugated lipid 0-3%, preferably 0.5%-2.5%, based on the total molar amount of the lipids being 100%.

[0065] According to a specific embodiment of the present application, the mRNA vaccine further comprises an adjuvant. The adjuvant used may be, for example, an aqueous solution of salt and sugar. Preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; and the sugar is selected from one or more of sucrose, trehalose.

[0066] In another aspect, the present application also provides a method for preparing the tuberculosis mRNA vaccine, comprising:

[0067] each of the mRNA molecules in the plurality of mRNA molecules is prepared into a lipid nanoparticle, and then the plurality of lipid nanoparticles are mixed with each other; or

[0068] the plurality of mRNA molecules in the plurality of mRNA molecules are mixed into a mixture, and then the mRNA mixture is prepared into a lipid nanoparticle.

[0069] The method for preparing the tuberculosis mRNA vaccine can further comprise mixing the lipid nanoparticle with an auxiliary material to prepare a vaccine product.

[0070] In some embodiments of the present application, the vaccine dosage form of the present application is a freeze-dried dosage form or a frozen dosage form.

[0071] In some embodiments of the present application, the vaccine of the present application is a muscle injection vaccine.

[0072] In some embodiments of the present application, the vaccine of the present application is a prophylactic and / or therapeutic tuberculosis vaccine targeting the spleen and / or the lung.

[0073] The tuberculosis vaccine of the present application can be used as a prophylactic vaccine for latent activation or as a therapeutic drug for treating active tuberculosis, and has a significant inhibitory effect on Mycobacterium tuberculosis. BRIEF DESCRIPTION OF DRAWINGS

[0074] FIG. 1 is an electrophoresis detection diagram of the synthesized partial antigen mRNA in the embodiment of the present application.

[0075] FIG. 2 is an electrophoresis detection diagram of the synthesized partial antigen mRNA in the embodiment of the present application.

[0076] FIG. 3 is an electrophoresis detection diagram of the synthesized partial antigen mRNA in the embodiment of the present application.

[0077] FIG. 4 shows the results of Western Blot qualitative detection of the expression of related antigens.

[0078] FIG. 5 shows the results of indirect detection of the expression of related antigens.

[0079] FIG. 6 shows the results of in vitro inhibition test of Mycobacterium tuberculosis by the vaccine of the embodiment of the present application.

[0080] FIG. 7 shows the results of challenge test of the vaccine of the embodiment of the present application. DETAILED DESCRIPTION

[0081] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present application, the technical solutions of the present application are described in detail as follows, but cannot be understood as limiting the implementable scope of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. The experimental methods not specified in the specific conditions in each embodiment are operated according to the conventional conditions in the field. Each starting reagent material used in the embodiments can be commercially available or prepared according to the prior art in the field.

[0082] Example 1

[0083] In this embodiment, various antigen combinations are designed, see Table 1.

[0084] Table 1: Antigen combinations

[0085] The amino acid sequences and corresponding mRNA sequences of each antigen used in this embodiment are shown in Table 2.

[0086] Table 2: Amino acid sequences and mRNA sequences of antigens

[0087] Rv2029c: Response to hypoxia, low levels of NO and CO levels, found to have phosphofructokinase-like domain, which can play a role in the utilization of fructose by Mtb.

[0088] Rv3872 (PE35): PE35 (Rv3872) gene of Mycobacterium tuberculosis exists in the difference region (RD), which is deleted in all bovine Mycobacterium vaccine strains. Hanif SN et al. used pUMCV6 DNA vaccine vector to clone the gene encoding PE35 antigen, which can induce antigen-specific Th-1 type (antigen-induced cell proliferation and IFN-γ secretion), lack of Th-2 type (IL-5 secretion) and anti-inflammatory (IL-10 secretion) response. In addition, multiple epitopes of PE35 induced cellular responses.

[0089] Rv1759c (PE-PGRS family protein Wag22): Campuzano J et al. designed a new vaccine to prevent Mycobacterium tuberculosis reactivation, using a chronic tuberculosis experimental model in B6D2F1 mice, they observed the continuous expression of Rv1759c on the cell wall of phagocytosed Mycobacterium in activated macrophages in lung granulomas, this antigen induced the production of IFN-γ after stimulation, indicating that this antigen may play an important role in maintaining the immune response of latent infection.

[0090] Rv2031c belongs to MTB dormancy regulating genes, which mainly expresses alpha-crystallin protein (HspX) in latent period, participates in universal cell stress response. It can regulate the metabolism of Mycobacterium tuberculosis in host cells, and is important for the survival of latent period. The depletion of the protein will worsen the tolerance of Mycobacterium tuberculosis to anaerobes. Therefore, it is considered as a potential candidate drug for promoting the survival of pathogens during hypoxia, which is similar to the latent period. In addition, its role in impairing immune response by blocking the differentiation of monocytes to DC cells has been recently confirmed.

[0091] Sequence optimization

[0092] In the present application, the mRNA sequence with high stability and high expression is designed by sequence optimization according to the amino acid sequence of the above antigen.

[0093] All mRNA sequence design indicators are within the allowable range, the number of unpaired bases is less, the CAI value is higher, and the design principle of high stability and high expression is met.

[0094] mRNA synthesis

[0095] The sequence-optimized gene is constructed into an mRNA universal vector, template DNA is prepared by PCR method for mRNA transcription, and Cap1 cap analog, N1-methyl pseudouracil and 120 nt Poly A tail are used for mRNA synthesis (each mRNA is 100% m1ψ modified, 5' cap structure is m7G(5')ppp(5')(2'OMeA)pG, 5'UTR sequence: GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC (SEQ ID NO: 47), 3'UTR sequence: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 48), Ploy A tail sequence is 120 nt A), to verify the expression of the related antigen.

[0096] The purified mRNA was detected by electrophoresis, as shown in Figures 1-3. In Figure 1, lanes 1-11 are Rv2031c, Rv2029c, Rv2628, Rv2660c, Rv1813c, Rv2624c, Rvl285, M72, Ag85A, Ag85B and IFN-γ, respectively, which have sizes close to the theoretical values and single bands. In Figure 2, lanes 1-6 are Ag85A, Ag85B, Rvl196, ESAT6, Rv2660c, CFP10, respectively, which have sizes close to the theoretical values and single bands. In Figure 3, lanes 1-9 are Rv0915c, Rv0934, Rv1759c, Rv1806, Rv2351c, Rv2770c, Rv2941, Rv3812, Rv3872, respectively, which have sizes close to the theoretical values and single bands.

[0097] Expression verification

[0098] The mRNA was transfected into 293T / 17 cells with a confluence of more than 70%, and Western blot detection was performed 48h after transfection. In the qualitative detection of antigen expression by Western Blot (as shown in Figure 4), some small proteins (<20kDa) failed to detect protein expression. Rv2624c, Ag85A, Rvl285, Rvl196, Rv2029c, Rv2031c and Rv1813c could detect antigen expression, and the protein size was consistent with the theoretical value, while Rv2628 and Rv2660c failed to detect expression by Western blot.

[0099] Since it is difficult to detect small molecular weight proteins by WB, indirect Elisa was used to qualitatively detect proteins. Intracellular proteins were taken 48h after cell transfection (without dilution, 2-fold dilution, 4-fold dilution) for Elisa detection. The sample coating order was Rv2628, Rv2660c, ESAT6, TB10.4, Control. Based on the above table, the OD values of each sample were detected by an enzyme-labeled instrument, and the OD values of the undiluted samples were plotted as a column chart (as shown in Figure 5). The OD values were higher than the blank control, indicating that each mRNA had different levels of expression.

[0100] Vaccine preparation

[0101] Since the TB vaccine is mainly based on CD4+ cell immunity, the project adopts the spleen-targeting LNP carrier T19-5 with strong cell immune response to prepare mRNA-containing lipid nanoparticles (mRNA-LNP), and the main quality control parameters are encapsulation efficiency > 90% and particle size 100-120 nm. Among them, the composition of LNP carrier T19-5 is T19: DSPC: PEG-DMG: CHOL with a mass ratio of 48: 16: 1.5: 34.5. T19, DSPC, PEG-DMG, and CHOL are dissolved in anhydrous ethanol to form organic phase A (the average concentration of lipids is 10 mg / ml). The mRNA to be carried is dissolved in a pH = 4.0 citric acid / sodium citrate buffer to form aqueous phase B (the concentration of mRNA is 0.54 mg / ml). The mRNA-LNP is prepared by mixing solution A and solution B in a volume ratio of 1:3 using a microfluidic device. After preparation, the mRNA-LNP is dialyzed in 20 mM Tris buffer for 24 h, and the solution is changed every 8 h. After 24 h, the mRNA-LNP vaccine product is obtained by passing through a 0.22 μm filter to remove bacteria.

[0102] In this embodiment, the parameters of the mRNA-LNP carrying mRNA encoding each antigen prepared are shown in Table 3. Each mRNA-LNP encodes a single component antigen.

[0103] Table 3

[0104] The particle size, PDI, and point encapsulation rate of each mRNA-LNP are within the quality standard range.

[0105] BCG suspension preparation: The BCG colonies on the upper layer of the Roche medium were scraped off and added to a sterile grinding flask containing 1 mL of sterile 1x PBS. The bacteria were ground and shaken thoroughly, and then left to stand for 15 minutes. The upper layer of the bacterial solution was aspirated into a 15 mL sterile centrifuge tube, and the OD 600 (0.3 = 10 7 CFU), and the bacterial solution was diluted to 10 6 CFU / 100 μL / mice for subcutaneous immunization.

[0106] Animal immunization

[0107] The mRNA vaccines corresponding to each antigen / antigen combination (i.e., multiple component antigens) of each experiment were subjected to animal experiments in batches, with 5 C57 mice in each group. The vaccine dose required for each mouse for each immunization was 5 μg of each antigen. Except for the BCG group, which was immunized subcutaneously at 100 μL, the remaining 9 groups were immunized by intramuscular injection at 50 μL per mouse, and immunized twice with an interval of 14 days.

[0108] After the blood collection, the spleen was isolated after the mice were soaked in 75% alcohol and placed in a 2 mL EP tube (with 1500 μL of 1640 medium containing double antibodies added in advance, pre-cooled on ice).

[0109] The spleen was soaked in mouse lymphocyte separation medium (Dako) and the spleen was ground to isolate the spleen lymphocytes using a 75 μm filter (Falcon) and a syringe core. The experimental operation was performed according to the requirements of the instructions. The isolated spleen lymphocyte group was resuspended with 1 mL of red blood cell lysis solution, and the red blood cells were lysed for 2-3 min. After adding 2 mL of 1xPBS to terminate the lysis, 1000xg centrifugation was performed for 5 min. The RPMI 1640 complete medium (without antibiotics, 1xnon-essential amino acids, 10 mM Hepes, 1 mM sodium pyruvate, 5x10 -5 M 2-mercaptoethanol) was resuspended and counted, and adjusted to 1x10 7 cells / mL, 4°C standby (100 μL / well added to BMDM after Mtb infection, supplemented with culture medium to 1 mL), and the remaining spleen cells were frozen.

[0110] MGIA experiment

[0111] Immortalized BMDM plating:

[0112] The immortalized BMDM was plated at 2x10 6 Cells / Wells into a 24-well plate one day in advance, and RPMI 1640 complete medium (without double antibiotics) was added. One duplicate well was set up for each sample. A total of 50 mice were dissected, i.e. 50 samples, 100 wells of cells, which were plated into two different 24-well plates for each group.

[0113] Evaluation of protective effect (MGIA experiment-co-culture):

[0114] The pre-plated BMDM cells were infected with Mtb at MOI: 5 (at the same time as the dissection of the mice), and after 4 hours, the cells were washed twice with 1x sterile PBS (to remove the adherent cell surface and extracellular bacteria), 10 6 Cells / 100 μL / Wells of immune mouse SMC (without antibiotics, 1xnon-essential amino acids, 10 mM Hepes, 1 mM sodium pyruvate, 5x10 -5 M 2-mercaptoethanol) was added to 1 mL, and co-incubated for 96 hours, with 500 μL of medium supplemented at 48h. The BCG group was added with 2 mg / ml 2-thiophenecarboxylic acid hydride (to inhibit the proliferation of BCG in the spleen cells, which has no effect on Mtb).

[0115] Evaluation of protective effect (MGIA experiment-coated CFU):

[0116] The observation hole and the repeated hole were observed for contamination, and one non-contaminated hole was selected for lysis. The cell solution was taken into an EP tube (frozen for cytokine detection), washed with 500 μL of sterile 1x PBS, and 500 μL of sterile 0.05% SDS was added for lysis for 2-3 min, and then diluted 10 times with sterile 1x PBS. -2 The sterile coating beads were evenly coated on 7H10 (containing OADC) at each concentration, 3 plates were repeated (6x48 samples per day = 288 plates), and incubated at 37°C for 4 weeks (during which the contamination and CFU growth were observed).

[0117] In this example, after the spleen cell lysate was incubated with MTB infected immortal BMDM for 4 days, it was diluted 100 times and evenly coated on 7H10 (containing OADC), incubated at 37°C for 4 weeks, and the CFU growth was counted as shown in Figure 6. The results showed that Ag85a+Ag85b, Rv3615c, Rv2031c, Rv2029c, Rv1813c, Rv3872, Rv1759c and Rv2770c had good immunogenicity as antigens, and could effectively inhibit the proliferation of Mycobacterium tuberculosis after immunization of mice.

[0118] Challenge experiment

[0119] The mice were immunized twice by intramuscular injection, with an interval of 2 weeks, and the immunization dose was 5 μg (mRNA), 100 μg (protein). One dose of BCG (10 3 CFU) was used as a positive control and administered intradermally. The negative control group was injected with the same volume of normal saline. Two weeks after the second immunization, the H37Rv strain was infected by aerosol route, and 20-50 bacteria were sent into the lungs. After 4 weeks, all surviving animals were killed. At autopsy, all lung lobes were removed from the chest cavity for individual manipulation of each lung lobe. The right lung homogenate was diluted 10 times in succession, and then diluted 10 times with sterile 1x PBS. -2 -10 -3 The sterile coating beads were evenly coated on 7H10 (containing OADC) at each concentration, 3 plates were repeated, and the colony formation was counted after incubation at 37°C for 21 days in 5% carbon dioxide. The number of colonies was calculated, and the data was expressed as the average recovery of bacteria in log10.

[0120] The results of the challenge experiment are shown in Figure 7. The results showed that Ag85ab+Rv1813c+Rv2770c showed significant protection, and the Mycobacterium tuberculosis load in the lungs and spleens of mice decreased significantly below the detection limit, significantly better than BCG.

[0121] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. An antigen comprising the following antigen components: at least one Mycobacterium tuberculosis early secreted antigen or an immunologically active fragment thereof; at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and at least one Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof; wherein Optionally, two or more of the Mycobacterium tuberculosis early secreted antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof can form a fusion protein and / or a chimeric protein as the antigen component.

2. The antigen of claim 1, wherein: the Mycobacterium tuberculosis early secreted antigen comprises one or more of the following antigens: Ag85A, Ag85B, a fusion protein of Ag85A or a fragment thereof and Ag85B or a fragment thereof, a chimeric protein of Ag85A or a fragment thereof and Ag85B or a fragment thereof; preferably, the Mycobacterium tuberculosis early secreted antigen comprises a chimeric protein of a fragment of Ag85A and a fragment of Ag85B; more preferably, the Mycobacterium tuberculosis early secreted antigen has an amino acid sequence as set forth in SEQ ID NO:

5.

3. The antigen of claim 1 or 2, wherein, the Mycobacterium tuberculosis PE / PPE family antigen comprises PPE44.

4. The antigen according to any one of claims 1 to 3, wherein, the Mycobacterium tuberculosis latency associated antigen comprises Rv1813c.

5. A nucleic acid molecule encoding the antigen of any one of claims 1 to 4.

6. An mRNA comprising the mRNA molecule encoding the antigen of any one of claims 1 to 4.

7. The mRNA of claim 6, wherein: the coding region sequence of the mRNA molecule encoding the amino acid sequence as set forth in SEQ ID NO: 5 is as set forth in SEQ ID NO: 6; the coding region sequence of the mRNA molecule encoding PPE44 is as set forth in SEQ ID NO: 10; the coding region sequence of the mRNA molecule encoding Rv1813c is as set forth in SEQ ID NO:

8.

8. The mRNA according to claim 6 or 7, wherein, the mRNA molecule has one or more of the following modifications: modified with 1-methylpseudouridine; modified with 3' tailing (e.g. PloyA tail sequence); modified with at least one 5' capping; comprises at least one 5' UTR sequence; comprises at least one 3' UTR sequence.

9. A lipid nanoparticle loaded with the mRNA of any one of claims 6 to 8.

10. A pharmaceutical composition comprising: the mRNA of any one of claims 6 to 8, and a pharmaceutically acceptable excipient.

11. Use of the mRNA of any one of claims 6 to 8, the lipid nanoparticle of claim 9, or the pharmaceutical composition of claim 10 in the manufacture of a tuberculosis mRNA vaccine.

12. A tuberculosis mRNA vaccine comprising the mRNA of any one of claims 6 to 8; preferably, the vaccine is in a lipid nanoparticle dosage form; preferably, the vaccine dosage form is a freeze-dried dosage form or a frozen dosage form; preferably, the vaccine is a muscle injection vaccine.

13. The mRNA vaccine of claim 12, wherein, The lipid nanoparticle comprises mRNA and a lipid LNP, wherein the lipid LNP comprises one or more of a cationic lipid, a stabilizer lipid, a sterol, and a polymer conjugated lipid; Preferably, the cationic lipid comprises one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azanediyl)bis(hexan-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 9-heptadecanol 8-((7-((3-(hexylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amino)octanoate (T19), 9-heptadecanol 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amino)octanoate (T13); Preferably, the polymer conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, PEG-DSG; Preferably, the stabilizer phospholipid comprises one or more of DSPC, DOPE, DOPC, DOPS; Preferably, the sterol comprises one or more of cholesterol, beta-sitosterol; Preferably, the molar ratio of each lipid component, based on the total molar amount of lipids as 100%, is: cationic lipid 35%-57.5%, stabilizer lipid 0%-16%, sterol 27.5%-55%, polymer conjugated lipid 0-3%, preferably 0.5%-2.5%; Preferably, the mRNA vaccine further comprises an excipient; the excipient used may be, for example, an aqueous solution of salt and sugar; more preferably, the salt is selected from one or more of citrate, acetate, phosphate, or Tris salt; the sugar is selected from one or more of sucrose, trehalose; Preferably, the vaccine is a prophylactic and / or therapeutic tuberculosis vaccine targeting the spleen and / or the lung.

Citation Information

Patent Citations

  • Epitope peptide P16 of specificity CD8+T cells of mycobacterium tuberculosis and application thereof

    CN104356198A

  • M. tuberculosis vaccines

    CN104736555A

  • Fusion proteins for tuberculosis vaccines

    CN114222762A

  • Preparation and application of mycobacterium tuberculosis antigen composition PFHP010

    CN116003540A

  • Improved tuberculosis vaccines

    WO2005061534A2