Method for producing cell spheroid through co-culture of adipocytes and cardiomyocytes, cell spheroid produced thereby, and use thereof
Co-culturing adipocytes and cardiomyocytes in a 3D format addresses the limitations of suspension cell therapies by enhancing cardiomyocyte survival and function, effectively treating heart diseases through improved cardiac output and tissue regeneration.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-08-28
- Publication Date
- 2026-03-05
AI Technical Summary
Existing cell therapy products, particularly those in suspension form, face limitations in directly forming regenerative tissue due to physical and chemical stress during transplantation, leading to low survival rates and indirect therapeutic effects, which are insufficient for effectively treating heart diseases.
A method for producing cell spheroids through co-culturing adipocytes and cardiomyocytes, allowing for stable 3D culture and enhancing therapeutic effects by re-aggregating cells, which can be administered to improve heart function and regenerate damaged tissues.
The co-cultured cell spheroids enhance cardiomyocyte survival and function, improving cardiac output, reducing fibrosis, and regenerating blood vessels, thereby effectively treating heart diseases such as ischemic heart disease.
Smart Images

Figure KR2025013155_05032026_PF_FP_ABST
Abstract
Description
Method for producing cell spheroids through co-culturing of adipocytes and cardiomyocytes, cell spheroids produced thereby, and uses thereof
[0001] The present invention relates to a method for producing cell spheroids through co-culturing of adipocytes and cardiomyocytes, cell spheroids produced thereby, and uses thereof.
[0002] The heart receives blood from the veins and continuously circulates it throughout the body through the arteries. Blood carries oxygen and nutrients to various parts of the body, while simultaneously transporting waste products from various parts of the body and expelling them through the kidneys and lungs. The heart is composed of a cardiac wall, which is composed of three layers. The outermost layer is the epicardium, the middle layer is the myocardium, and the innermost layer is the endocardium. Part of the endocardium is made up of folds, which contain the valves that open and close the heart.
[0003] The heart contracts to pump blood, and this contraction is caused by the myocardium, which is made up of muscles, and this myocardium is the thickest layer of the heart.
[0004] In this regard, heart diseases include myocardial infarction and angina pectoris caused by hardening of the coronary arteries, heart valve disease caused by a disorder of the heart's vessels, cardiomyopathy and myocarditis caused by a disorder of the myocardium, and in addition, there is sudden death or sudden death in which a healthy and energetic person suddenly dies during sleep.
[0005] Among these, myocardial infarction and angina pectoris are called ischemic heart diseases because they are caused by a lack of blood (ischemia) in the coronary arteries that supply oxygen and nutrients to the heart due to blood flow obstruction in the coronary arteries surrounding the heart.
[0006] Ischemic heart disease is basically caused by an imbalance between the amount of oxygen that the heart muscle needs and the amount supplied. The causes include reduced blood flow due to arteriosclerosis, vascular spasm, or thrombosis of the coronary arteries surrounding the heart to supply oxygen to the heart muscle; when the heart is enlarged and the oxygen demand of the heart muscle exceeds the blood supply; and when oxygen transport is reduced due to severe anemia, lung disease, congenital heart disease, carbon monoxide poisoning, smoking, etc.
[0007] When the heart muscle itself becomes damaged due to increased ventricular load caused by hypertension or valvular heart disease, myocardial infarction, myocarditis, or cardiomyopathy, the heart cannot pump enough blood to the organs throughout the body, resulting in decreased cardiac output. To maintain the ventricular output, the heart responds by enlarging the cardiomyocytes, a phenomenon called cardiac hypertrophy. The heart is an organ that has completely completed its developmental differentiation and is unable to proliferate further. When the heart does not have enough blood volume, blood pressure rises, causing the heart to enlarge, which in turn deprives the heart muscle of sufficient oxygen and nutrients, damaging the cardiomyocytes. The damaged cardiomyocytes die, thinning the heart wall, reducing the ejection fraction and impairing the heart's pumping function. In such a situation, the only solution is to increase the size of the cardiomyocytes and induce the cardiomyocytes to generate new muscle.
[0008] This high incidence of heart disease can be attributed to factors such as Westernized eating habits, stress, lack of exercise, and the rise in adult diseases such as hyperlipidemia, diabetes, and obesity. Because adult diseases can be prevented and their symptoms improved through exercise and dietary habits, they are also called lifestyle diseases. This is also why research on the physiological activities of natural products to prevent or treat adult diseases is increasing. Studies on the physiological activities of natural products have reported numerous antioxidant effects, improved effects on vascular diseases such as hyperlipidemia, and inhibition of platelet aggregation of extracts from green tea, grapes, garlic, onions, and citrus fruits.
[0009] Meanwhile, cell therapy refers to a pharmaceutical product manufactured by manipulating cells through physical, chemical, or biological methods, such as in vitro culturing or selecting them. Most cell therapy products are developed in the form of a suspension of single cells cultured in vitro and suspended in additives. However, single cells in suspension preparations have limitations in that the transplanted cells cannot directly form regenerative tissue due to physical and chemical stress in the transplantation environment, as well as anoikis, a detachment-induced apoptosis between cells and the matrix or between cells. Instead, only indirect effects through substances secreted by the cells can be expected. To overcome these limited therapeutic effects, spheroid-type cell therapy products that can increase cell survival rate after transplantation into the body and enhance the therapeutic effects of cell therapy such as vascular regeneration by re-aggregating and recombining cells using a 3D culture method, or three-dimensional tissue engineering products that directly replace damaged tissues / organs by transplanting tissue engineering products in which cells are seeded on a support that acts as an extracellular matrix, are being actively developed.
[0010] However, despite the above research, there is still a need for new cell therapy agents to effectively treat various heart diseases.
[0011] An object of the present invention is to provide a method for producing cell spheroids, which comprises a step of co-culturing adipocytes and cardiomyocytes.
[0012] Another object of the present invention is to provide a cell spheroid manufactured according to the above manufacturing method.
[0013] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating heart disease, which comprises, as an active ingredient, a cell spheroid prepared by co-culturing adipocytes and cardiomyocytes.
[0014] Another object of the present invention is to provide a pharmaceutical composition for preventing or improving heart disease, which comprises, as an active ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0015] Another object of the present invention is to provide a food composition for preventing or improving heart disease, which comprises, as an active ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0016] Another object of the present invention is to provide a feed composition for preventing or improving heart disease, which comprises, as an active ingredient, cell spheroids produced by co-culturing adipocytes and cardiomyocytes.
[0017] Another object of the present invention is to provide a transplant composition comprising, as an active ingredient, a cell spheroid manufactured by co-culturing adipocytes and cardiomyocytes.
[0018] Another object of the present invention is to provide a composition for regeneration or maturation of cardiomyocytes, which comprises, as an active ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0019]
[0020] The technical problem to be achieved according to the technical idea of the invention disclosed in this specification is not limited to the problem to solve the above-mentioned problem, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.
[0021] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.
[0022]
[0023] As one aspect for achieving the above object, the present invention provides a method for producing a cell spheroid, including a step of co-culturing adipocytes and cardiomyocytes.
[0024] In the present invention, the 'spheroid' refers to a cell structure modeled in three dimensions, and more specifically, refers to a cell aggregate or multicellular structure in which a plurality of single cells are cultured in three dimensions. The diameter of the spheroid may increase with the passage of culture time, but when it exceeds a certain size, cell necrosis may occur inside the spheroid. Therefore, it is preferable to culture with an appropriate diameter of the spheroid, and for example, the diameter may be 0.1 to 1 mm, preferably 0.1 to 0.5 mm, and more preferably 0.1 to 0.3 mm, but is not limited thereto.
[0025] In the present invention, the method for producing a cell spheroid includes a step of co-culturing adipocytes and cardiomyocytes, and may further include a step of differentiating adult stem cells into adipocytes prior to the co-culturing step.
[0026] In the present invention, the "adult stem cell" refers to a specific cell type existing in the tissues or organs of an adult, and refers to a population of undifferentiated cells capable of differentiation and self-replication. The adult stem cell of the present invention may be a stem cell derived from one or more selected from the group consisting of bone marrow, umbilical cord blood, blood, skin, fat, and placenta, and preferably an adipose-derived stem cell derived from fat.
[0027] In the present invention, the "adipose-derived stem cells" refer to stem cells derived from adipose tissue. The adipose-derived stem cells may be stem cells derived from adipose tissue of mammals such as humans, dogs, and mice, but are not limited thereto. The adipose-derived stem cells may be a type of adult stem cell isolated from adipose tissue.
[0028] In the present invention, the 'adipocytes' collectively refer to cells that form adipose tissue that stores energy as fat, and can be classified into white adipocytes, brown adipocytes, and beige / brite adipocytes depending on the morphological characteristics and differentiation origin of the cells. In the present invention, the adipocytes co-cultured with cardiomyocytes may exist in a spheroid state, and may be spheroids formed by seeding adipose-derived stem cell single cells into a patterned spheroid formation dish and then culturing them for 2 to 3 days.
[0029] In the present invention, the 'cardiomyocyte' refers to a cell that constitutes most of the walls of the atrium and ventricle.
[0030] In the present invention, the term "co-culture" refers to culturing two or more different types of target cells in the same culture space with the same culture environment. Co-culture includes direct co-culture, which allows contact between multiple different cells in the same culture space, and indirect co-culture, which is divided by a membrane with pores of a certain size so that each cell is prevented from physical contact and interacts through secreted proteins or metabolites. In a specific embodiment, the co-culture of the present invention corresponds to direct co-culture, but is not limited thereto.
[0031] In the present invention, when field potential is recorded using a multi-electrode array system plate, co-culture of adipocytes and cardiomyocytes differentiated from the adipose-derived stem cells exhibits a higher potential amplitude than in the case of culturing cardiomyocytes alone, and the beating cycle of the cardiomyocytes is also maintained more stably, so that the physiological function of the cardiomyocytes can be improved.
[0032] As one aspect for achieving the above purpose, the present invention provides a cell spheroid manufactured according to the above manufacturing method.
[0033] In the present invention, the manufactured cell spheroid may be an 'adipocyte-cardiomyocyte co-culture spheroid', in which cardiomyocytes are positioned between adipocytes, or may be a mixed form of adipocytes and cardiomyocytes. In addition, the spheroid form may be stably maintained for 1 week or longer, may be stably maintained for 3 weeks or longer, may be stably maintained for 5 weeks or longer, or may be stably maintained for 7 weeks or longer, but is not limited thereto, and preferably may be stably maintained for 3 to 5 weeks.
[0034] In the present invention, the manufactured cell spheroid may not exhibit cell necrosis inside the spheroid while maintaining the spheroid shape, compared to a spheroid manufactured by culturing cardiomyocytes alone, and the expression of actinin or connexin-43 may be stably maintained.
[0035] In the present invention, the manufactured cell spheroid has invasion activity, and when the spheroid is administered or transplanted, it can contribute to the regeneration of cardiomyocytes by infiltrating and extending into surrounding cells and regenerating them.
[0036] As one aspect for achieving the above purpose, the present invention provides a pharmaceutical composition for preventing or treating heart disease, which comprises, as an active ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0037] In the present invention, the term 'active ingredient' means an ingredient that exhibits the desired activity alone or can exhibit activity together with a carrier that is inactive in itself.
[0038] In the present invention, 'heart disease' is a broad concept including heart disease, and may be selected from the group consisting of coronary artery disease, chronic heart failure, dilated cardiomyopathy, hypertrophic cardiomyopathy, pericarditis, endocarditis, diastolic hypofunction, cardiac hypertrophy, and cardiac fibrosis, for example. Specifically, examples of diseases related to diastolic hypofunction include, but are not limited to, left ventricular hypertrophy, heart failure, diastolic heart failure, mitral regurgitation, aortic regurgitation, hypertension, dilated cardiomyopathy, ischemic heart disease, ventricular septal defect, tricuspid regurgitation, pulmonary regurgitation, pulmonary hypertension, right ventricular myocardial infarction, cardiomyopathy affecting the right ventricle, atrial septal defect, atrial fibrillation, hypertrophic cardiomyopathy, and infiltrative cardiomyopathy.
[0039] In the present invention, the cell spheroids produced by co-culturing the adipocytes and cardiomyocytes may improve ejection fraction, fractional shortening, cardiac output, stroke volume, or end-systolic pressure-volume relation. In addition, the spheroids produced by co-culturing the adipocytes and cardiomyocytes may reduce fibrosis of cardiac tissue, have activity in preserving or regenerating blood vessels, and have activity in regenerating cardiomyocytes.
[0040] In a specific embodiment of the present invention, when spheroids prepared by co-culturing adipocytes and cardiomyocytes were administered to an animal model of severe ischemic heart disease, it was confirmed that cardiac function was improved by increasing the ejection fraction and the fraction of compartment shortening compared to when a single adipocyte spheroid or cardiomyocyte spheroid was administered separately. In addition, stroke volume and cardiac output were improved, and the maximal volume (Vmax), which is an index of cardiac remodeling measured at maximum diastole, was decreased, and the maximum pressure change rate and the minimum pressure change rate were increased, thereby confirming that cardiac function was improved and protection from cardiac remodeling was provided. In addition, it was confirmed that the end-systolic cardiac volume and pressure change (ESPVR) increased, while the end-diastolic cardiac volume and pressure change (EDPVR) decreased, thereby confirming that the cardiac contractility and hemodynamic recovery capacity were improved.
[0041] The term 'prevention' of the present invention means any act of inhibiting or delaying heart disease by administering to a subject a cell spheroid prepared by co-culturing the adipose cells and cardiomyocytes of the present invention.
[0042] The term 'treatment' of the present invention means all acts of administering the pharmaceutical composition of the present invention to a subject to improve or alleviate the degree of symptoms of heart disease or to provide benefit.
[0043] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of such pharmaceutically acceptable carriers include carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.
[0044] Additionally, carriers for parenteral administration may include water, suitable oils, saline, aqueous glucose, and glycols. They may also contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.
[0045] The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally. Parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration.
[0046] The pharmaceutical composition of the present invention may be formulated as a preparation for oral or parenteral administration, depending on the route of administration as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.
[0047] Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.
[0048] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, or preservatives may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, and preservatives may be additionally included.
[0049] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. The injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injections from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. Additionally, the above injections may in most cases additionally contain isotonic agents such as sugar or sodium chloride.
[0050] Transdermal administration includes ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" here refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.
[0051] For inhalation administration, the compositions used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of all pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).
[0052] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy or biological response modifiers.
[0053] As another aspect for achieving the above purpose, the present invention provides a pharmaceutical composition for preventing or improving heart disease, which comprises, as an active ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0054] The above 'fat cells', 'cardiomyocytes', 'spheroids', 'active ingredient', 'heart disease', and 'prevention' are as described above.
[0055] The term 'improvement' of the present invention means any act of improving or benefiting the condition of a heart disease by using a cell spheroid produced by co-culturing the adipose cells and cardiomyocytes of the present invention.
[0056] The term 'quasi-drug' used in the present invention means an article other than a device, machine or apparatus used for the purpose of diagnosing, treating, alleviating, managing or preventing a disease of a human or animal, and an article other than a device, machine or apparatus used for the purpose of exerting a pharmacological effect on the structure and function of a human or animal, and may include, but is not limited to, an oral preparation, and the method of formulation, dosage, method of use, components, etc. of a quasi-drug may be appropriately selected from conventional techniques known in the art.
[0057] In addition to the above-mentioned ingredients, the quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent, as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc.
[0058] As another aspect for achieving the above object, the present invention provides a food composition for preventing or improving heart disease, which comprises, as an active ingredient, a spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0059] The above 'fat cells', 'cardiomyocytes', 'spheroids', 'active ingredient', 'heart disease', 'prevention' and 'improvement' are as described above.
[0060] The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additive, feed, cultured meat, etc., and is intended for consumption by animals including humans or livestock. The above-mentioned type of food composition can be manufactured in various forms according to conventional methods known in the art. The above-mentioned 'cultured meat' refers to lean meat produced by cell engineering technology that collects and cultures stem cells of living animals and cultures meat without a livestock farm.
[0061] The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (ham, sausages, corned beef, etc.), breads and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (soybean paste, soy sauce, sauces, etc.), etc., and the above-mentioned effective ingredient can be added thereto to manufacture the composition.
[0062] In addition, nutritional supplements can be manufactured by adding the above-mentioned active ingredient to capsules, tablets, pills, etc. Furthermore, health functional foods can be manufactured in the form of tea, juice, and drinks, and can be consumed as health drinks by liquefying, granulating, encapsulating, and powdering. In addition, to use the cardiomyocyte spheroids as a food additive, they can be manufactured in the form of a powder or concentrate. In addition, they can be manufactured in the form of a composition by mixing them with known active ingredients known to be effective in improving heart disease.
[0063] In addition to the above, the health food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents.
[0064] As another aspect for achieving the above object, the present invention provides a feed composition for preventing or improving heart disease, which comprises, as an active ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0065] The above 'fat cells', 'cardiomyocytes', 'spheroids', 'active ingredient', 'heart disease', 'prevention' and 'improvement' are as described above.
[0066] The term 'feed' of the present invention refers to any natural or artificial diet, meal, etc. or ingredients of the meal for animals to eat, ingest, and digest, and can be manufactured into various forms of feed known in the art, and specifically includes, but is not limited to, concentrate feed, forage, feed additives, feed supplements, pet nutrients, or special feed.
[0067] Concentrated feed includes, but is not limited to, seed products including grains such as wheat, oats, and corn; bran including rice bran, wheat bran, and barley bran as by-products obtained from refining grains; sesame cakes which are by-products obtained from extracting soybeans, sesame seeds, linseeds, and coconut oil; residual starch which is the main component of starch residue left after removing starch from sweet potatoes, potatoes, etc.; animal feed such as fish meal, fish waste, fish soluble which is concentrated fresh liquid obtained from fish; meat meal, blood meal, feather meal, skim milk powder, dried whey which is the residue when manufacturing cheese from milk or casein from skim milk; yeast, chlorella, and seaweed. Forage includes, but is not limited to, raw forage such as wild grass, pasture, and green grass; root vegetables such as forage turnips, forage beets, and a type of turnip called luterberger; silage, which is stored forage made by filling a silo with raw grass, green grass crops, and grain and fermenting it with lactic acid; hay made by cutting and drying wild grass and pasture; straw from breeding crops; and leaves of legumes. Special feed includes, but is not limited to, mineral feed such as oyster shells and rock salt; urea feed such as urea or its derivative diuretic isobutane; feed additives and dietary supplements, which are substances added in small amounts to compound feed to supplement ingredients that are likely to be lacking when only natural feed ingredients are mixed or to increase the storability of feed.
[0068] The feed composition of the present invention may further include ingredients added to conventional feed. Examples of ingredients added to such feed may include grain powder, meat powder, and legumes. The grain powder may be at least one selected from rice flour, wheat flour, barley flour, and corn flour. The meat powder may be a powdered meat powder obtained by pulverizing at least one selected from chicken, beef, pork, and ostrich meat. The legumes may be at least one selected from soybeans, kidney beans, peas, and black beans.
[0069] The feed composition of the present invention may, in addition to the grain powder, meat powder, and legumes that are ingredients added to the conventional feed mentioned above, add at least one selected from among nutrients and minerals to increase the nutritional value of the feed, and may include at least one selected from among antifungal agents, antioxidants, anticoagulants, emulsifiers, and binders to prevent deterioration of feed quality.
[0070] The feed composition for improving heart disease according to the present invention can be manufactured by adding cell spheroids in an appropriate effective concentration range according to various feed manufacturing methods known in the art.
[0071] The feed composition according to the present invention is not particularly limited and can be applied to any subject intended for the prevention or improvement of heart disease. For example, it can be applied to any subject, including non-human animals such as monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cows, sheep, pigs, goats, birds, and fish.
[0072] As another aspect for achieving the above object, the present invention provides a composition for transplantation comprising, as an active ingredient, a cell spheroid manufactured by co-culturing adipocytes and cardiomyocytes.
[0073] The above 'adipocytes', 'cardiomyocytes', 'co-culture', 'spheroids' and 'active ingredient' are as described above.
[0074] In the present invention, the term "transplantation" is used in a general sense to describe the process of transplanting an organ, tissue, cell mass, or individual cell into a patient. The term "transplantation" is defined as the process of transferring viable tissue or cells to a recipient with the goal of maintaining the functional integrity of the transplanted tissue or cells.
[0075] As a specific example, when a spheroid manufactured by co-culturing the above-described adipose cells and cardiomyocytes was transplanted into a subject, it was confirmed that a large number of transplanted cardiomyocytes were engrafted in the damaged area, and it was confirmed that remuscularization was induced therefrom, resulting in a therapeutic effect.
[0076] As another aspect for achieving the above purpose, the present invention provides a composition for regeneration or maturation of cardiomyocytes, which comprises, as an effective ingredient, a cell spheroid produced by co-culturing adipocytes and cardiomyocytes.
[0077] The above 'adipocytes', 'cardiomyocytes', 'co-culture', 'spheroids' and 'active ingredient' are as described above.
[0078] As a specific example, when the above-mentioned adipocytes and cardiomyocytes were co-cultured, it was confirmed that further maturation occurred in the co-cultured cardiomyocytes, and in the case of cell spheroids produced by co-culturing adipocytes and cardiomyocytes, it was confirmed that cardiomyocytes infiltrated into the matrix, thereby confirming cardiomyocyte regenerative activity, and when cell spheroids produced by co-culturing adipocytes and cardiomyocytes were administered to an animal model of severe ischemic heart disease, it was confirmed that the number of surviving / increased cardiomyocytes in both the infarct / border zone significantly increased. The composition for cardiomyocyte regeneration or maturation comprising the cell spheroid of the present invention as an active ingredient may exhibit an effect in vivo or in vitro.
[0079] As another aspect for achieving the above object, the present invention provides a method for preventing or treating heart disease, comprising a step of administering to a subject a composition comprising cell spheroids prepared by co-culturing adipocytes and cardiomyocytes.
[0080] As another aspect for achieving the above object, the present invention provides the use of a composition comprising cell spheroids prepared by co-culturing adipocytes and cardiomyocytes for the prevention or treatment of heart disease.
[0081] As another aspect for achieving the above object, the present invention provides the use of a composition comprising cell spheroids produced by co-culturing adipocytes and cardiomyocytes for the production of a drug for preventing or treating heart disease.
[0082] The above 'adipocytes', 'cardiomyocytes', 'coculture', 'spheroids', 'heart disease', 'prevention' and 'treatment' are as described above.
[0083]
[0084] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.
[0085] When the cell spheroid manufactured through co-culture of the present invention with adipocytes and cardiomyocytes is administered, the function of cardiomyocytes can be improved, such as inducing regeneration and maturation of cardiomyocytes, strengthening heartbeat, and improving the regularity of the heartbeat cycle, and the cardiac function can be restored or improved, such as improving the ejection fraction, cardiac output, and segmental shortening ratio, and thus can be utilized as a material for medicines, foods, feeds, etc. for the prevention, improvement, or treatment of cardiac diseases.
[0086] Figure 1 shows the changes over time observed daily using a fluorescence microscope in co-cultured adipocytes and cardiomyocytes differentiated from adipose-derived stem cells.
[0087] Figures 2 and 3 show the physiological functions of cardiomyocytes observed using a multi-electrode array system plate when adipocytes and cardiomyocytes differentiated from adipose-derived stem cells were co-cultured and when cardiomyocytes were cultured alone.
[0088] Figure 4 shows the beating cycle of cardiomyocytes co-cultured with adipocytes differentiated from adipose-derived stem cells and the beating cycle of cardiomyocytes cultured alone.
[0089] Figure 5 illustrates the process of making a dish for producing spheroids (Figure 5A) and the process of producing cardiomyocytes into cell spheroids (Figure 5B).
[0090] Figure 6 shows the results of observing cell spheroids manufactured only with cardiomyocytes using an optical microscope at day 0, day 2, week 1, week 3, and week 5, respectively.
[0091] Figure 7 shows the histological morphology of cell spheroids manufactured only with cardiomyocytes observed with an optical microscope through hematoxylin & eosin (H&E) staining (Figure 7A), and stained with a cardiomyocyte-specific marker using fluorescent immunostaining and observed with a confocal fluorescence microscope (Figure 7B).
[0092] Figure 8 shows the results of manufacturing a co-cultured 3D cardiomyocyte spheroid and then staining it using Oil red O staining to confirm whether it differentiated into adipocytes.
[0093] Figure 9 shows the relative expression levels of genes (CD90, CD105, adiponectin, PPARα, PPARγ, UCP1) corresponding to specific indicators of each of adipocytes and adipose stem cells to confirm whether differentiation into adipocytes was successful after differentiation into adipocytes from adipose-derived stem cells.
[0094] Figures 10 to 12 show genes that are increased or decreased in adipocytes after differentiation from adipose-derived stem cells into adipocytes, in order to confirm whether differentiation into adipocytes is successful, by biological process, molecular function, and cellular component.
[0095] Figure 13A illustrates the process of producing spheroids through co-culturing of adipocytes and cardiomyocytes after labeling cells with fluorescent markers.
[0096] Figure 13B shows the process of cardiomyocytes attaching to adipose cell spheroids after inoculating cardiomyocytes into adipose spheroids for co-culture, observed under a fluorescence microscope on days 0 and 1.
[0097] Figure 14 shows the observation of three-dimensional cardiomyocyte spheroids co-cultured after cell labeling with a fluorescent marker at 1 week (Day 7), 3 weeks (Day 21), and 5 weeks (Day 35).
[0098] Figure 15 shows the histological morphology of co-cultured 3D cardiomyocyte spheroids observed with an optical microscope through hematoxylin & eosin (H&E) staining at week 1 (Day 7), week 3 (Day 21), and week 5 (Day 35) (Figure 15A), and stained with fluorescent immunostaining using a cardiomyocyte-specific marker and observed with a confocal fluorescence microscope (Figure 15B).
[0099] Figure 16 shows the observation of cell organelles of cardiomyocytes cultured alone (Figure 16A) and co-cultured spheroids (Figure 16B) after manufacturing three-dimensional cardiomyocyte spheroids.
[0100] Figure 17 shows the process of cell invasion when producing cell spheroids by co-culturing adipocytes and cardiomyocytes.
[0101] Figure 18 shows whether cell invasion occurs and cells grow by extending in the case of cell spheroids produced by co-culturing adipocytes (Adipocytes, Adipo) and cardiomyocytes (CM).
[0102] Figure 19 shows whether cell invasion occurs and cells grow by extending in the case of cell spheroids produced by co-culturing adipose-derived stem cells (ADSCs) and cardiomyocytes (CM).
[0103] Figure 20 illustrates the process of administering spheroids by direct injection into the myocardium to evaluate the effectiveness of spheroids manufactured by co-culturing adipocytes and cardiomyocytes.
[0104] Figure 21 shows the ejection fraction (EF), fraction of fraction shortening (FS), left ventricular end-diastolic diameter (LVIDd), and end-systolic diameter (LVIDs) measured over time when single cardiomyocyte spheroids (CM), adipose differentiated spheroids (AD), and spheroids prepared by co-culturing adipocytes and cardiomyocytes (CMAD) were administered to an animal model of ischemic heart disease.
[0105] Figure 22 shows the calculated change rates in the ejection fraction (EF) and fraction of fraction shortening (FS) when single cardiomyocyte spheroids (CM), adipose-differentiated spheroids (AD), and spheroids prepared by co-culturing adipocytes and cardiomyocytes (CM+AD) were administered to an animal model of ischemic heart disease.
[0106] Figure 23 shows the results of calculating the left ventricular pressure-volume loop, cardiac output, stroke volume, maximum volume (Vmax), maximum pressure change rate (dP / dt max), and minimum pressure change rate (dP / dt min) when single cardiomyocyte spheroids (CM), adipose differentiated spheroids (AD), and spheroids prepared by co-culturing adipocytes and cardiomyocytes (CMAD) were administered to an animal model of ischemic heart disease.
[0107] Figure 24 shows the results of measuring left ventricular pressure-volume, end-systolic pressure-volume relationship (EDPVR), and end-diastolic pressure-volume relationship (EDPVR) when single cardiomyocyte spheroids (CM), adipose differentiated spheroids (AD), and spheroids prepared by co-culturing adipocytes and cardiomyocytes (CMAD) were administered to an animal model of ischemic heart disease.
[0108] Figure 25 shows the analysis of the degree of cardiac fibrosis progression (percent fibrosis) and viable myocardium area when single cardiomyocyte spheroids (CM), adipose differentiated spheroids (AD), and spheroids prepared by co-culturing adipocytes and cardiomyocytes (CMAD) were administered after myocardial infarction.
[0109] Figure 26 shows the number of microvessels (# of capillaries) and the number of cardiomyocytes (# of cardiomyocytes) measured in the infarct zone and the border zone to determine whether the survival myocardial area and angiogenesis were promoted when single cardiomyocyte spheroids (CM), adipose differentiated spheroids (AD), and spheroids prepared by co-culturing adipocytes and cardiomyocytes (CMAD) were administered after myocardial infarction.
[0110] Figure 27 shows the number of administered cardiomyocytes that were labeled and traced to determine whether the administration of spheroids (CMAD) manufactured by co-culturing adipose cells and cardiomyocytes played a direct role in the repair of the damaged infarct area after myocardial infarction.
[0111] Figure 28 shows the expression ratio of CX43 measured by performing immunofluorescence staining using CX43 antibody to confirm whether the engrafted transplanted cells are synchronized with the host cardiomyocytes and show a mature morphology.
[0112] Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.
[0113]
[0114] Example 1. Co-culture of adipocytes and cardiomyocytes differentiated from adipose-derived stem cells.
[0115] 1.1. Preparation of fat cells
[0116] Adipose-derived stem cells (ADSCs, SCRC-4000, ATCC, USA) were cultured in a basal medium (PCS-500-030, ATCC, USA) mixed with a growth medium kit (PCS-500-040, ATCC, USA) for 5–6 days until 90% of the cells covered the bottom of the cell culture vessel. The medium was changed every 2–3 days, and when the cells almost filled the bottom of the culture vessel, the existing basal medium was completely removed and replaced with adipogenic differentiation medium (A1007001, Gibco, USA). The cells were cultured in differentiation medium for 2 weeks, and the medium was replaced with fresh medium every 2–3 days.
[0117]
[0118] 1.2. Coculture of adipocytes and cardiomyocytes
[0119] Cardiomyocytes were counted immediately after thawing and co-cultured by attaching them as single cells to cell culture dishes in which differentiation into adipocytes was well achieved in Example 1.1. A fluorescent staining reagent (V22889, Invitrogen, USA) was used to visually distinguish the two types of cells. Adipocytes (DiO, green fluorescence) and cardiomyocytes (DiI, red fluorescence) were each exposed to the staining reagent for 20 minutes and were cultured in culture dishes after two DPBS washes. Changes over time were observed using a fluorescence microscope and an optical microscope at 1, 2, and 3 weeks of culture.
[0120] As a result, as shown in Fig. 1, when adipose cells and cardiomyocytes were co-cultured, it was confirmed that cardiomyocytes were cultured stably for a long period of time, whereas when only cardiomyocytes were cultured, many cells died during long-term culture and separated from the bottom of the dish or clumped together.
[0121]
[0122] 1.3. Confirmation of the effect of improving the physiological function of cardiomyocytes in a co-culture system of cardiomyocytes and adipocytes.
[0123] Field potentials were recorded using a multi-electrode array (MEA) system plate (Axion Biosystems, Atlanta, GA, USA) at weekly intervals starting 7 days after the cells were cultured. The MEA plates were placed in a controlled chamber set at 37°C and continuously perfused with 5% CO2, 20% O2, and 75% N2. Field potentials of spontaneously beating cardiomyocytes on the MEA plates were recorded using Integrated Studio (AxIS) software version 2.4 (Axion Biosystems) and analyzed using the Axion Cardiac Data Plotting Tool (Axion Biosystems). Field potential waveforms were recorded 30 minutes after the equilibration period. Data obtained from the electrodes were used to analyze parameters such as field potential duration and field potential amplitude.
[0124] As a result, as shown in Fig. 2, when cardiomyocytes and adipocytes were co-cultured from 1 to 4 weeks after differentiation, a higher potential amplitude was observed than in the case of single cardiomyocytes. Furthermore, as shown in Fig. 3, the second potential peak in the co-cultured case was also confirmed to be higher than in the case of single cardiomyocytes. In addition, as shown in Fig. 4, the beating cycle was also maintained more stably in the co-cultured case than in the case of single cardiomyocytes, and in particular, in the case of co-culture, the size and stability of the action potential increased as the culture period increased.
[0125] The above results indicate that the physiological function of cardiomyocytes can be further improved when co-cultured with adipocytes differentiated from cardiomyocytes and adipose-derived stem cells.
[0126]
[0127] Example 2. Preparation and characterization of cardiomyocyte spheroids.
[0128] 2.1. Method for manufacturing cardiomyocyte spheroids
[0129] A schematic diagram of the method for manufacturing cardiomyocyte spheroids is shown in Fig. 5.
[0130] Specifically, a dish was manufactured that was specially treated to prevent cell attachment to the bottom surface of the dish pattern area, enabling spheroids to be obtained without special enzymatic treatment. 1 ml of 70% ethanol was added to the grooved center of the prepared spheroid forming dish. Subsequently, the dish was washed three times with 1 ml of PBS to remove the 70% ethanol, and the PBS present in the dish was removed immediately before cell seeding.
[0131] Afterwards, cardiomyocytes were 1Х10 6 The cells were counted to be 1.5 ml / cell. 500 μl of medium containing cells was dispensed into the center of the prepared spheroid formation dish. The final medium volume was 2 ml. Afterwards, the cells were cultured in a 37°C, 5% CO2 cell incubator for 2 days, and spheroid formation was observed under an optical microscope.
[0132] After 2 days, 2 ml of new medium was slowly added to the dish wall, and spheroids were obtained using a 1 ml pipette. Most spheroids could be easily recovered after rinsing twice with culture medium. Spheroid culture was maintained for up to 5 weeks, and the spheroid morphology was observed under an optical microscope on days 0, 2, 7, 21, and 35. Cell spheroids prepared only with cardiomyocytes observed under an optical microscope are shown in Figure 6.
[0133]
[0134] 2.2. Observation of cardiomyocyte spheroids: Optical microscopic observation
[0135] Spheroids were prepared according to Example 2.1, and their histological morphology was observed under an optical microscope via hematoxylin-eosin staining on Day 7, Day 21, and Day 35. As shown in Fig. 7A, the spheroid morphology was well maintained until Day 35, but histological observation confirmed that necrosis was induced inside the spheroids.
[0136]
[0137] 2.3. Observation of cardiomyocyte spheroids: Confocal microscopy
[0138] After transferring the spheroid tissue sections onto slides using paraffin blocks, α-actinin (α-Actinin; abcam, ab9465, USA) and Connexin-43 (connexin-43; abcam, ab62689, USA) were stained using fluorescent immunohistochemistry, and protein expression was confirmed as a fluorescence image using a confocal fluorescence microscope. The expression of gap junction proteins such as Connexin-43 or a cardiomyocyte-specific marker such as α-actinin, which can determine the maturity of cardiomyocytes, was confirmed. α-Actinin was confirmed by mint blue fluorescence, Connexin-43 by green fluorescence, and nuclei were confirmed by blue fluorescence using DAPI staining. As a result, as shown in Figure 7B, it was confirmed that the expression of α-actinin and connexin-43 decreased rapidly on the 35th day.
[0139]
[0140] Example 3. Production and characterization of spheroids through co-culture of adipocytes and cardiomyocytes differentiated from adipose-derived stem cells.
[0141] 3.1. Differentiation of adipose-derived stem cells into adipocytes
[0142] 3.1.1. Method
[0143] For co-culture of adipocytes and cardiomyocytes, adipose-derived stem cells were labeled with a green fluorescent marker (DiO, green fluorescence) and then cultured at 1X10 6 Single cells from the dog were plated onto patterned dishes, and spheroid formation was confirmed after 2 days. After spheroid formation, the adipogenic medium was replaced every 2 days for 2 weeks.
[0144]
[0145] 3.1.2. Confirmation of differentiation of adipose-derived stem cells into adipocytes - Oil Red O staining
[0146] After spheroid production, fat differentiation was confirmed using Oil red O staining.
[0147] First, 0.7 g of oil red O (O0625, Sigma, USA) powder was dissolved in 200 ml of isopropanol with stirring, and the insoluble precipitate was filtered through a 0.4 μm filter and stored in the refrigerator. The reaction solution was made by mixing the oil red O solution and filtered triple-distilled water in a 6:4 ratio for 20 minutes, and filtered through a 0.4 μm filter to remove the precipitate. The cells to be stained with oil red O were left in a 4% paraformaldehyde fixative solution at room temperature for 5 minutes, and after 5 minutes, the existing 4% paraformaldehyde solution was completely removed, replaced with a new fixative solution, and fixed at 4℃ for more than 1 hour.
[0148] After fixation, the fixative solution was removed and washed with 60% isopropyl alcohol. After removing the isopropyl alcohol, the cells were reacted for 10 minutes in a reaction solution (Oil red O reaction solution mixed with water in a 6:4 ratio, 1 ml for a 6-well plate). After removing all the reaction solution, the cells were washed four times with distilled water and observed under an optical microscope.
[0149] As a result, differentiation into adipocytes was confirmed by confirming that the lipids within the cells were stained red (Fig. 8).
[0150]
[0151] 3.1.3. Determining whether adipose-derived stem cells differentiate into adipocytes - Measuring gene expression levels
[0152] To determine whether adipose-derived stem cells differentiated into adipocytes, the relative expression levels of stem cell- and adipocyte-specific genes were measured.
[0153] Specifically, RNA was isolated from differentiated cells and undifferentiated cells using Trizol (ambion, cat no. 15596-026) and then synthesized into cDNA. The genes CD90 and CD105, which are specifically expressed in stem cells, and the genes adiponectin, peroxisome proliferator-activated receptor α (PPARα), peroxisome proliferator-activated receptor γ (PPARγ), and uncoupling protein 1 (UCP1), which are specifically expressed in adipocytes, were confirmed through real-time RT PCR. The sequences of the primers used here are shown in Table 1 below.
[0154] Gene Forward (5'→3') Reverse (5'→3') CD90TCGCTCTCCTGCTAACAGTCTTG (SEQ ID NO: 1)CACACGTGTAGGTGCCCTCG (SEQ ID NO: 2)CD105ACTCGCACACGCGTTCCC (SEQ ID NO: 3)GTGCTCCCGATGCTGTGGTT (SEQ ID NO: 4)AdiponectinCCCCAACATGCCCATTCGCT (SEQ ID NO: 5)TTGGTCGCCCACCTCCAGAT (SEQ ID NO: 6)PPARαTTATCCTGTGGTCCCCGGCA (SEQ ID NO: 7)CGCGTTGTGTGACATCCCGA (SEQ ID NO: 8)PPARγCCGGGCCCTGGCAAAACATT (SEQ ID NO: 9)ATGGCCACCTCTTTGCTCTGC (SEQ ID NO: 10)UCP1GGTGTCGGCTCTTATCGCTGG (SEQ ID NO: 11) CAGGATCCAAGTCGCAAGAAGGA (SEQ ID NO: 12)
[0155] As a result, as shown in Fig. 9, in differentiated adipocytes, it was confirmed that the gene expression of stem cell markers CD90 and CD105 decreased, and in the case of adipocyte markers adiponectin, PPARα, PPARγ, and UCP1, the gene expression amount increased, thereby confirming that differentiation into adipocytes occurred from adipose-derived stem cells (Fig. 9).
[0156]
[0157] In addition, RNA was isolated from each of the adipogenic and undifferentiated cells using Trizol (Invitogen), and then genes that were increased or decreased in the adipogenic differentiated cells compared to the undifferentiated cells were identified by biological process, molecular function, and cellular component using NGS analysis.
[0158] The pattern of increase or decrease in gene expression between adipose undifferentiated cells and adipose differentiated cells is as shown in Fig. 10, and the result of performing GO (Gene Ontology) analysis on genes with increased expression in adipocytes was as shown in Fig. 11. It was confirmed that the expression of genes related to biological processes such as cell growth, inflammatory response, and metabolic process, such as TNF receptor superfamily member 9 (TNFRSF9), CXC motif chemokine ligand 10 (CXCL10), bone morphogenic protein-7 (BMP7), and tumor necrosis factor (TNF), was increased. These genes are related to molecular functions such as signal transduction, protein binding, and enzyme activity, and are associated with cellular components such as cell membrane, cytoplasm, and chromatin.
[0159] In addition, as a result of performing GO analysis on genes with reduced expression in adipocytes, as shown in Fig. 12, a decrease in the expression of genes involved in biological processes such as cell migration, extracellular matrix reorganization, and cell signaling, such as matrix metalloproteinase-8 (MMP8), transforming growth factor-β2 (TGFBR2), matrix metalloproteinase-3 (MMP3), S100 calcium binding protein A1 (S100A1), and platelet-derived growth factor receptor A (PDGFRA), was confirmed. These genes are associated with molecular functions related to protein degradation, cell signaling regulation, and components such as the extracellular matrix, cytoskeleton, and cell membrane.
[0160]
[0161] 3.2. Coculture of adipocytes and cardiomyocytes
[0162] Thawed single cardiomyocytes on patterned dishes containing adipose-differentiated spheroids were labeled with a red fluorescent marker (DiI, red fluorescent) and cultured at 1X10 6 The co-culture process of adipocytes and cardiomyocytes labeled with fluorescent markers is shown in Figure 13A. After cardiomyocytes were inoculated into adipocyte spheroids, the formation of a three-dimensional structure between the cardiomyocytes and adipocytes was observed using an optical microscope for one day, and the results are shown in Figure 13B.
[0163] The morphological changes of co-cultured 3D cardiomyocyte spheroids were observed under a fluorescence microscope at 1 week (Day 7), 3 weeks (Day 21), and 5 weeks (Day 35). As shown in Figure 14, spheroids were formed in which cardiomyocytes were positioned between adipocytes in the co-culture of adipocytes and cardiomyocytes, and this morphology was well maintained for 5 weeks.
[0164] In addition, the morphological analysis of the co-cultured 3D spheroids using hematoxylin-eosin staining was observed under an optical microscope. As shown in Figure 15A, unlike the spheroid culture composed only of cardiomyocytes, no cell necrosis was observed inside the spheroids co-cultured with adipocytes even after 35 days of culture. Actinin and connexin-43 were well expressed even inside the spheroids, confirming that the spheroids maintained a healthy shape.
[0165] Meanwhile, after transferring the spheroid tissue sections onto slides, the expression of specific proteins Connexin 43 and Actinin was confirmed using a confocal fluorescence microscope through fluorescent immunostaining, and observation was conducted over 1, 3, and 5 weeks. As a result, as shown in Figure 15B, it was confirmed that the expression of Actinin and Connexin-43 was well maintained even on the 35th day.
[0166]
[0167] 3.3. Observation of organelles in cardiomyocyte spheroids
[0168] The samples were pretreated for TEM imaging. The tissues were fixed in 2.5% glutaraldehyde and washed three times for 10 minutes each with phosphate buffer. The supernatant was removed, and 1% OsO4 was added and left for 2 hours. The materials were washed three times for 10 minutes each with 1× PBS buffer and dehydrated by sequential exposure to 50% to 100% ethanol for 20 minutes each. Afterwards, they were left for 30 minutes twice in 100% propylene oxide and embedded using a mixture of polypropylene oxide and Epon812. 100% Epon812 media was added and left for 3 hours, and the materials were solidified in a 70℃ oven.
[0169] Afterwards, the tissue was cut into 1 μm pieces using an ultra microtome, transferred to a slide glass, and attached and fixed while stretching on a hot plate (at 80°C), and cell organelles such as mitochondria and myofibrils were observed.
[0170] As a result, as shown in Fig. 16, mitochondria and gap junctions were well formed in both the cardiomyocyte-only culture group (Fig. 16A, CM only) and the co-culture group with adipocytes (Fig. 16B, CM+AD). On the other hand, in the co-culture group with adipocytes, sarcomeres were well organized and regularly arranged compared to the cardiomyocyte-only culture group, which means that the co-cultured cardiomyocytes were more mature than the single-cultured cardiomyocytes.
[0171]
[0172] 3.4. Confirmation of cell spheroid invasion
[0173] As shown in Figure 17, cell spheroids co-cultured with adipocytes and cardiomyocytes exhibited a reversal of position. Based on this, cell spheroids co-cultured with adipocytes and cardiomyocytes were placed in an invasion matrix at Week 1 and Week 3 to determine whether the cells grew by extending.
[0174] The invasion matrix was thawed on ice for 4 hours or overnight at 4°C. The 3D Culture Qualified 96 Well Spheroid Formation Plate was placed on ice in a refrigerator for 15 minutes to chill the wells, and 50 μl of invasion matrix was added per well of the 3D Culture Qualified 96 Well Spheroid Formation Plate while working on ice. The plate was centrifuged at 300 xg at 4°C for 5 minutes to remove any air bubbles present in the plate and to place the spheroids within the invasion matrix in the center of the wells.
[0175] The plate was placed in a 37°C cell incubator for 1 hour to promote gel formation, and after 1 hour, 100 μl of a medium containing invasion matrix and culture medium in a 1:1 ratio was added. The plate was cultured in a tissue culture incubator at 37°C for 3–6 days, and spheroids in each well were photographed every 24 hours using a confocal fluorescence microscope.
[0176] As a result, as shown in Figure 18, when cardiomyocytes and adipocytes were co-cultured in three-dimensional spheroids and a three-dimensional invasion analysis was performed in vitro, the spheroids composed solely of cardiomyocytes (CMs-only) maintained their initial shape without any invaded cells even on the fifth day, whereas the spheroids composed solely of adipocytes (Adipocyte only) began invading from the first day of culture, and by the fifth day, many cells could be observed invading from the spheroids into the matrix.
[0177] In co-cultured spheroids composed of cardiomyocytes and adipocytes (CMs with Adipo), cardiomyocyte invasion was observed along the adipocyte invasion pathway. However, as shown in Figure 19, cardiomyocyte invasion was not observed in co-cultures of stem cells and cardiomyocytes (ADSCs+CMs) prior to adipocyte differentiation. This suggests that adipocytes play a key role in inducing cardiomyocyte invasion.
[0178]
[0179] Example 4. Evaluation of the effectiveness of cell spheroids through cardiac function analysis.
[0180] To determine whether the combination of co-cultured spheroids of adipocytes and cardiomyocytes (hereinafter, 'CM+AD spheroids') constructed based on the results of in vitro experiments can improve the therapeutic effect and tissue regeneration ability based on cardiomyocyte transplantation in an animal model of severe ischemic heart disease, 8-week-old Fisher 344 rats were injected with 1×10 single cardiomyocyte spheroids (CM), adipocyte-differentiated spheroids (AD), and cardiomyocyte-adipocyte-differentiated spheroids (CM+AD) after inducing myocardial infarction through permanent ligation of the coronary artery. 6Each dose was administered by direct intramyocardial injection. To minimize bleeding and cell release during the intramyocardial injection process, a syringe that did not leak blood was used, as shown in Figure 20, even when injected into the heart muscle.
[0181] Afterwards, cardiac function such as ejection fraction (EF %), fraction of fraction of segment shortening (FS %), and left ventricular end-diastolic / end-systolic diameters (LVIDd / LVIDs) were measured using echocardiographic techniques from 1 week (1W) to 12 weeks (12W) after transplantation. For this purpose, animals were anesthetized with isoflurane and maintained at 37°C using a heating pad. A transthoracic echocardiography system equipped with a 15 MHz L15-7io linear transducer (Affniti 50G, Philips) was used, and all parameters were measured in M-mode reaching the mid-papillary muscle level, and the group classification was blinded during the examination.
[0182] Ejection fraction (EF) and segmental shortening (FS), which are indicators of left ventricular systolic function, were calculated using the following equations: (LVEDV = Left ventricular end-diastolic volume; LVESV = Left ventricular end-systolic volume; LVEDD = Left ventricular end-diastolic dimension; LVESD = Left ventricular end-systolic dimension)
[0183] EF (%) = [(LVEDV-LVESV) / LVEDV] × 100
[0184] FS (%) = [(LVEDD-LVESD) / LVEDD] × 100
[0185]
[0186] As shown in Figs. 21 and 22, the analysis results confirmed that the ejection fraction (LVEF %) and fraction of segmental shortening (LVFS %) continuously decreased during the observation period in both the myocardial infarction control group and the AD alone and CM alone cell therapy groups. The control group showed a decrease of -14.9% and -7.1% at 12 weeks (12W) compared to the time of transplantation (1 week, 1W), while the AD alone group showed a decrease of -11% and -5.1%, respectively. In addition, the CM alone group showed a significant improvement compared to the control group with a decrease of -8.9% and -4.2%, respectively, but did not prevent the decline in cardiac function.
[0187] In contrast, the CM+AD group showed significant improvements in cardiac function compared to all experimental groups, with improvements of +1.9% and +2.1%, respectively. This confirms that combining differentiated adipocytes with cardiomyocytes is an effective strategy that can significantly improve the efficacy of cardiomyocyte-based cell therapy.
[0188]
[0189] Example 5. Evaluation of the effectiveness of cell spheroids through hemodynamic analysis.
[0190] To more precisely assess cardiac function, left ventricular hemodynamic measurements were performed using an invasive pressure-volume (PV) catheter that can measure left ventricular hemodynamic pressure and volume. After minimal bleeding thoracotomy, the left ventricular apex of the heart was punctured with a 26-gauge needle, and a 2F conductance catheter (SPR-838, Millar) was inserted into the left ventricle. Pressure-volume (PV) parameters were recorded in real time using a PV conductance system (MPVS Ultra, emka TECHNOLOGIES, Paris, France) coupled to a digital converter (PowerLab 16 / 35, ADInstruments, Colorado Springs, CO).
[0191] Independent measurements of cardiac functional load, including the slope of the end-systolic pressure-volume relationship (ESPVR) and the end-diastolic pressure-volume relationship (EDPVR), were achieved at different preloads induced by temporary inferior vena cava (IVC) occlusion using a needle holder. After hemodynamic measurements, 50 μl of hypertonic saline (20% NaCl) was injected into the left jugular vein to calculate parallel conductance. Blood was collected from the left ventricle using a heparinized syringe and placed in a cuvette, where the conductance signal was converted to volume using a catheter.
[0192] Meanwhile, cardiac remodeling occurs, in which cardiac structure changes such as ventricular dysfunction and left ventricular dilation occur after acute and chronic infarction. Regarding this, as shown in Figure 23, the PV loop analysis results measured 12 weeks after myocardial infarction in the above experiment showed that, specifically, in the spheroid (CMAD) group co-cultured with adipocytes and cardiomyocytes, two parameters of general cardiac function, such as stroke volume (SV) and cardiac output (CO), were significantly higher than in the other groups, and the maximum volume (V max), an index of cardiac remodeling measured at maximum diastole, recorded a significantly lower value than in the other groups. The maximum pressure change rate (dP / dt max) and the minimum pressure change rate (dP / dt min), which indicates the pressure change in the LV, were confirmed to be significantly increased in the CMAD group compared to the other groups. These experimental results suggest that the spheroid group co-cultured with adipocytes and cardiomyocytes can protect against cardiac remodeling by significantly improving cardiac function compared to other experimental groups (control group, single cardiomyocyte spheroids; CM, adipocyte-differentiated spheroids; AD).
[0193]
[0194] Meanwhile, the end-systolic pressure-volume relationship (ESPVR) is an index that measures the changes in cardiac volume and pressure at the end of systole. Because it measures the gradient after temporarily blocking the inferior vena cava, it can measure function without being affected by the preload and afterload of the heart, and the gradient becomes gentler as the contractility of the heart decreases. The end-diastolic pressure-volume relationship (EDPVR) is an index that measures the changes in cardiac volume and pressure at the end of diastole. In the case of heart disease, if the stiffness of the heart increases, the gradient becomes steeper due to the influence of the end of diastole.
[0195] As shown in Figure 24, the CMAD group recorded significantly higher ESPVR values and the lowest EDPVR values compared to all experimental groups. This confirms that combining differentiated adipocytes with cardiomyocytes is an effective strategy for improving the hemodynamic recovery capacity of the heart based on cardiomyocytes.
[0196]
[0197] Example 6. Cardiac fibrosis analysis
[0198] To analyze the progression of cardiac fibrosis after myocardial infarction, Masson's trichrome (MT) staining was performed. Three paraffin-embedded slides were warmed in a 37°C drying oven before deparaffinization and rehydration, and paraffin sections were refixed in Bouin's solution at 56°C for 1 hour. The sections were stained with Weigert's iron hematoxylin solution for 15 minutes at room temperature, followed by Biebrich's scarlet-acid fuchsin solution for 20 minutes at room temperature. Finally, the sections were counterstained with aniline blue for 15 minutes and then warmed in 1% acetic acid for 1 minute at room temperature. Each step was followed by extensive washing. Collagen fibers were observed in blue, and viable cardiac muscle in red. All parameters, including the area of fibrosis, were quantified using the ImageJ program.
[0199] As shown in Fig. 25, in the case of the administration of adipocytes alone (AD), there was no difference in the degree of cardiac fibrosis (% Fibrosis) and viable myocardium area (% Viable myocardium) compared to the control group, whereas in the case of the administration of cardiomyocytes alone (CM), there was a significant improvement in both. In the case of the spheroids co-cultured with adipocytes and cardiomyocytes (CMAD group), cardiac fibrosis was significantly reduced compared to the administration of cardiomyocytes alone (CM), and the highest viable myocardium area was recorded, confirming that the cell therapy method combining differentiated adipocytes based on cardiomyocytes is an effective strategy for preventing myocardial survival and progression to fibrosis.
[0200]
[0201] Example 7. Histological evaluation of efficacy through immunofluorescence staining
[0202] 7.1. Confirmation of surviving cardiomyocytes and vascular changes after myocardial infarction
[0203] To compare the survival myocardial area after myocardial infarction and to confirm whether angiogenesis was promoted, histological analysis was performed on myocardium (cTNT) and blood vessels (CD31) using tissues 12 weeks after myocardial infarction / cell administration. For this purpose, two analysis zones were set: the infarct zone and the border zone, and mm in each. 2 The number of microvessels (# of capillaries) and the number of cardiomyocytes (# of cardiomyocytes) were measured and compared.
[0204] As shown in Fig. 26, the experimental groups administered cells (AD, CM, CMAD) significantly improved the density of microvessels within the injury boundary area compared to the untreated control group. However, the blood vessels in the infarction area were not significantly improved in the CM only group compared to the control group. However, in the experimental groups that included AD administration (AD, CMAD), the number of blood vessels significantly increased, and in particular, the CMAD experimental group recorded a significantly higher number of blood vessels compared to all other experimental groups, confirming the effective effect of vascular preservation / neovascularization.
[0205] Meanwhile, the number of surviving / increased cardiomyocytes was confirmed, and there was no significant improvement in both the infarct / border zones in the AD-administered experimental group compared to the control group. However, in the experimental group including CM administration (CM, CMAD), the number of cardiomyocytes was significantly higher than in the control group in both zones, and it was confirmed that the effect of the CMAD experimental group could be significantly improved compared to the experimental group administered CM alone.
[0206]
[0207] 7.2. Confirmation of repair of damaged infarct area after myocardial infarction
[0208] To evaluate the survival and normal engraftment of the administered cells through tissue tracking of the transplanted cardiomyocytes and to observe whether spheroid administration played a direct role in the repair of the damaged infarct area after myocardial infarction, cardiomyocytes fluorescently labeled with RFP (Red Fluorescent Protein) were used to track the cells. Afterwards, the number of engrafted cardiomyocytes (# of muscle formed by iPSC-CMs) was counted by dividing them into infarct / border area through verification using human specific TNT (troponin T) antibody.
[0209] As shown in Figure 27, in the CM alone administration experimental group, no surviving cells existed within the infarct area, and only a small number of cells remained in the border area. This confirmed that effective myocardial augmentation for infarct repair expected from cell transplantation did not occur. On the other hand, in the CMAD administration experimental group, compared to the CM alone administration experimental group, there were three times more transplanted cardiomyocytes in the border area, and a large number of transplanted cardiomyocytes engrafted in the infarct area. These experimental results suggest that a cell therapy strategy that combines cardiomyocytes and adipocytes differentiated from adipose-derived stem cells has an essential therapeutic effect of promoting cell engraftment in the infarct area where myocardial infarction occurred and inducing remuscularization.
[0210]
[0211] 7.3. Confirmation of the synchronization and electrophysiological stability of transplanted cardiomyocytes with the host.
[0212] Immunofluorescence staining using the CX43 antibody was performed to assess whether the engrafted transplanted cells were synchronized with host cardiomyocytes and exhibited a mature morphology that could improve electrophysiological properties. CX43 is a marker for gap junctions, and well-developed gap junctions suggest efficient electrical connections between cells.
[0213] Based on these points, the analysis results showed that, as shown in Fig. 28, the transplanted cardiomyocytes in the CMAD administration experimental group had a significantly higher CX43 expression ratio (Localization to ID) in the pattern existing within the intercalated disc (ID), which indicates a normal cell junction state, compared to the CM alone administration group. This confirmed that the combined use of stem cells differentiated from adipose-derived stem cells can be an effective strategy that contributes to the effective synchronization of the transplanted cardiomyocytes with the host and increased electrophysiological safety.
[0214]
[0215] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A method for producing a cell spheroid, comprising a step of co-culturing adipocytes and cardiomyocytes.
2. In paragraph 1, Before the step of co-culturing adipocytes and cardiomyocytes, A method for producing a cell spheroid, further comprising a step of differentiating adult stem cells into adipocytes.
3. In paragraph 2, A method for producing a cell spheroid, wherein the adult stem cells are derived from at least one selected from the group consisting of fat, bone marrow, umbilical cord blood, blood, skin, and placenta.
4. A cell spheroid manufactured according to any one of the manufacturing methods of clauses 1 to 3.
5. A pharmaceutical composition for preventing or treating heart disease, comprising a cell spheroid manufactured by co-culturing adipose cells and cardiomyocytes as an active ingredient.
6. In paragraph 5, A pharmaceutical composition wherein the above-mentioned fat cells are differentiated from adult stem cells.
7. In paragraph 6, A pharmaceutical composition wherein the adult stem cells are derived from at least one selected from the group consisting of fat, bone marrow, umbilical cord blood, blood, skin, and placenta.
8. In paragraph 5, A pharmaceutical composition, wherein the heart disease is at least one selected from the group consisting of coronary artery disease, chronic heart failure, dilated cardiomyopathy, hypertrophic cardiomyopathy, pericarditis, endocarditis, diastolic dysfunction, cardiomegaly, and cardiac fibrosis.
9. In paragraph 8, A pharmaceutical composition, wherein the diastolic cardiac dysfunction is selected from at least one selected from the group consisting of left ventricular hypertrophy, heart failure, diastolic heart failure, mitral regurgitation, aortic regurgitation, hypertension, dilated cardiomyopathy, ischemic heart disease, ventricular septal defect, tricuspid regurgitation, pulmonary regurgitation, pulmonary hypertension, myocardial infarction, cardiomyopathy affecting the right ventricle, atrial septal defect, atrial fibrillation, hypertrophic cardiomyopathy, and infiltrative cardiomyopathy.
10. In paragraph 5, A pharmaceutical composition wherein the above spheroid improves cardiac function.
11. In paragraph 5, A pharmaceutical composition wherein the spheroid improves ejection fraction, fractional shortening, cardiac output, stroke volume, or end-systolic pressure-volume relation.
12. In paragraph 5, A pharmaceutical composition wherein the above spheroid reduces cardiac fibrosis.
13. In paragraph 5, A pharmaceutical composition wherein the above spheroid has vascular preservation or neovascularization activity.
14. In paragraph 5, A pharmaceutical composition wherein the above spheroid has regenerative activity of cardiomyocytes.
15. A pharmaceutical composition for preventing or improving heart disease, comprising, as an active ingredient, a cell spheroid manufactured by co-culturing adipose cells and cardiomyocytes.
16. In paragraph 15, A pharmaceutical composition wherein the above-mentioned fat cells are differentiated from adult stem cells.
17. In paragraph 15, A pharmaceutical composition, wherein the heart disease is at least one selected from the group consisting of coronary artery disease, chronic heart failure, dilated cardiomyopathy, hypertrophic cardiomyopathy, pericarditis, endocarditis, diastolic cardiac dysfunction, cardiomegaly, and cardiac fibrosis.
18. A food composition for preventing or improving heart disease, comprising, as an active ingredient, a cell spheroid manufactured by co-culturing adipose cells and cardiomyocytes.
19. A composition for transplantation comprising, as an active ingredient, a cell spheroid manufactured by co-culturing adipose cells and cardiomyocytes.
20. A composition for regeneration or maturation of cardiomyocytes, comprising, as an active ingredient, a cell spheroid manufactured by co-culturing adipose cells and cardiomyocytes.
21. A method for preventing or treating heart disease, comprising administering to a subject a composition comprising the cell spheroid of paragraph 4.
22. Use of a composition comprising the cell spheroid of claim 4 for the prevention or treatment of heart disease.
23. Use of a composition comprising the cell spheroid of claim 4 for the manufacture of a medicament for preventing or treating heart disease.
Citation Information
Patent Citations
Compositions and methods for organoid generation and disease modeling
JP2022153580A
Composition of spray powder materials for solidification treatment of pet excrement
KR1020250155900A
Hearing aid device to insert receiver by rotary actuation
KR102314978B1
Cardiac or vascular tissue spheroid
US20160022870A1
Heart extracellular matrix-derived scaffold for culture and transplantation of cardiac organoid and method of preparing the same
US20230108699A1