Improved methods for gene editing

The method integrates large DNA sequences using single-stranded oligonucleotides and site-specific recombinases with variant recombination sites, addressing inefficiencies in current genome-editing technologies by achieving precise and scalable integration across diverse cell types.

WO2026038057A1PCT designated stage Publication Date: 2026-02-19GENOME RES LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2025/051826
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-16
Filing Date
2025-08-18
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Current genome-editing technologies face limitations in integrating large DNA sequences efficiently and precisely, often resulting in complex integration events, off-target effects, and varying efficiency across different cell types due to reliance on endogenous repair pathways like HDR, NHEJ, and MMR, which are difficult to scale and control.

Method used

A method combining endonuclease-mediated homology-directed repair using single-stranded oligonucleotides templates with a site-specific recombinase, employing at least two variant recombination sites to integrate large cargos up to 14 kb in a single step, ensuring precise and scalable integration across various cell types.

Benefits of technology

Enables efficient, scalable, and reproducible integration of large DNA sequences, reducing off-target effects and maintaining insert specificity, while allowing simultaneous tagging or editing of multiple genomic sites with high efficiency and purity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GB2025051826_19022026_PF_FP_ABST
    Figure GB2025051826_19022026_PF_FP_ABST
Patent Text Reader

Abstract

The invention relates to methods and systems for gene editing combining endonuclease mediated homology directed repair using single stranded oligonucleotides templates with a site-specific recombinase to allow large cargos to be integrated at any location in the genome.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Improved Methods for Gene Editing

[0002] Field of Invention

[0003] The present invention relates to methods for gene editing combining endonuclease mediated homology directed repair using single stranded oligonucleotides templates with a site-specific recombinase to allow large cargos to be integrated at any location in the genome. The invention also relates to systems, compositions and kits for gene editing.

[0004] Introduction

[0005] Recent advancements in genome-editing technologies have provided efficient tools for specific genome modifications across various cell types and organisms. An important component of genome engineering is site-specific integration of DNA sequences to genomically tag particular proteins to investigate their function and allow expression of transgenes under endogenous regulatory elements or at specific safe harbour loci. These are important for studying the localisation, temporal dynamics and protein interactions of genes for understanding cellular function and for controlling transgene expression in cell therapeutics such as CAR-T therapies.

[0006] CRISPR-Cas9 enhanced homology-directed repair (HDR) has become a key technology for transgene integration. This involves creating a double-strand break (DSB) and supplying an excess of a homologous template DNA which is used to elicit a highly precise repair. Short synthetic single-stranded DNA (ssDNA) oligonucleotides with ~100 nt of homology have been highly effective in many cell types but they are limited in cargo capacity to around 100 nt making insertion of large transgenes impossible. Longer plasmid DNA with around 500-1000 nt of homology can be used to integrate larger fragments, but there have been observations of complex, multimeric integration events at the on target site. Others have used long ssDNA or linear double-strand DNA (dsDNA) to circumvent these problems, but the former is difficult to produce, especially with longer cargos, and the latter is prone to random integration at off-target sites in the genome. Protection of linear dsDNA with DNA structures or chemical modifications such as biotin has been shown to reduce non-specific integration and achieve tagging in some cell types. However, with all of these methods, it is still necessary to produce a HDR template DNA of thousands of bases that is different for every targeted site. Also, the efficiency of integration drops rapidly with increasing insertion size, making it difficult to insert inserts of more than 5-10 kb.

[0007] To overcome the size limitation, some groups have successfully combined HDR-mediated integration of a landing pad at a specific genomic locus followed by a second step of site-specific recombination. The serine integrase Bxb1 is particularly useful for this, as it efficiently and specifically recombines heterologous attB and attP sites without known pseudo-sites in the human genome. Its recombination is directional and irreversible. However, such integration typically involves a two-step process, with clonal selection after the HDR event, making it quite lengthy and difficult to scale to multiple sites.

[0008] An alternative method for integration employs the non-homologous end joining (NHEJ) repair mechanism that ligates two dsDNA ends together. By simultaneously cutting the genome and a donor DNA within the cell, this can be exploited to insert the donor DNA into any desired genomic site. This allows common donor plasmids to be used, avoiding the need for cloning, and making scaling of this method possible. It also has less of a length limitation than HDR-based methods, and tens of kilobases can be integrated using these methods. However, there is no control over orientation of the insertion, in some cases the whole plasmid will be integrated, and the NHEJ repair mechanism can sometimes introduce small insertions and deletions around the genomic cut site.

[0009] Prime editing (PE) combines a modified single-guide RNA (pegRNA) containing the template for the desired edit, with a reverse transcriptase (RT) fusion to Cas9. This makes a nick at a genomic locus and extends the genomic DNA by reverse transcription of the pegRNA to introduce the edit, and through manipulation of mismatch repair (MMR) pathways can be biased towards incorporation of the newly edited strand. PE offers advantages over HDR such as fewer mutagenic DSBs, but it also has limitations, including fewer targetable sites and limited insertion length (<50 bp). Recently, insertion of a site-specific recombinase site using PE, and simultaneous delivery of the cognate recombinase resulted in efficient integration of large cargos into specific genomic sites in a single-delivery reaction (PASTE technology). Recombination efficiency has recently been improved using evolved Bxb1 integrase (eeBxbl and evoBxbl). Similarly, template-jumping prime editing (TJ PE) has allowed insertions up to 800 bp. However, despite progress with computational prediction tools, it is still difficult to design effective PE guides without testing several permutations. Also, the target sites are somewhat limited by directionality of the PE process and availability of Cas9 cut sites.

[0010] All of these methodologies rely on the endogenous DNA repair pathways of HDR, NHEJ or MMR. The efficiency of these repair pathways varies significantly between cell types. Embryonic stem cells and induced pluripotent stem cells tend to favour HDR pathways, but many cancer cell lines and terminally differentiated cells preferentially repair through NHEJ. Thus, the choice of the method will depend on the cell type and respective repair pathways that are active.

[0011] Summary of Invention Site-specific integration of DNA sequences into the genome is an important tool in fundamental research, synthetic biology and cell therapeutic applications. It can be used for protein tagging to investigate expression, localisation, and interactions as well as for expression of transgenes either under endogenous regulatory elements or at consistent safe harbour loci. Here the present inventors have developed and optimised a simple and effective method for site specific integration in a single step that combines endonuclease mediated homology directed repair using single stranded oligonucleotides templates with a site-specific recombinase to allow large cargos to be integrated at any location in the genome. The present inventors have demonstrated that single stranded oligo DNA nucleotides (ssODN) homology directed repair (HDR) templates encoding at least two variant recombination sites can be used in the present method to direct integration of exogenous polynucleotides. This is in contrast to other available editing methods such as prime editing which is limited to the use of only a single recombination site. The use of two recombination sites for the integration step means that cargo vectors comprising two recombination sites are required. The presence of two recombination sites in the cargo vector allows the generation of scalable, pure, and reproducible plasmid library of donor cargos.

[0012] Genome editing methods are disclosed in WO2023 / 052774, incorporated herein by reference, which use a single recombination site in the ssODN and cargo vector, this approach has certain advantages in the generation of therapeutics as no extraneous plasmid sequence is left behind after integration. However, this approach requires that the cargo vector must be circularised each time which is time consuming, less robust and may result in impurities comprising concatemers. In contrast the present approach requires constructing a plasmid comprising two variant recombination sites which flank the desired donor polynucleotide. This means that once the cargo vector is generated, the vector can be easily propagated in bacteria and extracted using standard laboratory techniques, resulting in a pure, scalable, and replicable preparation.

[0013] The present technology requires off the shelf Cas9 and oligonucleotide reagents combined with a set of cargo plasmids that are universal to any integration site. The inventors herein demonstrate the method adaptability by tagging at multiple sites and in multiple cell types. The invention also relates to systems, compositions and kits for one step gene editing. Examples demonstrate that the presently claimed method can integrate large (up to 14 kb) cargos and that it is possible to simultaneously tag two genes or edit two sites with combination of integration and Cas9-mediated knockouts or other HDR events.

[0014] An aspect of the present invention relates to a method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule.

[0015] An aspect of the present invention relates to a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites.

[0016] An aspect of the present invention relates to a system for gene editing comprising: a Cas9 endonuclease; a single guide RNA (sgRNA); a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites.

[0017] An aspect of the present invention relates to a method for site-specific integration of an exogenous polynucleotide sequence in a cell, comprising: delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase, and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and an exogenous polynucleotide; maintaining the cell under conditions such that the targeting domain directs endonuclease mediated integration of the at least two variant recombination sites from the ssODN HDR template at a genomic site of interest; maintaining the cell under conditions such that the DNA recombinase is expressed; allowing the DNA recombinase to contact the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector, wherein the DNA recombinase can mediate site-specific recombination between the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector to integrate the exogenous polynucleotide into the genomic site of interest.

[0018] An aspect of the present invention relates to a cargo vector obtained by: preparing a dsDNA comprising a nucleotide sequence encoding a cargo molecule flanked by at least two variant recombination sites.

[0019] An aspect of the present invention relates to a method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites flanking a cargo molecule, a promoter and a selectable marker, wherein the nucleotide sequence encoding the promoter and the nucleotide sequence encoding the selectable marker flank the said at least two recombination sites; and monitoring said cell for expression of the selectable marker.

[0020] An aspect of the invention relates to a method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites and a nucleotide sequence encoding a first fragment of a selectable marker or tag, wherein the nucleotide sequence encoding the first fragment of a selectable marker or tag is located between the two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites flanking a cargo molecule, a promoter and a second fragment of a selectable marker or tag, wherein the nucleotide sequence encoding the promoter and the nucleotide sequence encoding the selectable marker flank the said at least two recombination sites; and monitoring said cell for expression of the selectable marker or tag.

[0021] Figures

[0022] The invention is further described in the following non-limiting figures. Figure 1. Minimal integration across mispaired combinations of attachment site variants (GA vs GT) a, Schematic of heterotypic cassettes, b, Testing mNeonGreen integration at the ACTR10 site using GA or GT attP variants and evaluating the specificity of matched and unmatched attB / attP dinucleotide interactions. Both GA and GT attP variant sites show better integration of cargo when paired with the corresponding attB / attP pair, with minimal integration observed across mismatched combinations. This indicates no significant crosstalk between these variants.

[0023] Figure 2. ONE-step Directional Tagging. Schematic of ONE-STEP directional tagging. Note that ONE-step Directional Tagging is also referred to as dual-cassette tagging herein.

[0024] Figure 3. Comparison of ONE-step Tagging and ONE-step Directional Tagging. Comparison of ONE-step Tagging (one attP cassette) and ONE-step Directional (two heterotypic cassettes) methods showed similar efficiency in integrating mNeonGreen at the 5’ end of ACTR10. The FACS depicts the integration efficiencies under both conditions, illustrating that the use of two heterotypic cassettes in DIRECTIONAL TAGGING does not significantly alterthe overall efficiency compared to the ORIGINAL single attP cassette approach.

[0025] Figure 4. a) ONE-step Directional Tagging allows for simultaneous tagging of multiple loci with different cargo vectors. Schematic of experimental design on the top. FACS analysis showing efficiency of multiplexed tagging insertion of combinations of fluorophores (mNeonGreen and mCherry) at two different loci (ACTR10 and MAP4), on the bottom, b) Simultaneous tagging of a primary gene (MAP4) along with a knockout (KO) event at a secondary gene (BFP). Schematic of experimental design on the left. Reagents designed to tag MAP4 with mCherry were delivered simultaneously with a BFP sgRNA into a BFP reporter line. The presence of the mCherry signal, combined with the BFP-GFP reporter assay, enabled us to monitor KO rates by detecting the loss of BFP. Roughly 76% of the cells successfully tagged with mCherry also exhibited BFP KO. c) Simultaneous tagging of a primary gene (MAP4) along with a HDR event at a secondary gene (BFP to GFP). Schematic of experimental design on the left. Reagents designed to tag MAP4 with mCherry were delivered simultaneously with a HDR template employed to introduce the 2-nucleotide mutation in the BFP reporter gene, resulting in subsequent conversion to GFP into a BFP reporter line. The presence of the mCherry signal, combined with the BFP-GFP reporter assay, enabled us to monitor HDR rates by detecting the gain of GFP. Roughly 72% of the cells successfully tagged with mCherry also exhibited GFP HDR events.

[0026] Figure 5. Simultaneously multiplexed tagging of two different loci (Imaging). Endogenous multiplexed protein tagging with mNeonGreen and mCherry via ONE-STEP tagging at 2 loci (ACTR10 and MAP4). 40x Fluorescence images of representative cells are shown. Cells have nuclear Hoechst staining. Endogenous expression of mNeonGreen and mCherry localise according to known, literature based, location of the two tagged genes. Scale bar 30pm.

[0027] Figure 6. Directional ONE-STEP tagging efficiency at the 5’ end of the ACTR10 locus using mNeonGreen as cargo donor, a. ‘Negative control’ omits Bxb1 and circular donor; ‘Random integration control’ omits the ssDNA donor indicating unspecific donor integration of <1 % and ‘Tagging efficiency’ includes delivery of all components, resulting in on-target tagging efficiency of 11%. b, AZD-7648 is a potent DNA-PK inhibitor that improves gene tagging in iPSCs. mNeonGreen integration efficiency at the 5’end of ACTR10 increases to 47.31 % (A1ATD) and 19.36% (Kolf2.1s) from 5.98% and 2.30% respectively using 0.5uM of DNA-PK inhibitor AZD- 7648. c, Testing of cargo donor concentration to achieve optimal tagging efficiency. Using higher concentrations of mNeonGreen dsDNA cargo donor significantly enhanced tagging efficiency at the ACTR10 locus, even in the absence of AZD-7648, thus demonstrating that an excess of cargo donor alone is adequate to improve results, d, Directional ONE-step Tagging across multiple cell types. Percentage of integration of a 0.8kb tag at the MAP4 locus across different human cell lines (Kolf2.1s, A1 ATD, K562, HAP1). e, FACS plot showing the integration of a 14.4 kb cargo into the BFP locus of the Kolf21s BFP reporter line. Cells that undergo integration are characterised by the loss of BFP signal and the gain of RFP signal, indicating successful integration. The tagging efficiency is approximately 14.5%.

[0028] Figure 7. Schematic of heterotypic cassette in a method of integration wherein the cargo vector can act as a reporter of successful integration. The cargo vector comprises a promotor sequence and GFP sequence flanking the heterotypic cassette such that once the integration has occurred expression of GFP occurs. Thereby providing a marker of successful integration.

[0029] Figure 8. a. Schematic representation of attP / attB-GA and attP / attB-GT cassettes, b. Evaluation of mNeonGreen integration at the ACTR10 locus using attP-GA or attP-GT variants and matched or mismatched attB / attP dinucleotide combinations in A1ATD hiPSC cells. Specific pairing of attB and attP dinucleotides (GA-GA or GT-GT) results in higher integration efficiency compared to mismatched pairs (n=3). Error bars represent standard deviation. Data were analysed using two-sided t test.

[0030] Figure 9. a. Schematic of dual-cassette ONE-STEP tagging strategy. A single-stranded DNA HDR template (~200 nt) containing two heterologous attP sites (attP-GA and attP-GT) and ~50 bp homology arms was used in combination with a plasmid donor containing cargo flanked by corresponding attB variants, b. Bar chart comparing mNeonGreen integration efficiency at the ACTR10 locus using the original ONE-STEP technology (~80%) and the dual-cassette strategy (~60%) in A1 ATD hiPSC cells. Error bars indicate standard deviation. Data were analysed using two-sided t test.

[0031] Figure 10. a. Bar chart showing mNeonGreen integration at three additional loci (LMNA, FBL, and MAP4) in the A1ATD hiPSC line. Tagging efficiencies ranged from 2.1 % to 10.8%, depending on the locus. Data represent n=3 biological experiments; error bars indicate standard deviation. Data were analysed using two-sided t test. b. Endogenous protein tagging with mNeonGreen via Dual-cassette ONE STEP tagging at four loci (ACTR10, FBL, LMNA and MAP4). Fluorescence images of representative cells are shown. Cells have nuclear Hoechst staining. Endogenous expression of mNeonGreen localise according to known, literature based, location of the four tagged genes. Scale bar 25pm. Figure 11. Bar chart showing extension of ONE-STEP tagging to additional cell types. Integration at the MAP4 locus resulted in tagging efficiencies of 6.6% in Kolf_2_C1 hiPSC cells and 28.6% in K562 lymphoblast cells. Data represent n=3 biological experiments; error bars indicate standard deviation. Data were analysed using two-sided t test.

[0032] Figure 12. a. Schematic of multiplexed gene integration strategy using dual-cassette donors. ACTR10 was targeted with GA-mNeonGreen-GT, and MAP4 with CT-mCherry-AG, in a single nucleofection. b. On the left, flow cytometry analysis demonstrating successful dual tagging, with approximately 6% of cells expressing both mNeonGreen and mCherry in A1ATD hiPSC cell line. On the right, bar chart quantifying dual-tagging efficiency across triplicate experiments; error bars indicate standard deviation, c. Double-positive and single-positive cell populations were sorted by flow cytometry, and site-specific integration at ACTR10 and MAP4 loci was validated by ddPCR using junction-specific probes for mNeonGreen and mCherry. Error bars indicate standard deviation. Data were analysed using two-sided t test.

[0033] Figure 13. a. On the top, schematic of experimental design for simultaneous tagging of MAP4 with mCherry and knockout (KO) of the BFP gene in BFP reporter kolf_2_C1 hiPSCs. mCherry- tagging reagents for MAP4 were co-delivered with a BFP sgRNA into the BFP reporter line (BFP reporter Kolf_2_C1). Successful KO events were monitored by loss of BFP expression. On the bottom, bar chart quantifying percentage of KO events in mCherry-tagged versus mCherry- tagged cells without KO events, b. On the top, schematic of experimental design. Reagents for tagging MAP4 with mCherry were co-delivered with a sgRNA and HDR template to convert BFP to GFP in a BFP reporter cell line (BFP reporter kolf_2_C1 hiPSCs). The mCherry signal indicates MAP4 tagging, while GFP gain monitored HDR at the BFP locus. On the bottom, bar chart quantifying percentage of HDR events in mCherry-tagged versus mCherry-tagged cells without HDR events.

[0034] Figure 14. Long read sequencing of integrated loci. Plots of read coverage (aggregate view) of attB mNeonGreen integration at the ACTR10 locus. Data is from Cas9-enrichment combined with PacBio long read sequencing. Insertions and mismatches are not depicted. Panels a and b show all reads mapping to the edited ACTR10 locus. The mNeonGreen fragment is not present in all alleles, and thus there is a lower coverage over this region. The coordinates refer to the edited allele. Insertions and mismatches are not depicted. Panels c-h show reads classified by allele type (see Methods). Coordinates refer to a set of smaller ~50kb maps of the edited and unedited ACTR10 locus variants, c and d show reads classified as containing full insertion into ACTR10. Panels e and f show reads classified as ssODN knock-in. Panels g and h show reads classified as wild-type, indel or substitution. Maps of the relevant loci are shown above the plots (except for panels c and d - maps are the same as for a and b). Panels i and j show the proportions of reads classified as fully integrated (mNeonGreen), ssODN integrated (ssODN) and wild-type, indel or substitution (wild-type-indel) for single and dual cassette conditions, respectively. Figure 15. Schematic of the One-STEP tagging strategy for whole-gene or genetic locus replacement. All reagents were delivered simultaneously: two sgRNAs targeting sites flanking the gene of interest; a single-stranded oligodeoxynucleotide (ssODN) with 50 bp homology arms flanking two heterotypic recombination cassettes (GA and GT) and the 11th 0-strand of mNeonGreen positioned between them; a Bxb1 recombinase expression plasmid; and a donor cargo vector comprising a CAGG promoter driving the first 10 0-strands of mNeonGreen, a P2A sequence, two heterotypic recombination cassettes flanking the transgene of interest, a T2A sequence, and a puromycin resistance gene. The cargo vector does not express mNeonGreen unless site-specific integration occurs, allowing recombination of the 11th 0-strand into the construct. Edited cells are transiently mNeonGreen-positive and puromycin-resistant, enabling enrichment of correctly modified cells. Representative flow cytometry plots show that the cargo vector alone does not produce mNeonGreen fluorescence, whereas integration at the target site results in detectable mNeonGreen expression.

[0035] Detailed Description of the Invention

[0036] The aspects and embodiments of the invention will now be further described. In the following passages, different embodiments are described. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary.

[0037] Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, pathology, oncology, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012).

[0038] Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery.

[0039] An aspect of the present invention relates to a method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule.

[0040] The methods of the invention utilise endonuclease driven integration of at least two recombination sites at a genomic site of interest. The endonuclease is directed to the genomic site of interest via a targeting domain. The targeting domain is designed to recognize a target DNA region of interest and directs the endonuclease to the target DNA region for editing. The endonuclease catalyses the formation of a double stranded break at the genomic site of interest. At the double stranded break homology-directed repair occurs, integrating the ssODN HDR template comprising a nucleotide sequence encoding at least two variant recombination sites. Once the at least two variant recombination sites are integrated at the genomic target site, the recombination sites can be recognised by the DNA recombinase. The DNA recombinase also recognises the at least two variant recombination sites present in the cargo vector. Upon recognition of the at least two variant recombination sites present at the genomic target site and the at least two variant recombination sites in the cargo vector, the DNA recombinase catalyses a unidirectional site-specific recombination of the cargo molecule at the genomic target site.

[0041] The present inventors have herein demonstrated that by using variant recombination sites highly efficient directional insertion of exogenous polynucleotides can be achieved with the omission of unwanted sequences through backbone excision. The central dinucleotide of recombination sites plays a crucial role in the integration process by facilitating the association of these attachment sites. Therefore, by using recombination sites with specific variant dinucleotides efficient integration of cargo only occurs when the variant recombination site is paired with a matching variant recombination site, i.e., very little cross-talk occurs between different variant recombination sites. As such, two variant recombination sites may be present in the ssODN HDR template to direct insertion of an exogenous polynucleotide encoded in a cargo vector. The cargo vector comprises the exogenous polynucleotide flanked by two variant recombination sites, this means that the cargo vectors can be readily produced and do not require modification prior to transfection, maintaining insert specificity.

[0042] As used herein, the term "gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences. A "gene" refers to coding sequence of a gene product, as well as non-coding regions of the gene product, including 5'UTR and 3'UTR regions, introns and the promoter of the gene product. The coding region of a gene can be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA and antisense RNA. A gene can also be an mRNA or cDNA corresponding to the coding regions (e.g. exons and miRNA) optionally comprising 5'- or 3' untranslated sequences linked thereto. These definitions generally refer to a single-stranded molecule, but in specific embodiments will also encompass an additional strand that is partially, substantially or fully complementary to the single-stranded molecule. Thus, a nucleic acid may encompass a single-stranded molecule or a double-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a molecule. As used herein, a single-stranded nucleic acid may be denoted by the prefix "ss", a double stranded nucleic acid by the prefix "ds", and a triple stranded nucleic acid by the prefix "ts". The term "gene" may refer to the segment of DNA involved in producing a polypeptide chain, it includes regions preceding and following the coding region as well as intervening sequences (introns and non-translated sequences, e.g., 5'- and 3'- untranslated sequences and regulatory sequences) between individual coding segments (exons). A gene can also be an amplified nucleic acid molecule produced in vitro comprising all or a part of the coding region and / or 5'- or 3'-untranslated sequences linked thereto.

[0043] Targeted genome modification or targeted genome editing is known in the art as a genome engineering technique that uses targeted DNA double-strand breaks (DSBs) to stimulate genome editing through homologous recombination (HR)-mediated recombination events or other repair mechanisms. To achieve effective genome editing via introduction of site-specific DNA DSBs, four major classes of customizable DNA binding proteins have been used in the art: meganucleases derived from microbial mobile genetic elements, ZF nucleases based on eukaryotic transcription factors, rare-cutting endonucleases / sequence specific endonucleases (SSN), for example TALENs, transcription activator-like effectors (TALENs) from Xanthomonas bacteria, and the RNA-guided DNA endonuclease Cas9 from the type II bacterial adaptive immune system CRISPR (clustered regularly interspaced short palindromic repeats). Meganuclease, ZF, and TALEN proteins all recognize specific DNA sequences through protein- DNA interactions. Although meganucleases integrate its nuclease and DNA-binding domains, ZF and TALEN proteins consist of individual modules targeting 3 or 1 nucleotides (nt) of DNA, respectively. ZFs and TALENs can be assembled in desired combinations and attached to the nuclease domain of Fokl to direct nucleolytic activity toward specific genomic loci. Zinc finger proteins have specific DNA binding properties and can be targeted to specific DNA sequences via the zinc finger binding domain. The present invention may use zinc finger nucleases or TALENs to catalyse the integration of the at least two variant recombination sites from the ssODN HDR template.

[0044] Upon delivery into host cells via the bacterial type III secretion system, TAL effectors enter the nucleus, bind to effector-specific sequences in host gene promoters and activate transcription. Their targeting specificity is determined by a TAL effector DNA binding domain, a central domain of tandem, 33-35 amino acid repeats. This is followed by a single truncated repeat of 20 amino acids. The majority of naturally occurring TAL effectors examined have between 12 and 27 full repeats.

[0045] These repeats only differ from each other by two adjacent amino acids, their repeat- variable diresidue (RVD). The RVD that determines which single nucleotide the TAL effector will recognize: one RVD corresponds to one nucleotide, with the four most common RVDs each preferentially associating with one of the four bases. Naturally occurring recognition sites are uniformly preceded by a T that is required for TAL effector activity. TAL effectors can be fused to the catalytic domain of the Fokl nuclease to create a TAL effector nuclease (TALEN) which makes targeted DNA double-strand breaks (DSBs) in vivo for genome editing. The use of this technology in genome editing is well described in the art, for example in US 8,440,431 , US 8,440, 432 and US 8,450,471 (all incorporated herein by reference). Customized plasmids can be used with the Golden Gate cloning method to assemble multiple DNA fragments. The Golden Gate method uses Type IIS restriction endonucleases, which cleave outside their recognition sites to create unique 4 bp overhangs. Cloning is expedited by digesting and ligating in the same reaction mixture because correct assembly eliminates the enzyme recognition site. Assembly of a custom TALEN or TAL effector construct and involves two steps: (i) assembly of repeat modules into intermediary arrays of 1-10 repeats and (ii) joining of the intermediary arrays into a backbone to make the final construct.

[0046] Another genome editing method is CRISPR. The use of this technology in genome editing is well described in the art, for example in US 8,697,359, incorporated herein by reference. In short, CRISPR is a microbial nuclease system involved in defence against invading phages and plasmids. CRISPR loci in microbial hosts contain a combination of CRISPR- associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage. Three types (I- III) of CRISPR systems have been identified across a wide range of bacterial hosts. One key feature of each CRISPR locus is the presence of an array of repetitive sequences (direct repeats) interspaced by short stretches of non-repetitive sequences (spacers). The non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct Cas nucleases to the target site (protospacer).

[0047] The Type II CRISPR is one of the most well characterized systems and carries out targeted DNA double-strand breaks in four sequential steps. First, two non-coding RNAs, the pre-crRNA array and tracrRNA, are transcribed from the CRISPR locus. Second, tracrRNA hybridizes to the repeat regions of the pre-crRNA and mediates the processing of pre-crRNA into mature crRNAs containing individual spacer sequences. Third, the mature crRNA: tracrRNA complex directs Cas9 to the target DNA via Watson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM), an additional requirement for target recognition. Finally, Cas9 mediates cleavage of target DNA to create a double-stranded break within the protospacer. Cas9 is thus the hallmark protein of the type II CRISPR-Cas system, and a large monomeric DNA nuclease guided to a DNA target sequence adjacent to the PAM sequence motif by a complex of two noncoding RNAs: CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The Cas9 protein contains two nuclease domains homologous to RuvC and HNH nucleases. The HNH nuclease domain cleaves the complementary DNA strand whereas the RuvC-like domain cleaves the non-complementary strand and, as a result, a blunt cut is introduced in the target DNA. Heterologous expression of Cas9 together with a guide RNA (gRNA) also called single guide RNA (sgRNA) can introduce site-specific double strand breaks (DSBs) into genomic DNA of live cells from various organisms. For applications in eukaryotic organisms, codon optimized versions of Cas9, which is originally from the bacterium Streptococcus pyogenes, have been used. It is also possible to use alternative nucleases to Cas 9 for example Cpf1 (also known as Cas12a), MAD7 (an engineered nuclease of the Class 2 type V-A CRISPR-Cas (Cas12a / Cpf1) family) and related nucleases.

[0048] In an embodiment of the present methods, a synthetic CRISPR system is used comprises two components the gRNA (also known as sgRNA) and the Cas endonuclease. The sgRNA is a specific RNA sequence that recognizes the target DNA region of interest and directs the Cas nuclease there for editing. The gRNA is made up of two parts: crispr RNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold forthe Cas nuclease. A ribonucleoprotein (RNP) complex can be used to deliver the nuclease in complex with the gRNA into the target cell. Using an RNP for delivery has a number of advantages including that is does not leave exogenous sequences in the genome thereby reducing potential for off target effects, it can also be used in cells which are difficult to transfect. Furthermore, in the present invention where a RNP is used to deliver the Cas9 to the cell, this means that the Cas9 protein will be immediately active and can direct the targeted integration of the variant recombination site at the genomic site of interest. The gRNA is an artificial molecule comprising one domain interacting with the Cas or any other CRISPR effector protein or a variant or catalytically active fragment thereof and another domain interacting with the target nucleic acid of interest and thus representing a synthetic fusion of crRNA and tracrRNA. The genomic target can be any approximately a 20 nucleotide DNA sequence, provided that the target is present immediately upstream of a PAM sequence.

[0049] In an embodiment the endonuclease is a DNA endonuclease. In an embodiment the endonuclease is selected from a Cas9 endonuclease, a Cpf1 (Cas12a) endonuclease, CasX endonuclease, CasY endonuclease, MAD7 endonuclease, TALEN, zinc finger nuclease, prime editor nuclease, genetically modified Cas endonuclease. The endonuclease can be targeted to specific regions of the genome via targeting domains. The targeting domain may be part of the nuclease or conjugated to the nuclease or may be a separate moiety from the nuclease. For example, where a Cas endonuclease is used in the method of the invention the targeting domain is a single guide RNA. Where a zinc finger nuclease is used in the method of the invention, the targeting domain is a zinc-finger DNA binding domain. The zinc finger DNA binding domain can be assembled in desired combinations to target various sequences. Where a transcription activator-like effector nuclease (TALEN) is used in the method of the invention the targeting domain is a transcription activator-like effector DNA binding domain. Transcription activator-like effector DNA binding domain comprises of tandem repeats of about 34 amino acids per repeat. Each repeat contains two variable diresidues (RVD) at amino acid position 12 and 13 that confer DNA base recognition. In an embodiment the targeting domain may be selected from an sgRNA), a zinc finger DNA binding domain, transcription activator-like effector DNA binding domain.

[0050] Where Cas9 is used in the methods of the invention, once expressed, the Cas9 protein and the gRNA form a ribonucleoprotein complex through interactions between the gRNA “scaffold” domain and surface-exposed positively-charged grooves on Cas9. Cas9 undergoes a conformational change upon gRNA binding that shifts the molecule from an inactive, non-DNA binding conformation, into an active DNA-binding conformation. Importantly, the “spacer” sequence of the gRNA remains free to interact with target DNA. The Cas9-gRNA complex will bind any genomic sequence with a PAM, but the extent to which the gRNA spacer matches the target DNA determines whether Cas9 will cut. Once the Cas9-gRNA complex binds a putative DNA target, a “seed” sequence at the 3' end of the gRNA targeting sequence begins to anneal to the target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target DNA in a 3' to 5' direction (relative to the polarity of the gRNA).

[0051] As used herein, the term “guide polynucleotide”, relates to a polynucleotide sequence that can form a complex with a Cas endonuclease and enables the Cas endonuclease to recognize and optionally cleave a DNA target site. The guide polynucleotide can be a single molecule or a composed of more than one discrete polynucleotide. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (an RNA-DNA combination sequence). Used herein the guide polynucleotide is an RNA sequence referred to as a guide RNA (sgRNA). Optionally, the guide polynucleotide can comprise at least one nucleotide, phosphodiester bond or linkage modification such as, but not limited, to Locked Nucleic Acid (LNA), 5-methyl dC, 2,6-Diaminopurine, 2'-Fluoro A, 2'-Fluoro U, 2'-O-Methyl RNA, phosphorothioate bond, linkage to a cholesterol molecule, linkage to a polyethylene glycol molecule, linkage to a spacer 18 (hexaethylene glycol chain) molecule, or 5' to 3' covalent linkage resulting in circularization. A guide polynucleotide that solely comprises ribonucleic acids is also The terms “target site”, “target sequence”, “target DNA”, “target locus”, “genomic target site”, “genomic target sequence”, and “genomic target locus” are used interchangeably herein and refer to a polynucleotide sequence in the genome (including choloroplastic and mitochondrial DNA) of a cell at which a double-strand break is induced in the cell by a Cas endonuclease. The target site can be a regulatory region that influences expression of the target regulatory sequence.

[0052] In an embodiment the guide polynucleotide may be designed using suitable algorithms such as Dharmacon™ Edit-R™, crOATAN, JACKS, Vienna bioscore, KS score which can be used to design highly potent guide RNAs. The gRNAs may be provided in a vector which may be designed for a single gRNA.

[0053] As used herein the term “single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template” refers to a single stranded donor oligonucleotide which is used to insert or change a short nucleotide sequence at an endogenous genomic target region. These donor nucleotides are used as part of the homology directed repair mechanism. Homology-directed repair (HDR) is a process of homologous recombination where a DNA template is used to provide the homology necessary for precise repair of a double-strand break (DSB). As such in the present method when a double stranded break is introduced at the genomic site of interest catalysed by the endonuclease, the ssODN HDR template is used to repair the double stranded break, via a homology directed repair mechanism. The ssODN HDR template comprises a nucleotide sequence encoding at least two variant recombination sites, as such the at least two variant recombination sites are inserted into the genomic site of interest via homology directed repair.

[0054] In an embodiment the present invention does not relate to the use of a prime editor guide RNA (pegRNA) template to provide the nucleotide sequence encoding a at least two variant recombination sites. A pegRNA is an sgRNA with a primer binding sequence and the template containing the desired RNA sequence added at the 3’ end. Prime editing systems are currently limited to the insertion of only a single recombination site. As such, a drawback to prime editing systems is the limited scope of donor vectors that can be used in the system. In contrast the present invention allows the use of multiple recombination sites which allows scalable, pure and reproducible donor vectors to be produced and used in the methods which is highly valuable for commercial applications.

[0055] As used herein the term “recombination site” refer a specific nucleotide sequence that is recognised by a recombinase enzyme. These sites direct site-specific recombination wherein DNA strand exchange occurs between nucleotide sequences have a certain degree of sequence homology. Site-specific recombination involves two short DNA sequences (recombination sites) which may be within the same molecule or in different molecules. A recombinase enzyme recognizes the recombination sites and then promotes a rearrangement of the DNA. This rearrangement requires recombinase-catalyzed breaking and rejoining of both DNA strands in each site. Depending on the DNA recombinase that is to be used, different recombination sites in the ssODN HDR template and the cargo vector may be required, the selection of suitable recombination sites is within the capabilities of the skilled person.

[0056] In the present invention variant recombination sites are used. At least two variant recombination sites are present in the ssODN HDR template, and at least two variant recombination sites are present in the cargo vector, these sites are recognised by the recombinase enzyme and direct insertion of the cargo polynucleotide in the genomic target site.

[0057] DNA recombinases are enzymes generally derived from bacteria or fungi which can catalyse the directionally sensitive DNA exchange reactions between short target site sequences that are specific to each recombinase. The target sequence may be between 25-60 nucleotides in length. In an embodiment the DNA recombinase is a serine recombinase, for example Bxb1 or phiC31. In an embodiment the DNA recombinase is selected from; Bxb1 , phiC31 , Cre, Flp, KD, B2, B3, or R. Flp (also known as flippase) recombinase is derived from Saccharomyces cerevisiae and recognizes a pair of FLP recombinase target (FRT) sequences. Cre recombinase is encoded by the P1 bacteriophage cyclization recombination gene and recognizes pairs of LoxP sites. PhiC31 integrase is a serine recombinase derived from Streptomyces phage (pC31 , phiC31 catalyses site-specific recombination between its corresponding attP and attB recombination sites. Bxb1 is a large serine recombinase derived from mycobacteriophage, Bxb1 catalyses site-specific recombination between its corresponding attP and attB recombination sites. In a preferred embodiment the serine recombinase is Bxb1. The use of Bxb1 has advantages as it has been shown to be functional and non-toxic in mammalian cells and is able to catalyse highly efficient unidirectional recombination between short heterologous attP and attB target sites. In an embodiment engineered versions of Bxb1 may be used, for example Bxb1 that have been engineered for higher recombination efficiency. Examples of engineered Bxb1 include eeBxbl and evoBxbl . In some embodiments the recombinase is selected from eeBxbl or evoBxbl (see for example Pandey et al Nat Biomed Eng. 2024 (30), incorporated herein by reference).

[0058] The present inventors have shown that variant recombination sequences are highly specific and must be paired with their matching variant recombination sequence, in order to be recombine and insert exogenous polynucleotide sequences. The term “variant” refers to a polynucleotide that differs from a reference or wild-type polynucleotide by single or multiple non-native nucleotide substitutions, deletions, and / or additions. As such a variant recombination site refers to a recombination site sequence that differs from a reference sequence or wild-type recombination site sequence by single or multiple non-native nucleotide substitutions, deletions, and / or additions. The nucleotide sequences of recombination sites are known in the art and the skilled person would be able to determine suitable variant sequences to use in the present invention. In the present invention the at least two variant recombination sites comprise sequences that differ from one another i.e. the recombination sites comprise variant sequences of one another. For example, where there are two recombination sites the first recombination site comprises a sequence that differs from the second recombination site. In some embodiments the variant nucleotide present in the recombination site is found at the central dinucleotide. The central dinucleotide may be present substantially halfway between the 5’ and 3’ ends of the recombination site sequence. In some embodiments the at least two variant recombination sites comprise variant central dinucleotides, i.e. the central dinucleotide is different in the at least two variant recombination sites.

[0059] In an embodiment the at least two variant recombination sites are at least two heterotypic recombination sites. The term “heterotypic” recombination sites refer to recombination sites that comprise sequences that differ in at least one nucleotide. In an embodiment the at least two heterotypic recombination sites comprise different central dinucleotides. In an embodiment the at least two variant recombination sites comprise at least two heterotypic attP sites, or at least two heterotypic attB sites.

[0060] In an embodiment the at least two variant recombination sites present in the ssODN HDR template are selected from variant attB, variant attP, variant attL, variant attR, variant LoxP, variant FRT, preferably variant attP. In an embodiment the at least two variant recombination sites present in the ssODN HDR template each comprise a variant central dinucleotide. Where at least two variant recombination sites are present in the ssODN HDR template, the variant recombination sites comprise sequences that are different from one another in at least one nucleotide. The variant recombination site in the ssODN HDR template may be heterotypic recombination sites. The ssODN HDR template may comprise at least two heterotypic attB, heterotypic attP, heterotypic attL, heterotypic attR, heterotypic LoxP, heterotypic FRT. The heterotypic recombination sites may differ from one another in at least one nucleotide. For example, there may be two heterotypic attP sites present in the ssODN HDR template, wherein the two heterotypic attP sites differ from one another in at least one nucleotide. In an embodiment the heterotypic attP sites differ from one another at the central dinucleotide.

[0061] In an embodiment the at least two variant recombination sites present in the cargo vector are selected from variant attB, variant attP, variant attL, variant attR, variant LoxP, variant FRT, preferably variant attB. In an embodiment the at least two variant recombination sites present in the cargo vector comprises a variant central dinucleotide. Where at least two variant recombination sites are present in the cargo vector, the variant recombination sites comprise sequences that are different from one another.

[0062] In an embodiment the at least two variant recombination sites present in the ssODN HDR template comprise variant attP recombination sites. In an embodiment the variant attP may comprise SEQ ID NO:1 or SEQ ID NO: 2. In an embodiment the ssODN HDR template comprises a first and second attP recombination site wherein the first and second attP recombination sites differ in their central dinucleotide. As such the variant attP recombination site may comprises a central dinucleotide selected from but not limited to GA, GT, AG, AC, or CT. The variant attP recombination site may comprise a central GA dinucleotide (attP-GA). In an embodiment the variant attP site comprising a central GA dinucleotide comprises SEQ ID NO: 3. The variant attP recombination site may comprise a central GT dinucleotide (attP-GT). In an embodiment the variant attP site comprising a central GT dinucleotide comprises SEQ ID NO: 4 or SEQ ID NO: 8. The variant attP recombination site may comprise a central AG dinucleotide (attP-AG). In an embodiment the variant attP site comprising a central AG dinucleotide comprises SEQ ID NO: 5. The variant attP recombination site may comprise a central AC dinucleotide (attP-AC). In an embodiment the variant attP site comprising a central AC dinucleotide comprises SEQ ID NO: 6. The variant attP recombination site may comprise a central CT dinucleotide (attP-CT). In an embodiment the variant attP site comprising a central CT dinucleotide comprises SEQ ID NO: 7.

[0063] In an embodiment the first variant attP site comprises a central GA dinucleotide and the second variant attP recombination site comprises a central GT dinucleotide. In an embodiment there is no spacer between the first and second variant recombination sites. The ssODN HDR template may comprise a first variant attP site comprising a central GA dinucleotide and a second variant attP recombination site comprising a central GT dinucleotide, for example the ssODN HDR template may comprise SEQ ID NO:24. The ssODN HDR template may comprise a first variant attP site comprising a central GT dinucleotide and a second variant attP recombination site comprising a central GA dinucleotide, for example the ssODN HDR template may comprise SEQ ID NO:25.

[0064] In an embodiment the at least two variant recombination sites present in the cargo vector comprise variant attB recombination sites. In an embodiment the variant attB sites may comprise SEQ ID NO: 9 or SEQ ID NO: 10. In an embodiment the cargo vector comprises a first and second attB recombination site wherein the first and second attB recombination sites differ in their core dinucleotide. As such the variant attB recombination site may comprises a core dinucleotide selected from but not limited to GA, GT, AG, AC, or CT. The variant attB recombination site may comprise a central GA dinucleotide (attB-GA). In an embodiment the variant attB site comprising a central GA dinucleotide comprises SEQ ID NO: 11 , or SEQ ID NO:17 The variant attB recombination site may comprise a central GT dinucleotide (attB-GT). In an embodiment the variant attB site comprising a central GT dinucleotide comprises SEQ ID NO: 12 or SEQ ID NO: 16. The variant attB recombination site may comprise a central AG dinucleotide (attB-AG). In an embodiment the variant attB site comprising a central AG dinucleotide comprises SEQ ID NO: 13. The variant attB recombination site may comprise a central AC dinucleotide (attB-AC). In an embodiment the variant attB site comprising a central AC dinucleotide comprises SEQ ID NO: 14. The variant attB recombination site may comprise a central CT dinucleotide (attB-CT). In an embodiment the variant attB site comprising a central CT dinucleotide comprises SEQ ID NO: 15.

[0065] In an embodiment the cargo vector comprises a first variant attB recombination site comprising a central GA dinucleotide, and a second variant attB recombination site comprising a central GT dinucleotide. The first and second variant attB recombination sites in the cargo vector comprise different central dinucleotides.

[0066] Suitable recombination sites maybe be selected from the ssODN HDR template and the cargo vector based on the specificity of the DNA recombinase that will be used. In a preferred embodiment the at least two variant recombination sites present in the ssODN are selected from variant attB or variant attP. In a preferred embodiment the at least two variant recombination sites present in the cargo vector are selected from variant attB or variant attP. In an embodiment the DNA recombinase is Bxb1 and the at least two variant recombination sites present in the ssODN are variant attP sites and the at least two variant recombination sites present in the cargo vector are variant attB sites. In an embodiment the DNA recombinase is Bxb1 and the at least two variant recombination sites present in the ssODN are variant attB sites and the at least two variant recombination sites present in the cargo vector are variant attP sites. In an embodiment the DNA recombinase is phiC31 and the at least two variant recombination sites present in the ssODN are variant attP and the at least two variant recombination sites present in the cargo vector are variant attB. In an embodiment the DNA recombinase is ph iC31 and the at least two variant recombination sites present in the ssODN are variant attB and the at least two variant recombination sites present in the cargo vector are variant attP.

[0067] According to the various aspects of the invention, in some embodiments, the ssODN HDR template encodes at least two variant recombination sites which are contiguous, i.e., there is no spacer sequence present between the two variant recombination sites. The terms spacer sequence and intervening sequence are used synonymously herein.

[0068] In the present methods, once the at least two variant recombination sites from the ssODN HDR template are integrated within the genome at the target site, and therefore provide a double stranded sequence, the DNA recombinase can recognise the at least two variant recombination sites at the target site and the at least two variant recombination sites encoded within the cargo vector. Upon recognition of the recombination sites in the target and the cargo vector the DNA recombinase can mediate site-specific recombination which results in the introduction of the nucleotide sequence encoding the cargo molecule into the genomic site of interest.

[0069] The inventors remarkably found that the methods of the invention can advantageously be carried out in a single step method with simultaneous delivery of the components. The inventors have surprisingly found that the recombinase does not act on the ssODN HDR template and only acts on the double stranded DNA once the ssODN HDR template is used to repair the double stranded break, via a homology directed repair mechanism. Thus, in one embodiment of the methods described herein, the components are delivered to the cell in a single step.

[0070] In an embodiment the method for gene editing, comprises delivering simultaneously to a cell: a Cas endonuclease, a single guide RNA (sgRNA), a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule.

[0071] Once the Cas endonuclease, the single guide RNA (sgRNA), a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, the DNA recombinase and the cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule, i.e. the gene editing components, are delivered to the cell these components then direct the editing of the cell genome. Once within the cell the sgRNA guides the Cas endonuclease to the genomic site of interest. The Cas endonuclease catalyses the formation of a double stranded break which is repaired via HDR using the ssODN HDR template resulting in the integration of the at least two variant recombination sites at the genomic site of interest.

[0072] Once the at least two variant recombination sites are integrated into the genomic site of interest and becomes dsDNA, it is recognised by the DNA recombinase. The at least two variant recombination sites present in the cargo vector are also recognised by the DNA recombinase, the DNA recombinase can mediate site-specific recombination to integrate the nucleotide sequence encoding the cargo molecule into the genomic site of interest.

[0073] The DNA recombinase may be provided to the cell in a number of different formats. For example, the DNA recombinase may be provided as; a plasmid or vector comprising a nucleotide sequence encoding the DNA recombinase, an mRNA encoding the DNA recombinase or as a polypeptide.

[0074] According to the various aspects of the invention, preferably, the DNA recombinase is provided / delivered in a plasmid or vector, e.g. an expression vector that comprises a nucleotide sequence encoding the DNA recombinase. The DNA recombinase is therefore expressed in the cell once the components have been delivered and it is not delivered as a protein. Delivery in an expression vector delays expression of the recombinase protein. This allows the other components, preferably delivered as a protein and / or RNA to act first, i.e. it allows the endonuclease to act first to include the double stranded break which is then repaired via HDR using the ssODN HDR template. In other words, this allows double stranded breakage and integration of the ssODN HDR template with the recombinase site to occur first. Once it is expressed, the recombinase acts on the double stranded DNA which now includes a recombination site. This also avoids recombination of the cargo molecules with the donor template prior to integration and double stranded DNA formation.

[0075] Expression of the recombinase protein may occur after at least 12 hours, e.g. after about 24 hours to about 48 hours. Expression may peak around 48 h after delivery to the cell.

[0076] The expression vector may include additional sequences that would be known to a skilled person, including promoter sequences. Such promoter sequences can be further used to fine tune timing of the expression of the recombinase, for example by using an inducible promoter.

[0077] Where the DNA recombinase is provided as a vector or an mRNA which encodes the DNA recombinase, the cell will then express the DNA recombinase. The DNA recombinase is capable of recognising a double stranded DNA substrate as such the DNA recombinase will only recognise the at least two variant recombination sites once they are integrated at the genomic site of interest.

[0078] The endonuclease is preferably provided as a protein or ribonucleoprotein complex in the case of RNA-guided endonucleases.

[0079] As such, once the gene editing components are delivered to the cell, the method may optionally include the further steps of: maintaining the cell under conditions such that the targeting domain directs endonuclease mediated integration of the at least two variant recombination sites from the ssODN HDR template at a genomic site of interest, maintaining the cell under conditions such that the DNA recombinase is expressed, allowing the DNA recombinase to recognise the integrated at least two variant recombination sites and the at least two variant recombination sites encoded by the cargo vector, wherein, the DNA recombinase can mediate site-specific recombination between the integrated at least two variant recombination sites and the at least two variant recombination sites encoded by the cargo vector to integrate the nucleotide sequence encoding the cargo molecule into the genomic site of interest.

[0080] In certain embodiments the method for gene editing and other methods according to the invention do not comprise any further steps which comprise delivering components to the cell. As mentioned above the delivery of the gene editing components may be performed simultaneously in a one step manner.

[0081] As used herein the term “simultaneously” means that the components are delivered to the cell at the same time. The present method does not deliver the gene editing components in separate steps. For example, if the gene editing components are delivered by nucleofection then a single nucleofection step is required to deliverthe endonuclease, a targeting domain, a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule, to the cell.

[0082] A key benefit of the present method is that all of the editing components can be delivered to the cell in a single process which provides a streamlined and efficient gene editing method. As such the gene editing components may be delivered by any suitable method that allows simultaneous delivery of an endonuclease, a targeting domain, a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule, to a cell.

[0083] In an embodiment the gene editing components i.e. the endonuclease, the targeting domain, the single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, the DNA recombinase and the cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule are delivered to the cell simultaneously via electroporation, nucleofection, transfection, or viral gene transfer. An advantage of the present method is that the gene editing components can be delivered in a simultaneous manner, as this results in a streamlined one step process for gene editing. In a preferred embodiment the gene editing components are delivered via nucleofection. Nucleofection is an electroporation-based transfection method which enables transfer of nucleic acids such as DNA and RNA into cells by applying a specific voltage and reagents. Nucleofection results in delivery of DNA and RNA directly to the nucleus and therefore allows for efficient transfection of non-dividing cells as well as dividing cells.

[0084] The Cas endonuclease may be selected from any Cas endonuclease which can catalyse the formation of a double stranded break. Suitable Cas endonucleases include Cas9 endonuclease, Cpf1 (Cas12a) endonuclease, CasX endonuclease, CasY endonuclease, MAD7 endonuclease. Natural variants of Cas endonuclease from other species may be suitable. Engineered and modified versions of Cas endonucleases may be suitable for example Cas endonucleases with different PAM specificities, different on / off target activities or nickase versions. MAD7 may also be suitable which is an engineered class 2 type V-A CRISPR-Cas (Cas12a / Cpf1) system.

[0085] In an embodiment the Cas endonuclease is delivered as a ribonucleoprotein (RNP) complex. As mentioned above, providing the Cas endonuclease as an RNP complex has a number of advantages as it does not leave exogenous sequences in the genome thereby reducing potential for off target effects, it can also be used in cells which are difficult to transfect. Furthermore, in the present invention where a RNP is used to deliver the Cas9 to the cell, this means that the Cas9 protein will be immediately active and can immediately direct the targeted integration of the variant recombination site at the genomic site of interest.

[0086] The gene editing methods of the invention can be used for a variety of applications including to engineer exogenous polypeptide or genetic information into a genome for example for therapeutic purposes. The present gene editing method allows large transgenes to be inserted into the genome as such the cargo vector may comprise a gene, multiple genes, genomic regions, cDNA, or a genetic locus. Genomic regions or cDNA for therapeutics, for differentiation, for metabolic engineering may be encoded within the cargo vector. For example, genomic regions or cDNA for therapeutics may include dystrophin, dopamine production enzymes. Genomic regions or cDNA for differentiation may include transcription factor combinations to drive production of specific cell types. Genomic regions or cDNA for metabolic engineering may include enzyme cascades. The present method may be used to incorporate libraries of coding and non-coding sequences for example for use in saturation genome editing. The present method may be used to edit the genome of an animal to produce a transgenic animal for example the humanisation of a mouse genome by incorporating a human genetic locus, this may be used in the production of human antibodies within a transgenic animal. The present method may be used to incorporate non-genic sequences, and the cargo vector may encode, for example, guide libraries for CRISPR screening, synthetic DNA fragments. Furthermore, the cargo vector may encode a chimeric antigen receptor or an antibody or a fragment thereof. Other applications include to engineer tagged proteins for research purposes. For example, the tag may be a fluorescence marker, a purification tag, a degradation tag or a selectable marker.

[0087] As used in the various aspects, including the products and methods of the invention, herein, the cargo molecule may comprise a fluorescence marker, a purification tag, a destabilising / degradation tag, or a chimeric antigen receptor (CAR), a selectable marker, a gene, a genomic region or cDNA for therapeutics, for differentiation, for metabolic engineering, a genetic locus, guide libraries for CRISPR screening, synthetic DNA fragments, an antibody or fragment thereof, a T-cell receptor and / or a B-cell receptor.

[0088] In an embodiment the cargo vector encodes a cargo molecule selected from; a fluorescence marker, a purification tag, a degradation tag, or a chimeric antigen receptor (CAR). The degradation tag may be selected from an N-degron or a C-degron, preferably the degradation tag is selected from; AID, HALO or DHFR. The fluorescence marker may be selected from mNenonGreen, GFP, YFP, CFP, BFP, RFP, EGFP, mCherry, mStrawberry, mOrange, dTomato. The purification tag may be selected from Halo, SNAP, TAP, CLIP, FLAG, c-Myc, CBP or hexa histidine. The selectable marker is selected from puromycin resistance gene, blasticidin resistance gene, neomycin resistance gene or hygromycin resistance gene.

[0089] As used herein the term “cargo vector” is used to refer to a vector which encodes the exogenous polynucleotide sequence which is to be integrated at the genomic site of interest. The exogenous polynucleotide may encode a cargo molecule as described herein. As such the cargo vector comprises a nucleotide sequence encoding a cargo molecule and components required for successful incorporation of the nucleotide sequence encoding the cargo molecule. In particular the cargo vector comprises a nucleotide sequence encoding at least two variant recombination sites, as this allows forsite specific recombination between the at least two variant recombination sites present in the cargo vector and the at least two variant recombination sites that are integrated into the genome, directed by the DNA recombinase. The cargo vector may be double stranded.

[0090] The methods according to the invention may comprises a step of preparing the cargo vector, comprising: preparing a dsDNA comprising a nucleotide sequence encoding a cargo molecule flanked by at least two variant recombination sites.,

[0091] The cargo vectors of the present invention have the advantage that the vectors can be readily produced in a scalable mannerwith high purity and at high concentration. Producing highly pure and concentrated cargo vectors means allows the editing method to be performed with a very small volume of cargo vector which reduces potential toxic effect on the cells to be editing. The cargo vectors of the invention do not need to be modified priorto transfection and maintain insert specificity. The cargo vectors of the present invention can be used without in vitro circularisation as upon completion of the recombination the insert cassette is inserted and the bacterial backbone sequence is excised. In an embodiment the cargo vector may be a plasmid. In an embodiment the cargo vector comprises a dsDNA molecule comprising a nucleotide sequence encoding a cargo molecule flanked by at least two variant recombination sites.

[0092] In an embodiment the cargo vector consists of a nucleotide sequence encoding a cargo and at least two variant recombination sites. As such, in an embodiment the cargo vector does not comprise any extraneous nucleotide sequence.

[0093] In an embodiment the at least two variant recombination sites present in the cargo vector comprise any of the features described herein. In an embodiment the at least two variant recombination sites present in the cargo vector are selected from variant attB, variant attP, variant attL, variant attR, variant LoxP, variant FRT. In a preferred embodiment the at least two variant recombination sites present in the cargo vector are variant attB sites. In an embodiment the at least two variant recombination sites present in the cargo vector comprise a variant central dinucleotide. Where at least two variant recombination sites are present in the cargo vector, the variant recombination sites comprise sequences that are different from one another. The variant recombination site in the cargo vector may be heterotypic recombination site. The cargo vector may comprise at least two heterotypic attB, heterotypic attP, heterotypic attL, heterotypic attR, heterotypic LoxP, heterotypic FRT. The heterotypic recombination sites may differ from one another in at least one nucleotide. For example, there may be two heterotypic attB sites, wherein the two heterotypic attB sites differ from one another in at least one nucleotide. In an embodiment the heterotypic attB sites differ from one another at the central dinucleotide. In an embodiment the at least two variant recombination sites present in the cargo vector comprise variant attB recombination sites selected from SEQ ID NO: 9 or SEQ ID NO: 10. The at least two variant recombination sites present in the cargo vector may comprise SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17. an embodiment the first variant attB recombination site comprises a central GA dinucleotide, and the second variant attB recombination site comprises a central GT dinucleotide.

[0094] Where the cargo vector is designed to insert an exogenous polynucleotide at the N-terminal of a target sequence the cargo vector is designed to be in-frame with the gene-of-interest postrecombination. In order to ensure that the exogenous polynucleotide is in-frame post recombination, in some embodiments a DNA spacer may be included in the 3’ end of the dsDNA donor construct. In an embodiment the spacer does not contain a stop codon and / or a start codon. Where the cargo vector is designed to insert an exogenous polynucleotide at the C-terminal of a target sequence the cargo vector is designed to be in-frame with the gene-of-interest postrecombination. In order to ensure that the exogenous polynucleotide is in-frame post recombination, in some embodiments a DNA spacer may be included in the 3’ end of the dsDNA donor construct.

[0095] In certain embodiments of the invention the gene editing components may be used to perform multiple editing events in parallel. For example, multiple insertions may be performed at the same target site or multiple insertions may be performed at distinct target sites. In certain embodiments more than one cargo vector, for example 2, 3, 4, or 5 cargos vectors, may be delivered to the cell. In certain embodiments more than one ssODN HDR template comprising a nucleotide sequence encoding at least two variant recombination sites, for example 2, 3, 4, or 5 ssODN HDR templates, may be delivered to the cell. More than one ssODN HDR template may be used to introduce at least two variant recombination sites at more than one target site. The variant recombination sites present in the more than one ssODN HDR templates may be the same or different. The more than one ssODN HDR template may direct integration of the cargo at the same or different genomic sites. As such, the method may comprise delivering more than one targeting domain to the cell to target distinct sites. The more than one targeting domains may be designed to target the same or different genomic region. Where more than one ssODN HDR template is delivered to the cell these may be used to simultaneously integrate multiple cargo at distinct positions within the genome, alternatively they may be used to integrate multiple cargo at the same position.

[0096] In some embodiments it may be advantageous to include additional components in the cargo vector. The additional components may be incorporated into the cargo vector but no intended to be inserted at the target site. Additional components may include promotors, tags or markers. The additional components are encoded in the cargo vector in addition to the cargo molecule. The promotor may be any suitable promotor sequence. Examples of suitable promotor sequences include but are not limited to CMV promotor, EF1 a promotor, CAG promotor, PGK promotor, U6 promotor. The marker may be any fluorescence marker or any antibiotic resistance marker. For example, a fluorescence marker, or selectable markers may be incorporated into the cargo vector in addition to the cargo molecule. The fluorescence marker may be selected from mNeonGreen, GFP, YFP, CFP, BFP, RFP, EGFP, mCherry, mStrawberry, mOrange, dTomato. The selectable marker is selected from puromycin resistance gene, blasticidin resistance gene, neomycin resistance gene or hygromycin resistance gene. In an embodiment, the tag may be Thy1 .1 . Thy1 .1 positive cells can be selected by using dextran coated magnetic beads. When performing genome editing it can be difficult and time consuming to assess whether the insertion has occurred. In general genome sequencing is required to confirm that the editing has occurred. By including additional components into the cargo vector, it may be possible to monitor which cells have been successfully edited. For example, the cargo vector may further comprise a nucleotide sequence that encodes a promotor sequence and a nucleotide sequence that encodes a tag or marker which flank the at least two variant recombination sites, such that the promotor and the tag or marker come into proximity only once the cargo molecule has been inserted at the target site. In this way once the insertion has occurred expression of the tag or marker can occur and provide a mechanism by which to identify cells which have been edited. In an embodiment the cargo vector further comprises a nucleotide sequence that encodes a promotor sequence and a nucleotide sequence that encodes a tag or marker. In an embodiment the promoter sequence is separated from the tag or marker by the at least two recombination sites which flank a cargo molecule.

[0097] By including additional components into both the single-stranded oligo DNA nucleotide (ssODN) and homology-directed repair (HDR) template the cargo vector, it may be possible to monitor which cells have been successfully edited. For example, the single-stranded oligo DNA nucleotide (ssODN) and homology-directed repair (HDR) template may further comprise a nucleotide sequence encoding a first fragment of a selectable marker or tag, and the cargo vector may further comprise a nucleotide sequence that encodes a promotor sequence and a nucleotide sequence that encodes a second portion of a selectable marker or tag. In this way only upon successful recombination is the full sequence of the selectable marker or tag reconstituted. For example, the first fragment of the selectable marker may comprise a nucleotide sequence encoding beta strand 11 of mNeonGreen, and the second fragment of the selectable marker may comprise a nucleotide sequence encoding beta strands 1-10 of mNeonGreen. Upon successful recombination, the full mNeonGreen protein comprising both portions is reconstituted. This allows for selection of cells which are mNeonGreen-positive, and hence enrichment for cells only in which successful editing has occurred.

[0098] An aspect of the invention relates to a method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites and a nucleotide sequence encoding a first fragment of a selectable marker or tag, wherein the nucleotide sequence encoding the first fragment of a selectable marker or tag is located between the two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites flanking a cargo molecule, a promoter and a second fragment of a selectable marker or tag, wherein the nucleotide sequence encoding the promoter and the nucleotide sequence encoding the selectable marker flank the said at least two recombination sites; and monitoring said cell for expression of the selectable marker or tag.

[0099] In one embodiment, the promoter may be any constitutive or inducible promoter. In one embodiment, the promoter may be a CMV promotor, EF1 a promotor, CAG promotor, PGK promotor or U6 promotor. In one embodiment the selectable marker may be selected from a fluorescence marker, antibiotic resistance marker or tag. The fluorescence marker may be selected from mNeonGreen, GFP, YFP, CFP, BFP, RFP, EGFP, mCherry, mStrawberry, mOrange, dTomato, TRE3G as a synthetic inducible mammalian promoter orthe UBC and SV40 constitutive mammalian promoters. In an embodiment, the antibiotic resistance marker may be Hygromycin, Puromycin, Neomycin and / or Blasticidin resistance genes and 3- and 6-split Hygromycin resistance genes. Suitable markers are described in Jilette et al Nat Commun. 2019 Oct 31 ;10(1):4968 incorporated herein by reference.

[0100] The cargo vector comprising additional components as described above may be used in a method of monitoring gene editing. An aspect of the invention relates to a method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites flanking a cargo molecule, a promoter and a selectable marker, wherein the nucleotide sequence encoding the promoter and the nucleotide sequence encoding the selectable marker flank the said at least two recombination sites; and monitoring said cell for expression of the selectable marker.

[0101] In some embodiments the methods of the invention may be combined with additional gene editing techniques for example to perform simultaneous insertion of exogenous polynucleotide at a first target site and to perform a nucleotide deletion or gene knock out at a second target site. As such the gene editing method of the resent invention may further comprise steps of providing the necessary components to perform a nucleotide deletion to gene knock out. The skilled person will be aware of various techniques that can be used to achieve deletions and knock outs. In an embodiment the method of gene editing further comprises providing one or more additional targeting domains, for example a second targeting domain, to direct endonuclease directed cleavage at a second target site. In an embodiment the methods of the present invention may comprise performing additional step to perform a HDR event at a second target site. In an embodiment the method of gene editing further comprises providing one or more additional targeting domains, for example a second targeting domain, and one or more ssDNA donor molecules to direct endonuclease directed HDR at a second target site.

[0102] In an embodiment the gene editing components may be delivered to the cell in vivo, in vitro or ex vivo. In some embodiments, the gene editing components are delivered to prokaryotic or eukaryotic cells. The cells may be an immune cell, stem cell or progenitor cell. When immune cells are used in the practice of the invention, the immune cells may be a monocytes, eosinophils, basophils, neutrophils, natural killer cells or lymphocytes. When lymphocytes are used in the practice of the invention, the lymphocytes may be T lymphocytes or B lymphocytes. When T lymphocytes are used in the practice of the invention, the T lymphocytes may be CD4+ T cels, CD8+ T cells or Chimeric Antigen Receptor (CAR) T-cells. When stem cells are used in the practice of the invention, the stem cells may be human induced pluripotent stem cells, multipotent adult stem cells or pluripotent embryonic stem cells. Wherein the cell is selected from a mammalian cell or a plant cell, preferably wherein the cell is selected from an iPSC or a stem cell.

[0103] The methods of the present invention may further comprise performing steps which bias cell repair mechanisms towards HDR and integration of the ssODN, these steps may include exposing the cell to DNA-PK inhibitors and or POLQ inhibitors. The method may also comprise a step of performing cold shock of the cells, which may help to bias cell repair mechanisms towards HDR and integration of the ssODN. The cold shock may be performed at approximately 28°C to 35°C, preferably at 32°C.

[0104] An aspect of the invention relates to a single-stranded oligo DNA nucleotide (ssODN) homology- directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites. The ssODN HDR may have any of the additional features described herein. The variant recombination sites present in the ssODN HDR template may have any of the additional features described herein. In an embodiment the at least two variant recombination sites present in the ssODN HDR template comprise variant attP recombination sites. In an embodiment the variant attP may comprise SEQ ID NO:1 or SEQ ID NO: 2. In an embodiment the ssODN HDR template comprises a first and second attP recombination site wherein the first and second attP recombination sites differ in their central dinucleotide. As such the variant attP recombination site may comprises a central dinucleotide selected from but not limited to GA, GT, AG, AC, or CT. The variant attP recombination site may comprise a central GA dinucleotide (attP-GA). In an embodiment the variant attP site comprising a central GA dinucleotide comprises SEQ ID NO: 3. The variant attP recombination site may comprise a central GT dinucleotide (attP-GT). In an embodiment the variant attP site comprising a central GT dinucleotide comprises SEQ ID NO: 4 or SEQ ID NO: 8. The variant attP recombination site may comprise a central AG dinucleotide (attP-AG). In an embodiment the variant attP site comprising a central AG dinucleotide comprises SEQ ID NO: 5. The variant attP recombination site may comprise a central AC dinucleotide (attP-AC). In an embodiment the variant attP site comprising a central AC dinucleotide comprises SEQ ID NO: 6. The variant attP recombination site may comprise a central CT dinucleotide (attP-CT). In an embodiment the variant attP site comprising a central CT dinucleotide comprises SEQ ID NO: 7.

[0105] The present inventors show herein for the first time that two variant recombination sites can be used in an ssODN HDR template to direct efficient recombination of exogenous polynucleotide sequences. In some embodiments the ssODN HDR template encodes at least two variant recombination sites which are contiguous, i.e., there is no spacer sequence present between the two variant recombination sites. In an embodiment the at least two variant recombination sites comprise different variant sequences. In an embodiment the at least two variant recombination sites comprise variant attP sites.

[0106] In an embodiment the ssODN HDR template comprises a first variant attP site comprising a central GA dinucleotide and a second variant attP recombination site comprising a central GT dinucleotide. In an embodiment there is no spacer between the first and second variant recombination sites. The ssODN HDR template may comprise a first variant attP site comprising a central GA dinucleotide and a second variant attP recombination site comprising a central GT dinucleotide, for example the ssODN HDR template may comprise SEQ ID NO:24. The ssODN HDR template may comprise a first variant attP site comprising a central GT dinucleotide and a second variant attP recombination site comprising a central GA dinucleotide, for example the ssODN HDR template may comprise SEQ ID NO:25.

[0107] An aspect of the invention relates to a system for gene editing comprising: a Cas9 endonuclease; a single guide RNA (sgRNA); a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two recombination sites.

[0108] The components of the methods are described above.

[0109] In an embodiment the cargo molecule encoded in the cargo vector of the system may comprise any cargo molecule described herein for example fluorescence marker, a purification tag, a destabilising / degradation tag, or a chimeric antigen receptor (CAR), a selectable marker, a gene, a genomic region or cDNA for therapeutics, for differentiation, for metabolic engineering, a genetic locus, guide libraries for CRISPR screening, synthetic DNA fragments, an antibody or fragment thereof, a T-cell receptor and / or a B-cell receptor. In an embodiment the system is formulated for simultaneous delivery to a cell.

[0110] An aspect of the present invention relates to a composition comprising a Cas9 endonuclease, a single guide RNA (sgRNA), a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule.

[0111] The cargo molecule encoded in the cargo vector of the composition may comprise any cargo molecule described herein for example fluorescence marker, a purification tag, a destabilising / degradation tag, or a chimeric antigen receptor (CAR), a selectable marker, a gene, a genomic region or cDNA for therapeutics, for differentiation, for metabolic engineering, a genetic locus, guide libraries for CRISPR screening, synthetic DNA fragments, an antibody or fragment thereof, a T-cell receptor and / or a B-cell receptor. In an embodiment the composition is formulated for simultaneous delivery to a cell.

[0112] The composition may comprise additional reagents to optimise simultaneous delivery of the Cas9 endonuclease, the single guide RNA (sgRNA), the single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, the DNA recombinase and the cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule i.e. the gene editing components.

[0113] In an embodiment the system, composition, or kit for gene editing can perform multiple editing events, for example editing at one or more target site. Editing at one or more target site may comprise insertion or exogenous polynucleotide, deletion of polynucleotide sequence or a combination thereof, for example insertions at one or more distinct target sites may be performed, or an insertion may be performed at one target site and a deletion or knock out may be performed at a second distinct target site. In order to perform multiple editing events the composition, system or kit may comprise one or more ssODN HDR templates, one or more cargo vectors, and / or one or more targeting domains. In an embodiment the composition, system or kit may comprise one or more ssODN HDR templates, one or more cargo vectors, and / or one or more targeting domains.

[0114] An aspect of the present invention relates to a method for site specific integration of an exogenous polynucleotide sequence in a cell, comprising delivering to a cell a gene editing system, wherein the gene editing system comprises; a endonuclease, a targeting domain a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and an exogenous polynucleotide, wherein the gene editing system is delivered to the cell simultaneously, maintaining the cell under conditions such that the targeting domain directs endonuclease mediated integration of the at least two variant recombination sites from the ssODN HDR template at a genomic site of interest; optionally maintaining the cell under conditions such that the DNA recombinase is expressed, allowing the DNA recombinase to contact the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector, wherein the DNA recombinase can mediate site-specific recombination between the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector to integrate the exogenous polynucleotide into the genomic site of interest.

[0115] In an embodiment the exogenous polynucleotide may encode any cargo molecule described herein for example fluorescence marker, a purification tag, a destabilising / degradation tag, or a chimeric antigen receptor (CAR), a selectable marker, a gene, a genomic region or cDNA for therapeutics, for differentiation, for metabolic engineering, a genetic locus, guide libraries for CRISPR screening, synthetic DNA fragments, an antibody or fragment thereof, a T-cell receptor and / or a B-cell receptor. In an embodiment the exogenous polypeptide encodes a tag such as a fluorescence marker, a purification tag, a destabilising / degradation tag. As such the method of the invention comprise methods of producing tagged proteins.

[0116] The components of the methods are described above.

[0117] An aspect of the present invention relates to a method of producing a tagged protein comprising: delivering to a cell: an endonuclease, a targeting domain, a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a tag; maintaining the cell under conditions such that the targeting domain directs endonuclease mediated integration of the at least two variant recombination sites from the ssODN HDR template at a genomic site of interest, that is in proximity of the nucleotide sequence encoding the protein that is to be tagged; optionally maintaining the cell under conditions such that the DNA recombinase is expressed; allowing the DNA recombinase to contact the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector, wherein the DNA recombinase can mediate site-specific recombination between the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector to integrate the tag into the genomic site of interest; and optionally maintaining the cell under conditions such that expression of a tagged protein can occur.

[0118] The components of the methods are described above.

[0119] In an embodiment the genomic site at which the nucleotide sequence encoding the tag is integrated is in proximity of the nucleotide sequence encoding the protein that is to be tagged, therefore the tag may be integrated upstream or downstream or internally within the nucleotide sequence. In an embodiment the genomic site at which the nucleotide sequence encoding the tag is integrated is upstream of the nucleotide sequence encoding the protein to be tagged. The term “upstream” refers to the 5’ end of the coding strand of DNA. For example, the nucleotide sequence encoding the tag may be integrated at the 5’ end of the open reading frame. In a preferred embodiment the nucleotide sequence encoding the tag may be integrated at the 5’ end of the open reading frame but downstream of the start codon. In an embodiment the genomic site at which the nucleotide sequence encoding the tag is integrated is downstream of the nucleotide sequence encoding the protein to be tagged. The term “downstream” refers to the 3’ end of the coding strand of DNA. For example, the nucleotide sequence encoding the tag may be integrated at the 3’ end of the open reading frame.

[0120] In an embodiment the method for producing a tagged protein may comprise two stages. The first stage may comprise engineering a cell to encode a tagged protein and the second stage may comprise expressing said tagged protein. The first stage may comprise the steps of: delivering to a cell: an endonuclease, a targeting domain, a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a tag; maintaining the cell under conditions such that the targeting domain directs endonuclease mediated integration of the at least two variant recombination sites from the ssODN HDR template at a genomic site of interest, that is in proximity of the nucleotide sequence encoding the protein that is to be tagged; optionally maintaining the cell under conditions such that the DNA recombinase is expressed; allowing the DNA recombinase to contact the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector, wherein the DNA recombinase can mediate site-specific recombination between the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector to integrate the tag into the genomic site of interest.

[0121] The second stage may comprise the step of: maintaining the cell under conditions such that expression of a tagged protein can occur.

[0122] The step of maintaining the cell under conditions such that expression of a tagged protein can occur may comprise maintaining the cell under specific temperature, nutrient level and agitation such that the cells can multiply. Conditions for successful cell culture and protein expression are known within the art and the skilled person can determine suitable expression conditions using routine methods.

[0123] In an embodiment the methods of site-specific integration and method of tag may target one or more target site for integrating exogenous polypeptide, i.e., the method may perform multiple editing events. Editing at one or more target site may comprise insertion of exogenous polynucleotide, deletion of polynucleotide sequence or a combination thereof, for example insertions at one or more distinct target sites may be performed, or an insertion may be performed at one target site and a deletion or knock out may be performed at a second distinct target site. In order to perform multiple editing events, the composition, system or kit may comprise one or more ssODN HDR templates, one or more cargo vectors, and / or one or more targeting domains. In an embodiment the composition, system or kit may comprise one or more ssODN HDR templates, one or more cargo vectors, and / or one or more targeting domains.

[0124] An aspect of the present invention relates to a cargo vector obtained by: preparing a dsDNA comprising a nucleotide sequence encoding a cargo molecule flanked by at least two variant recombination sites.

[0125] The cargo vectors of the present invention have the advantage that the vectors can be readily produced in a scalable manner. The cargo vectors of the invention do not need to be modified prior to transfection and maintain insert specificity. The cargo vectors of the present invention can be used without in vitro circularisation as upon completion of the recombination the insert cassette is inserted and the bacterial backbone sequence is excised.

[0126] The components are described above.

[0127] An aspect of the invention relates to a kit comprising: a Cas9 endonuclease; a single guide RNA (sgRNA); a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule and optionally instructions for use.

[0128] The components are described above.

[0129] In an embodiment the components of the kit are formulated for simultaneous delivery to a cell. In an embodiment the kit further comprises components which optimise simultaneous delivery of the gene editing system.

[0130] All documents mentioned in this specification are incorporated herein by reference in their entirety, including references to gene accession numbers, scientific publications and references to patent publications.

[0131] "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein. Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.

[0132] The term “comprising” or “comprises” where used herein means including the component(s) specified but not to the exclusion of the presence of other components. The term “consisting essentially of’ or “consists essentially of’ means including the components specified but excluding other components except for materials present as impurities, unavoidable materials present as a result of processes used to provide the components and the like. The term “consisting of’ or “consists of’ means including the components specified but excluding other components.

[0133] Whenever appropriate, depending upon the context, the use of the term “comprises” or “comprising” may also be taken to include the meaning “consists essentially of’ or “consisting essentially of’, and also may also be taken to include the meaning “consists of’ or “consisting of’.

[0134] The optional features set out herein may be used either individually or in combination with each other where appropriate and particularly in the combinations as set out in the accompanying claims. The optional features for each aspect or exemplary embodiment of the invention, as set out herein are also applicable to all other aspects or exemplary embodiments of the invention, where appropriate. In other words, the skilled person reading this specification should consider the optional features for each aspect or exemplary embodiment of the invention as interchangeable and combinable between different aspects and exemplary embodiments.

[0135] It should be understood that while the use of words such as “preferable”, “preferably”, “preferred” or “more preferred” in the description suggest that a feature so described may be desirable, it may nevertheless not be necessary and embodiments lacking such a feature may be contemplated as within the scope of the invention as defined in the appended claims. In relation to the claims, it is intended that when words such as “a,” “an,” or “at least one,” are used to preface a feature there is no intention to limit the claim to only one such feature unless specifically stated to the contrary in the claim.

[0136] The invention is further described in the following non-limiting examples.

[0137] EXAMPLES

[0138] Example 1 : Directional ONE STEP (also termed dual cassette) tagging with variant recombinase sites

[0139] The central dinucleotide within the attP and attB sites of Bxb1 plays a crucial role in the integration process by facilitating the association of these attachment sites (Ghosh, P., Kim, A. I. & Hatfull, G. F., 2003). Since one bottleneck of the technology is the efficient and reproducible generation of the minicircle DNA cargo, we decided to investigate the use of these variant recombination sites to allow specific integration of a defined part of a plasmid. We decided to test mNeonGreen integration at the ACTR10 site by using the GA attP, which has been reported to have greater efficiency than the WT GT attP sequence (Jusiak, B. et al., 2019), and explored the specificity of matched and unmatched attB / attP dinucleotide interactions. We found that both GA and GT attP variant sites efficiently integrated cargo only when paired with the corresponding attB / attP pair, with minimal integration across mismatched combinations, with 10-fold less integration of GA donor into GT site, indicating no significant crosstalk between these variants (Figure 1).

[0140] Based on this observation, we designed a directional tagging strategy by adding two variant attP sites (attP-GA and attP-GT) onto the 200 nt ssDNA used as an HDR template still preserving ~50 bp homology arms on each side. This is combined with a plasmid containing the cargo flanked by the two variant sites as a donor (Figure 2).

[0141] We compared the ONE STEP tagging technology (described in WO2023 / 052774 incorporated herein by reference) with the ONE STEP directional tagging strategy and achieved similar tagging efficiency (Figure 3) with the advantage that now we can generate a more scalable, pure and reproducible plasmid library of donor cargos.

[0142] Example 2: Multiplexed tagging and simultaneous CRISPR editing

[0143] Multiplexed gene integration is a valuable technique for labelling different proteins, enabling the visualisation of their intracellular localization and interactions within the same cell. We employed directional tagging to simultaneously tag ACTR10 with mNeonGreen and MAP4 with mCherry in the same cell (Figure 4a). Using FACS, we observed successful simultaneous tagging of MAP4-mCherry and ACTR10-mNeonGreen (Figure 4a and 12b, the latter data obtained with improved recombinase). Interestingly, there was a greater percentage of double tagging events (2,41 % mChr-mNg+) than you would expect from the combination of the efficiency at each individual site (1 ,81 % mCh+, 8.92% mNg+), suggesting that successful tagging at one site might enrich for a second tagging event. The double-positive cells were sorted, and the tagged genes were confirmed to be visible in their respective cellular compartments, consistent with the known subcellular localizations of ACTR10 and MAP4 protein products by imaging (Figure 5).

[0144] Another valuable application of the ONE STEP tagging technology is the simultaneous tagging of a primary gene along with a knockout (KO) or homology-directed repair (HDR) editing event at a second gene). We delivered reagents designed to tag MAP4 with mCherry into the BFP reporter line. The presence of the mCherry signal, combined with the BFP-GFP reporter assay, enabled us to monitor KO and HDR rates by detecting the loss of BFP or the gain of GFP signals, respectively. We observed that 70% of the cells successfully tagged with mCherry also exhibited either a BFP KO (Figure 4b) or GFP HDR event (Figure 4c).

[0145] Multiplexed ONE-STEP tagging The central dinucleotide within the attP and attB sites of Bxb1 integrase plays a crucial role in the recombination process by facilitating specific pairing between these attachment sites (Ghosh et al., 2003). Modifying the central dinucleotide sequence can alter integrase activity and confer orthogonality, enabling the targeted integration of different fluorophores at distinct genomic loci (Jusiak et al., 2019). Several dinucleotide variants — such as GA, CT, and AG — have been reported to exhibit higher integration efficiencies than the wild-type GT sequence, with many achieving efficiencies greater than 75%, making them promising candidates for multiplexed integration strategies (29).

[0146] To explore this, we first assessed mNeonGreen integration efficiency at the ACTR10 locus using different attP site variants. Specifically, we compared the wild-type attP-GT with an attP-GA variant. Our goal was to evaluate the specificity of matched versus mismatched attB / attP dinucleotide interactions (Fig. 8a). We found that both GT and GA attP sites supported similarly efficient cargo integration when paired with the corresponding attB variant. In contrast, mismatched combinations led to significantly reduced integration (~10-fold lower), indicating minimal crosstalk between the variants (Fig. 8b).

[0147] A key application of orthogonal integrase systems is multiplexed protein tagging, enabling simultaneous visualization of protein localization and interaction within individual cells. To demonstrate this, we used the ONE-STEP tagging method to simultaneously tag ACTR10 with mNeonGreen and MAP4 with mCherry in the same cell. Flow cytometry analysis confirmed successful dual tagging, with a significant population of double-positive cells (up to ~26%). Interestingly we see a higher proportion of double tagging events that we would expect based on the individual efficiencies, suggesting that successful tagging at one locus enriches for simultaneous tagging at a second locus.

[0148] ONE-STEP tagging and simultaneous CRISPR editing

[0149] Another valuable application of the ONE-STEP tagging technology is its ability to combine targeted protein tagging with a simultaneous CRISPR-mediated genome editing event, such as HDR or a KO, at a second locus. This is shown in Figure 10.

[0150] To demonstrate this, we firstly delivered reagents designed to tag MAP4 with mCherry in the BFP reporter hiPSC line. The presence of mCherry fluorescence confirmed successful tagging, while the BFP-to-GFP reporter system enabled simultaneous assessment of editing efficiency at a second locus. Specifically, gain of GFP signalled an HDR event. By flow cytometry, we observed efficient mCherry integration at the MAP4 locus (~10%), 80% of which also had HDR outcomes in the reporter assay, resulting in ~8.5% where both events occurred simultaneously. More of the mCherry MAP4 cells showed an HDR event (~80%) than untagged cells (~30%) showing that selection for successful tagging can be used to enrich other editing events.

[0151] We then delivered reagents designed to tag ACTR10 with mNeonGreen and a BFP sgRNA in the same BFP-based reporter cell line, this time looking for a simultaneous loss of BFP indicating a NHEJ-mediated knockout. We observed efficient mNeonGreen integration at the ACTR10 locus (~52%), ~90% of which (~46%) had simultaneous BFP KO in the reporter assay. Again, selection for tagged cells enriched for knockout (~90%) in comparison to the untagged population (~53%).

[0152] These two sets of experiments validate the ability of the ONE-STEP approach to support multiplexed genome engineering in a single experiment.

[0153] Example 3. Dual-cassette ONE-STEP tagging using a combination of heterologous attachment sites.

[0154] To increase the versatility of the technology, we developed a dual-cassette tagging strategy that eliminates the need to generate a new minicircle for each donor construct. This approach uses a ssODN HDR template (~200 nt) that incorporates two heterologous attP sites (attP-GA and attP-GT), while maintaining ~50 bp homology arms on either side. This universal template is used in combination with a plasmid donor in which the cargo is flanked by the corresponding variant attB sites (Figure 2 and Figure 9). We also incorporated the use of an improved recombinase that led to significant improvements in efficiency.

[0155] We tested mNeonGreen integration efficiency at the ACTR10 locus, comparing the original ONE-STEP technology with the dual-cassette ONE-STEP tagging strategy with an improved Bxb1 recombinase and standardised minicircle production method. While the dual-cassette strategy demonstrated efficient tagging (60%), it showed a slightly reduced efficiency compared to the original method (80%) (Fig. 9). This reduction is likely due to a lower transfection efficiency of the donor due to its larger size, as the plasmid backbone is present alongside the cargo (unlike the minicircle). We have shown (Figure 6 a-c) that this the molar ratio of donor to expression plasmid is critical for tagging efficiency, and we cannot further increase the donor concentration without negatively impacting cell viability due to DNA toxicity. Additionally, there is likely a reduced efficiency because of the necessity of performing two recombination events in the dualcassette strategy may inherently be less efficient than a single integration when using a minicircle.

[0156] It is possible that recombination only occurs at one of the two sites resulting in integration of the whole plasmid. To analyse this and to look for other concatemeric or imperfect integrations we performed targeted long-read sequencing of edited and sorted cells (see Methods) from the single and dual cassette strategies (Figure 14). This showed that of the reads mapping to the locus, the single cassette strategy resulted in 62% fully integrated, 31 % showing ssODN integration without subsequent site-specific recombination and 7% of alleles mapping to the unedited locus, most of which had indels or mutations. These were slightly lower in the dual cassette strategy which showed 43% fully integrated alleles, 33% ssODN only and 24% matching the unedited locus, mainly containing indels or mutations. The higher proportion of fully integrated alleles with the single cassette strategy is consistent with its increased efficiency (Figure 14a and Figure 14b), and suggests that there are likely more homozygous cells in this population. Importantly, both strategies resulted in the majority of the fully integrated alleles being integrated correctly (~99%). In the single cassette condition, we detect 1 / 88 (~1 .1 %) reads corresponding to fully integrated alleles that correspond to the integration of a circular dimer, these form as part of the ligation procedure and could be removed by further lowering the DNA ligation substrate concentrations and via size-exclusion purification methods. In the dual cassette condition, we detect 2 / 184 (~1 %) fully integrated allele reads that contain a plasmid backbone - these appear to be due to a plasmid dimer integration rather than the independent integration of two plasmids in each cassette at the ACTR10 locus, plasmid dimers occur naturally and can replicate in ArecA E. coli hosts. Plasmid stability elements are known that when incorporated into engineered plasmids can minimize dimer accumulation.

[0157] Despite the slightly reduced efficiency, the dual-cassette tagging strategy significantly enhances the versatility of our approach as we are now able to generate a universal library of donor plasmids (available via Addgene), facilitating broader adoption of this technology.

[0158] Since our technology does not require the assembly of long ssODN HDR templates but instead utilizes a short ssODN (200 nt) with approximately 50 bp of homology arms flanking the recombination cassettes, cargo integration can be easily scaled across different loci. We tested and confirmed the successful integration of mNeonGreen at three additional genomic locations (LMNA, FBL, and MAP4) in the hiPSC line A1ATD. Integration efficiency varied between 2.1 % and 10.8%, depending on the locus (Fig. 10a), likely due to differences in sgRNA and HDR rates that are highly dependent on the genomic locus. Although the efficiency was lower for some sites, by fluorescent sorting and expanding the cells we can enrich a pure population with the integrated construct. We also note that expression of the tagged genes remains stable for at least 1 month in culture.

[0159] To assess the accuracy of the tagging, we used fluorescence microscopy to compare the subcellular localization of mNeonGreen with the known localization of the tagged protein. For all fourtargeted loci, mNeonGreen localized as expected, confirming successful tagging (Fig. 10b). We also extended the ONE-STEP tagging technology with improved recombinase to additional cell types beyond the hiPSC lines (A1ATD and Kolf_2_C1), testing it in the K562 lymphoblast cell line. Integration of a 0.8 kb fluorescent tag at the MAP4 locus yielded varying efficiencies, ranging from 6.6% in Kolf_2_C1 cells to nearly 28.6% in K562 cells (Fig. 11).

[0160] We also leveraged the use of distinct attP sites (e.g., CT and AG) to generate a dual-cassette donor construct (CT-mCherry-AG) for a multiplexed gene integration experiment (Figure 12a). Specifically, we aimed to simultaneously tag two different genes within the same cell: ACTR10 with mNeonGreen using the GA-mNeonGreen-GT plasmid, and MAP4 with mCherry using the CT-mCherry-AG plasmid (Fig. 5).

[0161] Flow cytometry analysis confirmed successful dual tagging, with approximately 6% of cells expressing both fluorescent tags (Figure 12b). Double-positive and single-positive cell populations were sorted, and integration at the correct genomic loci was validated by ddPCR utilising the primers that span the fluorescent tags and the endogenous loci (Fig. 12c). Doublepositive cells were also imaged, revealing fluorescence signals consistent with the expected subcellular localization of ACTR10 and MAP4, further confirming correct tagging and minimal cross-talk between the GA-GT and CT-AG sites (Figure 5).

[0162] In conclusion, the dual-cassette ONE-STEP tagging strategy represents a substantial advance in the accessibility and scalability of our genome engineering platform across different genomic loci and cell types. By removing the need for custom minicircle donor production and instead employing a short, universal ssODN in combination with pre-made plasmid donors (available from Addgene), this method enables rapid and cost-effective adaptation across a wide range of target loci and cell types. Although the tagging efficiency is slightly reduced compared to the original minicircle-based system, this trade-off is justified by the operational flexibility and convenience of this system for certain applications.

[0163] Importantly, the generation of a standardized library of dual-cassette donor plasmids, designed with orthogonal attB sites, enables multiplexed and combinatorial tagging experiments, as demonstrated by the successful dual integration of fluorescent tags at ACTR10 and MAP4. This modularity opens the door to more complex synthetic biology applications, including multiplexed lineage tracing, protein interaction mapping, and organelle-specific reporter systems, all from a single universal workflow.

[0164] Example 4. Recombination monitoring system without the insertion of a reporter or selectable marker into the genome and gene replacement method.

[0165] We describe a recombination monitoring strategy that makes use of the dual cassette recombination invention. It has the advantage over traditional recombination reporters that the reporter or selectable marker is functional only after recombination has occurred and is not integrated into the genome. The fragmented reporter or selectable marker may be constitutively or inducibly expressed. In some variants, constitutive expression may constitute transcription but not translation. In some variants, only a start codon and Kozak sequence are absent from the reporter. This strategy can be used for research purposes and also for the rapid generation of clinically relevant cell types. The recombination monitoring strategy can be used in conjunction with a gene replacement method (also depicted in Figure 7 and Figure 15). The gene replacement strategy introduces two double-stranded breaks at two separate loci flanking a gene of interest. A ssODN with dual heterotypic recombination cassettes is inserted via HDR in place of the gene of interest. A cargo vector carrying a modified version of the gene of interest or some other construct is inserted. This approach has the advantage of introducing multiple edits across a large stretch of DNA simultaneously. It is useful in both research and clinical settings.

[0166] In a further embodiment of the recombination monitoring system, a genetic amplifier circuit is employed where expression of an activator protein induces expression from many or all cargo plasmids within a cell. The activator protein is co-expressed with the fragmented reporter or selectable marker and only translated when the fragmented reporter or selectable marker is complemented by recombination. The activator protein recognizes a promoter on the cargo plasmid activating a separate reporter. Without the use of an amplifier, expression from the cargo vector can be confined to one or two plasmid molecules enabling precision gene expression studies.

[0167] Material and Methods ssODN design ssODNs that contain a single recombination site use an attP variant sequence that is 58bp long. ssODNs that contain two recombination sites use core attP variant sequences that are 48bp long (their sequences are fully derived from the 58bp variant). When convenient, the length of one of the two 48bp long sites in the dual recombination cassette is extended by including an additional 5bp from the 58bp variant as described below. In this study, the recombination sites used in each part of the doublet pair of attP-attB sites contain different central dinucleotide mutants (heterotypic sites) in order to ensure the efficient integration of only the insert portion and not the backbone of the donor vector. This theoretically improves recombination efficiency by 50%. Table 1 and 2 contain a breakdown of the recombination sites used throughout this work - attP, attB, resulting attR and attL sites and the lengths of DNA spacers used to keep insertions in-frame in the case of gene tagging.

[0168] Due to the order of insertion of recombination sites in the genome - attP(s) being inserted in the genome first, and subsequently being recombined with a donor molecule containing attB(s) - the resulting recombinant sites and cassette are of the following structure: attR-insert-attL (this is the case for both the single and double pair of attP-attB site systems). In the case of 5’ end tagging (where an N-terminal protein fusion is desired), either the single or dual attP cassettes are designed to replace the start codon of the targeted CDS.

[0169] In the case of 3’ end tagging (where a C-terminal protein fusion is desired), either the single or dual attP cassettes are designed to replace the stop codon of the targeted CDS.

[0170] The single attP-attB pair results in attR and attL sites that are 52bp long post-recombination. The double attP-attB pair results in attR and attL sites which are 47bp long post-recombination. This difference necessitates a slightly different approach in the design of either ssODN oligos, dsDNA donor cargoes or both when keeping inserts in-frame with a native gene is of concern. In this study, we address this difference by implementing the necessary changes in the ssODN design and keep the dsDNA donor plasmids similar.

[0171] For information on how single pair N-terminal tagging and C-terminal constructs are kept inframe see the “dsDNA donor design” section.

[0172] To keep double pair N-terminal tagging constructs in-frame, a DNA spacer is included after the second attP of the ssODN in order to influence the length of the resulting attL. The preferred sequence used in this study is the final 5bp of the 58bp-long attP - effectively the ssODN contains a single 48bp attP followed by another 53bp attP. However, an alternative spacer can be used as long as it fulfils the requirements outlined in the “dsDNA donor design” section.

[0173] To keep double pair C-terminal tagging constructs in-frame, a DNA spacer is included before the first attP of the ssODN in order to influence the length of the resulting attR. The sequence used in this study is the first 5bp of the 58bp attP variant. This effectively results in a ssODN that contains a single attP of 53bp, followed by another 48bp attP. However, an alternative spacer can be used as long as it fulfils the requirements outlined in the “dsDNA donor design” section. sgRNA sequences for CRISPR cuts are designed to cut as close to the insertion site as possible, whilst minimising off-target effects, and ideally with the sgRNA sequence spanning the insertion site to block recutting after correct integration. If this is not possible, synonymous or non-coding mutations should be introduced in the PAM site within the homology arms of the ssODN. sgRNAs are synthesised as chemically modified RNAs (Synthego) to minimise toxicity and maximise editing efficiency. dsDNA donor design

[0174] Recombination donor constructs used in this study are circular dsDNA molecules and contain attB sites which are 46bp long. The double attP-attB pair system contains two attB sites flanking the insert. It can be used without in vitro circularisation as upon completion of the recombination the insert cassette is inserted and the bacterial backbone sequence is excised.

[0175] N-terminal tagging constructs are designed to be in-frame with the gene-of-interest postrecombination. The length of the attR and attL sites that result from recombination is 52bp in the case of the single attP-attB pair system and 47bp in the case of the dual attP-attB system.

[0176] To keep N-terminal tagging constructs in-frame a DNA spacer is included in the 3’ end of the dsDNA donor construct. Importantly, the spacer shouldn’t contain stop or start codons and its length should complement the attL to a length divisible by 3. A quick way to check that this is possible is to perform a modulo operation with a divisor of 3 on the sequence length - it should return a remainder of 2. This is because 52 (the length of attR and attL resulting from recombination of the single attP-attB system) has a remainder of 1 when divided by 3, their sum is 54, which is divisible by 3 and hence would be in-frame in the absence of stop codons.

[0177] To keep C-terminal tagging constructs in-frame a DNA spacer is included in the 3’ end of the dsDNA donor construct. As in the case of N-terminal tagging, the spacer’s length is designed to return a remainder of 2 when divided by 3 and not to avoid stop codons. dsDNA donor circularisation

[0178] The dsDNA donors used in the single attP-attB pair system were generated from producer plasmids, in turn purified from bacterial cultures. In initial experiments, the plasmids were digested with Bbsl and the fragment corresponding to the insert was gel purified. In subsequent experiments a PCR step to amplify the insert was performed and gel purification was omitted. Briefly, 16x 20 pL reactions were set up with 1x KAPA HS HiFi mastermix and 500 pg template plasmid DNA and primers M13F[17-mer] and IG161 af final concentrations of 300 nM each. PCR was performed with the following steps: 95°C 3 min; 25x (98°C 20 sec, 48°C 15 sec, 72°C 30 sec); 72°C 2 min. The reactions were then pooled, loaded onto a single column and purified using Macherey Nagel NucleoSpin PCR and Gel Extraction purification columns (referred to as MN kit), following the manufacturer’s protocol (in all cases, an extra step of centrifugation at 50 x g for 1 min was included during elution prior to the final spin as per manufacturer’s recommendations for increased sample recovery), elution volumes were 100-110 pL. The typical yields were between 8 and 10 pg of DNA. The pooled purified sample was digested in 5 x 100 pL reactions with 1x rCutsmart buffer (cat. #B6004) using 40 U of Bbsl-HF (R0539) at 37°C overnight. The reactions were then pooled, loaded onto a single column and purified using the MN kit as above. The purified and digested insert fragment was incubated in a ligation reaction to induce circularisation. Briefly, 10x reactions of 120 pL were prepared with 1x T4 DNA Ligase Reaction Buffer (cat. #B0202) and 2400 CELLI of T4 DNA Ligase and final DNA concentrations ranged between 8-9 ng / uL. The Low molar concentrations of DNA substrate and high concentrations of ligase improve the yield of the self-ligated circularised monomer. High DNA concentrations increase the accumulation of intermolecular ligation and the formation of linear and circular dimers, trimers and higher multimers. The reactions were incubated for a minimum of 2 hours up to overnight at 20°C. The reactions were then pooled, loaded onto a single column and purified using the MN kit as above. In some experiments, the ligation reactions were treated with T5 exonuclease (cat. #M0663) to remove carryover linear monomers and ligated linear multimers as well as open circles (nicked DNA) and ssDNA and purified again as described above. Routine quality control of the fraction of circular monomer was performed using Agilent Tapestation D500 screentape and D5000 dsDNA kit. Initial experiments with gel-purified circular monomer resistant to T5 exonucleolytic digestion were performed on 1x TAE 1 % agarose gels with EtBr to establish the correspondence of the migration pattern of the circular monomer molecular species between agarose and screentape - in the presence of EtBr, the circular monomer migrates faster than linear monomer like supercoiled DNA on agarose, on screen tapes the circular dsDNA migrates slower than linear dsDNA. For the tagging experiments shown in this paper, the molar proportion of circular monomers in the ligation end-product mixture ranged from ~40% to 50%.

[0179] Endotoxin removal from DNA preparations

[0180] DNA extractions were purified using the TXS method prior to nucleofections. Briefly, a 0.25 volume of TXS solution was added to 1 volume DNA solution and mixed thoroughly by inverting. The solution was then incubated at room temperature for 5-10 minutes or for as long as overnight at 4°C. A 0.25 volume of 5M NaCI was then added and mixed thoroughly by inverting. The sample was then centrifuged for at least 10 minutes at maximum speed (>15,000 x g) at 4°C. The clear upper layer, which contains the purified plasmid, was aspirated into a clean tube (care was taken not to take up the red tinted solution at the bottom of the tube). The clear supernatant was then precipitated using 100% isopropanol, washed with 70% v / v ethanol and dried. The DNA pellet was then resuspended with nuclease-free water or TE buffer (pH 8).

[0181] Mammalian cell culture

[0182] Kolf2.1s is an edited induced pluripotent stem cell (iPSC) line, corrected for a 19bp deletion in one copy of ARID2, which has undergone extensive characterisation and is commonly used for editing. Kolf2.1s are derived by the Human Induced Pluripotent Stem Cell Initiative (HipSci) consortium (ref). Kolf2.1s BFP / GFP reporter line contains a BFP reporter inserted in the ROSA26 locus under a EF1 a promoter (Bassett’s lab). iPSC lines were cultured under feeder free condition in Stemflex medium (combo kit, Gibco TM A3349401) on Vitronectin substrate. Vitronectin is used at 1 :100 dilution of a 1 mg / ml stock solution in PBS, using 1 ml per 6w well for coating. Incubate at RT for 1 hour before aspirating and replacing with culture media immediately. After initial thaw, cells were clump-passaged 1 :10 every 4-5 days and cultured in a humidified incubator at 37°C and 5% CO2. K562 and HAP1 were cultured respectively in RPMI and DMEM / F12 medium both supplemented with 10% (vol / vol) fetal bovine serum (FBS).

[0183] Nucleofection

[0184] Nucleofection of Cas9 RNP, ssODN containing the attP site, Bxb1 plasmid and cargo donor containing the attB site in iPSCs were carried out in P3 Primary Cell buffer in 16-well cuvettes (Lonza) using an Amaxa 4D-Nucleofector (Lonza). Synthetic sgRNA (Synthego) and end- blocked ssODN (ultramer; IDT) were diluted in IDT duplex buffer to a concentration of 200mM and 10OmM, respectively. eSpCas9 protein was in house produced and diluted in PBS to a final concentration of 4mg / ml.

[0185] Small molecule titration

[0186] All small molecule inhibitors tested are commercially available. AZD-7648 (HY-111783, MedChem Express), M3814 (HY-101570, MedChem Express) and NU7441 (S2638, Selleckchem) were dissolved in DMSO (Thermofischer Scientific) at a concentration of 5mM. IDT HDR Enhancer v2 (10007910, IDT) was purchased as a 0.69 mM concentrated solution in DMSO. IDT HDR Enhancer v1 is no longer commercially available.

[0187] Optimal concentrations of small molecule inhibitors were determined using the BFP-GFP reporter assay. Nucleofection of sgRNA (Synthego), Cas9 protein (produced in-house) and ssODN (Ultramer DNA oligo, IDT) into iPSC BFP reporter line were carried out in 10OuL cuvettes (Lonza) using an Amaxa 4D-Nucleofector (Lonza), P3 Primary Cell buffer and program CA137. Final amounts per nucleofection: 1x10 6 cells in 100 pL P3 solution, 20 pg Cas9 protein, 20 pg sgRNA and 500pmol ssODN. Post-nucleofection, cells were maintained in small molecule inhibitor supplemented culture media at various concentrations (0, 0.5, 1 , 2, 4, 10, 20, 30 and 50uM) for 24 hours. 3 days post-nucleofection, cells were analysed for presence or absence of GFP and BFP respectively by FACS (CytoFLEX, Beckman Coulter).

[0188] Genomic DNA extraction and characterisation by PCR

[0189] DNA was extracted from nucleofected cells using the DNAeasy Blood and Tissue kit from Qiagen (Cat. No. i ID: 69504) according to manufacturer’s instructions. After purification, genomic DNA was eluted in 50pl of water. To confirm correct integration, target regions were PCR amplified and analysed by gel electrophoresis. 10ng of gDNA was used to set up 50p I PCR reactions using KAPA HiFi HotStart ReadyMix (2x) (KAPA Biosystems, KK2601). The thermal cycling profile of the PCR was: 95°C 3 min; 35x (98°C 20 s, 65°C 15s, 72°C 15s); 72°C 1 min.

[0190] Genome-editing characterisation by ICE analysis

[0191] Quantification of ssODN integration

[0192] A few days post-electroporation, edited cells were pelleted by centrifugation and the DNA isolated using PureLink™ Genomic DNA Mini Kit according to manufacturer’s instructions. Amplicons were generated using indicated PCR primers (Table XXX), designed to amplify an approximately 1000 bp region of genomic DNA surrounding the target site. 10ng of gDNA was used to set up 50pl PCR reactions using KAPA HiFi HotStart ReadyMix (2x) (KAPA Biosystems, KK2601). The thermal cycling profile of the PCR was: 95°C 3 min; 35x (98°C 20 s, 65°C 15s, 72°C 15s); 72°C 1 min.

[0193] Resulting PCR product was purified using Monarch® PCR & DNA Cleanup Kit (5 pg) according to manufacturer’s instructions and shipped to Genewiz (Leipzig, Germany) for Sanger sequencing. Trace sequencing files were uploaded to ICE v2 (https: / / ice.synthego.com / , Synthego) to quantify efficiency of ssODN integration.

[0194] Imaging

[0195] Cells for imaging were plated on PhenoPlate 96-well black walled microplates (Rewity, cat. #6005182). Once confluent cells were washed with 10OpI PBS per well and fixed at room temperature for 10 minutes with 4% PFA supplemented with Hoechst at 1 pg / ml for nuclei staining (40pl / well). Post-fixing, cells were washed 3 times then stored in 10OpI PBS. Cells were imaged on an Opera Phenix (Perkin Elmer) using a 40x / 1 .1 NA water lens, or as specified in the figure legends. Hoechst and mNeonGreen were excited at 375nm and 488nm, respectively. Hoechst fluorescence was collected at 435-480nm with an exposure time of 60ms, and mNeonGreen fluorescence was collected at 500-525nm with an exposure time of 100ms.

[0196] Primary T cell isolation and stimulation

[0197] Human biological samples were sourced ethically, and their research use was in accord with the terms of informed consent under an institutional review board / ethics committee-approved protocol (15 / NW / 0282). Peripheral blood mononuclear cells (PBMCs) were isolated from fresh leukapheresis products from human healthy donors (Leukopaks, BiolVT) using a Ficoll-Paque PLUS (GE Healthcare, cat. #GE17-1440-03) density gradient centrifugation. Cells were cryopreserved in freezing media (RPMI 1640 (Gibco, cat. #52400025), 10% DMSO, 50% Fetal Bovine Serum (FBS, SIGMA-ALDRICH, cat. #F9665)) and stored in liquid nitrogen. PBMCs were thawed a day before T cell isolation, resuspended in complete RPMI media at 20e6 cells / mL (RPMI 1640, 10% FBS, 100 U / mL Penicillin-Streptomycin (Gibco, cat. #15140122), 2 mM L- Glutamine (Merck, cat. #G7513)) and incubated at 37°C 5% CO2 overnight. PBMCs were collected and washed twice with DPBS without calcium or magnesium (Gibco, cat. #14190144). Total CD4+ T cells were isolated by immunomagnetic negative selection using the EasySep™ Human CD4+ T Cell Isolation Kit (STEMCELL Technologies, cat. #17952) according to the manufacturer’s instructions. After isolation, cells were cultured in media consisting of StemPro™-34 SFM (Gibco, cat. #10639011), 10% FBS, 100 U / mL Penicillin-Streptomycin, 2 mM L-Glutamine, recombinant Human IL-2 at 40U / mL 10 ng / mL (PeproTech, cat. #200- 02BiolegendR&D systems) (named as complete StemPro) at 1 e6 cells / mL. Cells were then stimulated with 12 pL / mL lmmunoCult™(TM) Human CD3 / CD28 T Cell Activator (STEMCELL Technologies, cat. #10971).

[0198] Nucleofection of primary T cells

[0199] Lyophilized sgRNAs (Synthego) and ssODNs (IDT) were resuspended in water to a stock concentration of 100pM and stored at -20°C until use. RNPs were produced by mixing sgRNAs (180 pmol) and Cas9 (Alt-R™ S.p. Cas9 Nuclease V3, IDT, 61 pmol) at a 3:1 sgRNA:Cas9 molar ratio. The following ONE STEP components were added to the RNP complexes: ssODN GA GT donor template (100 pmol), Bxb1 plasmid (500 ng), and GA mNeonGreen GT plasmid (1.5pg).

[0200] Primary T cells were spun down for 5min at 400g and washed twice with DPBS without calcium or magnesium, before being resuspended in B1 mix buffer (RECIPE) at 7e5 cells per 20pL and added to the ONE STEP pre-mix. The cells in the buffer were then transferred to a 16-well Nucleocuvette™ Strip (Lonza, 4D-Nucleofector™ X Kit) for nucleofection using the pulse code EH-115.

[0201] Immediately after nucleofection, 80pL of pre-warmed complete StemPro media was added to each well and incubated at 37°C with 5% CO2 for 15 min. The cells were then transferred to a 96-well round-bottom plate containing 145pL of media with 0.5pM AZD-7648 and incubated at 37°C with 5% CO2 for 24 hours. AZD-7648 was then washed out by removing supernatants without disturbing the pellets and resuspending the cells in 250pL of pre-warmed media.

[0202] Long-read sequencing using Cas9 enrichment

[0203] Kolf 2.1s cells were targeted with a mNeonGreen construct at the ACTR10 locus using either the single attP (GT) cassette or the dual attP (GA-GT) cassettes. Cells were then sorted on green fluorescence after a week of growth, following transfection. Five million cells per condition (sorted and unsorted, single and dual-cassette) were pelleted and frozen at -20°C. The pellets were thawed and high molecular weight (HMW) DNAwas extracted using the Qiagen Magattract HMW kit (cat. #67563), following the manufacturer’s protocol for blood cells. The HMW DNA was checked for quality and integrity on a Tapestation 4150 using a Genomic DNA screentape. The DNA extractions were found to >60 kb in length. Aliquots of the HMW DNA were then processed in accordance with the Oxford Nanopore Technologies protocol ENR_9084_v109_revW_04Dec2018 and with the Pacific Biosciences 103-329-400 REV 2 protocol (using the PureTarget™ repeat expansion kit).

[0204] Data analysis of long-read sequencing using Cas9 enrichment

[0205] Analysis of sequencing data consisted of the following steps - all reads were aligned to a modified human reference genome sequence (modified with the addition of an mNeonGreen insertion in the ACTR10 locus) using minimap2. The reads mapping to chromosome 14 were then extracted from the alignment as FASTQ using samtools (40). This step was done to limit computational overhead and to limit false positive alignment of off-target reads. The reads were then aligned again to short 50kb reference sequences representing the wild-type ACTR10 locus, the ssODN insertion or the full mNeonGreen insertion in the ACTR10 locus using minimap2. The alignments were then analysed using a custom Python script using the bamnostic module (41) - individual reads were assigned to alleles based on the highest alignment score (AS - a metric provided in SAM / BAM files produced by minimap2 (42)) and extracted into separate FASTQ files. The assigned reads were again mapped to the 50kb references and the resulting alignments were used for plotting a subregion flanked by the enrichment sgRNA’s cut sites (reads shorter than 300bp were filtered).

[0206] References

[0207] 1. Li,T„ Yang.Y., Qi,H„ Cui.W., Zhang, L„ Fu,X„ He,X„ Liu.M., Li,P.-F. and Yu,T. (2023) CRISPR / Cas9 therapeutics: progress and prospects. Signal Transduct Target Ther, 8, 36.

[0208] 2. Pacesa.M., Pelea.O. and Jinek.M. (2024) Past, present, and future of CRISPR genome editing technologies. Cell, 187, 1076-1100.

[0209] 3. Ran.F.A., Hsu.P.D., Wright, J., Agarwala.V., Scott, D.A. and Zhang, F. (2013) Genome engineering using the CRISPR-Cas9 system. Nat. Protoc., 8, 2281-2308.

[0210] 4. Chen,F., Pruett-Miller,S.M., Huang, Y., Gjoka.M., Duda,K., Taunton, J., Collingwood, T.N., Frodin.M. and Davis, G.D. (2011) High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases. Nat. Methods, 8, 753-755.

[0211] 5. Wang,X., Wang,Y., Huang, H., Chen,B., Chen,X., Hu, J., Chang, T., Lin,R.-J. and Yee,J.-K. (2014) Precise gene modification mediated by TALEN and single-stranded oligodeoxynucleotides in human cells. PLoS One, 9, e93575.

[0212] 6. Friedel, R.H., Plump, A., Lu,X., Spilker.K., Jolicoeur.C., Wong,K., Venkatesh.T.R., Yaron.A., Hynes, M., Chen,B., et al. (2005) Gene targeting using a promoterless gene trap vector (‘targeted trapping’) is an efficient method to mutate a large fraction of genes. Proceedings of the National Academy of Sciences, 102, 13188-13193. 7. Norris, A.L., Lee.S.S., Greenlees, K.J., Tadesse.D.A., Miller, M.F. and Lombardi, H.A. (2020) Template plasmid integration in germline genome-edited cattle. Nat. Biotechnol., 38, 163-164.

[0213] 8. Roth.T.L., Puig-Saus,C., Yu,R., Shifrut.E., Carnevale, J., Li.P.J., Hiatt, J., Saco, J., Krystofinski.P., Li,H., et al. (2018) Reprogramming human T cell function and specificity with non-viral genome targeting. Nature, 559, 405-409.

[0214] 9. Song,F. and Stieger.K. (2017) Optimizing the DNA Donor Template for Homology-Directed Repair of Double-Strand Breaks. Mol. Ther. Nucleic Acids, 7, 53-60.

[0215] 10. Zelensky, A.N., Schimmel, J., Kool,H., Kanaar.R. and Tijsterman.M. (2017) Inactivation of Pol 0 and C-NHEJ eliminates off-target integration of exogenous DNA. Nat. Commun., 8, 66.

[0216] 11 . Song, A., Zhang, Y., Han,L., Yegutkin.G.G., Liu,H., Sun,K., D’Alessandro, A., Li, J., Karmouty- Quintana.H., Iriyama.T., et al. (2017) Erythrocytes retain hypoxic adenosine response for faster acclimatization upon re-ascent. Nat. Commun., 8, 14108.

[0217] 12. Gutierrez-Triana, J.A., Tavhelidse.T., Thumberger.T., Thomas.l., Wittbrodt.B., Kellner, T., Anlas.K., Tsingos.E. and Wittbrodt.J. (2018) Efficient single-copy HDR by 5’ modified long dsDNA donors. Elife, 7.

[0218] 13. Shy.B.R., Vykunta.V.S., Ha, A., Talbot, A., Roth.T.L., Nguyen, D.N., Pfeifer, W.G., Chen.Y.Y., Blaeschke.F., Shifrut.E., et al. (2023) High-yield genome engineering in primary cells using a hybrid ssDNA repair template and small-molecule cocktails. Nat. Biotechnol., 41 , 521-531.

[0219] 14. Li.K., Wang.G., Andersen, T., Zhou.P. and Pu.W.T. (2014) Optimization of genome engineering approaches with the CRISPR / Cas9 system. PLoS One, 9, e105779.

[0220] 15. Feng.Y.Q., Seibier, J., Alami, R., Eisen, A., Westerman, K. A., Leboulch.P., Fiering.S. and Bouhassira.E.E. (1999) Site-specific chromosomal integration in mammalian cells: highly efficient CRE recombinase-mediated cassette exchange. J. Mol. Biol., 292, 779-785.

[0221] 16. Mulholland, C.B., Smets.M., Schmidtmann.E., Leidescher.S., Markaki.Y., Hofweber.M., Qin.W., Manzo, M., Kremmer.E., Thanisch.K., et al. (2015) A modular open platform for systematic functional studies under physiological conditions. Nucleic Acids Res., 43, e112.

[0222] 17. Low.B.E., Hosur.V., Lesbirel.S. and Wiles, M.V. (2023) Efficient targeted transgenesis of large donor DNA into multiple mouse genetic backgrounds using bacteriophage Bxb1 integrase. Sci. Rep., 13, 11756.

[0223] 18. Xu,Z., Thomas, L., Davies, B., Chalmers, R., Smith, M. and Brown, W. (2013) Accuracy and efficiency define Bxb1 integrase as the best of fifteen candidate serine recombinases for the integration of DNA into the human genome. BMC Biotechnol., 13, 87.

[0224] 19. Russell, J. P., Chang, D.W., Tretiakova.A. and Padidam.M. (2006) Phage Bxb1 integrase mediates highly efficient site-specific recombination in mammalian cells. Biotechniques, 40, 460, 462, 464.

[0225] 20. Singh, S., Ghosh, P. and Hatfull, G.F. (2013) Attachment site selection and identity in Bxb1 serine integrase-mediated site-specific recombination. PLoS Genet., 9, e1003490. 21. Dafhnis-Calas.F., Xu,Z., Haines, S., Malla.S.K., Smith, M.C.M. and Brown, W.R.A. (2005) Iterative in vivo assembly of large and complex transgenes by combining the activities of phiC31 integrase and Cre recombinase. Nucleic Acids Res., 33, e189.

[0226] 22. Chalberg.T.W., Portlock, J. L., Olivares, E.C., Thyagarajan.B., Kirby, P. J., Hillman, R.T., Hoelters.J. and Calos, M.P. (2006) Integration specificity of phage phiC31 integrase in the human genome. J. Mol. Biol., 357, 28-48.

[0227] 23. Durrant, M.G., Fanton, A., Tycko.J., Hinks.M., Chandrasekaran.S.S., Perry, N.T., Schaepe.J., Du,P.P., Lotfy.P., Bassik.M.C., et al. (2023) Systematic discovery of recombinases for efficient integration of large DNA sequences into the human genome. Nat. Biotechnol., 41 , 488-499.

[0228] 24. Suzuki, K., Tsunekawa.Y., Hernandez-Benitez, R., Wu,J., Zhu, J., Kim.E.J., Hatanaka.F., Yamamoto, M., Araoka.T., Li,Z. , et al. (2016) In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540, 144-149.

[0229] 25. Zeng,F., Beck,V., Schuierer.S., Garnier,!., Manneville.C., Agarinis.C., Morelli, L., Quinn, L., Knehr.J., Roma,G., et al. (2020) A Simple and Efficient CRISPR Technique for Protein Tagging. Cells, 9.

[0230] 26. Anzalone, A. V., Randolph, P.B., Davis, J. R., Sousa, A.A., Koblan.L.W., Levy, J. M., Chen, P. J., Wilson, C., Newby, G.A., Raguram.A., et al. (2019) Search-and-replace genome editing without double-strand breaks or donor DNA. Nature, 576, 149-157.

[0231] 27. Ferreira da Silva, J., Oliveira, G.P., Arasa-Verge,E.A., Kagiou.C., Moretton.A., Timelthaler.G., Jiricny , J . and Loizou.J.I. (2022) Prime editing efficiency and fidelity are enhanced in the absence of mismatch repair. Nat. Commun., 13, 760.

[0232] 28. Fichter.K.M., Setayesh.T. and Malik, P. (2023) Strategies for precise gene edits in mammalian cells. Mol. Ther. Nucleic Acids, 32, 536-552.

[0233] 29. Yarnall.M.T.N., loannidi, E. I., Schmitt-Ulms.C., Krajeski.R.N., Lim,J., Villiger.L., Zhou,W., Jiang, K., Garushyants.S.K., Roberts, N., et al. (2023) Drag-and-drop genome insertion of large sequences without double-strand DNA cleavage using CRISPR-directed integrases. Nat. Biotechnol., 41 , 500-512.

[0234] 30. Pandey.S., Gao.X.D., Krasnow.N.A., McElroy, A., Tao.Y.A., Duby.J.E., Steinbeck, B.J., McCreary, J., Pierce, S.E., Tolar, J., et al. (2024) Efficient site-specific integration of large genes in mammalian cells via continuously evolved recombinases and prime editing. Nat Biomed Eng, 10.1038 / S41551 -024-01227-1.

[0235] 31. Zheng, C., Liu,B., Dong,X., Gaston, N., Sontheimer.E.J. and Xue,W. (2023) Templatejumping prime editing enables large insertion and exon rewriting in vivo. Nat. Commun., 14, 3369.

[0236] 32. Wu,Y., Sidharta.M., Zhong, A., Persily.B., Li,M. and Zhou,T. (2023) Protocol for the design, conduct, and evaluation of prime editing in human pluripotent stem cells. STAR Protoc, 4, 102583. 33. Durrant, M.G., Perry, N.T., Pai.J.J., Jangid.A.R., Athukoralage.J.S., Hiraizumi.M., McSpedon.J.P., Pawluk.A., Nishimasu.H., Konermann.S., et al. (2024) Bridge RNAs direct programmable recombination of target and donor DNA. Nature, 630, 984-993.

[0237] 34. Guo,Q., Mintier.G., Ma-Edmonds,M., Storton.D., Wang,X., Xiao,X., Kienzle.B., Zhao,D. and Feder, J. N. (2018) ‘Cold shock’ increases the frequency of homology directed repair gene editing in induced pluripotent stem cells. Sci. Rep., 8, 1-11.

[0238] 35. Srivastava.M. and Raghavan.S.C. (2015) DNA double-strand break repair inhibitors as cancer therapeutics. Chem. Biol., 22, 17-29.

[0239] 36. Dharanipragada.P., Zhang, X., Liu,S., Lomeli, S.H., Hong, A., Wang,Y., Yang,Z., Lo,K.Z., Vega-Crespo, A., Ribas, A., et al. (2023) Blocking Genomic Instability Prevents Acquired Resistance to MAPK Inhibitor Therapy in Melanoma. Cancer Discov., 13, 880-909.

[0240] 37. Ma,R., Zhao, J., Du,H.-C., Tian,S. and Li,L.-W. (2012) Removing endotoxin from plasmid samples by Triton X-114 isothermal extraction. Anal. Biochem., 424, 124-126.

[0241] 38. Bruntraeger.M., Byrne, M., Long,K. and Bassett, A. R. (2019) Editing the Genome of Human Induced Pluripotent Stem Cells Using CRISPR / Cas9 Ribonucleoprotein Complexes. Methods Mol. Biol., 1961 , 153-183.

[0242] 39. Clement, K., Rees,H., Canver, M.C., Gehrke, J. M., Farouni, R., Hsu.J.Y., Cole.M.A., Liu.D.R., Joung.J.K., Bauer, D.E., et al. (2019) CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol., 37, 224-226.

[0243] 40. Li,H., Handsaker.B., Wysoker.A., Fennell, T., Ruan,J., Homer, N., Marth.G., Abecasis.G., Durbin, R. and 1000 Genome Project Data Processing Subgroup (2009) The Sequence Alignment / Map format and SAMtools. Bioinformatics, 25, 2078-2079.

[0244] 41. D Sherman, M. and E Mills, R. (2018) BAMnostic: an OS-agnostic toolkit for genomic sequence analysis. J. Open Source Softw., 3, 826.

[0245] 42. Li,H. (2021) New strategies to improve minimap2 alignment accuracy. Bioinformatics, 37, 4572-4574.

[0246] 43. Koblan.L.W., Doman, J. L., Wilson, C., Levy, J. M., Tay,T., Newby, G.A., Maianti.J.P., Raguram.A. and Liu.D.R. (2018) Improving cytidine and adenine base editors by expression optimization and ancestral reconstruction. Nat. Biotechnol., 36, 843-846.

[0247] 44. Cajka.G., Liu,M. and Shalem.O. (2024) CRISPR associated enzymes are mislocalized to the cytoplasm in iPSC-derived neurons resulting in KRAB-specific degradation. bioRxivorg, 10.1 101 / 2024.10.19.619045.

[0248] 45. Zafra.M.P., Schatoff.E.M., Katti.A., Foronda.M., Breinig, M., Schweitzer, A. Y., Simon, A., Han,T., Goswami.S., Montgomery, E., et al. (2018) Optimized base editors enable efficient editing in cells, organoids and mice. Nat. Biotechnol., 36, 888-893.

[0249] 46. Huhtinen.O., Prince, S., Lamminmaki.U., Salbo.R. and Kulmala.A. (2024) Increased stable integration efficiency in CHO cells through enhanced nuclear localization of Bxb1 serine integrase. BMC Biotechnol., 24, 44. 47. Bozas.A., Beumer, K.J., Trautman, J. K. and Carroll, D. (2009) Genetic analysis of zinc-finger nuclease-induced gene targeting in Drosophila. Genetics, 182, 641-651.

[0250] 48. Wimberger.S., Akrap.N., Firth, M., Brengdahl.J., Engberg.S., Schwinn, M.K., Slater, M.R., Lundin, A., Hsieh, P.-P., Li,S., et al. (2023) Simultaneous inhibition of DNA-PK and PolG improves integration efficiency and precision of genome editing. Nat. Commun., 14, 4761.

[0251] 49. Robert, F., Barbeau, M., Ethier, S., Dostie.J. and Pelletier, J. (2015) Pharmacological inhibition of DNA-PK stimulates Cas9-mediated genome editing. Genome Med., 7, 93.

[0252] 50. Conant, D., Hsiau.T., Rossi, N., Oki,J., Maures.T., Waite, K., Yang, J., Joshi, S., Kelso, R., Holden, K., et al. (2022) Inference of CRISPR edits from Sanger trace data. CRISPR J., 5, 123- 130.

[0253] 51. An, J., Zhang, C.-P., Qiu,H.-Y., Zhang, H.-X., Chen,Q.-B„ Zhang, Y.-M., Lei,X.-L., Zhang, C.- X., Yin,H. and Zhang, Y. (2024) Enhancement of the viability of T cells electroporated with DNA via osmotic dampening of the DNA-sensing cGAS-STING pathway. Nat. Biomed. Eng., 8, 149- 164.

[0254] 52. Jo,S., Das,S., Williams, A., Chretien, A.-S., Pagliardini.T. , Le Roy, A., Fernandez, J. P., Le Clerre.D., Jahangiri.B., Chion-Sotinel,l., et al. (2022) Endowing universal CAR T-cell with immune-evasive properties using TALEN-gene editing. Nat. Commun., 13, 3453.

[0255] 53. Bedbrook, J. R. and Ausubel.F.M. (1976) Recombination between bacterial plasmids leading to the formation of plasmid multimers. Cell, 9, 707-716.

[0256] 54. Summers, D.K. and Sherratt.D.J. (1984) Multimerization of high copy number plasmids causes instability: Cole 1 encodes a determinant essential for plasmid monomerization and stability. Cell, 36, 1097-1103.

[0257] 55. Sharpe, M.E., Chatwin, H.M., Macpherson, C., Withers, H.L. and Summers, D.K. (1999) Analysis of the ColE1 stability determinant Red. Microbiology, 145 ( Pt 8), 2135-2144.

[0258] 56. Cullot.G., Aird.E.J., Schlapansky.M.F., Yeh.C.D., van de Venn,L., Vykhlyantseva,!., Kreutzer.S., Mailander.D., Lewkow.B., Klermund.J., et al. (2024) Genome editing with the HDR- enhancing DNA-PKcs inhibitor AZD7648 causes large-scale genomic alterations. Nat. Biotechnol.

[0259] 57. Fiumara.M., Ferrari, S., Omer-Javed,A., Beretta, S., Albano, L., Canarutto.D., Varesi.A., Gaddoni.C., Brombin, C., Cugnata.F., et al. (2024) Genotoxic effects of base and prime editing in human hematopoietic stem cells. Nat. Biotechnol., 42, 877-891.

[0260] 58. Huang, M.E., Qin,Y., Shang.Y., Hao,Q., Zhan,C., Lian,C., Luo,S., Liu.L.D., Zhang, S., Zhang, Y., et al. (2024) C-to-G editing generates double-strand breaks causing deletion, transversion and translocation. Nat. Cell Biol., 26, 294-304.

[0261] 59. Eyquem.J., Mansilla-Soto,J., Giavridis.T., van der Stegen.S.J.C., Hamieh.M., Cunanan.K.M., Odak,A., Gbnen.M. and Sadelain.M. (2017) Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection. Nature, 543, 113-117.

[0262] SEQUENCES Table 1 - variant recombination sites

[0263] Bold - core dinucleotide

[0264] Underline - minimal site required for recombination

[0265] Table 2 DUAL attP ssODN DONORs

[0266] CCGCACAAACCAGGGCTCGCCGGTTTGTC

[0267] TGGTCAACCACCGCGGACTCAGTGGTGTA

[0268] CGGTACAAACCGGTTTGTCTGGTCAACCA

[0269] CCGCGGTCTCAGTGGTGTACGGTACAAAC

[0270] CCCGACAAGCCAGGTCAGGCTGGGGTGA

Claims

CLAIMS1 . A method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule.

2. The method of claim 1 , wherein the method comprises delivering the endonuclease, the targeting domain, the ssODN HDR template, the DNA recombinase and the cargo vector, simultaneously to the cell.

3. The method according to any preceding claim, wherein the at least two variant recombination sites present in the ssODN HDR template are selected from variant attB, variant attP, variant attL, variant attR, variant LoxP, variant FRT, preferably variant attP.

4. The method according to any preceding claim, wherein the at least two variant recombination sites present in the cargo vector are selected from variant attB, variant variant attP, variant attL, variant attR, variant LoxP, variant FRT, preferably variant attB.

5. The method according to any preceding claim, wherein the at least two variant recombination sites present in the ssODN HDR template comprise a variant central dinucleotide.

6. The method according to any preceding claim, wherein the at least two variant recombination sites present in the cargo vector comprises a variant central dinucleotide.

7. The method according to any preceding claim wherein the at least two variant recombination sites present in the ssODN HDR template comprise variant attP recombination sites, wherein a first variant attP recombination site comprises a central GA dinucleotide, and wherein a second variant attP recombination site comprises a central GT dinucleotide.

8. The method according to any preceding claim, wherein the at least two variant recombination sites present in the cargo vector comprise variant attB recombination sites, wherein a first variant attB recombination site comprises a central GA dinucleotide, and wherein a second variant attB recombination site comprises a central GT dinucleotide.

9. The method according to any preceding claim, wherein the ssODN HDR template encodes at least two variant recombination sites which are contiguous.

10. The method according to any preceding claim, wherein the endonuclease is provided as a protein.

11. The method according to any preceding claim, wherein and the DNA recombinase is provided in an expression vector.

12. The method according to any preceding claim, wherein the gene editing system is delivered to the cell via electroporation, nucleofection, transfection, lipid-based transfection or nanoparticles.

13. The method according to any preceding claim, wherein the endonuclease is selected from a Cas9 endonuclease, a Cpf1 (Cas12a) endonuclease, CasX endonuclease, CasY endonuclease, MAD7 endonuclease, transcription activator-like effector nuclease (TALEN), zinc finger nuclease.

14. The method according to any preceding claim, wherein the targeting domain is selected from a single guide RNA (sgRNA), a zinc finger DNA binding domain, transcription activator-like (TAL) effector DNA binding domain.

15. The method according to any preceding claim, wherein the endonuclease is delivered as a ribonucleoprotein (RNP) complex.

16. The method according to any preceding claim, wherein the cargo vector encodes a cargo molecule selected from; a fluorescence marker, a purification tag, a degradation tag, a selectable marker, a gene, a genomic region or cDNA for therapeutics, for differentiation, for metabolic engineering, a genetic locus, guide libraries for CRISPR screening, synthetic DNA fragments, an antibody or fragment thereof, a T-cell receptor, B-cell receptor or chimeric antigen receptor (CAR).

17. The method of claim 16, wherein the degradation tag is selected from an N-degron or a C-degron, preferably wherein the degradation tag is selected from; AID, DHFR, or HALO.

18. The method according to claim 16, wherein the fluorescence marker is selected from mNeonGreen, GFP, YFP, CFP, BFP, RFP, EGFP, mCherry, mApple, mStrawberry, mOrange, dTomato, tagRFP, tagBFP.

19. The method according to claim 16, wherein the purification tag is selected from Halo, SNAP, TAP, CLIP, FLAG, c-Myc, HA, CBP, or hexa histidine.

20. The method according to claim 16, wherein the selectable marker is selected from puromycin resistance gene, blasticidin resistance gene, neomycin resistance gene, hygromycin resistance gene or delta-TK.21 . The method according to any preceding claim, wherein the DNA recombinase is a serine recombinase.

22. The method according to any preceding claim, wherein the DNA recombinase is selected from; Bxb1 , phiC31 , Cre, Flp, KD, B2, B3, R.

23. The method according to any preceding claim, wherein the DNA recombinase is provided as a vector comprising a nucleotide sequence encoding a DNA recombinase, a polypeptide or as an mRNA sequence encoding a DNA recombinase.

24. The method according to any preceding claim, wherein the method comprises a step of preparing the cargo vector, comprising:preparing a dsDNA comprising a nucleotide sequence encoding a cargo molecule flanked by at least two variant recombination sites.

25. The method according to any preceding claim, wherein the cargo vector consists of a nucleotide sequence encoding a cargo and at least two variant recombination sites.

26. The method according to any preceding claim, wherein one or more cargo vectors are delivered to the cell.

27. The method according to any preceding claim, wherein one or more ssODN HDR templates, comprising a nucleotide sequence encoding at least two variant recombination sites, are delivered to the cell.

28. The method according to any preceding claim, wherein one or more targeting domains are delivered to the cell.

29. The method according to claim 28, wherein a ss DNA donor molecule is delivered to the cell.

30. The method according to any preceding claim, wherein the endonuclease, the targeting domain, the ssODN HDR template comprising a nucleotide sequence encoding at least two variant recombination sites, the DNA recombinase and the cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule, are delivered to the cell in vivo, in vitro or ex vivo.

31. The method according to any preceding claim wherein the cell is selected from a mammalian cell or a plant cell, preferably wherein the cell is selected from an immune cell, iPSC or a pluripotent or somatic stem cell.

32. A single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites.

33. The single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template according to claim 32, wherein the ssODN HDR template encodes at least two variant recombination sites which are contiguous.

34. A system for gene editing comprising: a Cas9 endonuclease; a single guide RNA (sgRNA); a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase and a cargo vector comprising a nucleotide sequence encoding at least two recombination sites.

35. The system according to claim 34, wherein the cargo molecule is selected from a fluorescence marker, a purification tag, a destabilising tag, or a chimeric antigen receptor (CAR).

36. The system according to claim 34 or 35, formulated for simultaneous delivery to a cell.

37. The system for gene editing according to any one of claims 34 to 36, wherein the system comprises one or more cargo vector.

38. A kit comprising: a Cas9 endonuclease; a single guide RNA (sgRNA); a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and a cargo molecule and optionally instructions for use.

39. The kit according to claim 38, wherein the cargo molecule is selected from a fluorescence marker, a purification tag, a destabilising tag, or a chimeric antigen receptor (CAR).

40. The kit according to claim 38 or 39, wherein the components are formulated for simultaneous delivery to a cell.

41. A kit according to any one of claim 38 to 40, further comprising components which optimise simultaneous delivery of the gene editing system.

42. A composition comprising: a Cas9 endonuclease; a single guide RNA (sgRNA); a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites.

43. The composition according to claim 42, wherein the cargo molecule is selected from a fluorescence marker, a purification tag, a destabilising tag, or a chimeric antigen receptor (CAR).

44. The composition according to claim 42 or 43, formulated for simultaneous delivery to a cell.

45. A method for site-specific integration of an exogenous polynucleotide sequence in a cell, comprising: delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template comprising a nucleotide sequence encoding at least two variant recombination sites, a DNA recombinase, and a cargo vector comprising a nucleotide sequence encoding at least two variant recombination sites and an exogenous polynucleotide;maintaining the cell under conditions such that the targeting domain directs endonuclease mediated integration of the at least two variant recombination sites from the ssODN HDR template at a genomic site of interest; maintaining the cell under conditions such that the DNA recombinase is expressed; allowing the DNA recombinase to contact the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector, wherein the DNA recombinase can mediate site-specific recombination between the at least two variant recombination sites at the genomic site of interest and the at least two variant recombination sites present in the cargo vector to integrate the exogenous polynucleotide into the genomic site of interest.

46. The method according to claim 45, wherein the exogenous polynucleotide encodes a tag, optionally wherein the tag is selected from a fluorescence marker, a purification tag, and / or a degradation tag.

47. The method of claim 45 or 46, wherein the genomic site of interest is in proximity to the nucleotide sequence encoding a protein.

48. A cargo vector obtained by: preparing a dsDNA comprising a nucleotide sequence encoding a cargo molecule flanked by at least two variant recombination sites.

49. A method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites flanking a cargo molecule, a promoter and a selectable marker, wherein the nucleotide sequence encoding the promoter and the nucleotide sequence encoding the selectable marker flank the said at least two recombination sites; and monitoring said cell for expression of the selectable marker.

50. The method according to claim 49, wherein the promoter is selected from CMV promoter, EF1 a promoter, CAG promoter, PGK promotor or U6 promoter.51 . The method according to claim 49 or 50, wherein the selectable marker is selected from a fluorescence marker, antibiotic resistance marker or tag.

52. The method according to claim 51 , wherein the fluorescence marker is selected from mNeonGreen, GFP, YFP, CFP, BFP, RFP, EGFP, mCherry, mStrawberry, mOrange or dTomato.

53. The method according to claim 51 , wherein the antibiotic resistance marker is selected from puromycin resistance gene, blasticidin resistance gene, neomycin resistance gene or hygromycin resistance gene.

54. The method according to claim 51 , wherein the tag is Thy1 .1 .

55. A method for gene editing comprising delivering to a cell: an endonuclease; a targeting domain; a single-stranded oligo DNA nucleotide (ssODN) homology-directed repair (HDR) template, comprising a nucleotide sequence encoding at least two variant recombination sites and a nucleotide sequence encoding a first fragment of a selectable marker or tag, wherein the nucleotide sequence encoding the first fragment of a selectable marker or tag is located between the two variant recombination sites; a DNA recombinase; and a cargo vector, comprising a nucleotide sequence encoding at least two variant recombination sites flanking a cargo molecule, a promoter and a second fragment of a selectable marker or tag, wherein the nucleotide sequence encoding the promoter and the nucleotide sequence encoding the selectable marker flank the said at least two recombination sites; and monitoring said cell for expression of the selectable marker or tag.

56. The method according to claim 55, wherein the promoter is selected from CMV promoter, EF1a promoter, CAG promoter, PGK promotor or U6 promoter.

57. The method according to claim 55 or 56, wherein the selectable marker is selected from a fluorescence marker, antibiotic resistance marker or tag.

Citation Information

Patent Citations

  • Improvement in gun-carriages

    US432A

  • TAL effector-mediated DNA modification

    US8440431B2

  • Improvement in the tops of cans or canisters

    US8440A

  • TAL effector-mediated DNA modification

    US8450471B2

  • CRISPR-Cas systems and methods for altering expression of gene products

    US8697359B1