mRNA tuberculosis vaccine, preparation method therefor, and use thereof

Abstract

An mRNA tuberculosis vaccine, a preparation method therefor, and a use thereof. First, provided is an antigen, comprising the following antigen components: a fusion protein or chimeric protein formed by at least one Mycobacterium tuberculosis early secreted antigen Ag85a, Ag85b and / or an immunologically active fragment thereof, at least one Mycobaterium tuberculosis PE / PPE family antigen Rv3872 (PE35) or an immunologically active fragment thereof, and at least one Mycobacterium tuberculosis latency-associated antigen Rv1813c or an immunologically active fragment thereof; selectively, two or more of these antigens or immunologically active fragments thereof can form a fusion protein and / or a chimeric protein as antigen components. By means of multiple antigen components, mRNA vaccines are more effective in preventing tuberculosis.

Description

Tuberculosis mRNA vaccine, preparation method and application thereof TECHNICAL FIELD

[0001] The present application relates to a tuberculosis mRNA vaccine, a preparation method and application thereof, and belongs to the technical field of biological products. BACKGROUND

[0002] Tuberculosis (TB) is a chronic infectious disease caused by Mycobacterium tuberculosis (MTB) complex. The disease can cause both pulmonary tuberculosis and extrapulmonary tuberculosis by invading organs such as liver, kidney, brain, and lymph nodes. The clinical symptoms of pulmonary tuberculosis mainly include cough and sputum, which may be accompanied by low fever, night sweats, weight loss, weakness, and other systemic symptoms; while the symptoms of extrapulmonary tuberculosis depend on the location of the organ.

[0003] For the treatment of tuberculosis, symptomatic treatment and specific treatment are usually included, mainly anti-tuberculosis drug treatment. For prevention, the tuberculin skin test is an important means for screening tuberculosis infection, and vaccination is an effective way of prevention.

[0004] So far, Bacillus Calmette-Guerin (BCG) is the only approved vaccine for preventing tuberculosis in the world. BCG is a live vaccine made of attenuated bovine MTB, which can effectively prevent tuberculous meningitis and miliary tuberculosis in infants and young children, but provides limited protection for children and adults, and the protective effect decreases with time. In addition, it is generally believed that BCG cannot prevent primary infection and has limited effect on preventing the spread of tuberculosis. The protective effect of other vaccines developed by the prior art, such as auxotrophic live attenuated tuberculosis vaccine, BCG recombinant vaccine, tuberculosis subunit vaccine and DNA vaccine, is also not ideal, and there is currently no new vaccine that can completely replace BCG.

[0005] Therefore, it is necessary to develop a new anti-TB vaccine. SUMMARY

[0006] An object of the present application is to provide a new vaccine for preventing and treating tuberculosis.

[0007] In the present application, a plurality of antigens are combined to prepare a tuberculosis vaccine.

[0008] In one aspect, the present application provides an antigen (single antigen molecule or composition) comprising the following antigen components:

[0009] at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0010] at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0011] at least one Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof;

[0012] In this case, two or more of the Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, and the Mycobacterium tuberculosis latency associated antigen or an immunologically active fragment thereof can be formed as a fusion protein and / or a chimeric protein as the antigen component.

[0013] According to a specific embodiment of the present application, the antigen of the present application can be a combination of a plurality of antigen molecules, or can be an antigen molecule in the form of a single molecule formed by fusion and / or chimerization of the plurality of antigen components.

[0014] According to a specific embodiment of the present application, the Mycobacterium tuberculosis early secretory antigen can be one or more selected from the group consisting of Ag85A, Ag85B, ESAT6, EspC (Rv3615c), EsxH (TB10.4), CFP10, and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0015] According to a specific embodiment of the present application, the Mycobacterium tuberculosis PE / PPE family antigen can be one or more selected from the group consisting of PPE18, Rv2770c (PPE44), Rv1806 (PE20), Rv3812 (PE_PGRS62), PE63, Rv1759c (PE-PGRS family protein WAG22), PPE14, Rv1818c (PE-PGRS33), Rv2608 (PPE42), Rv3872 (PE35), Rv1196 (PPE18), and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0016] According to a specific embodiment of the present application, the Mycobacterium tuberculosis latency associated antigen can be one or more selected from the group consisting of Rv1285 (cysD), Rv1813c, Rv2029c, Rv2031c, Rv2624c, Rv2628, Rv2660c, and the like, or an immunogenic fragment thereof, and a fusion protein and / or a chimeric protein formed by two or more of these antigens or fragments thereof.

[0017] In the present application, by combining multiple antigens for preparing a tuberculosis vaccine, the prepared tuberculosis vaccine can be used as a preventive vaccine for preventing latent activation, and also can be used as a therapeutic drug for treating active tuberculosis. In specific embodiments of the present application, the inhibitory effect on Mycobacterium tuberculosis is verified by experiments.

[0018] According to specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen comprises one or more of the following antigen components: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof.

[0019] Ag85A and Ag85B: A major component of the secreted protein in the culture filtrate of Mycobacterium tuberculosis is the Ag85 complex, which is a protein family with a relative molecular mass of 38000 composed of Ag85A, Ag85B, and Ag85C. Ag85A, 295 amino acids in length, is a key enzyme in the synthesis of the cell wall of Mycobacterium tuberculosis, responsible for catalyzing the acyl transfer reaction in the antigen 85 complex, transferring long-chain fatty acid ester groups to the coryne fatty acid of the cell wall. Ag85A can stimulate the body to produce humoral immunity, and also can stimulate Th1-type cellular immunity, inducing CD8+ T cell proliferation and the rise of IL-2 and IFN-γ. Ag85B, 285 amino acids in length, with a molecular weight of 34.6KD, also known as MPT59, Rv1886, is a Mycobacterium transferase related to bacterial cell wall synthesis, with multiple T cell epitopes, and can induce Th1 response and the production of IFN-γ.

[0020] In some specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B.

[0021] In some specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis early secreted antigen has an amino acid sequence as shown in SEQ ID NO: 5.

[0022] According to specific embodiments of the present application, in the antigen described in the present application, the Mycobacterium tuberculosis PE / PPE family antigen comprises Rv3872 (PE35).

[0023] Rv3872 (PE35): PE35 (Rv3872) gene of M. tuberculosis is present in the difference region (RD) which is deleted in all BCG vaccine strains. Hanif SN et al. used pUMCV6 DNA vaccine vector to clone the PE35 antigen encoded by the gene can induce antigen-specific Th-1 type (antigen-induced cell proliferation and IFN-γ secretion), lack of Th-2 type (IL-5 secretion) and anti-inflammatory (IL-10 secretion) response. In addition, multiple epitopes of PE35 all induced cellular responses.

[0024] According to a specific embodiment of the present application, in the antigen described in the present application, the M. tuberculosis latency-related antigen comprises Rv1813c.

[0025] Rv1813c: Protein expressed by MTB under hypoxic conditions, associated with the latent growth of bacteria. Although Rv1813c is not essential for the survival of M. tuberculosis in vitro, M. tuberculosis ΔRv1813c mutant is attenuated in a low-dose aerosol model of tuberculosis in mice, showing lower bacterial burden, delayed time to death, and reduced ability to stimulate proinflammatory cytokines interleukin-1β (IL-1β) and IL-12.

[0026] According to a specific embodiment of the present application, the present application provides an antigen (a single antigen molecule, or a composition) comprising the following antigen components:

[0027] at least one M. tuberculosis early secretory antigen or an immunologically active fragment thereof; the M. tuberculosis early secretory antigen comprises one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof;

[0028] at least one M. tuberculosis PE / PPE family antigen Rv3872 (PE35) or an immunologically active fragment thereof; and

[0029] at least one M. tuberculosis latency-related antigen Rv1813c or an immunologically active fragment thereof;

[0030] Optionally, two or more of the M. tuberculosis early secretory antigen or an immunologically active fragment thereof, the M. tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, and the M. tuberculosis latency-related antigen or an immunologically active fragment thereof can form a fusion protein and / or a chimeric protein as an antigen component.

[0031] Preferably, the M. tuberculosis early secretory antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B. More preferably, the M. tuberculosis early secretory antigen has an amino acid sequence as set forth in SEQ ID NO: 5.

[0032] In another aspect, the present application also provides a nucleic acid molecule which can encode the antigen of the present application.

[0033] According to a specific embodiment of the present application, the nucleic acid molecule of the present application can be a composition of a plurality of nucleic acid molecules, or a single nucleic acid molecule which can encode the plurality of antigen components.

[0034] According to a specific embodiment of the present application, the nucleic acid molecule of the present application comprises:

[0035] a nucleic acid molecule encoding at least one M. tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0036] a nucleic acid molecule encoding at least one M. tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0037] a nucleic acid molecule encoding at least one M. tuberculosis latency-associated antigen or an immunologically active fragment thereof.

[0038] According to a specific embodiment of the present application, when the antigen of the present application comprises a fusion protein and / or a chimeric protein antigen component, the nucleic acid molecule of the present application comprises a nucleic acid molecule encoding the fusion protein and / or the chimeric protein antigen component.

[0039] According to a specific embodiment of the present application, the nucleic acid molecule of the present application can be DNA or RNA.

[0040] In another aspect, the present application also provides an mRNA comprising an mRNA molecule encoding the antigen of the present application. The mRNA of the present application can be used to prepare a Mycobacterium tuberculosis mRNA vaccine.

[0041] According to a specific embodiment of the present application, the mRNA of the present application can be a composition of a plurality of mRNA molecules, or a single mRNA molecule which can encode the plurality of antigen components.

[0042] According to a specific embodiment of the present application, the mRNA of the present application comprises:

[0043] an mRNA molecule encoding at least one M. tuberculosis early secretory antigen or an immunologically active fragment thereof;

[0044] an mRNA molecule encoding at least one M. tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0045] mRNA molecules encoding at least one Mycobacterium tuberculosis latency-associated antigen or an immunologically active fragment thereof.

[0046] According to specific embodiments of the application, when the antigen described in the present application comprises a fusion protein and / or a chimeric protein antigen component, the mRNA of the present application comprises mRNA encoding these fusion protein and / or chimeric protein antigen components.

[0047] In some specific embodiments of the application, when the antigen described in the present application comprises a Mycobacterium tuberculosis early secreted antigen, the mRNA of the present application comprises mRNA encoding the Mycobacterium tuberculosis early secreted antigen. In some more specific embodiments, the Mycobacterium tuberculosis early secreted antigen has an amino acid sequence as set forth in SEQ ID NO: 5, and the mRNA of the present application comprises an mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 5. In some specific embodiments of the application, the coding region sequence of the mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 5 is as set forth in SEQ ID NO: 6, i.e., the coding region sequence of the mRNA molecule encoding the Mycobacterium tuberculosis early secreted antigen is as set forth in SEQ ID NO: 6.

[0048] In some specific embodiments of the application, when the antigen described in the present application comprises a Mycobacterium tuberculosis PE / PPE family antigen, the mRNA of the present application comprises mRNA encoding Rv3872 (PE35). In some more specific embodiments, Rv3872 (PE35) has an amino acid sequence as set forth in SEQ ID NO: 13, and the mRNA of the present application comprises an mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 13. In some specific embodiments of the application, the coding region sequence of the mRNA molecule encoding Rv3872 (PE35) is as set forth in SEQ ID NO: 14.

[0049] In some specific embodiments of the application, when the antigen described in the present application comprises a Mycobacterium tuberculosis latency-associated antigen, the mRNA of the present application comprises mRNA encoding Rv1813c. In some more specific embodiments, Rv1813c has an amino acid sequence as set forth in SEQ ID NO: 7, and the mRNA of the present application comprises an mRNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 7. In some specific embodiments of the application, the coding region sequence of the mRNA molecule encoding Rv1813c is as set forth in SEQ ID NO: 8.

[0050] According to specific embodiments of the present application, in the mRNA of the present application, the mRNA molecule has any one or more of the following modifications:

[0051] modified by 1-methylpseudouridine;

[0052] modified by 3' tailing (e.g. PloyA tail sequence);

[0053] modified by at least one 5' capping;

[0054] comprising at least one 5' UTR sequence;

[0055] comprising at least one 3' UTR sequence.

[0056] In some specific embodiments of the present application, in the mRNA of the present application, the 5' cap modification is selected from one of m7G, Cap0, Cap1, Cap2, modified Cap0, modified Cap1 and modified Cap2 structures, more specifically, can be Cap0, Cap1, Cap2, ARCA, Inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, any one of the 5' cap structures mentioned in patent applications CN202310091020.3 and CN202310391954.9. The entire contents of CN202310091020.3 and CN202310391954.9 are hereby incorporated by reference herein.

[0057] In some specific embodiments of the present application, the PloyA tail sequence can be any one of the PloyA tail sequences mentioned in patent applications WO2024041641A1 and CN202311309226.5. The entire contents of WO2024041641A1 and CN202311309226.5 are hereby incorporated by reference herein.

[0058] The mRNA of the present application can be used to prepare a vaccine in a lipid nanoparticle dosage form. Thus, in another aspect, the present application also provides a lipid nanoparticle loaded with the mRNA of the present application.

[0059] In another aspect, the present application also provides a pharmaceutical composition comprising: the mRNA of the present application, and a pharmaceutically acceptable excipient.

[0060] In another aspect, the present application also provides use of the mRNA, the lipid nanoparticle or the pharmaceutical composition in the preparation of a tuberculosis mRNA vaccine.

[0061] In another aspect, the present application also provides a tuberculosis mRNA vaccine comprising the mRNA of the present application.

[0062] In some embodiments of the present application, the vaccine of the present application is in a lipid nanoparticle formulation.

[0063] In some more specific embodiments of the present application, the lipid nanoparticle comprises mRNA and lipid LNP, wherein: the lipid LNP comprises one or more of a cationic lipid, a stabilizer lipid, a sterol, and a polymer conjugated lipid.

[0064] According to specific embodiments of the present application, the cationic lipid comprises one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azanediyl)bis(hexan-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 9-heptadecanol 8-((7-((3-(hexylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amino)octanoate (T19), 9-heptadecanol 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amino)octanoate (T13).

[0065] According to specific embodiments of the present application, the structure of T19 is:

[0066] According to specific embodiments of the present application, the structure of T13 is:

[0067] According to specific embodiments of the present application, the polymer conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, PEG-DSG.

[0068] According to specific embodiments of the present application, the stabilizer phospholipid comprises one or more of DSPC, DOPE, DOPC, DOPS.

[0069] According to specific embodiments of the present application, the sterol comprises one or more of cholesterol, beta-sitosterol.

[0070] According to a specific embodiment of the present application, the molar ratio of each lipid component in the lipid LNP is: 35%-57.5% of cationic lipids, 0%-16% or 5%-16% of supporting lipids, 27.5%-55% of solid sterol substances, and 0-3% of polymer conjugated lipids, preferably 0.5%-2.5%, based on the total molar amount of lipids being 100%.

[0071] According to a specific embodiment of the present application, the mRNA vaccine further comprises an adjuvant. The adjuvant used may be, for example, an aqueous solution of salt and sugar. Preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; and the sugar is selected from one or more of sucrose and trehalose.

[0072] In another aspect, the present application also provides a method for preparing the tuberculosis mRNA vaccine, comprising:

[0073] Each of the mRNA molecules in the mRNA of the present application is prepared into a lipid nanoparticle, and then a plurality of lipid nanoparticles are mixed with each other; or

[0074] A plurality of mRNA molecules in the mRNA of the present application are mixed into a mixture, and then the mRNA mixture is prepared into a lipid nanoparticle.

[0075] The method for preparing the tuberculosis mRNA vaccine can further comprise mixing the lipid nanoparticle with an adjuvant to prepare a vaccine product.

[0076] In some specific embodiments of the present application, the vaccine dosage form of the present application is a freeze-dried dosage form or a frozen dosage form.

[0077] In some specific embodiments of the present application, the vaccine of the present application is a muscle injection vaccine.

[0078] In some specific embodiments of the present application, the vaccine of the present application is a prophylactic and / or therapeutic tuberculosis vaccine targeting the spleen and / or lung.

[0079] The tuberculosis vaccine of the present application can be used as a prophylactic vaccine for latent activation or as a therapeutic drug for treating active tuberculosis, and has a significant inhibitory effect on Mycobacterium tuberculosis. BRIEF DESCRIPTION OF DRAWINGS

[0080] Figure 1 is an electrophoresis detection diagram of part of the antigen mRNA synthesized in the embodiment of the present application.

[0081] Figure 2 is an electrophoresis detection diagram of part of the antigen mRNA synthesized in the embodiment of the present application.

[0082] Figure 3 is an electrophoresis detection diagram of part of the antigen mRNA synthesized in the embodiment of the present application.

[0083] Figure 4 shows the results of Western Blot qualitative detection of the expression of the relevant antigens.

[0084] Figure 5 shows the results of indirect detection of the expression of the relevant antigens.

[0085] Figure 6 shows the results of in vitro inhibition test of Mycobacterium tuberculosis by the vaccine of the specific embodiment of the present application.

[0086] Figure 7 shows the results of challenge test of the vaccine of the specific embodiment of the present application. DETAILED DESCRIPTION

[0087] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present application, the technical solutions of the present application are described in detail as follows, but it should not be understood as a limitation on the scope of the present application. Based on the examples in the present application, all other examples obtained by those of ordinary skill in the art without making creative efforts are within the scope of protection of the present application. The experimental methods not specified in the specific conditions in each example are operated according to the conventional conditions in the field. Each starting reagent material used in the examples can be commercially available or prepared according to the prior art in the field.

[0088] Example 1

[0089] In this embodiment, various antigen combinations are designed, as shown in Table 1.

[0090] Table 1: Antigen combinations

[0091] The amino acid sequences and corresponding mRNA sequences of each antigen used in this embodiment are shown in Table 2.

[0092] Table 2: Amino acid sequences and mRNA sequences of antigens

[0093] Rv2029c: Response to hypoxia, low level of NO and CO level, found to have phosphofructokinase-like domain, which may play a role in the utilization of fructose by Mtb.

[0094] Rv2770c (PPE44) is a predicted virulence factor that is expressed upregulated on infected guinea pig lungs. Yu Z et al. heterologously expressed PPE44 in a non-pathogenic, fast-growing M. smegmatis strain. Subcellular localization analysis showed that Rv2770c is a cell wall-associated protein, which is speculated to be a candidate protein involved in host-pathogen interaction. Meanwhile, Rv2770c can also improve the survival rate of M. smegmatis in macrophages. Romano M et al. vaccinated mice with plasmid DNA vaccine encoding PPE44 or adjuvant-formulated recombinant PPE44 protein, which produced strong cellular and humoral immune responses. PPE44-based subunit vaccine can provide protection against intracellular challenge of virulent M. tuberculosis, and its efficacy is comparable to that of BCG.

[0095] Rv1759c (PE-PGRS family protein Wag22): Campuzano J et al. designed a new vaccine to prevent the reactivation of M. tuberculosis, using a chronic tuberculosis experimental model in B6D2F1 mice, they observed the sustained expression of Rv1759c on the cell wall of phagocytosed mycobacteria in activated macrophages in lung granulomas, and this antigen induced the production of IFN-γ after stimulation, indicating that the antigen may play an important role in maintaining the immune response of latent infection.

[0096] Rv2031c belongs to the MTB dormancy regulon, which mainly expresses α-crystallin (HspX) at high levels during latency, and is involved in the universal cellular stress response. It can regulate the metabolism of M. tuberculosis in host cells, and is important for its survival during latency. The depletion of this protein worsens the tolerance of M. tuberculosis to anaerobiosis. Therefore, it is considered a potential candidate drug to promote the survival of pathogens during hypoxia, which is similar to latency. In addition, its role in impairing the immune response by blocking the differentiation of monocytes into DC cells has recently been confirmed.

[0097] Sequence optimization

[0098] In the present application, the mRNA sequence with high stability and high expression is designed by sequence optimization according to the amino acid sequence of the above antigen.

[0099] All mRNA sequence design indicators are within the allowable range, the number of unpaired bases is less, and the CAI value is higher, which meets the design principles of high stability and high expression.

[0100] mRNA synthesis

[0101] The sequence-optimized genes were constructed into the mRNA universal vector, and the template DNA was prepared by PCR for mRNA transcription. The Capl cap analog, Nl-methyl pseudouridine, and 120 nt Poly A tail were used for mRNA synthesis (each mRNA was 100% mlψ modified, 5' cap structure: m7G(5')ppp(5')(2'OMeA)pG, 5'UTR sequence: GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCC GCCACC (SEQ ID NO: 47), 3'UTR sequence: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 48), Ploy A tail sequence: 120 nt A), to verify the expression of the relevant antigens.

[0102] The purified mRNA was subjected to electrophoresis detection, as shown in Figures 1-3. In Figure 1, lanes 1-11 were Rv2031c, Rv2029c, Rv2628, Rv2660c, Rv1813c, Rv2624c, Rv1285, M72, Ag85A, Ag85B, and IFN-γ, respectively, which had a size close to the theoretical value and a single band. In Figure 2, lanes 1-6 were Ag85A, Ag85B, Rv1196, ESAT6, Rv2660c, and CFP10, respectively, which had a size close to the theoretical value and a single band. In Figure 3, lanes 1-9 were Rv0915c, Rv0934, Rv1759c, Rv1806, Rv2351c, Rv2770c, Rv2941, Rv3812, and Rv3872, respectively, which had a size close to the theoretical value and a single band.

[0103] Expression verification

[0104] The mRNA was transfected into 293T / 17 cells with a confluence of more than 70%, and Western blot detection was performed 48 h after transfection. In the qualitative detection of antigen expression by Western Blot (as shown in Figure 4), some small proteins (<20 kDa) were not able to detect protein expression. Rv2624c, Ag85A, Rv1285, Rv1196, Rv2029c, Rv2031c, and Rv1813c were able to detect antigen expression, and the protein size was consistent with the theoretical value, while Rv2628 and Rv2660c were not able to detect expression by Western blot.

[0105] Due to the difficulty of detecting small molecular weight proteins by WB, indirect Elisa was used to qualitatively detect the proteins. After 48h of cell transfection, the intracellular proteins (without dilution, 2-fold dilution, 4-fold dilution) were subjected to Elisa detection. The sample coating sequence was Rv2628, Rv2660c, ESAT6, TB10.4, Control. Based on the above table, the OD values were detected by the microplate reader, and the OD values in the undiluted state were plotted as a column chart (as shown in Figure 5). The OD values were all higher than the blank control, indicating that each mRNA was expressed at different levels.

[0106] Vaccine preparation

[0107] Since the TB vaccine is mainly based on CD4+ cell immunity, the LNP carrier T19-5 with strong spleen targeting and strong cell immune response was used to prepare mRNA-LNP containing mRNA. The main quality control parameters were encapsulation efficiency > 90% and particle size 100-120 nm. Among them, the composition of LNP carrier T19-5 was T19: DSPC: PEG-DMG: CHOL with a mass ratio of 48: 16: 1.5: 34.5. T19, DSPC, PEG-DMG, CHOL were dissolved in anhydrous ethanol to form organic phase A (the average concentration of lipids was 10 mg / ml). The mRNA to be carried was dissolved in pH = 4.0 citric acid / sodium citrate buffer to form aqueous phase B (the concentration of mRNA was 0.54 mg / ml). Microfluidic equipment was used to mix solution A and solution B at a volume ratio of 1:3 to prepare mRNA-LNP. After preparation, the mRNA-LNP was dialyzed in 20 mM Tris buffer for 24 h, and the solution was changed every 8 h. After 24 h, the mRNA-LNP vaccine product was obtained by passing through a 0.22 μm filter to remove bacteria.

[0108] In this embodiment, the parameters of the prepared mRNA-LNP carrying mRNA encoding each antigen are shown in Table 3. Each mRNA-LNP encodes a single component antigen.

[0109] Table 3

[0110] The particle size, PDI, and point encapsulation rate of each mRNA-LNP were within the quality standard range.

[0111] BCG suspension preparation: The BCG colonies on the upper layer of the Roche medium were scraped off and added to a sterile grinding flask containing 1 mL of sterile 1x PBS. The bacteria were ground and shaken thoroughly, and then left to stand for 15 minutes. The upper layer of the bacterial solution was sucked into a 15 mL sterile centrifuge tube, and the OD 600 (0.3 = 10 7 CFU), and the bacterial solution was diluted to 10 6 CFU / 100 μL / mice for subcutaneous immunization.

[0112] Animal immunization

[0113] The antigen / antigen combination (i.e., multiple component antigens) of each experiment was subjected to animal experiments in batches, 5 C57 mice in each group, and each mouse required 5 μg of vaccine dose for each antigen per immunization, except for the BCG group which used subcutaneous immunization of 100 μL, and the remaining 9 groups used muscle injection immunization, 50 μL per mouse per immunization, with an interval of 14 days for two immunizations.

[0114] After the blood was taken, the spleen was separated after immersion in 75% alcohol, and placed in a 2 mL EP tube (with 1500 μL of 1640 medium containing double antibodies added in advance, pre-cooled on ice).

[0115] The spleen was immersed in mouse lymphocyte separation medium (Dako), and a 75 μm filter (Falcon) and syringe core were used to grind the spleen to separate the spleen lymphocytes. The experimental operation was carried out according to the requirements of the instruction manual. The separated spleen lymphocyte group was resuspended with 1 mL of red blood cell lysis solution, and the red blood cells were lysed for 2-3 min. After adding 2 mL of 1×PBS to terminate the lysis, 1000×g centrifugation was performed for 5 min. The RPMI 1640 complete medium (without antibiotics, 1×non-essential amino acids, 10 mM Hepes, 1 mM sodium pyruvate, 5×10 -5 M 2-mercaptoethanol) was resuspended and counted, and adjusted to 1×10 7 cells / mL, 4°C standby (100 μL / well added to BMDM co-incubated with Mtb-infected BMDM to 1 mL of supplemented medium), and the remaining spleen cells were frozen.

[0116] MGIA experiment

[0117] Immortal BMDM plating:

[0118] Immortal BMDM was plated in a 24-well plate at 2×10 6 Cells / Wells one day in advance, and RPMI 1640 complete medium (without double antibodies) was added. One duplicate well was set up for each sample. A total of 50 mice were dissected, i.e., 50 samples, 100 wells of cells, which were plated into two different 24-well plates for each group.

[0119] Evaluation of protective effect (MGIA experiment-co-culture):

[0120] The pre-plated BMDM cells were infected with Mtb at MOI: 5 (at the same time as the dissection of the mice), and after 4 hours, the cells were washed twice with 1×sterile PBS (to remove the adherent cell surface and extracellular bacteria), 10 6Cells / 100 μL / Wells Post-immune mouse SMC (without antibiotics, 1 x non-essential amino acids, 10 mM Hepes, 1 mM sodium pyruvate, 5 x 10 -5 M 2-mercaptoethanol), to 1 mL, co-incubate for 96 hours, 48h supplement 500 μL medium. BCG group add 2 mg / ml 2-thiophenecarboxylic acid hydride (inhibit the proliferation of BCG in spleen cells, no effect on Mtb).

[0121] Evaluation of protective effect (MGIA experiment-coated CFU):

[0122] Observe whether there is contamination in the wells and repeats, select a non-contaminated well for lysis. Take the cell liquid into the EP tube (frozen for cytokine detection), 500 μL sterile 1 x PBS wash, add 500 μL sterile 0.05% SDS lysis for 2-3 min, dilute to 10 -2 , use sterile coating beads to evenly coat on 7H10 (containing OADC), repeat 3 plates for each concentration (6 x 48 samples per day = 288 plates), 37°C culture for 4 weeks (observe contamination and CFU growth during the period).

[0123] In this embodiment, after the spleen cell lysate and MTB infected immortal BMDM were co-incubated for 4 days, they were diluted 100 times and evenly coated on 7H10 (containing OADC), and cultured at 37°C for 4 weeks. The CFU growth was counted and the results are shown in Figure 6. The results show that Ag85a+Ag85b, Rv3615c, Rv2031c, Rv2029c, Rv1813c, Rv3872, Rv1759c and Rv2770c have good immunogenicity as antigens, and can effectively inhibit the proliferation of Mycobacterium tuberculosis after immunization of mice.

[0124] Challenge experiment

[0125] The mice were immunized twice by intramuscular injection, with an interval of 2 weeks, and the immunization dose was 5 μg (mRNA), 100 μg (protein). BCG (1 dose, 10 3 CFU) as a positive control, given intradermally. The negative control group was injected with the same volume of normal saline. Two weeks after the second immunization, the H37Rv strain was infected by aerosol route, and 20-50 bacteria were sent into the lungs. After 4 weeks, all surviving animals were killed. At autopsy, all lung lobes were removed from the chest cavity for individual manipulation of each lung lobe. The right lung homogenate was diluted 10 times in succession, and then diluted to 10 -2 -10 -3The sterile spreader beads were used to spread the bacteria evenly on 7H10 (containing OADC) with 3 plates for each concentration. The plates were incubated at 37℃ for 21 days under 5% CO2, and then the colony forming units were counted. The number of colony forming units was calculated and the data was expressed as the average log10 of the recovered bacteria.

[0126] The results of the challenge experiment are shown in Figure 7. The results show that Ag85ab+Rv1813c+Rv3872 exhibited a significant protective effect, and the load of Mycobacterium tuberculosis in the lungs and spleens of the mice decreased significantly to below the detection limit, which was significantly better than that of BCG.

[0127] Although the present application has been described in detail with general description and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present application. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application.

Claims

1. An antigen comprising the following antigen components: at least one Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof; the Mycobacterium tuberculosis early secretory antigen comprises one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof; at least one Mycobacterium tuberculosis PE / PPE family antigen Rv3872 (PE35) or an immunologically active fragment thereof; and at least one Mycobacterium tuberculosis latency-associated antigen Rv1813c or an immunologically active fragment thereof; wherein Optionally, two or more of the Mycobacterium tuberculosis early secretory antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof, the Mycobacterium tuberculosis latency-associated antigen or an immunologically active fragment thereof can form a fusion protein and / or a chimeric protein as the antigen component.

2. The antigen of claim 1, wherein: the Mycobacterium tuberculosis early secretory antigen comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B; preferably, the Mycobacterium tuberculosis early secretory antigen has an amino acid sequence as shown in SEQ ID NO:

5.

3. A nucleic acid molecule encoding the antigen of claim 1 or 2.

4. An mRNA comprising the mRNA molecule encoding the antigen of claim 1 or 2.

5. The mRNA of claim 4, wherein: the coding region sequence of the mRNA molecule encoding the Mycobacterium tuberculosis early secretory antigen is as shown in SEQ ID NO: 6; the coding region sequence of the mRNA molecule encoding Rv3872 (PE35) is as shown in SEQ ID NO: 14; the coding region sequence of the mRNA molecule encoding Rv1813c is as shown in SEQ ID NO:

8.

6. The mRNA according to claim 4 or 5, wherein, the mRNA molecule has one or more of the following modifications: modified by 1-methylpseudouridine; modified by 3' tailing (e.g. PloyA tail sequence); modified by at least one 5' capping; comprises at least one 5' UTR sequence; comprises at least one 3' UTR sequence.

7. A lipid nanoparticle loaded with the mRNA of any one of claims 4 to 6.

8. A pharmaceutical composition comprising: the mRNA of any one of claims 4 to 6, and a pharmaceutically acceptable excipient.

9. Use of the mRNA of any one of claims 4 to 6, the lipid nanoparticle of claim 7, or the pharmaceutical composition of claim 8 in the manufacture of a tuberculosis mRNA vaccine.

10. A tuberculosis mRNA vaccine comprising the mRNA of any one of claims 4 to 6; preferably, the vaccine is in a lipid nanoparticle dosage form; preferably, the vaccine dosage form is a freeze-dried dosage form or a frozen dosage form; preferably, the vaccine is a muscle injection vaccine.

11. The mRNA vaccine of claim 10, wherein, the lipid nanoparticle comprises the mRNA and a lipid LNP, wherein: The lipid LNP comprises one or more of a cationic lipid, a supporting lipid, a sterol, and a polymer conjugated lipid; Preferably, the cationic lipid comprises one or more of 4-(N,N-dimethylamino)butanoic acid (dilinoleyl) methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azanediyl)bis(hexan-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-((decyloxy)hexyl)amino)octanoate) (SM-102), 9-heptadecanol 8-((7-((3-(octylthio)-2-methylpropanoyl)oxy)n-heptyl)(2-hydroxyethyl)amino)octanoate (T19), 9-heptadecanol 8-((5-((3-(octylthio)-2-methylpropanoyl)oxy)n-pentyl)(2-hydroxyethyl)amino)octanoate (T13); Preferably, the polymer conjugated lipid comprises one or more of PEG-DMG, ALC0159, PEG-DSPE, PEG-DSG; Preferably, the supporting phospholipid comprises one or more of DSPC, DOPE, DOPC, DOPS; Preferably, the sterol comprises one or more of cholesterol, beta-sitosterol; Preferably, the molar ratio of each lipid component, based on the total molar amount of the lipids as 100%, is: cationic lipid 35%-57.5%, supporting lipid 0%-16%, sterol 27.5%-55%, polymer conjugated lipid 0-3%, preferably 0.5%-2.5%; Preferably, the mRNA vaccine further comprises an excipient; the excipient used may be, for example, an aqueous solution of a salt and a sugar; more preferably, the salt is selected from one or more of citrate, acetate, phosphate, or Tris salt; the sugar is selected from one or more of sucrose, trehalose; Preferably, the vaccine is a prophylactic and / or therapeutic tuberculosis vaccine targeting the spleen and / or the lung.

Images