Light chain amyloid fibril antibodies, amyloid fibril and phagocyte targeting bi-specific phagocyte engagers, car-phagocytes, and uses thereof

Abstract

Amyloid-binding constructs, including antibodies, bispecific molecules, and chimeric antigen receptors, are provided for diagnosing or treating AL amyloidosis. Also provided are methods of detecting or reducing light chain amyloid fibril deposits in an organ of a subject.

Description

Dkt.93597 / 7312 91947-A-PCT LIGHT CHAIN AMYLOID FIBRIL ANTIBODIES, AMYLOID FIBRIL AND PHAGOCYTE TARGETING BI-SPECIFIC PHAGOCYTE ENGAGERS, CAR-PHAGOCYTES, AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application Nos. 63 / 663,801, filedJune 25, 2024, and 63 / 663,835, filed June 25, 2024, the contents of each of which are hereby incorporated by reference. STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under grant numberW81XWH2110607 awarded by the Department of Defense. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING

[0003] This application incorporates-by-reference nucleotide and / or amino acid sequenceswhich are present in the file named “250625_93597-7312_91947-A- PCT_Sequence_Listing_AWG.xml”, which is 62.6 kilobytes in size, and which was created on June 25, 2025, in the IBM-PC machine format, having an operating system compatibility with MS-Windows, which is contained in the xml file filed June 25, 2025 as part of this application. BACKGROUND

[0004] The disclosures of all publications, patents, patent application publications and booksreferred to in this application are hereby incorporated by reference in their entirety into the subject application to more fully describe the art to which the subject invention pertains.

[0005] Amyloid light chain amyloidosis (AL amyloidosis) is a monoclonal plasma celldisorder characterized by the pathologic deposition of light chain fibrils in vital organs that leads to their eventually failure and, ultimately, results in death. Heretofore, the therapeutic options for patients have been directed towards suppression of synthesis of amyloidogenic light chains by anti-plasma cell chemotherapy or autologous stem cell transplantation. Unfortunately, despite response rates of ~60%, only 13-33% of patients experience a complete remission, and in most patients, continued production of abnormal light chains leads to further amyloid deposition andeventual death. Considering that the anti-plasma cell chemotherapy only minimally impacts already-formed fibrillar deposits, new strategies are needed in the treatment of this ultimately fatal disorder.

[0006] The present invention addresses these needs and provides methods of treating anddiagnosing AL amyloidosis, including treatment of already-formed fibrillar deposits.SUMMARY OF THE INVENTION

[0007] The present disclosure provides an antibody which binds a light chain amyloid fibril,a light chain amyloid fibril-binding fragment of such antibody, or a fusion protein, comprising: a heavy chain variable region comprising: CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), and a light chain variable region comprising: CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48).

[0008] Also provided is a bispecific antibody which binds a light chain amyloid fibril andbinds a phagocyte wherein a portion thereof which binds a light chain amyloid fibril comprises (i) a heavy chain variable region comprising CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), and a light chain variable region comprising CDR1: RASQSISDYLH (SEQ ID NO:46),YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48); or (ii) a) a heavy chain variable region comprising: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2: IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and a light chain variable region comprising CDR1: QSLVHRNGNTY (SEQ ID NO:4), CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6); or b) a heavy chain variable region comprising: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8), CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and a light chain variable region comprising: CDR1: SQHSTYT (SEQ ID NO:10), CDR2:LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) a heavy chain variable region comprising: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and a light chain variable region comprising CDR1: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) a heavy chain variable region comprising: CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and a light chain variable region comprising: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41),CDR3: SQSTHVPFT (SEQ ID NO: 42).

[0009] Also provided is a bispecific antibody which binds a light chain amyloid fibril andbinds a phagocyte, wherein a portion thereof which binds a phagocyte comprises a heavy chain variable region comprising: CDR1: GFIFSDNY (SEQ ID NO:25), CDR2: ISDGGSYT (SEQ ID NO:26), CDR3: ARGYYRYEGAMDY (SEQ ID NO:27), and a light chain variable region comprising: CDR1: QSVLYSSNQKNY (SEQ ID NO:28), CDR2: WAS (SEQ ID NO:29), CDR3: HQYLSSWT (SEQ ID NO:30); or a heavy chain variable region comprising: CDR1: GFTFSSYV (SEQ ID NO:31), CDR2: ISDDGRNK (SEQ ID NO:32), CDR3: VREGYSGSWFDY (SEQ ID NO:33), and a light chain variable region comprising: CDR1: QGISSA (SEQ ID NO:34), CDR2: GAS (SEQ ID NO:35),CDR3: QQFNSYPFT (SEQ ID NO:36).

[0010] Also provided is a bispecific antibody which binds a light chain amyloid fibril andbinds a phagocyte comprising, wherein the bispecific antibody comprises VH complementary- determining regions CDR1 through CDR3, VL complementary-determining regions CDR1 through CDR3, and wherein one or more of CDR1 through CDR3 or either of, or both of, the VH and the VL has 85% or greater identity with, but not 100% identity with, the VH CDR1 through CDR3 sequences, or VL CDR1 through CDR3 sequences, respectively, set forth as follows: (i) VH CDR1 through CDR3: CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), VL CDR1 through CDR3: CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48); or (ii) a) VH CDR1 through CDR3: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2:IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and VL CDR1 through CDR3: CDR1: QSLVHRNGNTY (SEQ ID NO:4), CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6); or b) VH CDR1 through CDR3: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8), CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and VL CDR1 through CDR3: CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) VH CDR1 through CDR3: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2:IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and VL CDR1 through CDR3: CDR1: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) VH CDR1 through CDR3: CDR1: GFTFNTYAMY (SEQ ID NO:37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO:38), CDR3: PYSDSFAY (SEQ ID NO:39), and VL CDR1 through CDR3: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO:40), CDR2: KVSNRFS (SEQ ID NO:41), CDR3: SQSTHVPFT (SEQ ID NO:42).

[0011] A pharmaceutical composition comprising(i) the bispecific antibody which binds a light chain amyloid fibril and binds a phagocyte as described herein, and a carrier; or (ii) two or more different bispecific antibodies which bind a light chain amyloid fibril and bind a phagocyte as described herein, and a carrier is also provided.

[0012] A method for treating light chain amyloidosis in a subject, comprising administeringto the subject a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody as described herein is provided.

[0013] A method for reducing an amyloid fibril deposit in a subject having light chainamyloidosis, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody as described herein is provided.

[0014] Also provided is a method of reducing development of an amyloid fibril deposit in asubject, comprising administering to a subject identified as having AL amyloidosis a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody as described herein, effective to reduce development of an amyloid fibril deposit.

[0015] Also provided bispecific antigen binding construct comprising a first antigen-bindingpolypeptide construct which specifically binds a human light chain amyloid fibril antigen; a second antigen-binding polypeptide construct which specifically binds a cell surface marker on a phagocyte, and wherein the first antigen-binding polypeptide construct is joined via a linker to the second antigen-binding polypeptide construct.

[0016] A nucleic acid encoding a bispecific antibody as described herein is provided.

[0017] Additionally, a nucleic acid encoding a bispecific antigen binding construct asdescribed herein is provided.

[0018] Also provided is a cell comprising a nucleic acid as described herein, wherein thenucleic acid is heterologous to the cell genome.

[0019] A modified human phagocyte comprising a chimeric antigen receptor (CAR),wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain is also provided.

[0020] A pharmaceutical composition is provided comprising a modified human phagocytecomprising a chimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain and a pharmaceutically acceptable carrier.

[0021] A method is provided for treating light chain amyloidosis in a subject, comprisingadministering to the subject a therapeutically effective amount of a pharmaceutical compositioncomprising an amount of modified human phagocytes comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0022] A method for reducing an amyloid fibril in a subject having light chain amyloidosis isprovided, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising an amount of modified human phagocytes comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0023] A method of generating a modified human hematopoietic stem cells comprising achimeric antigen receptor (CAR) is provided, wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular domain of a stimulatory and / or co-stimulatory molecule, the method comprising obtaining CD34+ and / or hematopoietic stem cells from a sample obtained from a human, and transducing the CD34+ and / or hematopoietic stem cells with a nucleic acid encoding the CAR.

[0024] A CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cellgenerated by a method described herein is also provided.

[0025] Also provided is a fusion protein which is a chimeric antigen receptor (CAR),wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0026] A method of eliciting an immune response against amyloid light chain fibrils in asubject is provided comprising administering to the subject a CAR-antigen presenting cell wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular domain of a stimulatory and / or co-stimulatory molecule, effective to elicit an immune response.

[0027] Also provided is a polynucleotide encoding a chimeric antigen receptor (CAR), theCAR comprising a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.BRIEF DESCRIPTION OF THE DRAWINGS

[0028] For the purpose of illustrating the invention, there are depicted in drawings certainsome embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawing, unless otherwise indicated.

[0029] Figs. 1A-1E. Development of novel anti-λ AL amyloid antibodies. 1A) Schematicshowing example of antibody production and validation steps. Figs.1B-1E display sequences of a novel anti-amyloid antibody 1F10. 1B) Heavy chain: DNA sequence (1431 bp) of novel anti- amyloid antibody – SEQ ID NO: 49. 1C) Light chain: DNA sequence (705 bp) of novel anti- amyloid antibody – SEQ ID NO: 50. 1D) Heavy chain: Amino acid sequence (476 aa) of novel anti-amyloid antibody – SEQ ID NO: 51. 1E) Light chain: Amino acid sequence (234 aa) of novel anti-amyloid antibody – SEQ ID NO: 52.

[0030] Figs. 2A-2E. Characteristics of novel anti-amyloid antibody 1F10. 2A) 1F10 exhibitssuperior binding affinity to recombinant and patient λ amyloid fibrils as well as κ1 patient amyloid fibrils over 11-1F4. Recombinant λ6 Wil fibril, κ4 Len fibril, λ patient-derived, or κ1 patient-derived amyloid extract were coated on an ELISA plate and incubated with different concentrations of mouse IgG control, mouse 11-1F4, or mouse 1F10 antibodies. Binding was assessed following standard ELISA protocol. 2B) 1F10 showed excellent binding in ELISA assays to recombinant, patient hepatic, and patient cardiac lambda amyloid fibrils. 1F10 selectively binds λ amyloid fibrils without cross-reactivity to soluble LCs. Recombinant λ6 Wil fibril, different λ patients’ organ-derived amyloid extract, soluble λ light chain, or κ light chain were coated on an ELISA plate and incubated with different concentrations of mouse 1F10 antibody. Binding was assessed following the standard ELISA protocol. 2C) 1F10 exhibits superior phagocytic activity toward λ amyloid fibrils over 11-1F4. Human THP-1 cells were differentiated into macrophages by PMA stimulation and seeded into 96-well plates. Next, pHrodo Red-labeled λ6 Wil fibrils were incubated with different concentrations of mouse IgG control, mouse 11-1F4, or mouse 1F10 antibodies for half an hour, and then added to the THP-1 cell wells. pHrodo Red fluorescence signal intensity was quantified by plate reader. ****P<0.0001 by two-way ANOVA.1F10 showed superior effecting of phagocytosis of λ6 Wil as compared to 11-1F4. 2D) Both FITC-anti-lambda light chain and Cy3-1F10 staining showed good binding in lambda AL-amyloidosis patient renal biopsies (representative staining of 11patients).2E) 1F10 specifically stains λ amyloid fibrils on patient biopsies.1F10 and anti-λ light chain double staining was performed on renal biopsies from λ AL amyloidosis patients. As shown, 1F10 staining (red) co-localized with anti-λ light chain staining (green) of amyloid in glomeruli and blood vessels (verified by pathologist), further confirming 1F10’s binding specificity to λ amyloid fibrils (representative biopsy images from λ amyloid patients, N=11). The ThT staining (green) on an adjacent slide from the same paraffin block showed the same staining area, therefore verifying the specific AL amyloid staining by 1F10. ThT staining on an adjacent tissue section was added to confirm amyloid structure in the 1F10 IHC figure. The isotype control and 1F10 staining were performed on adjacent slides from the same tissue and therefore, they share the same ThT staining image. Although they are identical, the image is shown twice for consistency in figure layout.

[0031] Figs. 3A-3C. CHO cell-based production of recombinant 1F10 (mIgG2a). 3A) Detailsof m1F10 production from CHO cells by one-step Protein A purification. 3B) SDS-PAGE of purified antibody.3C) SEC-HPLC of purified antibody.

[0032] Figs. 4A-4B. Binding affinity characterization of recombinant 1F10. 4A)Recombinant mouse 1F10 was successfully produced and purified, and amyloid-binding affinities (EC50) were characterized by ELISA. Recombinant λ6 Wil fibril, κ4 Len fibril, λ patient-derived, or κ1 patient-derived amyloid extract were coated on an ELISA plate and incubated with different concentrations of mouse IgG control, m11-1F4, or recombinant mouse 1F10 antibodies. 4B) Binding was assessed following standard ELISA protocol. EC₅₀ values were not calculated for the κ1 fibril since the binding did not reach a plateau at the highest antibody concentration and hence EC₅₀ values could not be determined. Nonetheless, the data still demonstrate stronger binding of 1F10 compared to 11-1F4 on this fibril.

[0033] Figs. 5A-5B. 5A) 1F10 exhibits superior amyloid binding activity compared to 2A4.Recombinant λ6 Wil fibril, κ4 Len Fibril, κ1 patient-derived, or λ patient-derived cardiac amyloid extracts were coated on an ELISA plate and incubated with different concentrations of mouse IgG control, mouse 11-1F4, mouse 2A4, or mouse 1F10 antibodies. Binding was assessed following standard ELISA protocol. These data show that 2A4 (i.e., a mouse antibody version of birtamimab) is not an efficient AL amyloid binder, whereas 1F10 exhibits significantly more efficient binding to all types of AL amyloid fibrils. 5B) 1F10 exhibits superior phagocytic activity compared to 2A4. pHrodo Red-labeled λ6 Wil fibrils were incubated with differentconcentrations of mouse IgG control, mouse 11-1F4, mouse 2A4, or mouse 1F10 antibodies for half an hour, and then added to RAW264.7 cell wells. pHrodo Red fluorescence signal intensity was quantified by a plate reader 3–4 hours later to monitor phagocytic activity. 1F10 showed superior effecting of phagocytosis of κ4 Len and λ6 Wil fibrils as compared to 2A4.

[0034] Fig. 6. 1F10 exhibits superior λ fibril clearance activity in vivo. Dylight755-labeledλ6 Wil fibrils were mixed with 20% Matrigel and s.c. injected into BalB / C mice (5 mg / mouse, 6 wks, female). The next day, mice were randomized into three groups receiving i.v. injection of mouse IgG2a kappa isotype control, mouse 11-1F4, or mouse 1F10 antibodies (100 ug / mouse, N= 5 / group) three times a week. Dylight755 signal change was monitored by fluorescence imaging (fold change mean ± SEM, N=5). *P<0.05 by two-way ANOVA (1F10 vs IgG: *P=0.022; 1F10 vs 11-1F4: *P=0.038).

[0035] Figs. 7A-7C. 1F10 was further successfully chimerized to human IgG1 backbone, andproduced using CHO cells. 7A) Details of ch1F10 production from CHO cells by one-step Protein A purification. 7B) SDS-PAGE of purified antibody. 29C) SEC-HPLC of purified antibody.

[0036] Figs. 8A-8C. Binding affinity and phagocytic activity characterization of chimeric1F10. 8A) AL amyloid-binding affinities (EC50) of the ch1F10 were characterized by ELISA assays and compared to ch11-1F4 (CAEL-101). Recombinant λ6 Wil fibril, κ4 Len fibril, λ patient-derived, or κ1 patient-derived amyloid extract were coated on an ELISA plate and incubated with different concentrations of ch11-1F4 or ch1F10 antibodies. 8B) Binding was assessed following standard ELISA protocol. EC₅₀ values were not calculated for the κ1 fibril since the binding did not reach a plateau at the highest antibody concentration and hence EC₅₀ values could not be determined. Nonetheless, the data still demonstrate stronger binding of ch1F10 compared to ch11-1F4 on this fibril. 8C) ch1F10 exhibited superior phagocytic activity compared to ch11-1F4 (CAEL-101). Human THP-1 cells were differentiated into macrophages by PMA stimulation and seeded into 96-well plates. Next, pHrodo Red-labeled λ6 Wil fibrils were incubated with human IgG control, ch11-1F4, or ch1F10 antibodies for 30 minutes, and then added to the THP-1 cell wells. Fluorescence signal intensity was quantified 3–4 hours later to monitor phagocytic activity. ****P<0.0001 by two-way ANOVA. Again, ch1F10 showed superior effecting of phagocytosis of lambda6 Wil fibrils as compared to ch11-1F4.

[0037] Fig. 9. Schematic diagram of an example bi-specific phagocyte-engager (BiPE)binding an AL amyloid fibril and a macrophage, leading to amyloid clearance.

[0038] Fig. 10A-10C: 10A) Design of scFv BiPEs. 10B) HEK293 cells were transduced bythe indicated pCDH-BiPEs-His6-EF1-eGFP lentivirus, and the GFP positive cells were selected by flow cytometry assay. 10C) HEK293 cells that stably express the indicated BiPEs were cultured in OPTI-MEM serum free medium for 72 hours. Culture media were collected and followed by Ni-NTA beads affinity purification. The scFv BiPEs were eluted by 400mM Imidazole PBS buffer and desalted by ultrafiltration. The purified scFv BiPEs were detected by western blotting using anti-His tag.

[0039] Fig. 11: Solid phase ELISA assay using AL amyloid extract. Cardiac AL amyloidextract (K1) were coated onto ELISA plate and dried overnight at 37oC. scFv BiPEs (with C- terminal His-tag) were added at the indicated concentration and incubated for 2 hours at RT, followed by anti-His-HRP secondary antibody incubation and TMB development. For the negative controls, either AL amyloid extract only without scFv BiPEs, or scFv BiPEs only without AL amyloid extract coating were used. For the positive control, 1ng of His-tag MMP-13 recombinant protein was directly coated onto the ELISA plate.

[0040] Fig. 12. ScFv BiPEs bind to different types of AL amyloid fibril in vitro as shown byELISA assay.

[0041] Fig. 13. Design and production of exemplary IgG scFv BiPEs.

[0042] Fig. 14. Amyloid binding affinity of IgG scFv BiPEs by ELISA. It was found that2+2 > 2+1 > 11-1F4 FcM >= 11-1F4 WT.

[0043] Fig. 15. CD64 binding affinity of full IgG BiPEs by ELISA. 2+2 > 2+1 >>> 11-1F4FcM >= 11-1F4 WT.

[0044] Fig. 16. THP1 binding affinity of full IgG BiPEs by FC. THP1 were stained with2.8ug / ml Iso-IgG, or Ch11-1F4 wt, Ch11-1F4 mut, BsAb2+1, or BsAb2+2 for 30min at 4c, then washed twice, stained cells were separated into two tubes for fixing with 1ml 0.5%PFA or unfixing, after 30min fixing, cells were washed with FACS buffer, then distributed the fixed or unfixed cells into tubes with different concentration of TAMRA-Len pep, the pep final concentration is 40ug / ml , 20ug / ml, 10ug / ml, 5ug / ml, 2.5ug / ml or 1.25ug / ml for 30min at 4c. After washing twice with FACS buffer, samples were analyzed with LSRII. 2+2 > 2+1 >= 11- 1F4 FcM > 11-1F4 WT.

[0045] Figs. 17A-17C: Different IgG-Fab bispecific antibody designs (Fig. 17A) and theirELISA binding assays on Len fibrils (Fig.17B) and CD64 (Fig.17C).

[0046] Fig. 18. CD64 binding affinity measured by Surface Plasmon Resonance (SPR).

[0047] Fig. 19. BiPE D THP-1 Phagocyte binding affinity measured by flow cytometry usinganti-kappa LC secondary antibody. THP-1 cells were stained with hIgG1 κ, c11-1F4, anti-CD64 H22, or BiPE D for 30 min at 4ºC, then washed twice with FACS buffer. The cells were then stained with PE-conjugated anti-kappa human light chain secondary antibody for 30 min at 4°C. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20.

[0048] Fig. 20. Verification of enhanced THP1 cell binding affinity of BiPE D by flowcytometry using TARMA-Len(1-22) peptide. To verify the antigen binding ability of BiPE D upon phagocyte engagement, an 11-1F4-specific staining method was developed using fluorescence dye TRAMRA labeled Len(1-22) peptide. Len(1-22) peptide contains the first 22 amino acids of Len protein, which contains the binding epitope for 11-1F4. THP1 were incubated with 5nM hu-IgG, or ch11-1F4, BiPE D and F for 30min at 4C, then washed twice with FACS buffer. The cells were then distributed into tubes with different concentrations of TAMRA-Len(1-22) peptide (10ug / ml, 5ug / ml, 2.5ug / ml, 1.25ug / ml or 0.625ug / ml) for 30min at 4C. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20.

[0049] Fig. 21. Antibody D Cellular Binding is Resistant to IgG-based Fc Blockage. The leftside cartoon illustrated the principle of the Fc-independent cellular binding mechanism of BiPE D. THP1 were pre-treated with human IgG-based Fc blocker (Miltenyi) and then incubated with different concentrations of hu-IgG, ch11-1F4, BiPE D or F for 30min at 4ºC, then washed twice with FACS buffer, then the cells were stained with TAMRA-Len(1-22) peptide for 30min at 4ºC. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20.

[0050] Fig. 22. Antibody D cellular binding is resistant to IgG competition. Differentconcentrations of hu-IgG from 50ug / ml to 6.25ug / ml were added to THP-1 cells. The cells were then incubated with 5nM huIgG, Ch11-1F4, or BiPE D for 30 min at 4ºC, then washed twice with FACS buffer. The cells were then stained with 1.25ug / ml TAMRA-Len for 30 min at 4ºC. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20.

[0051] Fig. 23. Antibody D THP1 Cellular Binding is Resistant to IgG-based Fc Blockage.THP1 were pre-treated with human IgG-based Fc blocker (Miltenyi) or without blocker, then incubated with 5nM hu-IgG, or ch11-1F4, BiPE D respectively for 30min at 4ºC, after washingtwice with FACS buffer, the cells were stained with 1.25ug / ml TAMRA-Len1-22 peptide for 30min at 4ºC. After washing twice with FACS buffer, samples were analyzed with Fortessa X- 20.

[0052] Fig. 24. Antibody D Showed Higher Binding Affinity to Primary Phagocyte-Resistantto Fc Blocker. Human PBMCs were incubated with 1:1000 live dead blue for 15min, then cells were split into two parts: incubated with or without human Fc blocker. Both groups of cells were incubated with 5nM human IgG, or Ch11-1-F4, or D for 30min at 4ºC, and co-stained with antibodies against CD45, CD3, CD14, CD19. Cells were then washed twice, and incubated with TAMRA-Len(1-22) peptide 2.5ug / ml for 30min at 4ºC, after twice washing, fixed with 0.5% PFA and analyzed with Fortessa X-20.

[0053] Figs. 25A-25C. Antibody D Showed the Highest Amyloid Fibril PhagocytosisActivity. 25A) Schematic of phagocytosis assay. 25B) Phagocytosis assay results in the THP1 macrophage cell line.25C) Phagocytosis assay results in human primary M1 macrophages.

[0054] Figs. 26A-26C. D Fibril Phagocytosis Activity is Resistant to Fc / IgG Competition.Phagocytic activity was reassessed in parallel under three conditions: IgG-free (Fig. 26A), with Fc blocker (Fig. 26B), and with serum IgG competition (Fig.26C). Differentiated human THP1 macrophage cells were pre-treated without or with hIgG-based Fc blocker (Miltenyi) or 20% human serum, then incubated with pHrodo Red-labeled kappa4 Len Fibril and antibodies at the indicated concentrations for 1 hour. Phagocytosis rate was evaluated by the red fluorescence signal intensity.

[0055] Fig. 27. AL Amyloid fibril-specific CAR-phagocyte – in this example a CAR-Macrophage.

[0056] Fig. 28. A CAR-Macrophage example of the CAR-phagocyte therapy for ALAmyloidosis resulting in amyloid fibril resolution.

[0057] Fig. 29. RAW264.7 cells were infected by CAR-GFP lentivirus. GFP and CAR-GFPfusion proteins cell surface expression (middle and right panel) was confirmed by fluorescence microscopy.

[0058] Fig. 30. RAW264.7 cells were infected by CAR-GFP lentivirus. Human lambdaamyloid extract was covalently labeled by pH-sensitive fluorescence dye pHrodo red (only lights up under acidic conditions) and incubated with RAW cells for 2 hours. Phagocytosis was observed by fluorescence microscopy. (See merge panels).

[0059] Figs. 31A-31B. 31A) A specific non-limiting example of a CAR construct comprisingan 11-1F4 scFv and specified transmembrane and signaling domains, as well as a GFP for experimental confirmation purposes; 31B) GFP fluorescence confirming successful expression in the cells transduced with the CAR. Fluorescence microscope of the GFP or 11-1F4-CAR-GFP transduced RAW264.7 cells.

[0060] Figs. 32A-32B. 32A) A specific example of the CAR-Macrophage therapy shown inFig. 2, the CAR-Macrophage comprising an 11-1F4 scFv and specified transmembrane and signaling domains, as well as a GFP for experimental confirmation purposes.32B) After 4 hours of incubation with RAW 264.7 cells transduced by either GFP control vector or 11-1F4 CAR- GFP construct, the uptake and acidification of the pHrodo red–labeled fibrils was assessed under fluorescence microscope. As shown, 11-1F4 CAR-GFP macrophages showed significantly increased phagocytosis activity compared to the GFP control cells.

[0061] Fig. 33. Phagocytosis assay of pHrodo red labeled AL amyloid fibril by GFP or 11-1F4-CAR-GFP transduced primary mouse bone marrow derived macrophages.

[0062] Figs. 34A-34E. 34A) Design of an 11-1F4-Flag-CAR-T2A-Luciferase GFP construct.34B) Confirmation of CAR cell surface expression in transduced THP-1 cells using APC-anti- Flag FC and IF. 34C) Production of human primary CAR macrophages. 34D) Confirmation of the expression of common macrophage markers on the CAR CD34+ differentiated macrophages by flow cytometry.34E) Phagocytosis assay of pHrodo red labeled human AL amyloid fibril by GFP-T2A-luciferase or 11-1F4-CAR-T2A-luciferase GFP transduced human macrophages.

[0063] Fig. 35. Additional examples of anti-amyloid CAR constructs.

[0064] Figs. 36A-36C. 36A) Schematic figure of CD34+ transduction and transplantation toNSG-SGM3 mice. 36B) Transduction efficiency of CD34+ cells from PBSC by GFP-EV or 11- 1F4 CAR virus detected by flow cytometry. 36C) Chimera check 6 weeks after transduced CD34+ cells i.v. injected into NSG-SGM3 mice by flow cytometry.

[0065] Fig. 37. AL Amyloid fibril-specific CAR-HSC therapy embodiment.

[0066] Fig. 38. Both M1 and M2 CAR M showed amyloid clearance activities.

[0067] Fig. 39A-39C. Comparison of FcRg and MegF10 signaling domains. 39A) Design ofadditional 11-1F4 CARs using MegF10 signaling domain. 39B) FcRg and MegF10 signaling domains showed similar phagocytic activities of Len fibril. 39C) FcRγ and MegF10 signaling domains showed similar phagocytic activities of Wil fibril.

[0068] Fig. 40. Confirmation of 11-1F4 CAR-M compared to CD19 Control CAR-M.

[0069] Figs. 41A-41D. In vivo Amyloid targeting activity of l1-1F4 CAR-M. 41A)Intraperitoneal injection of labelled CAR-M or control into labeled amyloid in vivo model; Fluorescence imaging for amyloid and BLI for CAR-M or control.41B) Images of results.41C). Macrophage amyloid recruitment rate.15D) Peritoneal macrophage count.

[0070] Figs. 42A-42C. 42A) Novel mouse model enabling real-time monitoring of ALamyloid and CAR-P in vivo. 42B) BLI imaging for phagocyte tracking in G4S-Ctrl-P and 11- 1F4-CAR-P mice (left) and quantification of luciferase activity (right). 42C) Fluorescence imaging for amyloid tracking in G4S-Ctrl-P and 11-1F4-CAR-P mice (left) and quantification of relative change in Dylight755 (Len Fibril) detection (right)..

[0071] Fig. 43. Myeloid cell boosted with M-CSF+GM-CSF hydrodynamic injection: 12-dayex vivo expanded CD34+ cells from cord blood were injected into NSG mice, after 12 weeks, the mice were hydrodynamic injected with 20ug M-CSF and GM-CSF expressing plasmids, 1 week later, human myeloid cell boosted in PBMC were found.

[0072] Figs. 44A-44D. 11-1F4 CAR-Macrophages Phagocytose AL Amyloid Fibrils in vitro.44A) GFP-CAAX, G4S-FcRγ-GFP, 11-1F4-FcRγ-GFP, and α-CD19-FcRγ-GFP CARs. 44B) In vitro phagocytosis assay. 44C) Phagocytosis of pHrodo Red κ4-Len Fibril by CAR- Macrophages.44D) Phagocytosis of pHrodo Red λ6-Wil Fibril by CAR-Macrophages.

[0073] Figs. 45A-45B. 45A) 11-1F4-CAR-P displays superior λ-AL amyloid phagocytosisactivity compared to the naked c11-1F4 antibody. 45B) 11-1F4-CAR-P displays superior κ-AL amyloid phagocytosis activity compared to the naked c11-1F4 antibody in the condition of serum IgG competition. The pHrodo Red-labeled κ4 Len fibril phagocytosis assay was conducted under either condition without hIgG / human serum, or with 20% human serum.11-1F4 naked antibody induced antigen dependent phagocytosis (ADP) is largely inhibited by the high concentration of IgG in human serum, whereas 11-1F4 CAR phagocyte’s activity is not affected by IgG competition.

[0074] Fig. 46. Human hematopoietic stem cell (HSC)-derived anti-AL amyloid CAR-Phagocyte (CAR-P) strategy. Briefly, mobilized PBMCs are isolated from a subject suffering from or likely to have AL amyloidosis. HSCs are isolated from the PBMCs and transduced to generate CAR-HSCs which encode an anti-AL amyloid CAR. The CAR-HSCs are thenexpanded and differentiated ex vivo to generate CAR-phagocytes, which can then be introduced into the subject.

[0075] Figs. 47A-47C. Human HSC-derived anti-AL amyloid CAR-P. 47A) Anti-ALamyloid CAR-P workflow. 47B) Anti-AL amyloid CAR-P timeline. 47C) Flow cytometry plots of G4S-CAR-P and 11-1F4-CAR-P cells gating on CD11c and G4S signal (upper panel), and flow cytometry quantifications displaying counts of G4S-CAR-P, 11-1F4-CAR-P, and unstained control cells across various markers, specifically: G4S, CD14, CD16, CD206, CD64, CD68, HLA-DR, and CD86 (lower panel).

[0076] Figs. 48A-48B. 11-1F4 HSC-derived CAR-Ps display enhanced AL-amyloid fibrilphagocytosis in vitro. 48A) Images of phagocytosis by G4S-FcR-GFP Ctrl-P (left) and 11-1F4- FcR-GFP CAR-P (right) cells.48B) Quantification of phagocytosis.DETAILED DESCRIPTION OF THE INVENTION

[0077] The present disclosure provides an antibody which binds a light chain amyloidfibril, a light chain amyloid fibril-binding fragment of such antibody, or a fusion protein, comprising: CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), and a light chain variable region comprising CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48).

[0078] In some embodiments, a heavy chain of the antibody comprises SEQ ID NO:51. Insome embodiments, a heavy chain of the antibody, preferably the VH of the antibody, comprises amino acids 20-140 of SEQ ID NO: 51. In some embodiments, a light chain of the antibody comprises SEQ ID NO:52. In some embodiments, a light chain of the antibody, preferably the VL of the antibody, comprises amino acids 21-127 of SEQ ID NO: 52. In some embodiments, the antibody is an IgG. Also provided is an scFv comprising SEQ ID NOS: 43, 44, 45, 46, 47, and 48. Also provided is an Fab or an F(ab’)2comprising SEQ ID NOS: 43, 44, 45, 46, 47, and 48. In some embodiments, the antibody, scFv, or fragments thereof bind lambda light chain amyloid in preference to kappa light chain amyloid. In some embodiments, the antibody, scFv, or fragments thereof have a greater affinity for lambda light chain amyloid than affinity for kappa light chain amyloid.

[0079] In some embodiments, the antibody has human framework regions.

[0080] In some embodiments, the antibody is humanized.

[0081] In some embodiments, the antibody has a human sequence Fc region or has 85% ormore sequence identity therewith.

[0082] In some embodiments, the Fc region comprises at least one mutation which improvesphagocyte-binding by the antibody, and / or enhances antibody-dependent cellular cytotoxicity (ADCC) and / or antibody-dependent cellular phagocytosis (ADCP) by a phagocyte bound by the antibody.

[0083] In some embodiments, the Fc region comprises at least one mutation selected fromthe group consisting of S298A, E333A, K334A, S239D, I332E, P247I, A339Q, F234L, R292P, Y300L, V305I, P396L, A330L, and G236A, preferably wherein the Fc region comprises G236A, S239D, and I332E mutations.

[0084] In some embodiments, the antibody is chimeric.

[0085] In some embodiments, the antibody is a monoclonal antibody.

[0086] In some embodiments, the antibody is an IgG1(λ) or an IgG2(λ) or an IgG4.

[0087] In some embodiments, the fusion protein is a single chain variable fragment (scFv).

[0088] In some embodiments, the antibody, fragment, or fusion protein preferentially binds alambda light chain amyloid fibril over a kappa light chain amyloid fibril.

[0089] In some embodiments, the antibody, fragment, or fusion protein comprises a portionwhich has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 65-68.

[0090] A composition is provided comprising the antibody, fragment, or fusion proteindescribed herein and a pharmaceutically acceptable carrier or physiologically acceptable carrier.

[0091] A method for treating light chain amyloidosis in a subject, comprising administeringto the subject a therapeutically effective amount of a pharmaceutical composition comprising the antibody, fragment or fusion protein described above.

[0092] In some embodiments, the light chain amyloidosis is characterized by formation oflambda light chain amyloid fibrils.

[0093] Also provided is a method for reducing an amyloid fibril deposit in a subject havinglight chain amyloidosis, comprising administering to the subject a therapeutically effectiveamount of a pharmaceutical composition comprising the antibody, fragment or fusion protein described above.

[0094] In some embodiments, the amyloid fibril deposit comprises lambda light chainamyloid fibrils.

[0095] A polynucleotide molecule encoding the antibody, fragment or fusion proteindescribed above is also provided.

[0096] In some embodiments, the polynucleotide molecule comprises a nucleic acidsequence having a portion which has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 49, 50, 63, and / or 64.

[0097] Also provided is a vector comprising the polynucleotide.

[0098] In some embodiments, the vector is a lentiviral vector.

[0099] In some embodiments, the vector is an RNA vector.

[0100] In some embodiments, the vector comprises a promoter, preferably a constitutive oran inducible promoter, operably linked to the polynucleotide sequence encoding the antibody, fragment or fusion protein.

[0101] Also provided is a cell comprising or genetically modified by the polynucleotide orvector described above.

[0102] A method of isolating the antibody, fragment or fusion protein comprisingmaintaining the cell in culture medium and isolating the antibody, fragment or fusion protein expressed by the cell is also provided.

[0103] Also provided is a pharmaceutical composition comprising the polynucleotide of orthe vector described above, and a pharmaceutically acceptable carrier.

[0104] Also provided is a method for treating light chain amyloidosis in a subject or reducingan amyloid fibril deposit in a subject having light chain amyloidosis, the method comprising: administering to the subject (a) an effective amount of the polynucleotide described above, (b) a genetically modified cell modified by the polynucleotide or the vector described above, (c) a cell comprising the polynucleotide or the vector described above, or (d) the vector described above.

[0105] The present disclosure also provides a bispecific antibody which binds a light chainamyloid fibril and binds a phagocyte wherein a portion thereof which binds a light chain amyloid fibril comprises (i) a heavy chain variable region comprising: CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), and a light chain variable region comprising CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48); or (ii) a) a heavy chain variable region comprising: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2: IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and a light chain variable region comprising: CDR1: QSLVHRNGNTY (SEQ ID NO:4),CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6); or b) a heavy chain variable region comprising: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8), CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and a light chain variable region comprising: CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) a heavy chain variable region comprising: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and a light chain variable region comprising CDR1: ENIYSY (SEQ ID NO:16), CDR2:NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) a heavy chain variable region comprising: CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and a light chain variable region comprising: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

[0106] In some embodiments, a portion of the bispecific antibody which binds the phagocytebinds CD64 or binds CD89 on a phagocyte cell surface.

[0107] In some embodiments, a portion of the bispecific antibody which binds the phagocytecomprises a heavy chain variable region comprising: CDR1: GFIFSDNY (SEQ ID NO:25), CDR2: ISDGGSYT (SEQ ID NO:26), CDR3: ARGYYRYEGAMDY (SEQ ID NO:27), and a light chain variable region comprising: CDR1:QSVLYSSNQKNY (SEQ ID NO:28), CDR2: WAS (SEQ ID NO:29), CDR3: HQYLSSWT (SEQ ID NO:30); or a heavy chain variable region comprising: CDR1: GFTFSSYV (SEQ ID NO:31), CDR2: ISDDGRNK (SEQ ID NO:32), CDR3: VREGYSGSWFDY (SEQ ID NO:33), and a light chain variable region comprising: CDR1: QGISSA (SEQ ID NO:34), CDR2: GAS (SEQ ID NO:35), CDR3: QQFNSYPFT (SEQ ID NO:36).

[0108] Also provided is a bispecific antibody which binds a light chain amyloid fibril andbinds a phagocyte, wherein a portion thereof which binds a phagocyte comprises a heavy chain variable region comprising: CDR1: GFIFSDNY (SEQ ID NO:25), CDR2: ISDGGSYT (SEQ ID NO:26), CDR3: ARGYYRYEGAMDY (SEQ ID NO:27), and a light chain variable region comprising: CDR1:QSVLYSSNQKNY (SEQ ID NO:28), CDR2: WAS (SEQ ID NO:29), CDR3: HQYLSSWT (SEQ ID NO:30); or a heavy chain variable region comprising: CDR1: GFTFSSYV (SEQ ID NO:31), CDR2: ISDDGRNK (SEQ ID NO:32), CDR3: VREGYSGSWFDY (SEQ ID NO:33), and a light chain variable region comprising: CDR1: QGISSA (SEQ ID NO:34), CDR2: GAS (SEQ ID NO:35), CDR3: QQFNSYPFT (SEQ ID NO:36).

[0109] In some embodiments, the bispecific antibody,a) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:1-6, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or b) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:1-6, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or c) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:7-12, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; ord) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:7-12, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or e) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:13-18, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or f) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:13-18, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or g) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:37-42, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or h) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:37-42, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or i) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:43-48, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or j) comprises a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS: 43-48, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker, or comprising a) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOS:1-6, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOS:25- 30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or b) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 1-6, and anscFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31- 36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or c) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 7-12, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25- 30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or d) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 7-12, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31- 36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or e) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 13-18, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25- 30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or f) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 13-18, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31- 36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or g) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 37-42, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25- 30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or h) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 37-42, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31-36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or i) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 43-48, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25- 30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or j) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 43-48, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31- 36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker.

[0110] In some embodiments, the bispecific ab is an IgG-scFv. In some embodiments, thescFv is linked to a CH3 of the heavy chain.

[0111] In some embodiments, the antibody or one or both scFvs comprise framework regionsof a light chain and / or a heavy chain which are human framework regions, or have 85% or more sequence identity thereto. In some embodiments, the framework regions of the light chain and / or the heavy chain are human framework regions.

[0112] In some embodiments, the bispecific antibody binds a human macrophage. In someembodiments, the bispecific antibody binds a human neutrophil.

[0113] In some embodiments, the bispecific antibody is a bispecific phagocyte engager.

[0114] In some embodiments, the bispecific antibody binds a kappa chain human amyloidfibril.

[0115] In some embodiments, the bispecific antibody binds a lambda chain human amyloidfibril.

[0116] A bispecific antibody which binds a light chain amyloid fibril and binds a phagocytecomprising, wherein the bispecific antibody comprises VH complementary-determining regions CDR1 through CDR3, VL complementary-determining regions CDR1 through CDR3, and wherein one or more of CDR1 through CDR3 or either of, or both of, the VH and the VL has 85% or greater identity with, but not 100% identity with, the VH CDR1 through CDR3 sequences, or VL CDR1 through CDR3 sequences, respectively, set forth as follows: (i)CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), and a light chain variable region comprising CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48); or (ii) a) VH CDR1 through CDR3: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2: IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and VL CDR1 through CDR3: CDR1: QSLVHRNGNTY (SEQ ID NO:4), CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6);or b) VH CDR1 through CDR3: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8), CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and VL CDR1 through CDR3: CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) VH CDR1 through CDR3: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and VL CDR1 through CDR3: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) VH CDR1 through CDR3:CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and VL CDR1 through CDR3: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

[0117] In some embodiments, the bispecific antibody has a human sequence Fc region or has85% or more sequence identity therewith.

[0118] In some embodiments, the Fc region comprises at least one mutation which improvesphagocyte-binding by the bispecific antibody, and / or enhances antibody-dependent cellular cytotoxicity (ADCC) and / or antibody-dependent cellular phagocytosis (ADCP) by a phagocyte bound by the bispecific antibody.

[0119] In some embodiments, the Fc region comprises at least one mutation selected fromthe group consisting of S298A, E333A, K334A, S239D, I332E, P247I, A339Q, F234L, R292P, Y300L, V305I, P396L, A330L, and G236A, preferably wherein the Fc region comprises G236A, S239D, and I332E mutations.

[0120] In some embodiments, the phagocyte-binding portion of the bispecific antibodies andconstructs described herein can be constructed from the CDRs of other known anti-CD64 or anti- CD89 antibodies.

[0121] A pharmaceutical composition is provided comprising(i) the bispecific antibody which binds a light chain amyloid fibril and binds a phagocyte as described herein, and a carrier; or(ii) two or more different bispecific antibodies which bind a light chain amyloid fibril and bind a phagocyte as described herein, and a carrier.

[0122] A method for treating light chain amyloidosis in a subject, comprising administeringto the subject a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody as described herein.

[0123] A method for reducing an amyloid fibril deposit in a subject having light chainamyloidosis, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody as described herein.

[0124] In some embodiments, at least two or more different bispecific antibodies which eachbinds a light chain amyloid fibril and bind a phagocyte are administered, and wherein the two antibodies differ in their VH CDR sequences and / or their VL CDR sequences.

[0125] A method of reducing development of an amyloid fibril deposit in a subject,comprising administering to a subject identified as having AL amyloidosis a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody as described herein, effective to reduce development of an amyloid fibril deposit.

[0126] A bispecific antigen binding construct comprising a first antigen-binding polypeptideconstruct which specifically binds a human light chain amyloid fibril antigen; a second antigen- binding polypeptide construct which specifically binds a cell surface marker on a phagocyte, and wherein the first antigen-binding polypeptide construct is joined via a linker to the second antigen-binding polypeptide construct.

[0127] In some embodiments, the first antigen binding polypeptide construct is an scFv andthe second antigen binding polypeptide construct is an scFv.

[0128] In some embodiments, the linker is a peptide linker or a polypeptide linker.

[0129] In some embodiments, the bispecific antigen binding construct is capable of bringinga phagocyte adjacent to an amyloid fibril when bound to the amyloid fibril by binding both to the amyloid fibril and the phagocyte.

[0130] In some embodiments, the bispecific antigen binding construct is capable of bringinga phagocyte adjacent to an amyloid fibril when bound to the phagocyte by binding both to the amyloid fibril and the phagocyte.

[0131] In some embodiments, the phagocyte is a macrophage.

[0132] In some embodiments, the bispecific antigen binding construct is a bispecificantibody.

[0133] In some embodiments, the bispecific antigen binding construct is a tandem scFv, aKiH, a kl-body, or a CrossMab.

[0134] In some embodiments, the bispecific antigen binding construct is a bispecific fullIgG, a chemically-linked F(ab’)2, a diabody, an IgG-scFv, a TandAb (tandem diabody), a DVD- Ig (dual variable domain immunoglobulin), tandem Fab-IgG, or a DART (dual-affinity retargeting molecule).

[0135] In some embodiments, the cell surface marker on a phagocyte is CD64 or CD89.

[0136] In some embodiments, the first antigen-binding polypeptide construct monovalentlybinds the human light chain amyloid fibril antigen.

[0137] In some embodiments, the second antigen-binding polypeptide constructmonovalently binds the cell surface marker on a phagocyte.

[0138] A nucleic acid encoding a bispecific antibody as described herein is provided.

[0139] A nucleic acid encoding an antibody, antigen-bind fragment or fusion protein asdescribed herein is also provided.

[0140] A nucleic acid encoding a bispecific antigen binding construct as described herein isprovided.

[0141] Also provided is a cell comprising a nucleic acid as described herein, wherein thenucleic acid is heterologous to the cell genome.

[0142] A host cell is provided comprising a nucleic acid as described herein. In someembodiments, the host cell is a mammalian cell. In some embodiments, the host cell is derived from a mammalian cell. In some embodiments, the host cell is a CHO, NS0, Sp2 / 0, HEK293, or PER.C6 cell.

[0143] In some embodiments, a construct as described herein is a monomeric polypeptideform. In some embodiments, the construct is a multimeric polypeptide.

[0144] The term “bispecific” refers to the ability of the polypeptide (e.g., an antibody) tobind two distinct epitopes. For example, a bispecific antibody may comprise two distinct antigen binding domains which each bind a distinct epitope. In some embodiments, the two distinct antigens are located on two different molecules, e.g., a one epitope bound by a bispecific antibody is located on an amyloid fibril, and a different epitope is bound by the same bispecificantibody is located on a phagocyte. Several bispecific molecule formats referred to bi-specific phagocyte engagers (BiPEs) are described throughout the present disclosure.

[0145] In the case of VH and VL regions within a given antigen binding site, each may bederived from the same or different antibodies. Either of the antigen binding site may be located at either the N- or C-terminus of the polypeptide. Linkers used herein that permit a VH and VL region to associate such that their respective CDR regions can form a single unified antigen binding site are known in the art. For example, the peptide linkers described in EP 0623679 B1, US 5,258,498, EP 0573551 B1 and US 5,525,491.

[0146] Unless otherwise specified, the VH and / or VL regions of a given antigen binding sitemay be derived from different sources, for example from two different monoclonal antibodies which may or may not originate from two organisms of the same species, or may be modified (i.e., chimeric, truncated, humanized, deimmunized, etc.).

[0147] In some embodiments, a polypeptide (e.g., a bispecific antibody) as described hereincomprises two antigen binding sites, wherein each antigen binding site comprises one VH and one VL region. In this embodiment, the two antigen binding sites are covalently connected to one another through a short peptide spacer, and each antigen binding site specifically binds a different antigen. In some embodiments, a bispecific antibody herein comprises two antigen binding sites in the form of an entire antibody directed to a first antigen, with VH, VL and Fc regions, and an Fab directed to the second antigen, wherein the Fab is bonded via a peptide linker to the VH of the entire antibody directed to a first antigen. For example, see Fig.17A, e.g., D and E formats. In some embodiments of this format, the entire intact antibody is directed to an amyloid fibril and the Fab is directed to a macrophage / neutrophil cell surface marker, such as CD64. In some embodiments of this format, the entire intact antibody is directed to a macrophage / neutrophil cell surface marker, such as CD64 and the Fab is directed to an amyloid fibril. In some embodiments, the antibody has a format as shown in one of bispecific formats A, B, C, D, E or F of Fig. 17A. In this embodiment, the two antigen binding sites are covalently connected to one another through a short peptide spacer, and each antigen binding site specifically binds a different antigen.

[0148] In some embodiments, a bispecific antibody is a CrossMab with VL-VH crossover inanti-CD64, and, optionally, electrostatic steering of the 11-1F4 Fabs. In some embodiments, theFabs can be 2+1, asymmetrical, with knobs-in-hole Fc. In some embodiments, the Fabs can be 2+2, symmetrical, no knobs-in-holes Fc.

[0149] In some embodiments, the bispecific antibody is a tandem Fab-IgG.

[0150] In some embodiments, the portion of the bispecific antibody directed to an amyloidfibril preferentially binds lambda fibrils over kappa fibrils.

[0151] The VH and one VL region of each antigen-binding portion (e.g., scFv) of thebispecific construct may be in any order. E.g., in non-limiting examples in N- to C- order, VL(amyloid fibril)-L-VH(amyloid fibril)-S-VH(macrophage / neutrophil cell surface marker)-L- VL(macrophage / neutrophil cell surface marker); VH(amyloid fibril)-L-VL(amyloid fibril)-S-VH(macrophage / neutrophil cell surface marker)-L- VL(macrophage / neutrophil cell surface marker); VL(amyloid fibril)-L-VH(amyloid fibril)-S-VL(macrophage / neutrophil cell surface marker)-L- VH(macrophage / neutrophil cell surface marker); or VH(amyloid fibril)-L-VL(amyloid fibril)-S-VL(macrophage / neutrophil cell surface marker)-L- VH(macrophage / neutrophil cell surface marker), where "L" represents a first peptide linker covalently connecting a respective VH and VL. A non-limiting example of L includes a (G4S)3 linker. "S" represents a second peptide linker covalently connecting, e.g., a first scFv with a second scFv. A non-limiting example of S includes a (G4S) linker. VL(amyloid fibril) and VH(amyloid fibril) are the variable light and heavy regions, respectively, that bind an amyloid light chain fibril or deposit. For example, kappa or lambda forms, or both. VL(macrophage / neutrophil cell surface marker) and VH(macrophage / neutrophil cell surface marker) are the variable light and heavy regions, respectively, that bind a cell surface marker of a macrophage or neutrophil, for example, a CD64 or CD89.

[0152] In some embodiments, the bispecific antibody has symmetric architecture. In someembodiments, the bispecific antibody has asymmetric architecture. In some embodiments, the bispecific antibody is an appended IgG-HC fusion, such as, e.g., Fab-IgG, a tandem Fab-IgG (orthogonal Fab), Fab-IgG(CR3) or scFv-HC-IgG. In some embodiments, the bispecific antibody is an appended IgG-LC fusion, such as, e.g., an IgG-scFv such as, for example, IgG-scFv(:C), scFv(:C)-IgG or dAb-IgG. In some embodiments, the bispecific antibody is an appended IgG-HC & LC fusion, such as, e.g., a DVD-Ig, TVD-Ig or scFv4-IgG. In some embodiments, thebispecific antibody is a variable domain only bispecific antibody molecule, such as, e.g., a diabody or DART or dsDb or tandem scFv.

[0153] Anti-CD64 antibodies are well known in the art. For example, anti-CD64antibodies are available from Bioss Inc., Leinco Technologies, Inc., MyBioSource.com, BosterBio, Santa Cruz Biotechnology, Inc., Biorbyt, BioLegend, GeneTex, Bio-Rad, R&D Systems, Aladdin Scientific, Bioassay Technology Laboratory, Miltenyi Biotec, RayBiotech, LSBio, United States Biological, Antibodies.com, Huabio, Novus Biologicals, Ampersand Biosciences, BD Biosciences, G Biosciences, Elabscience Bionovation Inc., AAT Bioquest, Inc., Fine Biotech Co., Ltd, Ichorbio, AntibodySystem, Biomatik, Cell Sciences, Cedarlane, NSJ Bioreagents, Sino Biological, Inc., Abcam, Abbexa Ltd., Creative Biolabs, and others. Anti- CD64 antibody sequences are also well-known in the patent literature, e.g., in US7378504B2, hereby incorporated by reference. In some embodiments, the VL(macrophage / neutrophil cell surface marker) and VH(macrophage / neutrophil cell surface marker) bind to human CD64. In some embodiments, the CD64 antibody CDRs are identical to those of antibody H22 (e.g.,Catalog # MA5-48055, ThermoFisher Scientific, USA; e.g. Catalog #: FHC93413,AntibodySystem, France). H22 is also described in Graziano et al., J Immunol., 1995 Nov 15;155(10):4996-5002, hereby incorporated by reference.

[0154] In some embodiments, the anti-CD64 heavy chain comprises:CDR1: DNYMY (SEQ ID NO:53) CDR2: TISDGGSYTYYPDSVKG (SEQ ID NO:54) CDR3: GYYRYEGAMDY (SEQ ID NO:55)

[0155] In some embodiments, the anti-CD64 light chain comprises:CDR1: KSSQSVLYSSNQKNYLA (SEQ ID NO:56) CDR2: WASTRES (SEQ ID NO:57) CDR3: HQYLSSWT (SEQ ID NO:58)

[0156] Anti-CD89 antibodies are well known in the art. For example, anti-CD89 antibodiesare available from ThermoFisher Scientific, St. John’s Laboratory, Sigma-Aldrich, Bio-Rad, BioLegend. Anti-CD89 antibody sequences are also well-known in the patent literature, e.g. in US20030082643A1 and EP3870608A1, hereby incorporated by reference. In some embodiments, the VL(macrophage / neutrophil cell surface marker) and VH(macrophage / neutrophil cell surface marker) bind to human CD89. In some embodiments, the CD89 antibody CDRs are identical to those of antibody A59 (e.g., Catalog # MA5-28546 ThermoFisher Scientific, USA) or MIP8a (e.g., Catalog # MA5-28107 ThermoFisher Scientific, USA).

[0157] The assignment of amino acids to each domain can be in accordance with thedefinitions of Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), Chothia & Lesk, J. Mol. Biol. 196:901-917 (1987), or Chothia et al., Nature 342:878-883 (1989), each of which are hereby incorporated by reference in their entirety.

[0158] In some embodiments of the inventions described herein, the antibody, bispecificantibody, construct, fusion protein, or fragment thereof is isolated. As used herein, the term "isolated" refers to an antibody / construct that by virtue of its origin or source of derivation has one, two, three or four of the following: (1) is not associated with naturally associated components that accompany it in its native state, (2) is free of other proteins from the same species, (3) is expressed by a cell from a different species, and (4) does not occur in nature absent the hand of man.

[0159] In some embodiments, any antibody, bispecific antibody, construct, fusion protein, orfragment thereof as described herein can be produced recombinantly, for example antibodies expressed using a recombinant expression vector transfected into a host cell.

[0160] In some embodiments, an antibody, bispecific antibody, construct, fusion protein, orfragment as described herein may be used to detect or quantify amyloid fibrils, including specific types of amyloid fibrils. Many antibody-based detection methods are well-known in the art, including but not limited to, surface plasmon resonance, ELISA, and immunofluorescence microscopy assays. In some embodiments, an antibody, bispecific antibody, construct, fusion protein, or fragment as described herein may be used to diagnose a subject with AL amyloidosis.

[0161] In some embodiments, a polypeptide, including any antibody, a bispecific antibody,BiPE, scFv, construct, fusion protein, or fragment thereof as described herein, may be conjugated or chemically linked to another molecule, e.g., a small molecule, drug, toxin, enzyme or other polypeptide. In some embodiments, such a conjugate may be used to detect an amyloid fibril e.g., for diagnostic purposes. In some embodiments, a 1F10 antibody may be conjugated to a label or marker molecule (e.g., fluorescent molecule or peroxidase enzyme) to detect the presence of amyloid fibrils, e.g., for diagnostic purposes. In some embodiments, a bispecific antibody, BiPE, scFv, construct, fusion protein, or fragment thereof as described herein may be conjugated to a molecule to enhance phagocyte activity and / or phagocytosis of a phagocyte bound by the bispecific antibody, BiPE, scFv, construct, fusion protein, or fragment thereof.

[0162] The present disclosure also provides a modified human phagocyte comprising achimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0163] Also provided is a fusion protein which is a chimeric antigen receptor (CAR),wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0164] In some embodiments, the recited components are provided in an N to C terminusorder. In some embodiments the recited components are provided in an C to N terminus order.

[0165] In some embodiments, the CAR comprises a human amyloid lambda light chainfibril-binding domain. In some embodiments, the CAR binds a human WIL protein. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to SEQ ID NO: 59. In some embodiments, the CAR binds a lambda-6 type immunoglobulin light chain. In some embodiments, the CAR binds a variable domain of a lambda-6 type immunoglobulin light chain. In some embodiments, the CAR binds a constant domain of a lambda-6 type immunoglobulin light chain. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to amino acids 1-110 of SEQ ID NO: 59, or a portion thereof. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to amino acids 111-216 of SEQ ID NO: 59, or a portion thereof. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to NCBI PDB Accession No.2CD0_B (SEQ ID NO: 60).

[0166] In some embodiments, the CAR comprises a human amyloid kappa light chain fibril-binding domain. In some embodiments, the CAR binds a human LEN protein. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to SEQ ID NO: 61. In some embodiments, the CAR binds a kappa-4 type immunoglobulin light chain. In some embodiments, the CAR binds a variable domain of a kappa-4 type immunoglobulin light chain. In some embodiments, the CAR binds a constant domain of a kappa-4 type immunoglobulin light chain. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to amino acids 1-114 of SEQ ID NO: 61, or a portion thereof. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to amino acids 115-220 of SEQ ID NO: 61, or a portion thereof. In some embodiments, the CAR binds a peptide having at least 90% sequence identity to NCBI PDB Accession No.5LVE_A (SEQ ID NO: 62).

[0167] In some embodiments, the antigen binding domain of the CAR comprises a single-chain variable fragment (scFv). In some embodiments, the antigen binding domain of the CAR comprises an antibody, or an antigen-binding fragment of an antibody.

[0168] In some embodiments, the antibody is selected from the group consisting of amonoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, and a single domain antibody.

[0169] In some embodiments, the CAR comprises a scFv comprising a variable light chain(VL) and variable heavy chain (VH). In some embodiments, the scFv comprises a VL and VH of an antibody which binds a human amyloid light chain fibril, e.g., 11-1F4 antibody or CAEL-101 antibody or 1F10 antibody. In some embodiments, the scFv comprises a VL connected to a VH in an N to C terminus order. In some embodiments, the scFv comprises a VH connected to a VL in an N to C terminus order. In some embodiments, the VL and VH are connected by a linker region, e.g., a (G4S)3linker. In some embodiments, a second linker region connects the scFv to another portion of the CAR. For example, the second linker may connect the scFv to a hinge region of the CAR.

[0170] In some embodiments, the transmembrane domain of the CAR comprises a CD8transmembrane domain. In some embodiments, the transmembrane domain of the CAR comprises a CD28 transmembrane domain. In some embodiments, the transmembrane domain of the CAR comprises a human CD8 transmembrane domain. In some embodiments, the transmembrane domain of the CAR comprises a human CD28 transmembrane domain. In someembodiments, the transmembrane domain of the CAR further comprises a hinge region between the binding domain and the transmembrane domain. In some embodiments, the hinge region is a CD8 hinge region.

[0171] In some embodiments, the intracellular signaling domain of the CAR comprises a γ(gamma) subunit of an immunoglobulin Fc receptor (FcRγ) signaling domain. In some embodiments, the Fc receptor (FcRγ) signaling domain is a human Fc receptor (FcRγ) signaling domain.

[0172] In some embodiments, the intracellular signaling domain of the CAR comprises aCD3zeta (CD3ζ) subunit or a human Megf10 cytoplasmic domain. In some embodiments, the intracellular signaling domain of the CAR comprises a BAI1.

[0173] In some embodiments, the intracellular signaling domain of the CAR comprises aMERTK. In some embodiments, the intracellular signaling domain of the CAR comprises a TIM1.

[0174] In some embodiments, the intracellular signaling domain of the CAR comprises aTIM4. In some embodiments, the intracellular signaling domain of the CAR comprises a 4-1BB. In some embodiments, the intracellular signaling domain of the CAR comprises more than one type of the intracellular signaling domains listed herein.

[0175] In some embodiments, the modified human phagocyte exhibits phagocytosis ofhuman AL amyloid fibrils when bound thereto.

[0176] In some embodiments, the human amyloid light chain fibril-binding domaincomprises: a heavy chain variable region (VH) comprising CDR1: GFSLTSYG (SEQ ID NO:1), CDR2: IWGDGST (SEQ ID NO:2), and / or CDR3: VTLDY (SEQ ID NO:3); and / or a light chain variable region (VL) comprising CDR1: QSLVHRNGNTY (SEQ ID NO:4),CDR2: KVS (SEQ ID NO:5), and / or CDR3: FQTTYVPNT (SEQ ID NO:6).

[0177] In some embodiments, the human amyloid light chain fibril-binding domaincomprises a VH and / or VL encoded as follows: VH CAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTC CATCACATGCACTGTCTCAGGGTTCTCATTAAGCAGCTATGGTGTAAGCTGGGTTCG CCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGACGGGAGCA CAAATTATCATCCAAATCTCATGTCCAGACTGAGTATCAGCAAGGATATTTCCAAGA GCCAAGTTCTCTTCAAACTGAATAGTCTGCAAACTGATGACACAGCCACGTACTACT GTGTCACCTTGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO:19); and VL AGTGATGTTGTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAA GCCTCCATCTCTTGCAGATCTAGTCAGAGCCTTGTACATAGAAATGGAAACACCTAT TTACATTGGTACCTGCAGAAGCCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTT TCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGAT TTCACACTCAAGATCAGCAGAGTGGAGGCTGAGGATTTGGGACTTTATTTCTGTTTT CAAACTACATATGTTCCGAACACGTTCGGAGGGGGGACCAAGCTGGAAATCAAA (SEQ ID NO:20).

[0178] In some embodiments, the human amyloid light chain fibril-binding domaincomprises: a VH comprising CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8), and / or CDR3:ARHRYGDYYAMDY (SEQ ID NO:9); and / or a VL comprising CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), and / or CDR3: GVGDTIKEQFVYV (SEQ ID NO:12).

[0179] In some embodiments, the human amyloid light chain fibril-binding domaincomprises a VH and / or VL encoded as follows: VH GAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAA ACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTGGGTTCGC CAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGGTGGTATTAGTTA CACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCA AGAACAACCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCCTTGTATT ACTGTGCAAGACATAGGTACGGGGATTACTATGCTATGGACTACTGGGGTCAAGGA ACCTCAGTCACCGTCTCCTCA (SEQ ID NO:21); and VL CAACTTGTGCTCACTCAGTCATCTTCAGCCTCTTTCTCCCTGGGAGCCTCAGCAAAAC TCACGTGCACCTTGAGTAGTCAGCACAGTACGTACACCATTGAATGGTATCAGCAAC AGCCACTCAAGCCTCCTAAGTATGTGATGGAACTTAAGAAAGATGGAAGCCACAGC ACAGGTGATGGGATTCCTGATCGCTTCTCTGGTTCCAGCTCTGGTGCTGATCGCTACC TTACCATTTCCAACATCCAGCCTGAAGATGAAGCAATATACATCTGTGGTGTGGGTG ATACAATTAAGGAACAATTTGTGTATGTTTTCGGCGGTGGAACCAAGGTCACTGTCC TA (SEQ ID NO:22).

[0180] In some embodiments, the human amyloid light chain fibril-binding domaincomprises: a VH comprising CDR1:GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), and / or CDR3: ARRGNYDPFAY (SEQ ID NO:15); and / or a VL comprising CDR1: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), and / or CDR3: QHHYVTPWT (SEQ ID NO:18).

[0181] In some embodiments, the human amyloid light chain fibril-binding domaincomprises a VH and / or VL encoded as follows: VH GAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGAACTTCAATGAA GATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAA GCAGAGCCATGGAAAGAACCTTGAGTGGATTGGACTTATTATTCCTTACAATGGTGG TACTACCTACAACCAGAAGTTCAAGGACAAGGCCACATTAACTGTGGACAAGTCAT CCAGCACAGCCTACATGGACCTCCTCAGTCTGACATCTGAGGACTCTGCAGTCTATT ACTGTGCAAGACGGGGTAACTACGACCCGTTTGCTTACTGGGGCCAAGGGACTCTG GTCACTGTCTCTGCA (SEQ ID NO:23); and VL GACATCCAGATGACTCAGTCTCCAGCCTCCCTATCTGCATCTGTGGGAGAAACTGTC ACCATCACATGTCGACCAAGTGAGAATATTTACAGTTATTTAGCATGGTATCAGCAG AAACAGGGAAAATCTCCTCAGCTCCTGGTCTATAATGCAAAAACCTTATCAGAAGGT GTACCATCAAGGTTCAGTGGCAGTGGATCAGGCACACAGTTTTCTCTGAAGATCAAC AGCCTACAGCCTGAAGATTTTGGGAATTATTACTGTCAACATCATTATGTTACTCCGT GGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA (SEQ ID NO:24).

[0182] In some embodiments, the human amyloid light chain fibril-binding domaincomprises: a VH comprising CDR1: GFTFNTYAMY (SEQ ID NO:37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO:38), and / or CDR3: PYSDSFAY (SEQ ID NO:39); and / or a VL comprising CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO:40), CDR2: KVSNRFS (SEQ ID NO:41), and / or CDR3: SQSTHVPFT (SEQ ID NO:42).

[0183] In some embodiments, the human amyloid light chain fibril-binding domaincomprises: a VH comprising CDR1: GYTMN (SEQ ID NO: 43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO: 44), CDR3: KRLTGRGYAMDY (SEQ ID NO: 45); and / or a VL comprising CDR1: RASQSISDYLH (SEQ ID NO: 46), CDR2: YASQSIS (SEQ ID NO: 47), CDR3:QNGHSFPPT (SEQ ID NO: 48).

[0184] In some embodiments, the human amyloid light chain fibril-binding domaincomprises a VH and / or VL encoded as follows:

[0185] VHGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGAGCTTCAATGAA GATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAA ACAGAGCCATGGAAAGAACCTTGAGTGGATTGGACTTATTAATCCTTACAATGGTGG TACTAACTACAACCAAAAATTCAAGGGCAAGGCCACATTAACTGTAGACAAGTCAT CCAGCACATCCTTCATGGAGCTCCTCAGTCTGACATCTGAGGACTCTGCAGTCTATT ACTGTGCAAGAAAGCGGCTAACCGGACGGGGCTATGCTATGGACTACTGGGGTCAA GGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO: 63); and

[0186] VLGACATTGTGATGACTCAGTCTCCGGCCACCCTTTCTGTGACTCCAGGAGATAGAGTC TCTCTTTCCTGCAGGGCCAGCCAGAGTATTAGCGACTACTTACACTGGTATCAACAA AAATCACATGAGTCTCCAAGGCTTCTCATCAAATATGCTTCCCAATCCATCTCTGGG ATCCCCTCCAGGTTCAGTGGCAGTGGATCAGGGTCAGATTTCACTCTCAGTATCAAC AGTGTGGAACCTGAAGATGTTGGAGTGTATTACTGTCAAAATGGTCACAGCTTTCCT CCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA (SEQ ID NO: 64).

[0187] In some embodiments, the human amyloid light chain fibril-binding domaincomprises VH complementary-determining regions CDR1 through CDR3, and VL complementary-determining regions CDR1 through CDR3, wherein one or more of CDR1 through CDR3 or either of, or both of, the VH and the VL has 85% or greater identity with, but not 100% identity with, the VH CDR1 through CDR3 sequences, or VL CDR1 through CDR3 sequences, respectively, set forth as follows: (i) VH CDR1 through CDR3: CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44),CDR3: KRLTGRGYAMDY (SEQ ID NO:45), VL CDR1 through CDR3: CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48); or (ii) a) VH CDR1 through CDR3: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2: IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and VL CDR1 through CDR3: CDR1: QSLVHRNGNTY (SEQ ID NO:4), CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6); or b) VH CDR1 through CDR3: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8),CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and VL CDR1 through CDR3: CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) VH CDR1 through CDR3: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and VL CDR1 through CDR3: CDR1: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) VH CDR1 through CDR3: CDR1: GFTFNTYAMY (SEQ ID NO:37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO:38), CDR3:PYSDSFAY (SEQ ID NO:39), and VL CDR1 through CDR3: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO:40), CDR2: KVSNRFS (SEQ ID NO:41), CDR3: SQSTHVPFT (SEQ ID NO:42).

[0188] Amyloid-binding scFvs with CDRs substantially equivalent to those set forth in thepresent application are also disclosed. Within this embodiment, the term "substantially equivalent to" is understood to comprise amino acid sequences homologous to any of SEQ ID NOs: 1-6, or 7-12, or 13-18, or 37-42, or 43-48 or by sharing at least 70%, sequence identity based on a comparison of primary amino acid sequence. Such degrees of homology may be determined by standard sequence alignment programs such as Vector NTI (InforMax™, Maryland, USA). Such programs compare aligned sequences on an amino acid-by-amino acid basis, and can be set to various levels of stringency for the comparison (e.g. identical amino acid, conservative amino acid substitution, etc.). Within the meaning of this embodiment, two amino acids in question are considered as being "homologous" when they are either identical to one another or conservative substitutions of one another. By way of non-limiting example, two different amino acids belonging to the class of lipophilic amino acids would be considered homologous in the sense of this embodiment, even if these two amino acids were not identical, whereas a lipophilic amino acid on the one hand and a charged acidic amino acid on the other hand would not be considered homologous.

[0189] Single chain fragment variables (scFv) are known generally in the art. They are singlepolypeptides that contain a variable light chain (VL) and a variable heavy chain (VH) of an antibody. They are often ~25 kDa. The two chains are connected by a flexible linker peptide, often 15-20 amino acids long and usually made up of glycine and serine, optionally with dispersed hydrophilic residues for increased solubility. The linker generally keeps the C-terminus of one variable domain and the N-terminus of the other domain at a distance that favors proper folding and formation of the antigen-binding site while also minimizing oligomerization of thescFv. The variable domains order of an scFv can mirror that of an antibody (VL-linker-VH), or be VL-linker-VH or have a VH-linker-VL configuration.

[0190] In some embodiments, an scFv may comprise a linker peptide from 5 to 30 aminoacid residues long. In some embodiments, the scFv comprises a linker peptide comprising one or more of glycine, serine and threonine residues. (For example, see Bird et al., Science, 242: 423- 426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883 (1988) each of which are hereby incorporated by reference in their entirety.

[0191] In some embodiments, an scFv comprises framework regions of a light chain and / or aheavy chain which are human framework regions, or have 85% or more sequence identity thereto. In some embodiments, the framework regions of the light chain and / or the heavy chain are human framework regions.

[0192] In some embodiments, a CAR human amyloid light chain fibril-binding domain orscFv comprises a heavy chain of an antibody or a fragment thereof, preferably the VH of the antibody. In some embodiments, the antibody has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 51. In some embodiments, a CAR human amyloid light chain fibril-binding domain or scFv comprises a portion which has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to amino acids 20-140 of SEQ ID NO: 51.

[0193] In some embodiments, a CAR human amyloid light chain fibril-binding domain orscFv also comprises a light chain of an antibody or a fragment thereof, preferably the VL of the antibody. In some embodiments, the antibody has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 52. In some embodiments, a CAR human amyloid light chain fibril-binding domain or scFv comprises a portion which has at least 60%, at least 70%, at least 80%, at least 81%, at least82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to amino acids 21-127 of SEQ ID NO: 52.

[0194] Also provided is a human amyloid light chain fibril-binding domain or scFvcomprising SEQ ID NOS: 1-6, or 7-12, or 13-18, or 37-42, or 43-48.

[0195] In some embodiments, the CAR human amyloid light chain fibril-binding domain,scFv, or fragments thereof bind lambda light chain amyloid in preference to kappa light chain amyloid. In some embodiments, the antibody, scFv, or fragments thereof have a greater affinity for lambda light chain amyloid than affinity for kappa light chain amyloid.

[0196] In some embodiments, the CAR human amyloid light chain fibril-binding domain orscFv preferentially binds lambda light chain amyloid over kappa light chain amyloid.

[0197] In some embodiments, the CAR human amyloid light chain fibril-binding domain,scFv, or fragments thereof bind kappa light chain amyloid in preference to lambda light chain amyloid. In some embodiments, the antibody, scFv, or fragments thereof have a greater affinity for kappa light chain amyloid than affinity for lambda light chain amyloid.

[0198] In some embodiments, the CAR human amyloid light chain fibril-binding domain orscFv preferentially binds kappa light chain amyloid over lambda light chain amyloid.

[0199] In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M2marker upregulation. In some embodiments the CAR-phagocyte is a CAR-M having an M1 marker downregulation and / or an M2 marker upregulation. In some embodiments, the CAR- phagocyte is a CAR-macrophage having an M1 marker upregulation. In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M2 phenotype. In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M2 phenotype elicited by contacting the CAR- macrophage with one or more of M-CSF, TGF-beta, IL-10, IL-4, IL-3, or a glucocorticoid. In some embodiments, the CAR-macrophage does not have an M1 phenotype.

[0200] In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M1phenotype elicited by contacting the CAR-macrophage with one or more of GM-CSF, IFN- gamma, TNFalpha, or LPS. In some embodiments, the CAR-macrophage does not have an M2 phenotype.

[0201] In some embodiments, the CAR does not bind a human cancer cell-specific antigen.

[0202] In some embodiments, the CAR further comprises a hinge region, e.g. a CD8 hingeregion, between the human amyloid light chain fibril-binding domain and the transmembrane domain.

[0203] In some embodiments, the modified human phagocyte is a modified macrophage.

[0204] In some embodiments, the modified human phagocyte is a modified neutrophil.

[0205] In some embodiments, the modified phagocyte cell has been modified by geneticallymodifying a phagocyte to express the CAR, or is a progeny thereof.

[0206] In some embodiments, the modified phagocyte cell has been modified by geneticallymodifying a phagocyte to express the CAR. In some embodiments, the modified phagocyte cell is a first generation or later generation progeny of a phagocyte cell that has been modified by genetically modifying a phagocyte to express the CAR.

[0207] In some embodiments, the modified phagocyte cell has been modified by geneticallymodifying a stem cell, e.g. an HSC, to encode or express the CAR, followed by differentiation of the modified stem cell to generate the modified phagocyte cell.

[0208] A pharmaceutical composition comprising a modified human phagocyte comprising achimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain, and a pharmaceutically acceptable carrier.

[0209] In some embodiments, the composition comprises a plurality of phagocytes and atleast 50% of the phagocytes in the composition express a CAR. In some embodiments, the composition comprises a plurality of phagocytes and at least 33% of the cells in the composition express a CAR. In some embodiments, at least 25% of the cells in the composition express a CAR.

[0210] A method for treating light chain amyloidosis in a subject, comprising administeringto the subject a therapeutically effective amount of a pharmaceutical composition comprising an amount of modified human phagocytes comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0211] A method for reducing an amyloid fibril in a subject having light chain amyloidosis,comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising an amount of modified human phagocytes comprising a chimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0212] In some embodiments, the modified phagocytes have initially been obtained asphagocytes from the subject that is being treated prior to the phagocytes being modified to comprise the CAR. In some embodiments, the modified phagocytes have initially been obtained as phagocytes from another subject that is not the subject of the treatment, prior to the phagocytes being modified to comprise the CAR. In some embodiments, primary macrophages are transduced so as to produce the CAR-macrophages. In some embodiments, the modified phagocytes have been generated from hematopoietic stem cells from a peripheral blood mononuclear cells (PBMC)-containing sample from the subject that is being treated prior to the treatment. In some embodiments, the modified phagocytes have been generated from hematopoietic stem cells from a peripheral blood mononuclear cells (PBMC)-containing sample from a subject different than the subject that is being treated, prior to the treatment.

[0213] A method of generating a modified human hematopoietic stem cells comprising achimeric antigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular domain of a stimulatory and / or co-stimulatory molecule, the method comprising obtaining CD34+ and / or hematopoietic stem cells from a sample obtained from a human, and transducing the CD34+ and / or hematopoietic stem cells with a nucleic acid encoding the CAR or a vector comprising the nucleic acid encoding the CAR, optionally wherein the nucleic acid is a polynucleotide of any one of the polynucleotides described herein or wherein the vector is a vector of any one of the vectors described herein. In some embodiments, the method further comprises administering to a subject an agent that mobilizes peripheral blood mononuclear cells (PBMC) into the subject's peripheral blood and obtaining a or hematopoietic stem cells-containing sample thereof, or obtaining an adult bone marrow or umbilical cord blood sample comprising CD34+ cells.

[0214] In some embodiments, the CAR cells further comprise a suicide gene, e.g., in a non-liming example, HSV-TK. In some embodiments, the phagocytes, prior to modification byexpressing a CAR, are autologous to the subject. In some embodiments, the phagocytes, prior to modification by expressing a CAR, are allogenic to the subject.

[0215] In some embodiments, PBMC is obtained from the subject 1, 2, 3, 4, or 5 days afteradministration of an agent to the subject which elicits mobilization of PBMC. In some embodiments, the agent comprises G-CSF. In some embodiments, cells are obtained from the subject by apheresis. In some embodiments, cells are obtained from the subject to be treated. In some embodiments, cells are obtained from a different subject than the subject to be treated.

[0216] In some embodiments, transduction with a nucleic acid encoding the CAR is effectedusing a viral vector. In some embodiments, transduction with a nucleic acid encoding the CAR is effected using a lentiviral vector. In some embodiments, transduction with a nucleic acid encoding the CAR is effected using a gamma-retroviral vector. Viral vectors for transducing CAR into cells are known in the art, for example see Irving et al., Human Gene Therapy. Oct 2021.1044-1058 on the world wide web at doi.org / 10.1089 / hum.2021.173, and hereby incorporated by reference in its entirety.

[0217] In some embodiments, the hematopoietic stem cells transduced with a nucleic acidencoding the CAR are expanded subsequent to transduction.

[0218] In some embodiments, the hematopoietic stem cells transduced with a nucleic acidencoding the CAR are maintained in a differentiating medium under conditions to effect differentiation into a CAR-phagocyte or a CAR-antigen presenting cell.

[0219] In some embodiments, the hematopoietic stem cells transduced with a nucleic acidencoding the CAR are maintained in a differentiating medium under conditions to effect differentiation into a CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell.

[0220] In some embodiments, the hematopoietic stem cells are obtained from the PBMC-containing sample via selection for CD34 expression. In some embodiments, the modified macrophages can be purified or selected via cell surface marker expression. In some embodiments, selection can be effected via one or more of CD45, CD33, CD14, CD64, and CD172a expression.

[0221] In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M2marker upregulation. In some embodiments the CAR-phagocyte is a CAR-M having an M1 marker downregulation and / or an M2 marker upregulation. In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M1 marker upregulation. In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M2 phenotype. In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M2 phenotype elicited by contacting the CAR- macrophage with one or more of M-CSF, TGF-beta, IL-10, IL-4, IL-3, or a glucocorticoid. In some embodiments, the CAR-phagocyte is a CAR-macrophage having an M1 phenotype elicited by contacting the CAR-macrophage with one or more of GM-CSF, IFN-gamma, TNFalpha, or LPS. In some embodiments, the CAR-macrophage does not have an M2 phenotype. In some embodiments, the methods further comprise contacting CAR-macrophages with one or more of M-CSF, TGF-beta, IL-10, IL-4, IL-3, or a glucocorticoid to elicit an M2 phenotype prior to administration of the CAR-macrophages to a subject. In other embodiments, the methods further comprise contacting CAR-macrophages with one or more of GM-CSF, IFN-gamma, TNFalpha, or LPS to elicit an M1 phenotype prior to administration of the CAR-macrophages to a subject.

[0222] A CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell isprovided as generated by a method described herein. In some embodiments, the CAR comprises a human amyloid lambda light chain fibril-binding domain. In some embodiments, the CAR comprises a human amyloid kappa light chain fibril-binding domain.

[0223] In some embodiments, the antigen binding domain of the CAR comprises a single-chain variable fragment (scFv), an antibody, or an antigen-binding fragment of an antibody.

[0224] In some embodiments, the transmembrane domain of the CAR comprises a CD8 orCD28 transmembrane domain.

[0225] In some embodiments, the intracellular domain of the CAR comprises an FcRγsignaling domain.

[0226] In some embodiments, the modified human phagocyte exhibits phagocytosis ofhuman AL amyloid fibrils when bound thereto.

[0227] In some embodiments, the human amyloid light chain fibril-binding domaincomprises a VH comprising the following: a VH comprising the following: CDR1: GFSLTSYG (SEQ ID NO:1) CDR2:IWGDGST (SEQ ID NO:2) CDR3: VTLDY (SEQ ID NO:3) and / or a VL comprising the following: CDR1: QSLVHRNGNTY (SEQ ID NO:4) CDR2: KVS (SEQ ID NO:5) CDR3: FQTTYVPNT (SEQ ID NO:6); or a VH comprising the following: CDR1: GFTFSSYG (SEQ ID NO:7) CDR2: ISGGISYT (SEQ ID NO:8) CDR3: ARHRYGDYYAMDY (SEQ ID NO:9). and / or a VL comprising the following: CDR1: SQHSTYT (SEQ ID NO:10) CDR2: LKKDGSH (SEQ ID NO:11) CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or a VH comprising the following: CDR1: GYSFTGYT (SEQ ID NO:13)CDR2: IIPYNGGT (SEQ ID NO:14) CDR3: ARRGNYDPFAY (SEQ ID NO:15) and / or a VL comprising the following: CDR1: ENIYSY (SEQ ID NO:16) CDR2: NAK (SEQ ID NO:17) CDR3: QHHYVTPWT (SEQ ID NO:18); or a VH comprising the following: CDR1: GFTFNTYAMY (SEQ ID NO:37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO:38), CDR3: PYSDSFAY (SEQ ID NO:39), and / or a VL comprising the following: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO:40), CDR2: KVSNRFS (SEQ ID NO:41), CDR3: SQSTHVPFT (SEQ ID NO:42); or a VH comprising the following: CDR1: GYTMN (SEQ ID NO: 43), CDR2:LINPYNGGTNYNQKFKG (SEQ ID NO: 44), CDR3: KRLTGRGYAMDY (SEQ ID NO: 45), and / or a VL comprising the following: CDR1: RASQSISDYLH (SEQ ID NO: 46), CDR2: YASQSIS (SEQ ID NO: 47), CDR3: QNGHSFPPT (SEQ ID NO: 48).

[0228] In some embodiments, the constructs described herein can be producedrecombinantly, for example a CAR expressed using a recombinant expression vector transfected into a host cell.

[0229] In some embodiments, the CAR of the CAR-phagocyte comprises an antigen bindingdomain or scFv which binds to a human amyloid light chain fibril with an affinity of 100.0 nM KD or stronger. In some embodiments, the CAR comprises an antigen binding domain or scFv which binds to a human amyloid light chain fibril with an affinity of 10.0 nM KDor stronger. In some embodiments, the CAR comprises an antigen binding domain or scFv which binds to a human amyloid light chain fibril with an affinity of 2.0 nM KD or stronger. In some embodiments, the CAR comprises an antigen binding domain or scFv which binds to a human amyloid light chain fibril with an affinity of 1.0 nM KDor stronger.

[0230] In some embodiments, a CAR-macrophage is provided.

[0231] In some embodiments, the antigen binding domain of the CAR comprises an scFv.

[0232] In some embodiments, the intracellular domain of the CAR comprises a FcRγsignaling domain. In some embodiments, the transmembrane domain of the CAR comprises a CD8 transmembrane domain.

[0233] A method of eliciting an immune response against amyloid light chain fibrils in asubject comprising administering to the subject a CAR-antigen presenting cell wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular domain of a stimulatory and / or co-stimulatory molecule, effective to elicit an immune response.

[0234] In some embodiments, the response is an adaptive immune response.

[0235] In some embodiments, the CAR-antigen presenting cell is made by a methoddescribed herein.

[0236] In further embodiments, the CAR-HSC are switchable or inducible, e.g., using a teton / off system.

[0237] In some embodiments of the methods, the subject is a human.

[0238] In some embodiments the adult subject is over 50 years of age. In some embodimentsthe adult subject is over 60 years of age.

[0239] Also provided is a nucleic acid encoding a CAR as described herein. In someembodiments, the nucleic acid is a cDNA.

[0240] Also provided is a polynucleotide encoding a chimeric antigen receptor (CAR), theCAR comprising a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

[0241] In some embodiments, the CAR comprises a human amyloid lambda light chainfibril-binding domain or a human amyloid kappa light chain fibril-binding domain.

[0242] In some embodiments, the antigen binding domain of the CAR comprises a single-chain variable fragment (scFv), an antibody, or an antigen-binding fragment of an antibody.

[0243] In some embodiments, the antibody is selected from the group consisting of amonoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, and a single domain antibody.

[0244] In some embodiments, the transmembrane domain of the CAR comprises a CD8transmembrane domain or CD28 transmembrane domain, and / or wherein the intracellular domain of the CAR comprises a γ (gamma) subunit of an immunoglobulin Fc receptor (FcRγ) signaling domain, and / or wherein the intracellular domain of the CAR comprises a CD3zeta (CD3ζ) subunit.

[0245] In some embodiments, the human amyloid light chain fibril-binding domaincomprises: a) a VH comprising the following: CDR1: GYTMN (SEQ ID NO:43)CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44) CDR3: KRLTGRGYAMDY (SEQ ID NO:45) and / or a VL comprising the following: CDR1: RASQSISDYLH (SEQ ID NO:46) CDR2: YASQSIS (SEQ ID NO:47) CDR3: QNGHSFPPT (SEQ ID NO:48); or b) a VH comprising the following: CDR1: GFSLTSYG (SEQ ID NO:1) CDR2: IWGDGST (SEQ ID NO:2) CDR3: VTLDY (SEQ ID NO:3) and / or a VL comprising the following: CDR1: QSLVHRNGNTY (SEQ ID NO:4) CDR2: KVS (SEQ ID NO:5) CDR3: FQTTYVPNT (SEQ ID NO:6); or c) a VH comprising the following: CDR1:GFTFSSYG (SEQ ID NO:7) CDR2: ISGGISYT (SEQ ID NO:8) CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and / or a VL comprising the following: CDR1: SQHSTYT (SEQ ID NO:10) CDR2: LKKDGSH (SEQ ID NO:11) CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or d) a VH comprising the following: CDR1: GYSFTGYT (SEQ ID NO:13) CDR2: IIPYNGGT (SEQ ID NO:14) CDR3: ARRGNYDPFAY (SEQ ID NO:15), and / or a VL comprising the following: CDR1: ENIYSY (SEQ ID NO:16) CDR2: NAK (SEQ ID NO:17) CDR3: QHHYVTPWT (SEQ ID NO:18); or e) a VH comprising the following: CDR1: GFTFNTYAMY (SEQ ID NO:37),CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO:38), CDR3: PYSDSFAY (SEQ ID NO:39), and / or a VL comprising the following: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO:40), CDR2: KVSNRFS (SEQ ID NO:41), CDR3: SQSTHVPFT (SEQ ID NO:42).

[0246] In some embodiments, the CAR further comprises a CD8 hinge region between thehuman amyloid light chain fibril-binding domain and the transmembrane domain.

[0247] In some embodiments, the human amyloid light chain fibril-binding domain isencoded by a nucleic acid sequence having a portion which is at least 60%, at least 70%, least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 63 and / or 64, SEQ ID NOs: 19 and / or 20, or SEQ ID NOs: 21 and / or 22, or SEQ ID NOs: 23 and / or 24.

[0248] Also provided is a vector comprising any one of the polynucleotides described above.

[0249] In some embodiments, the vector is a lentiviral vector.

[0250] In some embodiments, the vector is an RNA vector.

[0251] In some embodiments, the vector comprises an inducible promoter operably linked tothe polynucleotide sequence encoding the CAR.

[0252] Also provided is a pharmaceutical composition comprising any one of thepolynucleotides described above or the vector of any one of the vectors described above, and a pharmaceutically acceptable carrier.

[0253] Also provided is a method for treating light chain amyloidosis in a subject or reducingan amyloid fibril deposit in a subject having light chain amyloidosis, the method comprising: administering to the subject an effective amount of any one of the polynucleotides describedabove, a genetically modified cell modified by any one of the polynucleotides or vectors described above, a cell comprising any one of the polynucleotides or vectors described above, or any one of the vectors described above.

[0254] Also provided is a cell comprising or genetically modified by any one of thepolynucleotides or vectors described above.

[0255] In some embodiments, a nucleic acid herein comprises a cDNA. In someembodiments, a nucleic acid herein comprises a DNA. In some embodiments, a nucleic acid herein comprises an RNA. In some embodiments, a nucleic acid herein comprises an mRNA.

[0256] As used herein, "Specific" binding denotes the ability to discriminate betweendifferent antigens as potential binding partners to such an extent that, from a pool of a plurality of different antigens as potential binding partners, only an antigen of interest is bound, or only an antigen of interest is significantly bound. Within the meaning of the invention, an antigen is "significantly" bound when, from among a pool of equally accessible different antigens as potential binding partners, the antigen of interest is bound at least 10-fold, preferably 50-fold, most preferably 100-fold or greater more frequently (in a kinetic sense) than other antigens which are not the antigen of interest.

[0257] The term "KD", as used herein, is intended to refer to the dissociation constant of anantibody-antigen interaction. One way of determining the KD or binding affinity of a polypeptide (e.g., an antibody) to an amyloid fibril can be by measuring binding affinity by, for example, by surface plasmon resonance (BIAcore3000TM surface plasmon resonance (SPR) system, BIAcore Inc., Piscataway N.J.). CM5 chips can be activated with N-ethyl-N'-(3-dimethylaminopropyl)- carbodiinide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the supplier's instructions.

[0258] In some embodiments, the polypeptide which binds to a human amyloid light chainfibril binds with an affinity of 100.0 nM KD or stronger.

[0259] In some embodiments, the polypeptide which binds to a human amyloid light chainfibril binds with an affinity of 10.0 nM KDor stronger.

[0260] In some embodiments, the polypeptide which binds to a human amyloid light chainfibril binds with an affinity of 2.0 nM KD or stronger.

[0261] In some embodiments, the polypeptide which binds to a human amyloid light chainfibril binds with an affinity of 1.0 nM KDor stronger.

[0262] In some embodiments, the scFv, antibody, or fragment thereof which binds to ahuman amyloid light chain fibril binds with an affinity of 100.0 nM KD or stronger.

[0263] In some embodiments, the scFv, antibody, or fragment thereof which binds to ahuman amyloid light chain fibril binds with an affinity of 10.0 nM KDor stronger.

[0264] In some embodiments, the scFv, antibody, or fragment thereof which binds to ahuman amyloid light chain fibril binds with an affinity of 2.0 nM KD or stronger.

[0265] In some embodiments, the scFv, antibody, or fragment thereof which binds to ahuman amyloid light chain fibril binds with an affinity of 1.0 nM KD or stronger.

[0266] In some embodiments, the human amyloid light chain fibril is, or is primarily,lambda.

[0267] In some embodiments, a polypeptide as described herein (e.g., a polypeptidecomprising an antigen binding domain, a construct, a scFv, or an antibody, including a bispecific antibody, CAR, or fragment thereof) comprises a human amyloid lambda light chain fibril- binding domain. In some embodiments, the polypeptide binds a human WIL protein. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to SEQ ID NO: 59. In some embodiments, the polypeptide binds a lambda-6 type immunoglobulin light chain. In some embodiments, the polypeptide binds a variable domain of a lambda-6 type immunoglobulin light chain. In some embodiments, the polypeptide binds a constant domain of a lambda-6 type immunoglobulin light chain. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to amino acids 1-110 of SEQ ID NO: 59, or a portion thereof. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to amino acids 111-216 of SEQ ID NO: 59, or a portion thereof. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to NCBI PDB Accession No.2CD0_B (SEQ ID NO: 60).

[0268] In some embodiments, the polypeptide comprises a human amyloid kappa light chainfibril-binding domain. In some embodiments, the polypeptide binds a human LEN protein. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to SEQ ID NO: 61. In some embodiments, the polypeptide binds a kappa-4 type immunoglobulin light chain. In some embodiments, the polypeptide binds a variable domain of a kappa-4 type immunoglobulin light chain. In some embodiments, the polypeptide binds a constant domain of a kappa-4 type immunoglobulin light chain. In some embodiments, the polypeptide binds a peptidehaving at least 90% sequence identity to amino acids 1-114 of SEQ ID NO: 61, or a portion thereof. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to amino acids 115-220 of SEQ ID NO: 61, or a portion thereof. In some embodiments, the polypeptide binds a peptide having at least 90% sequence identity to NCBI PDB Accession No.5LVE_A (SEQ ID NO: 62).

[0269] In some embodiments, a polypeptide comprising an antigen binding domain, aconstruct, a scFv, or an antibody, including a bispecific antibody, a chimeric antigen receptor (CAR), or fragment thereof comprises the CDRs of the 1F10 antibody described herein.

[0270] An epitope that "specifically binds" to an antibody or a polypeptide is a term wellunderstood in the art, and methods to determine such specific or preferential binding are also well known in the art. A molecular entity is said to exhibit "specific binding" or "preferential binding" if it reacts or associates more frequently, more rapidly, with greater duration and / or with greater affinity with a particular cell or substance than it does with alternative cells or substances. An antibody “specifically binds" or "preferentially binds" to an amyloid fibril / deposit, for example, if it binds with greater affinity, avidity, more readily, and / or with greater duration than it binds to other substances. For example, an antibody that specifically or preferentially binds to a given sequence or conformational epitope in an amyloid fibril is an antibody that binds this epitope with greater affinity, avidity, more readily, and / or with greater duration than it binds to other epitopes. In some embodiments the constructs herein preferentially bind an amyloid fibril. It is also understood by reading this definition that, for example, an antibody (or moiety or epitope) that specifically or preferentially binds to a first target may or may not specifically or preferentially bind to a second target. As such, "specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0271] Depending on the amino acid sequences of the constant domains of their heavychains, antibodies (immunoglobulins) can be assigned to different classes. The bispecific antibody if comprising an Fc can be e.g., any of an IgG, IgD, IgE, IgA or IgM. In some embodiments, the Fc may comprise one or more mutations relative to the wild-type sequence of the Fc in order to increase antibody-dependent cellular cytotoxicity (ADCC) and / or antibody- dependent cellular phagocytosis (ADCP). As a non-limiting example, the Fc may contain any one of the following mutations: S298A, E333A, K334A, S239D, I332E, P247I, A339Q, F234L,R292P, Y300L, V305I, P396L, A330L, and G236A. In some embodiments, the Fc region comprises G236A, S239D, and I332E mutations.

[0272] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domains of the heavy or light chain of the antibody. The variable domain of the heavy chain may be referred to as "VH." The variable domain of the light chain may be referred to as "VL." These domains are generally the most variable parts of an antibody and contain the antigen-binding sites. The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called hypervariable regions (HVRs) (or CDRs) both in the light-chain and the heavy- chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FR). The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a beta-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, Md. (1991)). The constant domains are not involved directly in the binding of an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.

[0273] The "light chains" of antibodies (immunoglobulins) from any vertebrate species canbe assigned to one of two clearly distinct types, called kappa (^) and lambda (^), based on the amino acid sequences of their constant domains.

[0274] "Framework" or "FR" residues are those variable domain residues other than theHVR residues as herein defined.

[0275] In some embodiments, the antigen binding domains, scFvs, or antibodies, includingbispecific antibodies, or CAR molecules described herein comprise a human framework region. In some embodiments, the framework region can comprise, in non-limiting examples, (i) a VH framework comprising the framework sequence of human germline IGHV1-2∗02, IGHV1-2∗04, IGHV1-2∗05, IGHV1-18∗04, IGHV1-69-2∗01, IGHV1-46∗01, IGHD5-12*01, IGHD5-24*01,IGHD6-25*01, IGHJ3*01, IGHJ4*01, IGHJ4*03, IGHJ6∗01, IGHJ6∗02 and / or (ii) a VL framework comprising the framework sequence of human germline IGKV1-13*02, IGKV1- 27*01, IGKV3-7*02, IGKV4-1*01, IGKV1D-13*02, IGKV3D-7*01, IGKJ1*01, IGKJ2*01, IGKJ4*01, IGKJ4*02. In some embodiments, the antigen binding domains, scFvs, or antibodies, including bispecific antibodies, comprise an optimized version of, having less than 100% sequence identity with, a (i) a VH framework comprising the framework sequence of human germline IGHV1-2∗02, IGHV1-2∗04, IGHV1-2∗05, IGHV1-18∗04, IGHV1-69-2∗01, IGHV1- 46∗01, IGHD5-12*01, IGHD5-24*01, IGHD6-25*01, IGHJ3*01, IGHJ4*01, IGHJ4*03, IGHJ6∗01, IGHJ6∗02 and / or (ii) a VL framework comprising the framework sequence of human germline IGKV1-13*02, IGKV1-27*01, IGKV3-7*02, IGKV4-1*01, IGKV1D-13*02, IGKV3D-7*01, IGKJ1*01, IGKJ2*01, IGKJ4*01, IGKJ4*02.

[0276] In some embodiments of a bispecific antibody or a CAR molecule comprising scFvs,the scFv may comprise a linker peptide from 5 to 30 amino acid residues long. In some embodiments, the scFv comprises a linker peptide comprising one or more of glycine, serine and threonine residues. (For example, see Bird et al., Science, 242: 423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA, 85:5879-5883 (1988) each of which are hereby incorporated by reference in their entirety.

[0277] The term "complementarity-determining region" or "CDR" when used herein refers tothe regions of an antibody variable domain which are hypervariable in sequence and / or form structurally defined loops. Generally, antibodies comprise six CDRs; three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). CDRS 1-3 of the VH or VL as referred to herein may alternatively be named with the H# or L# designation. In native antibodies, H3 and L3 display the most diversity of the six HVRs, and H3 in particular is believed to play a unique role in conferring fine specificity to antibodies. See, e.g., Xu et al., Immunity 13:37-45 (2000); Johnson and Wu, in Methods in Molecular Biology 248:1-25 (Lo, ed., Human Press, Totowa, N.J., 2003). Indeed, naturally occurring camelid antibodies consisting of a heavy chain only are functional and stable in the absence of light chain. See, e.g., Hamers-Casterman et al., Nature 363:446-448 (1993); Sheriff et al., Nature Struct. Biol.3:733-736 (1996). A number of HVR delineations are in use and are encompassed herein. The Kabat Complementarity Determining Regions (CDRs) are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health,Bethesda, Md. (1991) hereby incorporated by reference in its entirety). There are CDRs 1, 2, and 3 for each of the heavy and light chains. Chothia refers instead to the location of the structural loops (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)). The AbM HVRs represent a compromise between the Kabat HVRs and Chothia structural loops and are used by Oxford Molecular's AbM antibody modeling software. The "contact" HVRs are based on an analysis of the available complex crystal structures. HVRs may comprise "extended HVRs" as follows: 24- 36 or 24-34 (L1), 46-56 or 50-56 (L2) and 89-97 or 89-96 (L3) in the VL and 26-35 (H1), 50-65 or 49-65 (H2) and 93-102, 94-102, or 95-102 (H3) in the VH. The variable domain residues are numbered according to Kabat et al., supra, for each of these definitions.

[0278] In some embodiments, the variable regions disclosed herein are not modified. In someembodiments, the invention encompasses modifications to the variable regions disclosed herein. For example, the invention includes antibodies comprising functionally equivalent variable regions and CDRs which do not significantly affect their properties as well as variants which have enhanced or decreased activity and / or affinity. For example, the amino acid sequence may be mutated to obtain an antibody with the desired binding affinity to human amyloid fibril deposits. Examples of modified polypeptides include polypeptides with conservative substitutions of amino acid residues, one or more deletions or additions of amino acids which do not significantly deleteriously change the functional activity, or which mature (enhance) the affinity of the polypeptide for its ligand or use of chemical analogs.

[0279] Amino acid sequence insertions include amino- and / or carboxyl-terminal fusionsranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Examples of terminal insertions include an antibody with an N-terminal methionyl residue or the antibody fused to an epitope tag. Other insertional variants of the antibody molecule include the fusion to the N- or C- terminus of the antibody of an enzyme or a polypeptide which increases the half-life of the antibody in the blood circulation. Substitution variants have at least one amino acid residue in the antibody molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include the hypervariable regions, but framework alterations are also contemplated. Conservative substitutions are shown in Table 1 under the heading of "conservative substitutions." If such substitutions result in a change in biological activity, then more substantial changes, denominated "exemplary substitutions" in Table 1, or asfurther described below in reference to amino acid classes, may be introduced and the products screened.

[0280] Table 1: Amino Acid SubstitutionsOriginal Residue Conservative Substitutions Exemplary Substitutions Al A V l V l L Il e; t; a;

[0281] Substantial modifications in the biological properties of an antibody are accomplishedby selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a ^-sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side- chain properties: (1) Non-polar: Norleucine, Met, Ala, Val, Leu, Ile; (2) Polar without charge: Cys, Ser, Thr, Asn, Gln; (3) Acidic (negatively charged): Asp, Glu; (4) Basic (positively charged): Lys, Arg; (5) Residues that influence chain orientation: Gly, Pro; and (6) Aromatic: Trp, Tyr, Phe, His.

[0282] Non-conservative substitutions are made by exchanging a member of one of theseclasses for another class.

[0283] One type of substitution, for example, that may be made is to change one or morecysteines in the antibody, which may be chemically reactive, to another residue, such as, without limitation, alanine or serine. For example, there can be a substitution of a non-canonical cysteine. The substitution can be made in a CDR or framework region of a variable domain or in the constant region of an antibody. In some embodiments, the cysteine is canonical. Any cysteine residue not involved in maintaining the proper conformation of the antibody also may be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant cross-linking. Conversely, cysteine bond(s) may be added to the antibody to improve its stability.

[0284] A modification or mutation may also be made in a framework region, or constantregion if present, to increase the half-life of an antibody. See, e.g., PCT Publication No. WO 00 / 09560. A mutation in a framework region or constant region can also be made to alter the immunogenicity of the antibody, to provide a site for covalent or non-covalent binding to another molecule, or to alter such properties as complement fixation, FcR binding and antibody- dependent cell-mediated cytotoxicity. According to the invention, a single antibody may have mutations in any one or more of the CDRs or framework regions of the variable domain or in the constant region. According to the invention, a single scFv derived from variable regions of anantibody may have mutations in any one or more of the CDRs or framework regions of the variable domain or in the constant region.

[0285] In some embodiments, an antibody described herein is recombinantly produced. Insome embodiments, the fusion protein is produced in a eukaryotic expression system.

[0286] In some embodiments, the polypeptides (e.g., antibodies, including bispecificantibodies) disclosed herein are lyophilized and / or freeze dried and are reconstituted for use. Compositions or pharmaceutical compositions comprising the bispecific constructs and antibodies disclosed herein can comprise stabilizers to prevent loss of activity or structural integrity of the protein due to the effects of denaturation, oxidation or aggregation over a period of time during storage and transportation prior to use. The compositions or pharmaceutical compositions can comprise one or more of any combination of salts, surfactants, pH and tonicity agents such as sugars can contribute to overcoming aggregation problems. Where a composition or pharmaceutical composition of the present invention is used as an injection or infusion, it is desirable to have a pH value in an approximately neutral pH range, it is also advantageous to minimize surfactant levels to avoid bubbles in the formulation which are detrimental for injection into subjects. In some embodiments, the composition or pharmaceutical composition is in liquid form and stably supports high concentrations of bioactive antibody in solution and is suitable for inhalational or parenteral administration. In some embodiments, the composition or pharmaceutical composition is suitable for intravenous, intramuscular, intraperitoneal, intradermal and / or subcutaneous injection. In some embodiments, the composition or pharmaceutical composition is in liquid form and has minimized risk of bubble formation and anaphylactoid side effects. In some embodiments, the composition or pharmaceutical composition is isotonic. In some embodiments, the composition or pharmaceutical composition has a pH or 6.8 to 7.4.

[0287] Examples of pharmaceutically acceptable carriers include, but are not limited to,phosphate buffered saline solution, sterile water (including water for injection USP), emulsions such as oil / water emulsion, and various types of wetting agents. Preferred diluents for aerosol or parenteral administration are phosphate buffered saline or normal (0.9%) saline, for example 0.9% sodium chloride solution, USP. Compositions comprising such carriers are formulated by well-known conventional methods (see, for example, Remington's Pharmaceutical Sciences, 18th edition, A. Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990; and Remington, The Scienceand Practice of Pharmacy 20th Ed. Mack Publishing, 2000, the content of each of which is hereby incorporated in its entirety). In non-limiting examples, the can comprise one or more of dibasic sodium phosphate, potassium chloride, monobasic potassium phosphate, polysorbate 80 (e.g. 2-[2-[3,5-bis(2-hydroxyethoxy)oxolan-2-yl]-2-(2-hydroxyethoxy)ethoxy]ethyl (E)-octadec- 9-enoate), disodium edetate dehydrate, sucrose, monobasic sodium phosphate monohydrate, and dibasic sodium phosphate dihydrate.

[0288] The antibodies, or fragments of antibodies, or compositions, or pharmaceuticalcompositions described herein can also be lyophilized or provided in any suitable forms including, but not limited to, infusible solutions, injectable solutions or inhalable solutions, gel forms and tablet forms.

[0289] In some embodiments, the composition or pharmaceutical composition comprisingthe bispecific constructs or antibodies described herein is substantially pure with regard to the antibody, or antigen-binding fragment thereof. A composition or pharmaceutical composition comprising the antibody, or antigen-binding fragment thereof, described herein is "substantially pure" with regard to the antibody or fragment when at least 60% to 75% of a sample of the composition or pharmaceutical composition exhibits a single species of the antibody, or antigen- binding fragment thereof. A substantially pure composition or pharmaceutical composition comprising the antibody, or antigen-binding fragment thereof, described herein can comprise, in the portion thereof which is the antibody, or antigen-binding fragment, 60%, 70%, 80% or 90% of the antibody, or antigen-binding fragment, of the single species, more usually about 95%, and preferably over 99%. Purity or homogeneity may be tested by a number of means well known in the art, such as polyacrylamide gel electrophoresis or HPLC.

[0290] Administration can be intravascular. Administration can be via infusion or injection.Administration can also be direct to an affected organ, e.g., one where amyloid deposits have been identified. Administration can also be auricular, buccal, conjunctival, cutaneous, subcutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, via hemodialysis, interstitial, intrabdominal, intraamniotic, intra-arterial, intra-articular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebral, intracisternal, intracorneal, intracoronary, intradermal, intradiscal, intraductal, intraepidermal, intraesophagus, intragastric, intravaginal, intragingival, intraileal, intraluminal, intralesional, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular,intraovarian, intraepicardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intraorgan, intratympanic, intrauterine, intravascular, intravenous, intraventricular, intravesical, intravitreal, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, rectal, inhalationally, retrobulbar, subarachnoid, subconjuctival, sublingual, submucosal, topically, transdermal, transmucosal, transplacental, transtracheal, ureteral, uretheral, and vaginal.

[0291] In some embodiments, the antibody, fragment, or fusion protein (e.g., a scFv) isadministered at a dose of 0.5mg / kg to 100 mg / kg. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 101 mg / kg to 250 mg / kg. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 251 mg / kg to 500 mg / kg. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 501 mg / kg to 1000 mg / kg. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 1001 mg / kg to 2000 mg / kg. In some embodiments, the antibody, fragment or fusion protein is administered at a dose of up to 25 mg twice per daily, daily, every other day, weekly, monthly or every three months. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 25 to 100 mg twice per daily, daily, every other day, weekly, monthly or every three months. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 100 to 250 mg twice per daily, daily, every other day, weekly, monthly or every three months. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 250 to 500 mg twice per daily, daily, every other day, weekly, monthly or every three months. In some embodiments, the antibody, fragment, or fusion protein is administered at a dose of 500 to 1000 mg twice per daily, daily, every other day, weekly, monthly or every three months. In some embodiments, the antibody, fragment or fusion protein is administered at a dose of 1000 to 2000 mg twice per daily, daily, every other day, weekly, monthly or every three months.

[0292] Another aspect of the invention provides a method for the prevention, treatment oramelioration of an AL amyloidosis or amyloid disease. According to this aspect, the composition as disclosed hereinabove is administered to a subject in need of such a prevention, treatment or amelioration. In some embodiments, the subject is treated for an AL amyloidosis associateddysfunction of a heart, liver or kidney. In some embodiments, the subject is treated to reduce the extent of an AL amyloidosis associated deposit in a heart, liver or kidney.

[0293] A further aspect of the invention provides a use of the compositions as disclosedherein above for the production of a medicament for the prevention, treatment or amelioration of an AL amyloidosis or amyloid disease.

[0294] In a preferred embodiment, the prevention, treatment, or amelioration occurs in ahuman.

[0295] In some embodiments, any of the antigen binding molecules described herein,including but not limited to monospecific antibodies, bispecific antibodies, scFv molecules, CAR molecules, or fragments thereof, may be encoded by a polynucleotide molecule. Conventional viral and non-viral based gene transfer methods can be used to introduce polynucleotide molecules to target cells or tissues. In some embodiments, polynucleotide molecules are administered in vivo or ex vivo. Non-viral vector delivery systems include naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome, lipid nanoparticle, or poloxamer.

[0296] In some embodiments, a viral system may be used to deliver a polynucleotidemolecule to a target a cell or tissue. The use of RNA or DNA viral-based systems for viral- mediated delivery of polynucleotide molecules takes advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to those cells. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues.

[0297] Vectors suitable for introduction of transgenes into immune cells include non-integrating lentivirus vectors. See, e.g., U.S. Patent Application Publication No. 2009 / 0117617. A polynucleotide molecule may be delivered to a target cell using a non-integrating lentiviral particle method. Such a method may be used to deliver RNAs into the target cell, such that delivery of the RNAs to the target cell results in assembly of the compositions described herein inside of the target cell.

[0298] Viral vectors can be administered directly to a patient or they can be used to treatcells and the modified cells are administered to patients. Conventional viral-based systems for the delivery of polynucleotide molecules include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors. An RNA virus may beutilized for delivery of polynucleotide molecules. Also, a polynucleotide molecule may be delivered to a cell by non-integrating lentivirus.

[0299] Vectors may be delivered in vivo by administration to an individual patient, forexample by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application. Specifically, vectors (e.g., retroviruses, liposomes, lipid nanoparticles, etc.) containing therapeutic nucleic acid compositions can be administered directly to an organism for transduction of cells in vivo. Administration may be by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application (e.g., eye drops and cream) and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and more than one route can be used to administer a particular composition.

[0300] Alternatively, vectors may be delivered to cells ex vivo, such as to cells explantedfrom an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, optionally after selection for cells which have incorporated the vector. A non-limiting exemplary ex vivo approach may involve removal of tissue (e.g., peripheral blood, bone marrow, and spleen) from a patient for culture, nucleic acid transfer to the cultured cells (e.g., hematopoietic stem cells), followed by grafting the cells to a target tissue (e.g., bone marrow, and spleen) of the patient. Ex vivo cell transfection for diagnostics, research, or for gene therapy (e.g., via re- infusion of the transfected cells into the host organism) is well known to those of skill in the art. In some embodiments, cells are isolated from the subject organism, transfected with a nucleic acid composition, and re-infused back into the subject organism (e.g., patient).

[0301] The terms used in this specification generally have their ordinary meanings in the art,within the context of this invention and the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the methods of the invention and how to use them. Moreover, it will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonymsdoes not exclude the use of the other synonyms. The use of examples anywhere in the specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the invention or any exemplified term. Likewise, the invention is not limited to its preferred embodiments.

[0302] The term “subject” as used in this application means a mammal. Mammals includecanines, felines, rodents, bovine, equines, porcines, ovines, and primates including humans. Thus, the invention can be used in human medicine or also in veterinary medicine, e.g., to treat companion animals, farm animals, laboratory animals in zoological parks, and animals in the wild. The invention is particularly desirable for human medical applications. In a preferred embodiment the subject is a human.

[0303] The term “patient” as used in this application means a human subject. In someembodiments of the present invention, the “patient” is one suffering with AL amyloidosis.

[0304] The terms “treat”, “treatment” of a disease, and the like refer to slowing down,relieving, ameliorating or alleviating at least one of the symptoms of the disease, or reversing the disease after its onset.

[0305] The terms “prevent”, “prevention”, and the like refer to acting prior to overt diseaseor disorder onset, to prevent the disease or disorder from developing or minimize the extent of the disease or disorder or slow its course of development.

[0306] The term “in need thereof” with regard to a subject would be a subject known orsuspected of having or being at risk of developing AL amyloidosis.

[0307] A subject in need of treatment would be one that has already developed ALamyloidosis.

[0308] The terms “therapeutically effective amount” or "amount effective to" encompassesan amount sufficient to ameliorate or prevent a symptom or sign of the medical condition. Effective amount also means an amount sufficient to allow or facilitate diagnosis. An effective amount for a particular subject may vary depending on factors such as the condition being treated, the overall health of the patient, the method route and dose of administration and the severity of side effects. An effective amount can be the maximal dose or dosing protocol that avoids significant side effects or toxic effects.

[0309] The term “about” or “approximately” means within an acceptable error range for theparticular value as determined by one of ordinary skill in the art, which will depend in part onhow the value is measured or determined, i.e., the limitations of the measurement system, i.e., the degree of precision required for a particular purpose, such as a pharmaceutical formulation. For example, “about” can mean within 1 or more than 1 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0310] “And / or” as used herein, for example, with option A and / or option B, encompassesthe separate embodiments of (i) option A, (ii) option B, and (iii) option A plus option B.

[0311] All combinations of the various elements described herein are within the scope of theinvention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0312] Notably, each year in the United States approximately 4,500 individuals arediagnosed with AL Amyloidosis, the most common form of amyloidosis that presents in people between the ages of 50-80. The global treatment market size for amyloidosis is expected to reach $6.7 billion USD by 2025 with a CAGR of 7.2%. The current standard of care for treating AL Amyloidosis is chemotherapy which aims to deplete pathogenic plasma cells, but unfortunately patients have a high rate of relapse, and in any event this treatment does not remove any preexisting fibril deposits that drive organ dysfunction.

[0313] The compositions and methods provided herein will efficiently target and removeplaques, with the potential to reverse or cure a historically fatal disease, in addition to having diagnostic uses.

[0314] This invention will be better understood from the Experimental Details, which follow.However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims that follow thereafter. EXPERIMENTAL RESULTS1F10 Antibody

[0315] A new antibody was made by immunizing mice with lambda light chain (LC)amyloids, isolating antibody-secreting plasma cells therefrom, fusing and generating hybridomas, performing an ELISA screen against different types of LC including patient lambda tissue amyloid extract, verifying antibodies selected by staining different types of AL amyloidosis patient tissue samples an expansion of the selected hyrbidomas. An antibody which binds lambda-AL amyloid fibrils was identified and sequenced (see Figs.1A-1E).

[0316] The new hybridoma monoclonal antibody clone 1F10 showed superior λ-ALAmyloid fibril-specific binding affinity and phagocytotic activities compared to 11-1F4. As shown in Figs. 2A-2E, 1F10 showed superior binding to recombinant and patient λ amyloid fibrils as compared to 11-1F4; 1F10 selectively binds λ amyloid fibrils without cross-reactivity to soluble LCs; 1F10 showed excellent binding in ELISA assays to recombinant, patient hepatic, and patient cardiac lambda amyloid fibrils; 1F10 showed superior effecting of phagocytosis of lambda6 Wil as compared to 11-1F4; and both FITC-anti-lambda light chain and Cy3-1F10 staining showed good, specific binding in lambda AL-amyloidosis patient renal biopsies.

[0317] Figs. 3A-3C highlight the antibody quality and production feasibility of recombinantm1F10 antibodies.

[0318] Figs. 4A-4B demonstrate the superior fibril-binding characteristics of m1F10antibodies compared to 11-1F4 antibodies.

[0319] Figs. 5A-5B demonstrate the superior fibril-binding characteristics and phagocytosiseffecting ability of m1F10 antibodies compared to 2A4 antibodies.

[0320] Importantly, Fig. 6 demonstrates that 1F10 exhibits superior lambda fibril clearanceactivity in vivo compared to 11-1F4.

[0321] Figs. 7A-7C highlight the antibody quality and production feasibility of chimericch1F10 antibodies.

[0322] Figs. 8A-8C demonstrate the superior fibril-binding characteristics and phagocytosiseffecting ability of ch1F10 antibodies compared to ch11-1F4 antibodies.

[0323] Taken together, these data demonstrate (1) 1F10 is a novel monoclonal antibodyvalidated for its λ-AL amyloid fibril-specific binding and phagocytic activity; (2) m1F10 displays superior binding and effects superior phagocytic activities on λ-AL amyloid than m11- 1F4 and 2A4; (3) m1F10 displays superior λ-AL amyloid clearance activity in vivo; (4) chimeric1F10 displays superior λ-AL amyloid binding and effects superior phagocytic activities than CAEL-101. Design of amyloid fibril and phagocyte targeting Bi-specific Phagocyte Engagers (BiPEs)

[0324] To enhance the amyloid clearance efficacies of the AL amyloid targeting antibodies,a set of novel bi-specific phagocyte engagers (BiPEs) were designed that target both AL amyloid and phagocytes (Fig.9). The BiPEs are composed of two arms: an AL amyloid targeting arm (for example, with scFv of 11-1F4, 2A4, 31-8C7 or 57-18-H12 antibody) and a phagocyte targeting arm (for example, with scFv of anti-CD89 (clone 14A8) or anti-CD64 (clone H22)). In some embodiments, (G4S)3 linker is added between VL and VH, and G4S linker is used to link the two arms. His6 tag is added to the C-terminal of the constructs for affinity purification and detection purposes (Fig. 10A). The constructs were inserted into a lentiviral vector pCDH-CMV-MCS- EF1-eGFP and transduced into HEK 293 cells to generate the stable cell lines that constantly express the BiPEs (Fig. 10B). To produce the BiPEs, the stable HEK 293 cells were cultured in OPTI-MEM serum free medium for 72 hours and the culture supernatants were collected for Ni- NTA beads affinity purification (Fig.10C).

[0325] Confirmation of the AL Amyloid binding abilities of the BiPEs - AL amyloid bindingabilities of the BiPEs were tested by the solid phase ELISA assay. For this purpose, cardiac AL amyloid extracts (kappa 1 type) were coated onto ELISA plate and air dried overnight at 37oC. BiPEs (with C-terminal His-tag) were added at the indicated concentrations and incubated for 2 hours at RT, followed by anti-His-HRP secondary antibody incubation and TMB development. MMP-13-His6 recombinant protein was directly coated onto the plate as the positive control for His-tag-HRP antibody. As shown in Fig. 11, anti-kappa I fibril based BiPE (57-18-H12 / H22) showed binding ability to the cardiac origin kappa I fibril, while anti-lambda VIII fibril based 31- 8C7 / H22 showed weaker binding ability. The amyloid binding abilities of the BiPEs on different subtypes of the AL amyloid fibril can be measured and their effects on phagocytes recruitment and phagocytosis in the presence of macrophages confirmed.

[0326] ScFv BiPEs were found to bind to different types of AL amyloid fibril in vitro asshown by ELISA assay in Fig. 12. The design and production of exemplary Full IgG BiPEs is shown in Fig. 13, and in Fig.14 is demonstrated Amyloid binding affinity of full IgG BiPEs by ELISA. Unexpectedly, it was found that 2+2 > 2+1 > 11-1F4 FcM >= 11-1F4 WT. In other words, the BiPEs were more effective than the plain anti-amyloid antibody at binding amyloid.CD64 binding affinity of full IgG BiPEs by ELISA is shown in Fig, 15, with 2+2 > 2+1 >>> 11- 1F4 FcM >= 11-1F4 WT.

[0327] THP1 binding affinity of full IgG BiPEs by FC was determined, as shown in Fig.16. THP1 were stained with 2.8ug / ml Iso-IgG, or ch11-1F4 wt, Ch11-1F4 mut, BsAb2+1, or BsAb2+2 for 30min at 4ºC, then washed twice, stained cells were separated into two tubes for fixing with 1ml 0.5%PFA or unfixing, after 30min fixing, cells were washed with FACS buffer, then distributed the fixed or unfixed cells into tubes with different concentration of TAMRA-Len pep , the pep final concentration is 40ug / ml , 20ug / ml, 10ug / ml, 5ug / ml, 2.5ug / ml or 1.25ug / ml for 30min at 4ºC. After washing twice with FACS buffer, samples were analyzed with LSRII. 2+2 > 2+1 >= 11-1F4 FcM > 11-1F4 WT.

[0328] Compared to scFv, full IgG format of bispecific antibodies showed improvedproducibility and stability. Unexpectedly good amyloid binding, CD64 binding, and macrophage binding were all observed, with affinity 2+2 > 2+1 > ch11-1F4 FcM > ch11-1F4 WT.

[0329] Fig. 17A shows different bispecific antibody designs and their binding to Len fibrils(Fig.17B) and CD64 (Fig.17C).

[0330] Additional data shown in Fig. 18 demonstrates BiPE D’s excellent CD64 bindingaffinity as measured by SPR. Fig. 19 shows BiPE D’s superior phagocyte binding affinity as assessed by flow cytometry.

[0331] Antibody D type showed enhanced THP1 cell binding affinity (see Fig. 20).Specifically, THP1 cells were stained with 5nM hu-IgG, or ch11-1F4, BiPE D and F for 30min at 4ºC, then washed twice with FACS buffer, then distributed the cells into tubes with different concentrations of TAMRA-Len(1-22) peptide (10ug / ml, 5ug / ml, 2.5ug / ml, 1.25ug / ml or 0.625ug / ml) for 30min at 4ºC. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20. Also, as shown in Fig. 21, antibody D cellular binding is resistant to IgG- based Fc blockage. Here, THP1 cells were incubated with human IgG-based Fc blocker (Miltenyi) and then stained with different concentrations of hu-IgG, ch11-1F4, BiPE D or F for 30min at 4ºC, then washed twice with FACS buffer, then the cells were stained with 1.25ug / ml TAMRA-Len(1-22) peptide for 30min at 4ºC. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20.

[0332] Fig. 22 further demonstrates that BiPE D’s THP-1 binding is resistant to IgGcompetition.

[0333] Fig. 23 shows antibody D THP1 cellular binding-resistant to IgG-based Fc blockage.THP1 were incubated with human IgG based Fc blocker (Miltenyi) or without blocker, then stained with 5nM hu-IgG, or Ch11-1F4, BiPE D respectively for 30min at 4ºC, after washing twice with FACS buffer, the cells were stained with 2.5ug / ml or 1.25ug / ml TAMRA-Len1-22 peptide for 30min at 4ºC. After washing twice with FACS buffer, samples were analyzed with Fortessa X-20.

[0334] Antibody D showed higher phagocyte binding affinity-resistant to Fc blocker asshown in Fig. 24. Human PBMCs were incubated with 1:1000 live dead blue for 15min, then cells were split into two parts: incubated with or without human Fc blocker. Both groups of cells incubated with 5nM human IgG, or Ch11-1-F4, or D for 30min at 4ºC, and co-stained with antibodies against CD45, CD3, CD14, CD19. Cells were then washed twice, and incubated with TAMRA-Len(1-22) peptide 2.5ug / ml for 30min at 4ºC, after twice washing, fixed with 0.5% PFA and analyzed with Fortessa X-20. Moreover, antibody D showed the highest amyloid fibril phagocytosis activity as shown in Figs.25A-25C.

[0335] Figs. 26A-26C further demonstrate that the fibril phagocytosis activity effected byBiPE D is resistant to Fc / IgG competition.

[0336] In conclusion, 11-1F4 / CD64 BiPE D demonstrated enhanced CD64 andphagocyte binding affinity, resistant to FcR blockage and serum IgG competition.11-1F4 / CD64 BiPE D demonstrated enhanced AL amyloid clearance activity by recruiting CD64+ phagocytes in vitro, resistant to FcR blockage and Serum IgG blockage. Also, 11-1F4 / CD64 BiPE D demonstrated great producibility without aggregation. CAR-Phagocytes for treatment of AL Amyloidosis and methods of CAR-Phagocyte production

[0337] Herein is disclosed an AL amyloid fibril specific chimeric antigen receptor (CAR)phagocyte immunotherapy which induces fibril deposit specific phagocytosis thereby achieve efficient amyloid fibril clearance. Since AL amyloid deposit clearance is mainly through phagocytosis by macrophages or neutrophils, we have successfully built lambda or kappa light chain specific CAR macrophage lentiviral constructs (see Fig. 27 and 31A). CAR-transduced macrophages selectively engulf AL amyloid fibrils in an in vitro phagocytosis assay (see Figs. 28, 30, 32A-32B, 33).

[0338] Generation of 11-1F4 CAR transduced mouse macrophage and evaluation of CAR-Mmediated AL amyloid phagocytosis: To model the potential of 11-1F4 CAR-mediatedmacrophage phagocytosis of AL amyloid, the mouse macrophage cell line RAW264.7 was transduced with a first-generation 11-1F4 CAR with FcR signaling domain which triggers engulfment of antibody-bound particles. The 11-1F4 CAR contains the CD8 signal peptide sequence (SS), the extracellular single-chain antibody variable fragment (scFv) of 11-1F4, the CD8 hinge and transmembrane domains (TM), the cytosolic signaling domain of ^ subunit of high affinity Fc^RI (FcR^), and a C-terminal GFP tag (Fig. 31A). The CDRs of the scFv are as follows.

[0339] CDRs of 11-1F4 CAR:

[0340] VHCDR1: GFSLTSYG (SEQ ID NO:1) CDR2: IWGDGST (SEQ ID NO:2) CDR3: VTLDY (SEQ ID NO:3).

[0341] VLCDR1: QSLVHRNGNTY (SEQ ID NO:4) CDR2: KVS (SEQ ID NO:5) CDR3: FQTTYVPNT (SEQ ID NO:6).

[0342] VH and VL of 11-1F4 for CAR – exemplary nucleic acid constructs for the scFv:

[0343] VHCAGGTGCAGCTGAAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTC CATCACATGCACTGTCTCAGGGTTCTCATTAAGCAGCTATGGTGTAAGCTGGGTTCG CCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTAATATGGGGTGACGGGAGCA CAAATTATCATCCAAATCTCATGTCCAGACTGAGTATCAGCAAGGATATTTCCAAGA GCCAAGTTCTCTTCAAACTGAATAGTCTGCAAACTGATGACACAGCCACGTACTACT GTGTCACCTTGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO:19)

[0344] VLAGTGATGTTGTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAA GCCTCCATCTCTTGCAGATCTAGTCAGAGCCTTGTACATAGAAATGGAAACACCTAT TTACATTGGTACCTGCAGAAGCCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTT TCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGAT TTCACACTCAAGATCAGCAGAGTGGAGGCTGAGGATTTGGGACTTTATTTCTGTTTT CAAACTACATATGTTCCGAACACGTTCGGAGGGGGGACCAAGCTGGAAATCAAA (SEQ ID NO:20)

[0345] Cell surface expression of the 11-1F4-CAR-GFP fusion protein was confirmed underfluorescence microscope (Fig. 31B). To assess the phagocytosis of AL amyloid, patient-derived AL amyloid extract or recombinant amyloidogenic lambda 6 light chain Wil6 fibril were covalently labeled with a pH-sensitive fluorescence dye pHrodo red–STP ester. The pHrodo red fluorophore fluorescence emission is triggered only in the acidic microenvironment of the phagolysosome. After 4 hours of incubation with RAW 264.7 cells transduced by either GFP control vector or 11-1F4 CAR-GFP construct, the uptake and acidification of the pHrodo red– labeled fibrils was assessed under fluorescence microscope. As shown in Fig.32B, lower panels, 11-1F4 CAR-GFP macrophages showed significantly increased phagocytosis activity compared to the GFP control cells. Impressively, images under higher magnification (lowest panel) clearly showed the acidified fibril piece in CAR-GFP+ macrophages. Similar results were observed in primary mouse macrophages. Mouse bone marrow-derived macrophages (BMDM) were transduced with either GFP control vector or 11-1F4 CAR-GFP lentiviral constructs and incubated with pHrodo red-labeled AL amyloid fibrils. As shown in Fig. 33, 11-1F4 CAR macrophages potently bound to the amyloid piece and showed significantly higher phagocytosis efficacy compared to the GFP control cells.

[0346] Development of human 11-1F4 CAR CD34+ hematopoietic stem cells derivedmacrophages and assessment of AL amyloid phagocytosis efficacy: Gene transfer into primary human macrophages has been a longstanding challenge. Although we confirmed the AL amyloid engulfment activity of CAR transduced primary mouse macrophages, the lentiviral transduction efficacy of primary macrophages was lower than 10% even at the MOI as high as 100. In addition, macrophages do not expand, which can make the manufacture of enough CAR transduced macrophages for in vivo study and therapy impractical. To increase the transductionefficacy, we started the lentiviral transduction with CD34+ hematopoietic stem cells (HSCs), which yielded high transduction efficacy and expansion potency. A modified 11-1F4 CAR construct expressing both GFP and firefly luciferase markers for flow sorting and in vivo tracking was used in this study (Fig. 34A). In addition, to enable the assessment of cell surface CAR expression persistence, a flag tag was inserted between 11-1F4 scFv and CD8 hinge domain. The surface expression of Flag tag could be detected by both flow cytometry assay and immunofluorescence using APC conjugated anti-flag antibody on 11-1F4-Flag-CAR transduced human macrophage cell line THP1 (Fig. 34B). CD34+ cells selected from mobilized PBMCs were infected by the GFP-T2A-luciferase or 11-1F4-CAR-T2A-luciferase GFP lentivirus. At MOI=30, CD34+ cells yielded a high transduction rate > 90%. Transduced CD34+ cells can be expanded in HSC culture medium for 3 weeks to achieve high yield of CAR-CD34+ cells, and then cultured in the macrophage differentiation medium for 7 days to induce the CAR macrophages (Fig. 34C). Flow cytometry analysis of the differentiated cells showed typical macrophage marker gene expression including CD45, CD33, CD14, CD64, and CD172a (Fig. 34D). In vitro amyloid phagocytosis assay using GFP-luciferase vs.11-1F4-CAR GFP-luciferase CD34+ derived macrophages indicated that 11-1F4 CAR significantly increased AL amyloid engulfment (Fig.34E).

[0347] Additional AL amyloid targeting CAR constructs: Two additional amyloid-targetingCAR constructs were designed based on the scFv of anti-kappa I amyloid (antibody clone number: 57-18-H12) and anti-lambda VIII amyloid (antibody clone number: 31-8C7) as in Fig. 35. Human CD34 cells have been transduced by the lentiviral constructs and the amyloid engulfment efficiencies of the CAR CD34 derived macrophages are being quantified. A CAR based on the CDRs of the anti-amyloid antibody 2A4 (see SEQ ID NOS: 37-42) may also be constructed.

[0348] CDRs of anti-kappa (57-18-H12) LC amyloidosis antibody for CAR construct:

[0349] Anti-kappa VHCDR1: GFTFSSYG (SEQ ID NO:7) CDR2: ISGGISYT (SEQ ID NO:8) CDR3:ARHRYGDYYAMDY (SEQ ID NO:9).

[0350] Anti-kappa VLCDR1: SQHSTYT (SEQ ID NO:10) CDR2: LKKDGSH (SEQ ID NO:11) CDR3: GVGDTIKEQFVYV (SEQ ID NO:12).

[0351] VH and VL of anti-kappa LC amyloidosis antibody for CAR – exemplary nucleicacid constructs: Anti-kappa VH

[0352] GAAGTGAAGCTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGCTATGGCATGTCTTG GGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTGGTGGTA TTAGTTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACA ATGCCAAGAACAACCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGACACGGCC TTGTATTACTGTGCAAGACATAGGTACGGGGATTACTATGCTATGGACTACTGGGGT CAAGGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO:21)

[0353] Anti-kappa VLCAACTTGTGCTCACTCAGTCATCTTCAGCCTCTTTCTCCCTGGGAGCCTCAGCAAAAC TCACGTGCACCTTGAGTAGTCAGCACAGTACGTACACCATTGAATGGTATCAGCAAC AGCCACTCAAGCCTCCTAAGTATGTGATGGAACTTAAGAAAGATGGAAGCCACAGC ACAGGTGATGGGATTCCTGATCGCTTCTCTGGTTCCAGCTCTGGTGCTGATCGCTACC TTACCATTTCCAACATCCAGCCTGAAGATGAAGCAATATACATCTGTGGTGTGGGTG ATACAATTAAGGAACAATTTGTGTATGTTTTCGGCGGTGGAACCAAGGTCACTGTCC TA (SEQ ID NO:22)

[0354] CDRs of anti-lambda (31-8C7) LC amyloidosis antibody for CAR construct:

[0355] Anti-lambda VHCDR1: GYSFTGYT (SEQ ID NO:13)CDR2: IIPYNGGT (SEQ ID NO:14) CDR3: ARRGNYDPFAY (SEQ ID NO:15)

[0356] Anti-lambda VLCDR1: ENIYSY (SEQ ID NO:16) CDR2: NAK (SEQ ID NO:17) CDR3: QHHYVTPWT (SEQ ID NO:18)

[0357] VH and VL of anti-lambda LC amyloidosis antibody for CAR – exemplary nucleicacid constructs:

[0358] Anti-lambda VHGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGAACTTCAATGAA GATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAA GCAGAGCCATGGAAAGAACCTTGAGTGGATTGGACTTATTATTCCTTACAATGGTGG TACTACCTACAACCAGAAGTTCAAGGACAAGGCCACATTAACTGTGGACAAGTCAT CCAGCACAGCCTACATGGACCTCCTCAGTCTGACATCTGAGGACTCTGCAGTCTATT ACTGTGCAAGACGGGGTAACTACGACCCGTTTGCTTACTGGGGCCAAGGGACTCTG GTCACTGTCTCTGCA (SEQ ID NO:23)

[0359] Anti-lambda VLGACATCCAGATGACTCAGTCTCCAGCCTCCCTATCTGCATCTGTGGGAGAAACTGTC ACCATCACATGTCGACCAAGTGAGAATATTTACAGTTATTTAGCATGGTATCAGCAG AAACAGGGAAAATCTCCTCAGCTCCTGGTCTATAATGCAAAAACCTTATCAGAAGGT GTACCATCAAGGTTCAGTGGCAGTGGATCAGGCACACAGTTTTCTCTGAAGATCAAC AGCCTACAGCCTGAAGATTTTGGGAATTATTACTGTCAACATCATTATGTTACTCCGT GGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA (SEQ ID NO: 24)

[0360] CDRs of an additional anti-light chain amyloid fibril antibody for CAR construct:

[0361] VHCDR1: GFTFNTYAMY (SEQ ID NO:37) CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO:38) CDR3: PYSDSFAY (SEQ ID NO:39)

[0362] VLCDR1: RSSQSLVHSTGNTYLH (SEQ ID NO:40) CDR2: KVSNRFS (SEQ ID NO:41) CDR3: SQSTHVPFT (SEQ ID NO:42)

[0363] Engraftment of human 11-1F4 CAR CD34+ HSCs in humanized mice model -CD34+ cells were selected from G-CSF mobilized PBMCs (PBSC) with CD34+ microbeads, and then transduced with the GFP-T2A-luciferase or 11-1F4-CAR-T2A-luciferase GFP lentivirus. On the next day, most of the EV or CAR transduced CD34 cells were i.v. injected into NSG-SGM3 mice (1x105 / mouse). The rest of the cells were maintained in culture for another 2 days to check transduction efficiency. At MOI=30, CD34+ cells yielded a high transduction rate > 90%.6 weeks post injection, blood was draw from the transplanted mice tail, around 2-3% of human chimerism were detected by flow cytometry with 40-50% GFP+ in total human CD33+ cells. Figs.36A-36C.

[0364] In human therapy, expression of the CAR-APC is expected to elicit the mounting ofan adaptive immune response against AL-Amyloid (Fig.37).

[0365] Both M1 and M2 CAR M showed amyloid clearance activities as shown in Fig. 38,and FcRg showed higher activity compared to MegF10 as shown in Figs. 39A-39C. Fig. 40 shows confirmation of 11-1F4 CAR-M compared to CD19 Control CAR-M. In vivo, the amyloid targeting activity of l1-1F4 CAR-M is clear, as shown in Figs.41A-41D.

[0366] As shown in Figs. 42A-42C, a novel mouse model enabling real-time monitoring ofAL amyloid and CAR-P in vivo demonstrated that 11-1F4 CAR-Ps displayed accelerated AL amyloid clearance in vivo.

[0367] Myeloid cell boosted with M-CSF+GM-CSF hydrodynamic injection: 12-day ex vivoexpanded CD34+ cells from cord blood were injected into NSG mice, after 12 weeks, the mice were hydrodynamic injected with 20ug M-CSF and GM-CSF expressing plasmids, 1 week later, human myeloid cell boosted in PBMC were found. (Fig.43).

[0368] Figs. 44A-44D further demonstrate 11-1F4 CAR-Macrophages phagocytose ALamyloid fibrils in vitro. Specifically, the 11-1F4 CAR-Macrophages were shown to phagocytose both κ4-Len and λ6-Wil fibrils, and also displayed superior λ-AL amyloid phagocytosis activity compared to addition of c11-1F4 antibody to control macrophages. Additionally, 11-1F4 CAR- Macrophages has higher phagocytic activity than to that effected by naked c11-1F4 antibodies (Figs.45A-45B).

[0369] Human HSC-derived anti-AL amyloid CAR-Ps were generated by lentiviraltransduction of CD34+ HSCs isolated from mobilized PBMCs. The anti-amyloid CAR-HSCs were then sorted, expanded, and differentiated into anti-amyloid CAR-Ps (Figs. 47A-47C). Fig. 47C shows flow cytometry plots of G4S-CAR-P and 11-1F4-CAR-P cells gating on CD11c and G4S signal (upper panel), and flow cytometry quantification displaying counts of G4S-CAR-P, 11-1F4-CAR-P, and unstained control cells across various markers, specifically: G4S, CD14, CD16, CD206, CD64, CD68, HLA-DR, and CD86 (lower panel), demonstrating the ability to successfully generate human HSC-derived anti-AL amyloid CAR-Ps. Notably, 11-1F4 HSC- derived CAR-Ps displayed enhanced AL-amyloid fibril phagocytosis in vitro as shown in Figs. 48A-48B.

[0370] Taken together, these data demonstrate that (1) 11-1F4 CAR-Macrophagesdisplay increased phagocytic activity against AL amyloid fibrils; (2) the provided CAR-HSC strategy facilitates highly efficient production of CAR phagocytes; (3) 11-1F4 CAR-HSC- derived phagocytes exhibited highly potent phagocytic abilities against AL amyloid fibrils in vitro; (4) 11-1F4-CAR-P showed superior λ-AL amyloid phagocytosis activity than the naked c11-1F4 antibody; and (5) 11-1F4 CAR HSC-derived phagocytes significantly accelerated in vivo clearance of AL amyloid in the NSG-SGM3 mouse model.

[0371] Like 11-1F4 CAR-Ps, 1F10 CAR-Ps capable of binding amyloid fibrils can begenerated. For example, the CDRs of 1F10 may be included in an scFv of a human amyloid light chain fibril-binding domain of a 1F10 CAR.

[0372] CDRs of 1F10 are provided below:

[0373] VHCDR1: GYTMN (SEQ ID NO: 43) CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO: 44) CDR3: KRLTGRGYAMDY (SEQ ID NO: 45).

[0374] VLCDR1: RASQSISDYLH (SEQ ID NO: 46) CDR2: YASQSIS (SEQ ID NO: 47) CDR3: QNGHSFPPT (SEQ ID NO: 48).

[0375] VH and VL of 1F10 – exemplary nucleic acid sequences encoding a 1F10-based lightchain amyloid fibril binding region:

[0376] VHGAGGTCCAGCTGCAACAGTCTGGACCTGAGCTGGTGAAGCCTGGAGCTTCAATGAA GATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAA ACAGAGCCATGGAAAGAACCTTGAGTGGATTGGACTTATTAATCCTTACAATGGTGG TACTAACTACAACCAAAAATTCAAGGGCAAGGCCACATTAACTGTAGACAAGTCAT CCAGCACATCCTTCATGGAGCTCCTCAGTCTGACATCTGAGGACTCTGCAGTCTATT ACTGTGCAAGAAAGCGGCTAACCGGACGGGGCTATGCTATGGACTACTGGGGTCAA GGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO: 63)

[0377] VLGACATTGTGATGACTCAGTCTCCGGCCACCCTTTCTGTGACTCCAGGAGATAGAGTC TCTCTTTCCTGCAGGGCCAGCCAGAGTATTAGCGACTACTTACACTGGTATCAACAA AAATCACATGAGTCTCCAAGGCTTCTCATCAAATATGCTTCCCAATCCATCTCTGGG ATCCCCTCCAGGTTCAGTGGCAGTGGATCAGGGTCAGATTTCACTCTCAGTATCAAC AGTGTGGAACCTGAAGATGTTGGAGTGTATTACTGTCAAAATGGTCACAGCTTTCCT CCGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA (SEQ ID NO: 64).

Claims

1. CLAIMS What is claimed is:

1. An antibody which binds a light chain amyloid fibril, a light chain amyloid fibril-bindingfragment of such antibody, or a fusion protein, comprising: a heavy chain variable region comprising: CDR1: GYTMN (SEQ ID NO:43), CDR2: LINPYNGGTNYNQKFKG (SEQ ID NO:44), CDR3: KRLTGRGYAMDY (SEQ ID NO:45), and a light chain variable region comprising: CDR1: RASQSISDYLH (SEQ ID NO:46), CDR2: YASQSIS (SEQ ID NO:47), CDR3: QNGHSFPPT (SEQ ID NO:48).

2. The antibody of Claim 1, which has human framework regions.

3. The antibody of Claim 1, which is humanized.

4. The antibody of Claim 1, which has a human sequence Fc region or has 85% or moresequence identity therewith.

5. The antibody of claim 4, wherein the Fc region comprises at least one mutation whichimproves phagocyte-binding by the antibody, and / or enhances antibody-dependent cellular cytotoxicity (ADCC) and / or antibody-dependent cellular phagocytosis (ADCP) by a phagocyte bound by the antibody.

6. The antibody of claim 5, wherein the Fc region comprises at least one mutation selectedfrom the group consisting of S298A, E333A, K334A, S239D, I332E, P247I, A339Q, F234L, R292P, Y300L, V305I, P396L, A330L, and G236A, preferably wherein the Fc region comprises G236A, S239D, and I332E mutations.

7. The antibody of Claim 1, which is chimeric.

8. The antibody of Claim 1, which is a monoclonal antibody.

9. The antibody of Claim 1, wherein the antibody is an IgG1(λ) or an IgG2(λ) or an IgG4.

10. The fusion protein of Claim 1, which is a single chain variable fragment (scFv).

11. The antibody, fragment, or fusion protein of any of Claims 1-10, which preferentiallybinds a lambda light chain amyloid fibril over a kappa light chain amyloid fibril.

12. The antibody, fragment, or fusion protein of any of Claims 1-11, comprising a portionwhich has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 65-68.

13. A composition comprising the antibody, fragment, or fusion protein of any of Claims 1-12 and a pharmaceutically acceptable carrier or physiologically acceptable carrier.

14. A method for treating light chain amyloidosis in a subject, comprising administering tothe subject a therapeutically effective amount of a pharmaceutical composition comprising the antibody, fragment, or fusion protein of any of Claims 1-12.

15. The method of Claim 14, wherein the light chain amyloidosis is characterized byformation of lambda light chain amyloid fibrils.

16. A method for reducing an amyloid fibril deposit in a subject having light chainamyloidosis, comprising administering to the subject a therapeutically effective amountof a pharmaceutical composition comprising the antibody, fragment, or fusion protein of any of Claims 1-12.

17. The method of Claim 16, wherein the amyloid fibril deposit comprises lambda light chainamyloid fibrils.

18. A polynucleotide molecule encoding the antibody, fragment, or fusion protein of any ofClaims 1-12.

19. The polynucleotide of claim 18 comprising a nucleic acid sequence having a portionwhich has at least 60%, at least 70%, 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 49, 50, 63, and / or 64.

20. A vector comprising the polynucleotide of Claim 18 or 19.

21. The vector of Claim 20, wherein the vector is a lentiviral vector.

22. The vector of Claim 21, wherein the vector is an RNA vector.

23. The vector of any one of Claims 20-22, wherein the vector comprises a promoter,preferably a constitutive or an inducible promoter, operably linked to the polynucleotide sequence encoding the antibody, fragment or fusion protein.

24. A cell comprising or genetically modified by the polynucleotide of Claim 18 or 19 or thevector of any one of claims 20-23.

25. A method of isolating the antibody, fragment, or fusion protein of any of Claims 1-12,comprising maintaining the cell of Claim 24 in culture medium and isolating the antibody, fragment or fusion protein expressed by the cell.

26. A pharmaceutical composition comprising the polynucleotide of Claim 18 or 19 or thevector of any one of claims 20-23, and a pharmaceutically acceptable carrier.

27. A method for treating light chain amyloidosis in a subject or reducing an amyloid fibrildeposit in a subject having light chain amyloidosis, the method comprising: administering to the subject an effective amount of the polynucleotide of Claim 18 or 19, a genetically modified cell modified by the polynucleotide of Claim 18 or 19 or the vector of any one of Claims 20-23, a cell comprising the polynucleotide of Claim 18 or 19 or the vector of any one of Claims 20-23, or the vector of any one of Claims 20-23.

28. A bispecific antibody which binds a light chain amyloid fibril and binds a phagocyte,wherein a portion thereof which binds a light chain amyloid fibril comprises: a) a heavy chain variable region comprising: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2: IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and a light chain variable region comprising: CDR1: QSLVHRNGNTY (SEQ ID NO:4), CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6); or b) a heavy chain variable region comprising: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8),CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and a light chain variable region comprising: CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) a heavy chain variable region comprising: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and a light chain variable region comprising: CDR1: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) a heavy chain variable region comprising: CDR1:GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and a light chain variable region comprising: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

29. The bispecific antibody of Claim 28, wherein a portion thereof which binds thephagocyte binds CD64 or binds CD89 on a phagocyte cell surface.

30. A bispecific antibody which binds a light chain amyloid fibril and binds a phagocyte,wherein a portion thereof which binds a phagocyte comprises: a heavy chain variable region comprising: CDR1: GFIFSDNY (SEQ ID NO:25), CDR2: ISDGGSYT (SEQ ID NO:26), CDR3: ARGYYRYEGAMDY (SEQ ID NO:27), and a light chain variable region comprising: CDR1: QSVLYSSNQKNY (SEQ ID NO:28), CDR2: WAS (SEQ ID NO:29), CDR3:HQYLSSWT (SEQ ID NO:30); or a heavy chain variable region comprising: CDR1: GFTFSSYV (SEQ ID NO:31), CDR2: ISDDGRNK (SEQ ID NO:32), CDR3: VREGYSGSWFDY (SEQ ID NO:33), and a light chain variable region comprising: CDR1: QGISSA (SEQ ID NO:34), CDR2: GAS (SEQ ID NO:35), CDR3: QQFNSYPFT (SEQ ID NO:36).

31. The bispecific antibody of any of Claims 28-30,a) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:1-6, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or b) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:1-6, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or c) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:7-12, and a second scFv directed against a phagocyte cell surface antigen,comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or d) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:7-12, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or e) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:13-18, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or f) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:13-18, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker; or g) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:37-42, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:25-30, wherein the first and second scFv are linked by a flexible peptide linker; or h) comprising a first scFv directed against a light chain amyloid fibril, comprising SEQ ID NOS:37-42, and a second scFv directed against a phagocyte cell surface antigen, comprising SEQ ID NOS:31-36, wherein the first and second scFv are linked by a flexible peptide linker, or comprising a) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 1-6, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25-30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; orb) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 1-6, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31-36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or c) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 7-12, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25-30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or d) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 7-12, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31-36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or e) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 13-18, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25-30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or f) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 13-18, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31-36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; or g) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 37-42, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 25-30, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker; orh) comprising a heavy chain and a light chain configured to form an antigen-binding fragment which is directed against a light chain amyloid fibril and comprises SEQ ID NOs: 37-42, and an scFv which is directed against a phagocyte cell surface antigen and comprises SEQ ID NOs: 31-36, wherein a constant region of the heavy chain and scFv are linked by a flexible peptide linker.

32. The bispecific antibody of any of Claims 28-31, wherein the antibody or one or bothscFvs comprise framework regions of a light chain and / or a heavy chain which are human framework regions, or have 85% or more sequence identity thereto.

33. The bispecific antibody of Claim 32, wherein the framework regions of the light chainand / or the heavy chain are human framework regions.

34. The bispecific antibody of any of Claims 28-33, which binds a human macrophage.

35. The bispecific antibody of any of Claims 28-34, which is a bispecific phagocyte engager.

36. The bispecific antibody of any of Claims 28-35, which binds a kappa chain humanamyloid fibril.

37. The bispecific antibody of any of Claims 28-35, which binds a lambda chain humanamyloid fibril.

38. A bispecific antibody which binds a light chain amyloid fibril and binds a phagocyte,wherein the bispecific antibody comprises VH complementary-determining regions CDR1 through CDR3, VL complementary-determining regions CDR1 through CDR3, and wherein one or more of CDR1 through CDR3 or either of, or both of, the VH and the VL has 85% or greater identity with, but not 100% identity with, the VH CDR1 through CDR3 sequences, or VL CDR1 through CDR3 sequences, respectively, set forth as follows: a) VH CDR1 through CDR3: CDR1: GFSLTSYG (SEQ ID NO:1), CDR2:IWGDGST (SEQ ID NO:2), CDR3: VTLDY (SEQ ID NO:3), and VL CDR1 through CDR3: CDR1: QSLVHRNGNTY (SEQ ID NO:4), CDR2: KVS (SEQ ID NO:5), CDR3: FQTTYVPNT (SEQ ID NO:6); or b) VH CDR1 through CDR3: CDR1: GFTFSSYG (SEQ ID NO:7), CDR2: ISGGISYT (SEQ ID NO:8), CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and VL CDR1 through CDR3: CDR1: SQHSTYT (SEQ ID NO:10), CDR2: LKKDGSH (SEQ ID NO:11), CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); orc) VH CDR1 through CDR3: CDR1: GYSFTGYT (SEQ ID NO:13), CDR2: IIPYNGGT (SEQ ID NO:14), CDR3: ARRGNYDPFAY (SEQ ID NO:15), and VL CDR1 through CDR3: CDR1: ENIYSY (SEQ ID NO:16), CDR2: NAK (SEQ ID NO:17), CDR3: QHHYVTPWT (SEQ ID NO:18); or d) VH CDR1 through CDR3: CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and VL CDR1 through CDR3: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

39. The bispecific antibody of any of claims 28-38 which has a human sequence Fc region orhas 85% or more sequence identity therewith.

40. The bispecific antibody of claim 39, wherein the Fc region comprises at least onemutation which improves phagocyte-binding by the bispecific antibody, and / or enhances antibody-dependent cellular cytotoxicity (ADCC) and / or antibody-dependent cellular phagocytosis (ADCP) by a phagocyte bound by the bispecific antibody.

41. The bispecific antibody of claim 40, wherein the Fc region comprises at least onemutation selected from the group consisting of S298A, E333A, K334A, S239D, I332E, P247I, A339Q, F234L, R292P, Y300L, V305I, P396L, A330L, and G236A, preferably wherein the Fc region comprises G236A, S239D, and I332E mutations.

42. A pharmaceutical composition comprising(i) the bispecific antibody which binds a light chain amyloid fibril and binds a phagocyte of any of Claims 28-41, and a carrier; or (ii) two or more different bispecific antibodies which bind a light chain amyloid fibril and bind a phagocyte of any of Claims 28-41, and a carrier.

43. A method for treating light chain amyloidosis in a subject, comprising administering tothe subject a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody of any of Claims 28-41.

44. A method for reducing an amyloid fibril deposit in a subject having light chainamyloidosis, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody of any of Claims 28- 41.

45. The method of Claim 43 or 44, wherein at least two or more different bispecificantibodies which each binds a light chain amyloid fibril and bind a phagocyte are administered, and wherein the two antibodies differ in their VH CDR sequences and / or their VL CDR sequences.

46. A method of reducing development of an amyloid fibril deposit in a subject, comprisingadministering to a subject identified as having AL amyloidosis a therapeutically effective amount of a pharmaceutical composition comprising the bispecific antibody of any of Claims 28-41, effective to reduce development of an amyloid fibril deposit.

47. A bispecific antigen binding construct comprising a first antigen-binding polypeptideconstruct which specifically binds a human light chain amyloid fibril; a second antigen- binding polypeptide construct which specifically binds a cell surface marker on a phagocyte, and wherein the first antigen-binding polypeptide construct is joined via a linker to the second antigen-binding polypeptide construct.

48. The bispecific antigen binding construct of Claim 47, wherein the first antigen bindingpolypeptide construct is an scFv and the second antigen binding polypeptide construct is an scFv.

49. The bispecific antigen binding construct of Claim 47 or 48, wherein the linker is apeptide linker or a polypeptide linker.

50. The bispecific antigen binding construct of Claim 47, 48 or 49, wherein the bispecificantigen binding construct is capable of bringing a phagocyte adjacent to an amyloid fibril when bound to the amyloid fibril by binding both to the amyloid fibril and the phagocyte.

51. The bispecific antigen binding construct of Claim 47, 48 or 49, wherein the bispecificantigen binding construct is capable of bringing a phagocyte adjacent to an amyloid fibril when bound to the phagocyte by binding both to the amyloid fibril and the phagocyte.

52. The bispecific antigen binding construct of any of Claims 47 to 51, wherein thephagocyte is a macrophage.

53. The bispecific antigen binding construct of any of Claims 47 to 52, which is a bispecificantibody.

54. The bispecific antigen binding construct of any of Claims 47 to 53, which is a tandemscFv, a KiH, a kl-body, or a CrossMab.

55. The bispecific antigen binding construct of any of Claims 47 to 52, which is a bispecificfull IgG, a chemically-linked F(ab’)2, a diabody, an IgG-scFv, a TandAb (tandem diabody), a DVD-Ig (dual variable domain immunoglobulin), tandem Fab-IgG, or a DART (dual-affinity retargeting molecule).

56. The bispecific antigen binding construct of any of Claims 47 to 55, wherein the cellsurface marker on a phagocyte is CD64 or CD89.

57. The bispecific antigen binding construct of any of Claims 47 to 56, wherein the firstantigen-binding polypeptide construct monovalently binds the human light chain amyloid fibril antigen.

58. The bispecific antigen binding construct of any of Claims 47 to 57, wherein the secondantigen-binding polypeptide construct monovalently binds the cell surface marker on a phagocyte.

59. A nucleic acid encoding a bispecific antibody of any of Claims 28 to 41.

60. A nucleic acid encoding a bispecific antigen binding construct of any of Claims 47 to 58.

61. A cell comprising a nucleic acid as set forth in Claim 59 or 60, wherein the nucleic acidis heterologous to the cell genome.

62. A modified human phagocyte comprising a chimeric antigen receptor (CAR), wherein theCAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co- stimulatory molecule signaling domain.

63. The modified human phagocyte of Claim 62, wherein the CAR comprises a humanamyloid lambda light chain fibril-binding domain.

64. The modified human phagocyte of Claim 62, wherein the CAR comprises a humanamyloid kappa light chain fibril-binding domain.

65. The modified human phagocyte of Claim 62, 63 or 64, wherein the antigen bindingdomain of the CAR comprises a single-chain variable fragment (scFv), an antibody, or an antigen-binding fragment of an antibody.

66. The modified human phagocyte of Claim 65, wherein the antibody is selected from thegroup consisting of a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, and a single domain antibody.

67. The modified human phagocyte of any one of Claims 62-66, wherein the transmembranedomain of the CAR comprises a CD8 transmembrane domain or CD28 transmembrane domain.

68. The modified human phagocyte of any one of Claims 62-67, wherein the intracellulardomain of the CAR comprises a λ (gamma) subunit of an immunoglobulin Fc receptor (FcRγ) signaling domain.

69. The modified human phagocyte of any one of Claims 62-68, wherein the intracellulardomain of the CAR comprises a CD3zeta (CD3ζ) subunit.

70. The modified human phagocyte of any one of Claims 62-69, wherein the modified humanphagocyte exhibits phagocytosis of human AL amyloid fibrils when bound thereto.

71. The modified human phagocyte of any one of Claims 62-70, wherein the human amyloidlight chain fibril-binding domain comprises: a VH comprising the following: CDR1: GFSLTSYG (SEQ ID NO:1) CDR2: IWGDGST (SEQ ID NO:2) CDR3: VTLDY (SEQ ID NO:3) and / or a VL comprising the following:CDR1: QSLVHRNGNTY (SEQ ID NO:4) CDR2: KVS (SEQ ID NO:5) CDR3: FQTTYVPNT (SEQ ID NO:6).

72. The modified human phagocyte of any one of Claims 62-70, wherein the human amyloidlight chain fibril-binding domain comprises: a VH comprising the following: CDR1: GFTFSSYG (SEQ ID NO:7) CDR2: ISGGISYT (SEQ ID NO:8) CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and / or a VL comprising the following: CDR1: SQHSTYT (SEQ ID NO:10) CDR2: LKKDGSH (SEQ ID NO:11) CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or a VH comprising the following: CDR1: GYSFTGYT (SEQ ID NO:13) CDR2: IIPYNGGT (SEQ ID NO:14)CDR3: ARRGNYDPFAY (SEQ ID NO:15), and / or a VL comprising the following: CDR1: ENIYSY (SEQ ID NO:16) CDR2: NAK (SEQ ID NO:17) CDR3: QHHYVTPWT (SEQ ID NO:18).

73. The modified human phagocyte of any one of Claims 62-70, wherein the human amyloidlight chain fibril-binding domain comprises a VH comprising the following: CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and / or a VL comprising the following: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

74. The modified human phagocyte of any one of Claims 62-73, wherein the CAR furthercomprises a CD8 hinge region between the human amyloid light chain fibril-binding domain and the transmembrane domain.

75. The modified human phagocyte of any one of Claims 62-74, wherein the modified humanphagocyte is a modified macrophage.

76. The modified human phagocyte of any one of Claims 62-74, wherein the modified humanphagocyte is a modified neutrophil.

77. The modified human phagocyte of any one of Claims 62-76, wherein the modifiedphagocyte cell has been modified by genetically modifying a phagocyte to express the CAR, or is a progeny thereof.

78. A pharmaceutical composition comprising the modified human phagocyte of any one ofClaims 62-77 and a pharmaceutically acceptable carrier.

79. The pharmaceutical composition of Claim 78, comprising a plurality of phagocyteswherein at least 33% of the cells in the composition express the CAR.

80. A method for treating light chain amyloidosis in a subject, comprising administering tothe subject a therapeutically effective amount of a pharmaceutical composition comprising the modified human phagocyte of any of Claims 62-77.

81. A method for reducing an amyloid fibril deposit in a subject having light chainamyloidosis, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the modified human phagocyte of any of Claims 62-77.

82. The method of Claim 80 or 81, wherein the modified phagocytes have initially beenobtained as phagocytes from the subject that is being treated prior to the phagocytes being modified to comprise the CAR or wherein the modified phagocytes have been generated from hematopoietic stem cells from a peripheral blood mononuclear cells (PBMC)-containing sample from the subject that is being treated prior to the treatment.

83. A method of generating a modified human hematopoietic stem cell comprising a chimericantigen receptor (CAR), wherein the CAR comprises a human amyloid light chain fibril- binding domain, a transmembrane domain, and an intracellular domain of a stimulatory and / or co-stimulatory molecule, the method comprising obtaining CD34+ and / orhematopoietic stem cells from a sample obtained from a human, and transducing the CD34+ and / or hematopoietic stem cells with a nucleic acid encoding the CAR or a vector comprising the nucleic acid encoding the CAR, optionally wherein the nucleic acid is a polynucleotide of any one of Claims 105-112 or wherein the vector is a vector of any one of Claims 113-116.

84. The method of Claim 83, further comprising administering to the human an agent thatmobilizes peripheral blood mononuclear cells (PBMC) into the human's peripheral blood and obtaining a hematopoietic stem cells-containing sample therefrom, or obtaining an adult bone marrow or umbilical cord blood sample comprising CD34+ cells from the human.

85. The method of Claim 83 or 84, wherein the hematopoietic stem cells transduced with anucleic acid encoding the CAR or with a vector comprising the nucleic acid encoding the CAR are expanded subsequent to transduction.

86. The method of any of Claims 83-85, wherein the hematopoietic stem cells transducedwith a nucleic acid encoding the CAR or with a vector comprising the nucleic acid encoding the CAR are maintained in a differentiating medium under conditions to effect differentiation into a CAR-phagocyte or a CAR-antigen presenting cell.

87. The method of any of Claims 83-86, wherein the hematopoietic stem cells transducedwith a nucleic acid encoding the CAR or with a vector comprising the nucleic acid encoding the CAR are maintained in a differentiating medium under conditions to effect differentiation into a CAR-macrophage, a CAR-neutrophil, a CAR-monocyte, or a CAR- dendritic cell.

88. The method of any of Claims 83-87, wherein the hematopoietic stem cells are obtainedfrom the PBMC-containing sample via selection for CD34 expression.

89. A CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cellgenerated by the method of any of Claims 83-88.

90. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 89, wherein the CAR comprises a human amyloid lambda light chain fibril- binding domain.

91. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 89, wherein the CAR comprises a human amyloid kappa light chain fibril-binding domain.

92. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 89, 90 or 91, wherein the antigen binding domain of the CAR comprises a single- chain variable fragment (scFv), an antibody, or an antigen-binding fragment of an antibody.

93. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 92, wherein the transmembrane domain of the CAR comprises a CD8 or CD28 transmembrane domain.

94. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 92, wherein the intracellular domain of the CAR comprises an FcRγ signaling domain.

95. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 92, wherein the modified human phagocyte exhibits phagocytosis of human AL amyloid fibrils when bound thereto.

96. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 92, wherein the human amyloid light chain fibril-binding domain comprises a VH comprising the following: CDR1: GFSLTSYG (SEQ ID NO:1) CDR2: IWGDGST (SEQ ID NO:2) CDR3:VTLDY (SEQ ID NO:3), and / or a VL comprising the following: CDR1: QSLVHRNGNTY (SEQ ID NO:4) CDR2: KVS (SEQ ID NO:5) CDR3: FQTTYVPNT (SEQ ID NO:6); or a VH comprising the following: CDR1: GFTFSSYG (SEQ ID NO:7) CDR2: ISGGISYT (SEQ ID NO:8) CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and / or a VL comprising the following: CDR1: SQHSTYT (SEQ ID NO:10) CDR2: LKKDGSH (SEQ ID NO:11) CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or a VH comprising the following: CDR1:GYSFTGYT (SEQ ID NO:13) CDR2: IIPYNGGT (SEQ ID NO:14) CDR3: ARRGNYDPFAY (SEQ ID NO:15), and / or a VL comprising the following: CDR1: ENIYSY (SEQ ID NO:16) CDR2: NAK (SEQ ID NO:17) CDR3: QHHYVTPWT (SEQ ID NO:18); or a VH comprising the following: CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and / or a VL comprising the following: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

97. The CAR-macrophage, a CAR-neutrophil, a CAR-monocyte or a CAR-dendritic cell ofClaim 92, which is a CAR-macrophage.

98. The CAR-macrophage of Claim 92, wherein the antigen binding domain of the CARcomprises an scFv.

99. The CAR-macrophage of Claim 98, wherein the intracellular domain of the CARcomprises a FcRγ signaling domain.

100. The CAR-macrophage of Claim 98, wherein the transmembrane domain of the CARcomprises a CD8 transmembrane domain.

101. A method of eliciting an immune response against amyloid light chain fibrils in a subjectcomprising administering to the subject a CAR-antigen presenting cell wherein the CAR comprises a human amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular domain of a stimulatory and / or co-stimulatory molecule, effective to elicit an immune response.

102. The method of Claim 101, wherein the response is an adaptive immune response.

103. The method of Claim 101 or 102, wherein CAR-antigen presenting cell is made by themethod of Claim 86.

104. The method of any of Claims 80-82, 101 or 102, wherein the subject is a human.

105. A polynucleotide encoding a chimeric antigen receptor (CAR), the CAR comprising ahuman amyloid light chain fibril-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a stimulatory and / or co-stimulatory molecule signaling domain.

106. The polynucleotide of Claim 105, wherein the CAR comprises a human amyloid lambdalight chain fibril-binding domain or a human amyloid kappa light chain fibril-binding domain.

107. The polynucleotide of Claim 105 or 106, wherein the human amyloid light chain fibril-binding domain of the CAR comprises a single-chain variable fragment (scFv), an antibody, or an antigen-binding fragment of an antibody.

108. The polynucleotide of Claim 107, the antibody is selected from the group consisting of amonoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, and a single domain antibody.

109. The polynucleotide of any one of Claims 105-108, wherein the transmembrane domain ofthe CAR comprises a CD8 transmembrane domain or CD28 transmembrane domain, and / or wherein the intracellular domain of the CAR comprises a γ (gamma) subunit of an immunoglobulin Fc receptor (FcRγ) signaling domain, and / or wherein the intracellular domain of the CAR comprises a CD3zeta (CD3ζ) subunit.

110. The polynucleotide of any one of Claims 105-109, wherein the human amyloid lightchain fibril-binding domain comprises: a) a VH comprising the following: CDR1: GFSLTSYG (SEQ ID NO:1) CDR2: IWGDGST (SEQ ID NO:2) CDR3: VTLDY (SEQ ID NO:3) and / or a VL comprising the following: CDR1: QSLVHRNGNTY (SEQ ID NO:4) CDR2: KVS (SEQ ID NO:5) CDR3: FQTTYVPNT (SEQ ID NO:6); or b) a VH comprising the following:CDR1: GFTFSSYG (SEQ ID NO:7) CDR2: ISGGISYT (SEQ ID NO:8) CDR3: ARHRYGDYYAMDY (SEQ ID NO:9), and / or a VL comprising the following: CDR1: SQHSTYT (SEQ ID NO:10) CDR2: LKKDGSH (SEQ ID NO:11) CDR3: GVGDTIKEQFVYV (SEQ ID NO:12); or c) a VH comprising the following: CDR1: GYSFTGYT (SEQ ID NO:13) CDR2: IIPYNGGT (SEQ ID NO:14) CDR3: ARRGNYDPFAY (SEQ ID NO:15), and / or a VL comprising the following: CDR1: ENIYSY (SEQ ID NO:16) CDR2: NAK (SEQ ID NO:17) CDR3: QHHYVTPWT (SEQ ID NO:18);or d) a VH comprising the following: CDR1: GFTFNTYAMY (SEQ ID NO: 37), CDR2: RIRSKSNNYAIYYADSVKD (SEQ ID NO: 38), CDR3: PYSDSFAY (SEQ ID NO: 39), and / or a VL comprising the following: CDR1: RSSQSLVHSTGNTYLH (SEQ ID NO: 40), CDR2: KVSNRFS (SEQ ID NO: 41), CDR3: SQSTHVPFT (SEQ ID NO: 42).

111. The polynucleotide of any one of Claims 105-110, wherein the CAR further comprises aCD8 hinge region between the human amyloid light chain fibril-binding domain and the transmembrane domain.

112. The polynucleotide of any one of Claims105-111, wherein the human amyloid light chainfibril-binding domain is encoded by a nucleic acid sequence having a portion which has at least 60%, at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 19 and / or 20, SEQ ID NOs: 21 and / or 22, or SEQ ID NOs: 23 and / or 24.

113. A vector comprising the polynucleotide of any one of Claims 105-112.

114. The vector of Claim 113, wherein the vector is a lentiviral vector.

115. The vector of Claim 114, wherein the vector is an RNA vector.

116. The vector of any one of Claims113-115, wherein the vector comprises an induciblepromoter operably linked to the polynucleotide sequence encoding the CAR.

117. A pharmaceutical composition comprising the polynucleotide of any one of Claims 105-112 or the vector of any one of Claims 113-116, and a pharmaceutically acceptable carrier.

118. A method for treating light chain amyloidosis in a subject or reducing an amyloid fibrildeposit in a subject having light chain amyloidosis, the method comprising: administering to the subject an effective amount of the polynucleotide of any one of Claims 105-112, a genetically modified cell modified by the polynucleotide of any one of Claims 105-112 or the vector of any one of Claims 113-116, a cell comprising the polynucleotide of any one of Claims 105-112 or the vector of any one of Claims 113-116, or the vector of any one of Claims 113-116.

119. A cell comprising or genetically modified by the polynucleotide of any one of Claims105-112 or the vector of any one of Claims 113-116.