Tuberculosis mRNA vaccine, and preparation method therefor and use thereof

Abstract

Provided are a tuberculosis mRNA vaccine, and a preparation method therefor and the use thereof. Provided is an antigen, comprising the following antigen components: at least one fusion protein or chimeric protein formed by Mycobacterium tuberculosis early-secreted antigens Ag85A and Ag85B and / or an immunologically active fragment thereof, at least one Mycobacterium tuberculosis PE / PPE family antigen Rv2770c (PPE44) or an immunologically active fragment thereof, and at least one Mycobacterium tuberculosis latency-associated antigen Rv2029c or an immunologically active fragment thereof. Optionally, two or more of the antigens or immunologically active fragments thereof may form a fusion protein and / or a chimeric protein as an antigen component.

Description

Tuberculosis mRNA vaccine, preparation method and application thereof TECHNICAL FIELD

[0001] The present application relates to a tuberculosis mRNA vaccine, a preparation method and application thereof, and belongs to the technical field of biological products. BACKGROUND

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (MTB) complex. The disease can cause both pulmonary tuberculosis and extrapulmonary tuberculosis by invading organs such as liver, kidney, brain, and lymph nodes. The clinical symptoms of pulmonary tuberculosis mainly include cough and sputum, which may be accompanied by low fever, night sweats, weight loss, weakness, and other systemic symptoms; while the symptoms of extrapulmonary tuberculosis depend on the location of the organ.

[0003] For the treatment of tuberculosis, symptomatic treatment and specific treatment are usually included, mainly anti-tuberculosis drug treatment. For prevention, the tuberculin skin test is an important means for screening tuberculosis infection, and vaccination is an effective way of prevention.

[0004] So far, Bacillus Calmette-Guerin (BCG) is the only approved vaccine for preventing tuberculosis in the world. BCG is a live vaccine made of attenuated bovine MTB, which can effectively prevent tuberculous meningitis and miliary tuberculosis in infants and young children, but provides limited protection for children and adults, and the protective effect decreases with time. In addition, it is generally believed that BCG cannot prevent primary infection and has limited effect on preventing the spread of tuberculosis. The protective effect of other vaccines developed by the prior art, such as auxotrophic live attenuated tuberculosis vaccine, BCG recombinant vaccine, tuberculosis subunit vaccine and DNA vaccine, is also not ideal, and there is currently no new vaccine that can completely replace BCG.

[0005] Therefore, it is necessary to develop a new anti-TB vaccine. SUMMARY

[0006] One object of the present application is to provide a new vaccine for preventing and treating tuberculosis.

[0007] In the present application, a plurality of antigens are combined to prepare a tuberculosis vaccine.

[0008] In one aspect, the present application provides an antigen (single antigen molecule or composition) comprising the following antigen components:

[0009] at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0010] at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0011] at least one Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof;

[0012] In this case, two or more of the Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, and the Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof can be formed as a fusion protein and / or a chimeric protein as the antigen component.

[0013] According to a specific embodiment of the present application, the antigen of the present application can be a combination of a plurality of antigen molecules, or can be an antigen molecule in the form of a single molecule formed by fusion and / or chimerization of the plurality of antigen components.

[0014] According to a specific embodiment of the present application, the Mycobacterium tuberculosis early secretory antigen can be one or more selected from the group consisting of Ag85A, Ag85B, ESAT6, EspC (Rv3615c), EsxH (TB10.4), CFP10, and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0015] According to a specific embodiment of the present application, the Mycobacterium tuberculosis PE / PPE family antigen can be one or more selected from the group consisting of PPE18, Rv2770c (PPE44), Rv1806 (PE20), Rv3812 (PE_PGRS62), PE63, Rv1759c (PE-PGRS family protein WAG22), PPE14, Rv1818c (PE-PGRS33), Rv2608 (PPE42), Rv3872 (PE35), Rv1196 (PPE18), and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0016] According to a specific embodiment of the present application, the Mycobacterium tuberculosis latency associated antigen can be one or more selected from the group consisting of Rv1285 (cysD), Rv1813c, Rv2029c, Rv2031c, Rv2624c, Rv2628, Rv2660c, and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0017] In the present application, by combining multiple antigens for preparing a tuberculosis vaccine, the prepared tuberculosis vaccine can be used as a preventive vaccine for preventing latent activation, and also can be used as a therapeutic drug for treating active tuberculosis. In specific embodiments of the present application, the inhibitory effect on Mycobacterium tuberculosis is verified by experiments.

[0018] According to specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen comprises one or more of the following antigen components: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof.

[0019] Ag85A and Ag85B: A major component of the secreted protein in the culture filtrate of Mycobacterium tuberculosis is the Ag85 complex, which is a protein family with a relative molecular mass of 38000 composed of Ag85A, Ag85B, and Ag85C. Ag85A, 295 amino acids in length, is a key enzyme in the synthesis of the cell wall of Mycobacterium tuberculosis, responsible for catalyzing the acyl transfer reaction in the antigen 85 complex, transferring long-chain fatty acid ester groups to the coryne fatty acid of the cell wall. Ag85A can stimulate the body to produce humoral immunity, and also can stimulate Th1-type cellular immunity, inducing CD8+ T cell proliferation and the rise of IL-2 and IFN-γ. Ag85B, 285 amino acids in length, with a molecular weight of 34.6KD, also known as MPT59, Rv1886, is a Mycobacterium transferase related to bacterial cell wall synthesis, with multiple T cell epitopes, and can induce Th1 response and the production of IFN-γ.

[0020] In some specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B.

[0021] In some specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen has an amino acid sequence as shown in SEQ ID NO: 5.

[0022] According to specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis PE / PPE family antigen comprises Rv2770c (PPE44).

[0023] Rv2770c (PPE44) is a predicted virulence factor that is expressed upregulated on infected guinea pig lungs. Yu Z et al. heterologously expressed PPE44 in a non-pathogenic, fast-growing M. smegmatis strain. Subcellular localization analysis showed that Rv2770c is a cell wall-associated protein, which is postulated to be a candidate protein involved in host-pathogen interactions. Rv2770c also increased the survival of M. smegmatis within macrophages. Romano M et al. vaccinated mice with a plasmid DNA vaccine encoding PPE44 or with adjuvanted recombinant PPE44 protein, which elicited strong cellular and humoral immune responses. A PPE44-based subunit vaccine provided protection against intracellular challenge with virulent M. tuberculosis, with efficacy comparable to that of Bacille Calmette-Guerin (BCG).

[0024] According to a specific embodiment of the present application, the Mycobacterium tuberculosis latency-associated antigen comprises Rv2029c.

[0025] Rv2029c: responds to hypoxia, low levels of NO and CO levels, found to have a phosphofructokinase-like domain, which can play a role in the utilization of fructose by Mtb.

[0026] According to a specific embodiment of the present application, the antigen (single antigen molecule, or composition) comprises the following antigen components:

[0027] at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof; the Mycobacterium tuberculosis early secretory antigen comprises one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof;

[0028] at least one Mycobacterium tuberculosis PE / PPE family antigen Rv2770c (PPE44) or an immunologically active fragment thereof; and

[0029] at least one Mycobacterium tuberculosis latency-associated antigen Rv2029c or an immunologically active fragment thereof;

[0030] wherein, optionally, two or more of the Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis latency-associated antigen or an immunologically active fragment thereof can form a fusion protein and / or a chimeric protein as the antigen component.

[0031] Preferably, the M. tuberculosis early secretory antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B. More preferably, the M. tuberculosis early secretory antigen has an amino acid sequence as set forth in SEQ ID NO: 5.

[0032] In another aspect, the present application also provides a nucleic acid molecule which can encode the antigen of the present application.

[0033] According to a specific embodiment of the present application, the nucleic acid molecule of the present application can be a composition of a plurality of nucleic acid molecules, or a single nucleic acid molecule which can encode the plurality of antigen components.

[0034] According to a specific embodiment of the present application, the nucleic acid molecule of the present application comprises:

[0035] a nucleic acid molecule encoding at least one M. tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0036] a nucleic acid molecule encoding at least one M. tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0037] a nucleic acid molecule encoding at least one M. tuberculosis latency-associated antigen or an immunologically active fragment thereof.

[0038] According to a specific embodiment of the present application, when the antigen of the present application comprises a fusion protein and / or a chimeric protein antigen component, the nucleic acid molecule of the present application comprises a nucleic acid molecule encoding the fusion protein and / or the chimeric protein antigen component.

[0039] According to a specific embodiment of the present application, the nucleic acid molecule of the present application can be DNA or RNA.

[0040] In another aspect, the present application also provides an mRNA comprising an mRNA molecule encoding the antigen of the present application. The mRNA of the present application can be used to prepare a Mycobacterium tuberculosis mRNA vaccine.

[0041] According to a specific embodiment of the present application, the mRNA of the present application can be a composition of a plurality of mRNA molecules, or a single mRNA molecule which can encode the plurality of antigen components.

[0042] According to a specific embodiment of the present application, the mRNA of the present application comprises:

[0043] an mRNA molecule encoding at least one M. tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0044] an mRNA molecule encoding at least one M. tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0045] mRNA molecules encoding at least one Mycobacterium tuberculosis latency-associated antigen or an immunologically active fragment thereof.

[0046] According to specific embodiments of the application, when the antigen described in the present application comprises a fusion protein and / or a chimeric protein antigen component, the mRNA of the present application comprises mRNA encoding the fusion protein and / or the chimeric protein antigen component.

[0047] In some specific embodiments of the application, in the antigen described in the present application, the Mycobacterium tuberculosis early secretory antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B, and the mRNA of the present application comprises mRNA encoding the chimeric protein. In some more specific embodiments, the chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B has an amino acid sequence as shown in SEQ ID NO: 5, and the mRNA of the present application comprises an mRNA molecule encoding the amino acid sequence as shown in SEQ ID NO: 5. In some specific embodiments of the application, the coding region sequence of the mRNA molecule encoding the amino acid sequence as shown in SEQ ID NO: 5 is as shown in SEQ ID NO: 6, i.e., the coding region sequence of the mRNA molecule encoding the Mycobacterium tuberculosis early secretory antigen is as shown in SEQ ID NO: 6.

[0048] In some specific embodiments of the application, in the antigen described in the present application, the Mycobacterium tuberculosis PE / PPE family antigen comprises PPE44, and the mRNA of the present application comprises mRNA encoding PPE44. In some more specific embodiments, PPE44 has an amino acid sequence as shown in SEQ ID NO: 9, and the mRNA of the present application comprises an mRNA molecule encoding the amino acid sequence as shown in SEQ ID NO: 9. In some specific embodiments of the application, the coding region sequence of the mRNA molecule encoding PPE44 is as shown in SEQ ID NO: 10.

[0049] In some specific embodiments of the application, in the antigen described in the present application, the Mycobacterium tuberculosis latency-associated antigen comprises Rv2029c, and the mRNA of the present application comprises mRNA encoding Rv2029c. In some more specific embodiments, Rv2029c has an amino acid sequence as shown in SEQ ID NO: 11, and the mRNA of the present application comprises an mRNA molecule encoding the amino acid sequence as shown in SEQ ID NO: 11. In some specific embodiments of the application, the coding region sequence of the mRNA molecule encoding Rv2029c is as shown in SEQ ID NO: 12.

[0050] According to specific embodiments of the application, in the mRNA of the present application, the mRNA molecule has any one or more of the following modifications:

[0051] modified by 1-methylpseudouridine;

[0052] modified by 3' tailing (e.g. PloyA tail sequence);

[0053] modified by at least one 5' capping modification;

[0054] comprising at least one 5' UTR sequence;

[0055] comprising at least one 3' UTR sequence.

[0056] In some embodiments of the present application, the 5' cap modification in the mRNA of the present application can be selected from one of m7G, Cap0, Cap1, Cap2, modified Cap0, modified Cap1 and modified Cap2 structure, more specifically, can be Cap0, Cap1, Cap2, ARCA, Inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, any of the 5' cap structures mentioned in patent applications CN202310091020.3 and CN202310391954.9. The entire contents of CN202310091020.3 and CN202310391954.9 are hereby incorporated by reference.

[0057] In some embodiments of the present application, the PolyA tail sequence can be any of the PolyA tail mentioned in patent applications WO2024041641A1 and CN202311309226.5. The entire contents of WO2024041641A1 and CN202311309226.5 are hereby incorporated by reference.

[0058] The mRNA of the present application can be used to prepare a vaccine in a lipid nanoparticle dosage form. Thus, in another aspect, the present application also provides a lipid nanoparticle loaded with the mRNA of the present application.

[0059] In another aspect, the present application also provides a pharmaceutical composition comprising: the mRNA of the present application, and a pharmaceutically acceptable excipient.

[0060] In another aspect, the present application also provides use of the mRNA, the lipid nanoparticle or the pharmaceutical composition in the preparation of a tuberculosis mRNA vaccine.

[0061] In another aspect, the present application also provides a tuberculosis mRNA vaccine comprising the mRNA of the present application.

[0062] In some embodiments of the application, the vaccine described herein is in a lipid nanoparticle formulation.

[0063] In some more specific embodiments of the application, the lipid nanoparticle comprises mRNA and a lipid LNP, wherein: the lipid LNP comprises one or more of a cationic lipid, a stabilizer lipid, a sterol, and a polymer conjugated lipid.

[0064] According to specific embodiments of the application, the cationic lipid comprises one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 9-heptadecanol 8-((7-((3-(octylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amino)octanoate (T19), 9-heptadecanol 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amino)octanoate (T13).

[0065] According to specific embodiments of the application, the structure of T19 is:

[0066] According to specific embodiments of the application, the structure of T13 is:

[0067] According to specific embodiments of the application, the polymer conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, PEG-DSG.

[0068] According to specific embodiments of the application, the stabilizer phospholipid comprises one or more of DSPC, DOPE, DOPC, DOPS.

[0069] According to specific embodiments of the application, the sterol comprises one or more of cholesterol, beta-sitosterol.

[0070] According to specific embodiments of the application, the molar ratio of each lipid component in the lipid LNP, based on 100% of the total moles of lipids, is: cationic lipid 35-57.5%, stabilizer lipid 0-16% or 5-16%, sterol 27.5-55%, polymer conjugated lipid 0-3% preferably 0.5-2.5%.

[0071] According to a specific embodiment of the present application, the mRNA vaccine further comprises an adjuvant. The adjuvant used may be, for example, an aqueous solution of salt and sugar. Preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; and the sugar is selected from one or more of sucrose and trehalose.

[0072] In another aspect, the present application also provides a method for preparing the tuberculosis mRNA vaccine, comprising:

[0073] Each of the mRNA molecules in the mRNA according to the present application is prepared into a lipid nanoparticle, and then a plurality of lipid nanoparticles are mixed with each other; or

[0074] A plurality of mRNA molecules in the mRNA according to the present application are mixed into a mixture, and then the mRNA mixture is prepared into a lipid nanoparticle.

[0075] The method for preparing the tuberculosis mRNA vaccine can further comprise mixing the lipid nanoparticle with an adjuvant to prepare a vaccine product.

[0076] In some specific embodiments of the present application, the vaccine dosage form of the present application is a freeze-dried dosage form or a frozen dosage form.

[0077] In some specific embodiments of the present application, the vaccine of the present application is a muscle injection vaccine.

[0078] In some specific embodiments of the present application, the vaccine according to the present application is a prophylactic and / or therapeutic tuberculosis vaccine targeting the spleen and / or the lung.

[0079] The tuberculosis vaccine of the present application can be used as a prophylactic vaccine for latent activation or as a therapeutic drug for treating active tuberculosis, and has a significant inhibitory effect on Mycobacterium tuberculosis. BRIEF DESCRIPTION OF DRAWINGS

[0080] FIG. 1 is an electrophoresis detection chart of the synthesized partial antigen mRNA in the embodiment of the present application.

[0081] FIG. 2 is an electrophoresis detection chart of the synthesized partial antigen mRNA in the embodiment of the present application.

[0082] FIG. 3 is an electrophoresis detection chart of the synthesized partial antigen mRNA in the embodiment of the present application.

[0083] FIG. 4 shows the results of Western Blot qualitative detection of the expression of related antigens.

[0084] FIG. 5 shows the results of indirect detection of the expression of related antigens.

[0085] FIG. 6 shows the results of in vitro inhibition test of Mycobacterium tuberculosis by the vaccine according to the specific embodiment of the present application.

[0086] Figure 7 shows the results of challenge test of the vaccine of the embodiment of the present application. DETAILED DESCRIPTION

[0087] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present application, the technical solutions of the present application are described in detail as follows, but it should not be understood as a limitation on the scope of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application. The experimental methods not specified in the embodiments are operated according to the conventional conditions in the field. The starting reagent materials used in the embodiments are commercially available or prepared according to the prior art in the field.

[0088] Example 1

[0089] In this embodiment, various antigen combinations are designed, see Table 1.

[0090] Table 1: Antigen combinations

[0091] The amino acid sequences and corresponding mRNA sequences of each antigen used in this embodiment are shown in Table 2.

[0092] Table 2: Amino acid sequences and mRNA sequences of antigens

[0093] Rv1813c: A protein expressed by MTB under low oxygen conditions, associated with the latent growth of bacteria. Although Rv1813c is not essential for the survival of M. tuberculosis in vitro, M. tuberculosis ΔRv1813c mutants are attenuated in a low-dose aerosol model of tuberculosis in mice, showing lower bacterial burden, delayed time to death, and reduced ability to stimulate proinflammatory cytokines interleukin-1β (IL-1β) and IL-12.

[0094] Rv3872 (PE35): The PE35 (Rv3872) gene of M. tuberculosis exists in the difference region (RD), which is deleted in all bovine Mycobacterium vaccine strains. Hanif SN et al. used the pUMCV6 DNA vaccine vector to clone the PE35 antigen encoded by the gene, which can induce antigen-specific Th-1 type (antigen-induced cell proliferation and IFN-γ secretion), lack of Th-2 type (IL-5 secretion) and anti-inflammatory (IL-10 secretion) response. In addition, multiple epitopes of PE35 induced cellular responses.

[0095] Rv1759c (PE-PGRS family protein Wag22): Campuzano J et al. for the design of new vaccines to prevent the reactivation of Mycobacterium tuberculosis, they used the experimental model of chronic tuberculosis in B6D2F1 mice, observing the sustained expression of Rv1759c on the cell wall of phagocytosed mycobacteria by activated macrophages located in lung granulomas, this antigen induced the production of IFN-g after stimulation, suggesting that this antigen can play an important role in maintaining the immune response of latent infection.

[0096] Rv2031c belongs to the MTB dormancy regulon, which mainly expresses alpha-crystallin (HspX) at high levels during latency, and is involved in the universal cellular stress response. It can regulate the metabolism of Mycobacterium tuberculosis in host cells and is important for its survival during latency. Depletion of this protein worsens the tolerance of Mycobacterium tuberculosis to anaerobiosis. Therefore, it is considered a potential candidate drug to promote the survival of pathogens during hypoxia, which is similar to latency. In addition, its role in impairing the immune response by blocking the differentiation of monocytes into DC cells has recently been confirmed.

[0097] Sequence optimization

[0098] In the present application, the mRNA sequence with high stability and high expression is designed by sequence optimization according to the amino acid sequence of the above antigen.

[0099] All mRNA sequence design indicators are within the allowable range, the number of unpaired bases is less, the CAI value is higher, and it meets the design principles of high stability and high expression.

[0100] mRNA synthesis

[0101] The sequence-optimized gene is constructed into an mRNA universal vector, and template DNA is prepared by PCR method for mRNA transcription, and Cap1 cap analog, N1-methyl pseudouracil and 120 nt Poly A tail are used for mRNA synthesis (each mRNA is 100% m1ψ modified, 5' cap structure is m7G(5')ppp(5')(2'OMeA)pG, 5'UTR sequence: GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC (SEQ ID NO: 47), 3'UTR sequence: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 48), PloyA tail sequence is 120 nt of A), to verify the expression of the relevant antigen.

[0102] The purified mRNA was detected by electrophoresis, as shown in Figures 1-3. In Figure 1, lanes 1-11 are Rv2031c, Rv2029c, Rv2628, Rv2660c, Rv1813c, Rv2624c, Rv1285, M72, Ag85A, Ag85B and IFN-γ, respectively, which have sizes close to the theoretical values and single bands. In Figure 2, lanes 1-6 are Ag85A, Ag85B, Rv1196, ESAT6, Rv2660c, CFP10, respectively, which have sizes close to the theoretical values and single bands. In Figure 3, lanes 1-9 are Rv0915c, Rv0934, Rv1759c, Rv1806, Rv2351c, Rv2770c, Rv2941, Rv3812, Rv3872, respectively, which have sizes close to the theoretical values and single bands.

[0103] Expression verification

[0104] The mRNA was transfected into 293T / 17 cells with a confluence of more than 70%, and Western blot detection was performed 48 h after transfection. In the qualitative detection of antigen expression by Western Blot (as shown in Figure 4), some small proteins (<20 kDa) could not be detected for protein expression. Rv2624c, Ag85A, Rv1285, Rv1196, Rv2029c, Rv2031c and Rv1813c could be detected for antigen expression, and the protein sizes were consistent with the theoretical values, while Rv2628 and Rv2660c could not be detected for expression by Western blot.

[0105] Since it is difficult to detect small molecular weight proteins by WB, indirect Elisa was used for qualitative detection of proteins. Intracellular proteins were taken 48 h after cell transfection (without dilution, 2-fold dilution, 4-fold dilution) for Elisa detection. The sample coating order was Rv2628, Rv2660c, ESAT6, TB10.4, Control. Based on the above table, the OD values of each sample were detected by an enzyme-labeled instrument, and the OD values in the undiluted state were plotted as a column chart (as shown in Figure 5). The OD values were higher than the blank control, indicating that each mRNA had different levels of expression.

[0106] Vaccine preparation

[0107] Since the TB vaccine is mainly based on CD4+ cell immunity, the project adopts the LNP carrier T19-5 with strong spleen targeting and strong cell immune response to prepare mRNA-LNP containing mRNA, and the main quality control parameters are encapsulation rate > 90% and particle size 100-120 nm. Among them, the composition of LNP carrier T19-5 is T19: DSPC: PEG-DMG: CHOL with a mass ratio of 48: 16: 1.5: 34.5. T19, DSPC, PEG-DMG, CHOL are dissolved in anhydrous ethanol to form organic phase A (the average concentration of lipids is 10 mg / ml), and the mRNA to be carried is dissolved in pH = 4.0 citric acid / sodium citrate buffer to form aqueous phase B (the concentration of mRNA is 0.54 mg / ml). Using a microfluidic device, mRNA-LNP is prepared by mixing solution A: solution B at a volume ratio of 1:3. After preparation, the mRNA-LNP is dialyzed in 20 mM Tris buffer for 24 h, and the solution is changed every 8 h. After 24 h, the mRNA-LNP vaccine product is obtained by passing through a 0.22 μm filter to remove bacteria.

[0108] In this embodiment, the parameters of the mRNA-LNP prepared to carry the mRNA encoding each antigen are shown in Table 3. Each mRNA-LNP encodes a single component antigen.

[0109] Table 3

[0110] The particle size, PDI, and point encapsulation rate of each mRNA-LNP are within the quality standard range.

[0111] BCG suspension preparation: The BCG colonies on the upper layer of the Roche medium were scraped off and added to a sterile grinding flask containing 1 mL of sterile 1x PBS, and the bacteria were ground and shaken thoroughly. After standing for 15 minutes, the upper liquid was sucked into a 15 mL sterile centrifuge tube, and the OD 600 (0.3 = 10 7 CFU), the bacterial solution was diluted to 10 6 CFU / 100 μL / mice for subcutaneous immunization.

[0112] Animal immunization

[0113] The mRNA vaccines corresponding to each antigen / antigen combination (i.e., multiple component antigens) of each experiment were subjected to animal experiments in batches, with 5 C57 mice in each group. Each mouse required 5 μg of vaccine per antigen per immunization, and except for the BCG group which was subcutaneously immunized with 100 μL, the remaining 9 groups were all immunized by intramuscular injection, with 50 μL per mouse per immunization, and immunized twice with an interval of 14 days.

[0114] After blood collection, the spleen was isolated after immersion in 75% alcohol and placed in a 2 mL EP tube (with 1500 μL of 1640 medium with double antibodies added in advance, pre-cooled on ice).

[0115] The spleen was immersed in mouse lymphocyte separation medium (Dako) and the spleen was ground using a 75 μm filter (Falcon) and a syringe core. The experimental operation was performed according to the requirements of the instructions. The isolated spleen lymphocyte group was resuspended with 1 mL of red blood cell lysis solution, and the red blood cells were lysed for 2-3 min. After adding 2 mL of 1xPBS to terminate the lysis, 1000xg centrifugation was performed for 5 min. The RPMI 1640 complete medium (without antibiotics, 1xnon-essential amino acids, 10mM Hepes, 1mM sodium pyruvate, 5x10 -5 M 2-mercaptoethanol) was resuspended and counted, and adjusted to 1x10 7 cells / mL, 4°C standby (100 μL / well added to BMDM after Mtb infection, supplemented with medium to 1 mL), and the remaining spleen cells were frozen.

[0116] MGIA experiment

[0117] Immortalized BMDM plating:

[0118] Immortalized BMDM was plated at 2x10 6 Cells / Wells into a 24-well plate one day in advance, and RPMI 1640 complete medium (without double antibiotics) was added. One duplicate well was set up for each sample. A total of 50 mice were dissected, i.e. 50 samples, 100 wells of cells, which were plated into two different 24-well plates for each group.

[0119] Evaluation of protective effect (MGIA experiment-co-culture):

[0120] The pre-plated BMDM cells were infected with Mtb at MOI: 5 (at the same time as the dissection of the mice), and after 4 hours, the cells were washed twice with 1x sterile PBS (to remove the adherent cell surface and extracellular bacteria), 10 6 Cells / 100 μL / Wells of immune mouse SMC (without antibiotics, 1xnon-essential amino acids, 10mM Hepes, 1mM sodium pyruvate, 5x10 -5 M 2-mercaptoethanol) was added to 1 mL, and co-incubated for 96 hours, with 500 μL of medium added at 48h. The BCG group was added with 2mg / ml 2-thiophenecarboxylic acid hydride (to inhibit the proliferation of BCG in spleen cells, which has no effect on Mtb).

[0121] Evaluation of protective effect (MGIA experiment-coated CFU):

[0122] The observation hole and the repeated hole were observed for contamination, and one non-contaminated hole was selected for lysis. The cell solution was taken into an EP tube (frozen for cytokine detection), washed with 500 μL of sterile 1x PBS, and 500 μL of sterile 0.05% SDS was added for lysis for 2-3 min, and then diluted 10 times with sterile 1x PBS. -2 The sterile coating beads were evenly coated on 7H10 (containing OADC) at each concentration, 3 plates were repeated (6x48 samples per day = 288 plates), and incubated at 37°C for 4 weeks (during which the contamination and CFU growth were observed).

[0123] In this example, after the spleen cell lysate was incubated with MTB infected immortal BMDM for 4 days, it was diluted 100 times and evenly coated on 7H10 (containing OADC), incubated at 37°C for 4 weeks, and the CFU growth was counted as shown in Figure 6. The results showed that Ag85a+Ag85b, Rv3615c, Rv2031c, Rv2029c, Rv1813c, Rv3872, Rv1759c and Rv2770c had good immunogenicity as antigens, and could effectively inhibit the proliferation of Mycobacterium tuberculosis after immunization of mice.

[0124] Challenge experiment

[0125] The mice were immunized twice by intramuscular injection, with an interval of 2 weeks, and the immunization dose was 5 μg (mRNA), 100 μg (protein). One dose of BCG (10 3 CFU) was used as a positive control and administered intradermally. The negative control group was injected with the same volume of normal saline. Two weeks after the second immunization, the H37Rv strain was infected by aerosol route, and 20-50 bacteria were sent into the lungs. After 4 weeks, all surviving animals were killed. At autopsy, all lung lobes were removed from the chest cavity for individual manipulation of each lung lobe. The right lung homogenate was diluted 10 times in succession, and then diluted 10 times with sterile 1x PBS. -2 -10 -3 The sterile coating beads were evenly coated on 7H10 (containing OADC) at each concentration, 3 plates were repeated, and the colony formation was counted after incubation at 37°C for 21 days in 5% carbon dioxide. The number of colonies was calculated, and the data was expressed as the average recovery of bacteria in log10.

[0126] The results of the challenge experiment are shown in Figure 7. The results showed that Ag85ab+Rv2029c+Rv2770c showed significant protective effect, and the Mycobacterium tuberculosis load in the lungs and spleen of mice decreased significantly below the detection limit, which was significantly better than BCG.

[0127] While the application has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various modifications or changes can be made therein without departing from the spirit and scope thereof. Accordingly, it is intended that all such modifications and changes be included within the scope of the application as claimed.

Claims

1. An antigen comprising the following antigen components: at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof; the Mycobacterium tuberculosis early secretory antigen comprises one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof; at least one Mycobacterium tuberculosis PE / PPE family antigen Rv2770c (PPE44) or an immunologically active fragment thereof; and at least one Mycobacterium tuberculosis latency-associated antigen Rv2029c or an immunologically active fragment thereof; wherein Optionally, two or more of the Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis latency-associated antigen or an immunologically active fragment thereof can form a fusion protein and / or a chimeric protein as the antigen component.

2. The antigen of claim 1, wherein: the Mycobacterium tuberculosis early secretory antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B; preferably, the Mycobacterium tuberculosis early secretory antigen has an amino acid sequence as shown in SEQ ID NO:

5.

3. A nucleic acid molecule encoding the antigen of claim 1 or 2.

4. An mRNA comprising the mRNA molecule encoding the antigen of claim 1 or 2.

5. The mRNA of claim 4, wherein: the coding region sequence of the mRNA molecule encoding the Mycobacterium tuberculosis early secretory antigen is as shown in SEQ ID NO: 6; the coding region sequence of the mRNA molecule encoding Rv2770c is as shown in SEQ ID NO: 10; the coding region sequence of the mRNA molecule encoding Rv2029c is as shown in SEQ ID NO:

12.

6. The mRNA according to claim 4 or 5, wherein, the mRNA molecule has one or more of the following modifications: modified by 1-methylpseudouridine; modified by 3' tailing (e.g. PloyA tail sequence); modified by at least one 5' capping; comprises at least one 5' UTR sequence; comprises at least one 3' UTR sequence.

7. A lipid nanoparticle loaded with the mRNA of any one of claims 4 to 6.

8. A pharmaceutical composition comprising: the mRNA of any one of claims 4 to 6, and a pharmaceutically acceptable excipient.

9. Use of the mRNA of any one of claims 4 to 6, the lipid nanoparticle of claim 7, or the pharmaceutical composition of claim 8 in the manufacture of a tuberculosis mRNA vaccine.

10. A tuberculosis mRNA vaccine comprising the mRNA of any one of claims 4 to 6; preferably, the vaccine is in a lipid nanoparticle dosage form; preferably, the vaccine dosage form is a freeze-dried dosage form or a frozen dosage form; preferably, the vaccine is a muscle injection vaccine.

11. The mRNA vaccine of claim 10, wherein, the lipid nanoparticle comprises the mRNA and a lipid LNP, wherein: The lipid LNP comprises one or more of a cationic lipid, a supporting lipid, a sterol, and a polymer conjugated lipid; Preferably, the cationic lipid comprises one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azanediyl)bis(hexan-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 9-heptadecanol 8-((7-((3-(octylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amino)octanoate (T19), 9-heptadecanol 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amino)octanoate (T13); Preferably, the polymer conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, PEG-DSG; Preferably, the supporting phospholipid comprises one or more of DSPC, DOPE, DOPC, DOPS; Preferably, the sterol comprises one or more of cholesterol, beta-sitosterol; Preferably, the molar ratio of each lipid component, based on the total molar amount of the lipids as 100%, is: cationic lipid 35%-57.5%, supporting lipid 0%-16%, sterol 27.5%-55%, polymer conjugated lipid 0-3%, preferably 0.5%-2.5%; Preferably, the mRNA vaccine further comprises an excipient; the excipient used may be, for example, an aqueous solution of a salt and a sugar; more preferably, the salt is selected from one or more of citrate, acetate, phosphate, or Tris salt; the sugar is selected from one or more of sucrose, trehalose; Preferably, the vaccine is a prophylactic and / or therapeutic tuberculosis vaccine targeting the spleen and / or the lung.

Images