Targeting the interactions between bestrophin channels and glutamic acid decarboxylases for disease treatment
By enhancing bestrophin activity through GAD isoforms or correcting mutations, the methods address the lack of effective treatments for bestrophinopathies, improving anion permeability and reducing harmful currents, offering therapeutic benefits for vision-related diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-09
- Publication Date
- 2026-03-12
AI Technical Summary
Current treatments for bestrophinopathies, such as Best vitelliform macular dystrophy, adult-onset vitelliform macular dystrophy, autosomal recessive bestrophinopathy, autosomal dominant vitreoretinochoroidopathy, and retinitis pigmentosa, are inadequate, leading to progressive vision loss and potential blindness due to the lack of understanding of the physiological properties and cellular regulators of bestrophins like Best1.
Enhancing bestrophin-mediated anion currents by administering stimulators or inserting nucleic acids encoding glutamic acid decarboxylase (GAD) isoforms, such as GAD65 or GAD67, into cells, or using CRISPR/Cas9-based gene editing to correct mutations, or administering suppressors like siRNA or antibodies to modulate Best1 activity.
Promotes permeability of bestrophins to anions like glutamate, gluconate, or GABA, and reduces Ca2+-dependent Cl' currents, potentially treating bestrophinopathies and maintaining intraocular pressure, thereby alleviating symptoms and preventing vision loss.
Smart Images

Figure US2025045533_12032026_PF_FP_ABST
Abstract
Description
Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025TARGETING THE INTERACTIONS BETWEEN BESTROPHIN CHANNELS AND GLUTAMIC ACID DECARBOXYLASES FOR DISEASE TREATMENT
[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 692,462, filed on September 9, 2024, which is incorporated herein by reference in its entirety.
[0002] All patents, patent applications and publications cited herein are hereby incorporated by reference in their entirety. The disclosure of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described herein.GOVERNMENT SUPPORT
[0003] This invention was made with government support under TR001873, GM 149252, and GM127652 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND
[0004] The bestrophins are a family of Ca2+-activated anion channels consisting of four members in mammals (Bestl-Best4). They are widely distributed in various human organs including the airways, colon, kidney, pancreas and central nervous system, but they are best known for their physiological roles in the eye. In particular, Bestl is predominantly expressed in retinal pigment epithelium (RPE) and genetically linked to a spectrum of retinal degenerative disorders collectively known as bestrophinopathies. Over 350 different mutations in Bestl have been identified to cause bestrophinopathies. Exemplary bestrophathies include Best vitelliform macular dystrophy (BVMD), adult-onset vitelliform macular dystrophy (AVMD), autosomal recessive bestrophinopathy (ARB), autosomal dominant vitreoretinochoroidopathy (ADVIRC), and retinitis pigmentosa (RP). Additionally, bestrophins have roles in multiple aspects of physiology. The patients are susceptible to progressive vision loss that may eventually lead to blindness, and there is no treatment. On the other hand, Best2 resides in non-pigmented epithelium (NPE) regulating intra-ocular pressure (IOP), which must be properly maintained at all times as both hypertension and hypotension are deleterious conditions. Therefore, bestrophins are potential drug targets for various human diseases, especially of the eye.1ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025SUMMARY OF THE INVENTION
[0005] In certain aspects, described herein is a method of enhancing bestrophin-mediated anion currents in a subject, the method comprising administering a stimulator of the interaction between the bestrophin and an isoform of glutamic acid decarboxylase (GAD) to the subject. In some embodiments, the isoform is GAD65 or GAD67. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4. In some embodiments, the bestrophin is Bestl.
[0006] In certain aspects, described herein is a method of promoting bestrophin-mediated Ca2+-dependent CF currents in a subject, the method comprising inserting a nucleic acid encoding an isoform of glutamic acid decarboxylase into cells of the subject. In some embodiments, the nucleic acid is inserted into the cells via a vector. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an AAV vector or a lentiviral vector. In some embodiments, the isoform is GAD65 or GAD67. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some embodiments, the cells are retinal pigment epithelium cells. In some embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4. In some embodiments, the bestrophin is Bestl.
[0007] In certain aspects, described herein is a method of promoting bestrophin permeability to glutamate, gluconate, or GABA in a subject, the method comprising inserting a nucleic acid encoding an isoform of glutamic acid decarboxylase into cells of the subject. In some embodiments, the nucleic acid is inserted into the cells via a vector. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an AAV vector or a lentiviral vector. In some embodiments, the isoform is GAD65. In some embodiments, administration of GAD65 caused the neck and aperture of the bestrophin to open. In some embodiments, administration of GAD65 promotes the permeability of the bestrophin to GABA. In some embodiments, administration of GAD65 promotes the permeability of the bestrophin to glutamate. In some embodiments, the isoform is GAD67. In some embodiments, the cells are retinal pigment epithelium cells. In some embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4. In some embodiments, the bestrophin is Bestl.
[0008] In certain aspects, described herein is a method of promoting bestrophin permeability to glutamate, gluconate or GABA in a subject, the method comprising2ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 correcting a mutation in the gene encoding an isoform of glutamic acid decarboxylase into cells of the subject. In some embodiments, the correcting is performed using CRISPR / Cas9- based gene editing. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4. In some embodiments, the bestrophin is Bestl.
[0009] In certain aspects, described herein is a method of reducing Bestl -mediated Camdependent Cl’ currents in a subject, the method comprising administering a suppressor of an isoform of glutamic acid decarboxylase to the subject. In some embodiments, the isoform is GAD65 or GAD67. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some embodiments, the subject is a human. In some embodiments, the suppressor is an siRNA against the isoform of glutamic acid decarboxylase. In some embodiments, the suppressor is an antibody against the isoform of glutamic acid decarboxylase. In some embodiments, the subject has a bestrophin-related disease. In some embodiments, the bestrophin-related disease is Best vitelliform macular dystrophy (BVMD), adult-onset vitelliform macular dystrophy (AVMD), autosomal recessive bestrophinopathy (ARB), autosomal dominant vitreoretinochoroidopathy (ADVIRC), or retinitis pigmentosa (RP).BRIEF DESCRIPTION OF FIGURES
[0010] The patent or application file contains at least one drawing originally in color.
[0011] FIGS, la-f show the interactions between Bestl and glutamic acid decarboxylases (GADs) and the influence of GADs on Bestl -mediated Ca2+-dependent Cl’ currents in HEK293 cells, (a) Co-expressed Bestl -Ven-His and GAD-Cer-Myc were detected by immunoblotting in input (top) and immunoprecipitation (IP, bottom) samples. 65, GAD65;67, GAD67. The experiment was biologically replicated three times with similar results, and representative blots are shown. Original scans are provided in Fig. 2a. (b-d) Ca2+-dependent Cl’ currents conducted by Bestl (b), Bestl + GAD65 (c), and Bestl + GAD67 (d). Steadystate current density was recorded at +100 mV plotted vs. [Ca2+]i and fitted to the Hill equation; n = 5-11. 1, intracellular; E, extracellular, (e, f) Representative current traces (e) and population steady-state current density -voltage (I-V) relationships (f) of Bestl alone (black) or co-expressed with GAD65 (red solid) or GAD67 (red open) at 1 pM [Ca2+]i; n = 5-11. *p < 0.05 compared to Bestl alone; Inset, voltage protocol used to elicit currents. All error bars are3ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 presented as mean values + / - SEM; p values are calculated by two-tailed unpaired Student’s t test.
[0012] FIGS. 2a-d show immunoblotting of Bestl and GADs. (a) Indicated Bestl-Ven- His and GAD-Cer-Myc constructs were co-expressed in HEK293 cells and detected by an anti-His and anti-Myc antibody, respectively, in the input (Jeff) and anti-His immunoprecipitation (right samples. 405, Bestl 1-405; 65, GAD65; 67, GAD67. (b) The overall and membrane-bound protein levels of Bestl -Ven-His alone and upon co-expression with GAD65 or GAD67 in HEK293 cells were detected by an anti-His antibody, (c) iPSC- RPE cell lysate was incubated with purified Bestl -Ven-His on Ni-NTA beads, and the pulldown sample was subjected to immunoblotting by anti-His (Jeff) and anti-GAD65 (right) antibodies, (d) Bestl -Ven-His, GAD65-Cer-Myc and GAD67-Cer-Myc were individually cotransfected with the Bestl-, GAD65- and GAD67-specific siRNA, respectively, or a scramble siRNA, and the cell lysates were subjected to immunoblotting with anti-GFP (left and P- Actin (right) antibodies. Each experiment was biologically replicated three times with similar results, and the representative blots are shown.
[0013] FIGS. 3a-f show the influence of GADs on the permeability of Bestl to big anions glutamate and gluconate, (a) I-V relationships of Bestl alone (black), Bestl + GAD65 (red solid) and Bestl + GAD67 (red open), with glutamate as the principal anion in both sides of patch solutions; n = 5-7, *p < 0.05 compared to Bestl alone, (b) I-V relationships of Bestl alone (black), Bestl + GAD65 (red solid) and Bestl + GAD67 (red open) with external glutamate and internal Cl’; n = 5-12. (c) Relative permeability ratios of glutamate to Cl’ (PGIU / PCI) in Bestl alone, Bestl + GAD65 and Bestl + GAD67; n = 5-12. *p < 0.05 compared to Bestl alone, (d-f) The same format as a-c, except for gluconate replacing glutamate; n = 5- 7; *p < 0.05 compared to Bestl alone. All experiments are done at 1 pM [Ca2+]i in HEK293 cells. All error bars are presented as mean values + / - SEM; p values are calculated by two- tailed unpaired Student’s t test.
[0014] FIGS. 4a-h show the influence of GADs on the Bestl channel gates, (a, b) I-V relationships of Bestl -I76A / F80A / F84A (3 A) alone (black), Bestl -3 A + GAD65 (red solid) and Bestl -3 A + GAD67 (red open), with Cl’ (a) or glutamate (b) as the principal anion in both sides of patch solutions; n = 5-6. *p < 0.05 compared to Bestl alone, (c, d) I-V relationships (c) and PGIU / PCI relative permeability ratios (d) with external glutamate and internal Cl’ in Bestl -3 A alone (black), Bestl -3 A + GAD65 (red solid) and Bestl -3 A + GAD67 (red open); n = 5. *p < 0.05 compared to Bestl alone, (e-h) The same format as a-d4ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 for Bestl-I205A; n = 5-7; *p < 0.05 compared to Bestl alone. All experiments are done at 1 pM [Ca2+]i in HEK293 cells. All error bars are presented as mean values + / - SEM; p values are calculated by two-tailed unpaired Student’s t test.
[0015] FIGS. 5a-e show the role of the Bestl C-terminus in interaction with GADs. (a) I- V relationships of Bestl 1-405 alone (black), Bestl 1-405 + GAD65 (red solid) and Bestl 1-405 + GAD67 (red open), with Cl’ as the principal anion in both sides of patch solutions; n=6-15. (b) Co-expressed Bestl 1-405-Ven-His and GAD-Cer-Myc were examined by immunoblotting in input (top) and immunoprecipitation (IP, bottom) samples. The experiment was biologically replicated three times with similar results, and representative blots are shown. Original scans are provided in Fig. 2a. (c, d) Bar chart showing the steady-state current densities at +100 mV from cells transiently expressing the indicated Bestl C-terminal truncation constructs alone (black) and in the presence of GAD65 (c, red) or GAD67 (d, red) with Cl’ as the principal anion in both sides of patch solutions; n = 5-15. (e) The same format as c, but with glutamate as the principal anion in both sides of patch solutions; n = 5-6. All experiments are done at 1 pM [Ca2+]i in HEK293 cells. All error bars are presented as mean values + / - SEM; p values are calculated by two-tailed unpaired Student’s / test.
[0016] FIGS. 6a-f show the role of the Bestl C-terminus in Cl’ permeability, (a-f) I-V relationships of indicated Bestl C-terminus truncation mutants transiently expressed in HEK293 cells alone (black) and in the presence of GAD65 (a-c, red solid) or GAD67 (d-f, red open), with Cl’ as the principal anion in both sides of patch solutions; n = 5-8. All experiments are done at 1 pM [Ca2+]i. All error bars are presented as mean values + / - SEM; p values are calculated by two-tailed unpaired Student’s / test.
[0017] FIGS. 7a-h show the influence of GADs on GABA permeability in Bestl. (a) I-V relationships of Bestl alone (black), Bestl + GAD65 (red solid) and Bestl + GAD67 (red open) with Cl’ and GABA as the principal anion in internal and external solutions, respectively; n = 6-9. (b) Relative permeability ratios of GABA to Cl’ (PGABA / PCI) in Bestl alone (black), Bestl + GAD65 (red solid) and Bestl + GAD67 (red open); n = 5-6. *p < 0.05 compared to Bestl alone, (c, d) I-V relationships (c) and PGABA / PCI (d) measured for Bestl - 3A in the same format as a, b, respectively; n = 5; *p < 0.05 compared to 3A alone, (e, f) I-V relationships (e) and PGABA / PCI (f) measured for Bestl -1205 A in the same format as a, b, respectively; n = 5-11. (g, h) Relative ion conductance ratios of external GGABA / GCI (e) and internal Gci / Gci (f) in Bestl when GABA replacing Cl’ in the external solution; n = 5-11. All electrophysiology experiments are done at 1 pM [Ca2+]i in HEK293 cells. All error bars are5ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 presented as mean values + / - SEM; p values are calculated by two-tailed unpaired Student’s t test.
[0018] FIGS. 8a-f show the influence of GADs on Bestl-mediated anion currents in RPE cells, (a) Representative Cl’ current traces measured at 1 pM [Ca2+]i without (Jeff) or with GAD65 siRNA treatment (right), (b) I-V relationships in untreated cells at no Ca2+(black open) or 1 pM Ca2+(black solid) and in cells upon Bestl siRNA treatment at 1 pM [Ca2+]i (blue), with Cl’ as the principal internal and external anion; n= 5-6. *p < 0.05 compared to untreated cells at 1 pM [Ca2+]i. (c) I-V relationships in untreated cells (black) and cells upon GAD65 (red solid) or GAD67 (red open) siRNA treatment at 1 pM [Ca2+]i, with Cl’ as the principal internal and external anion; n= 5-6. *p < 0.05 compared to untreated cells, (d) I-V relationships in untreated cells at no Ca2+(black open) or 1 pM Ca2+(black solid) and in cells upon Bestl siRNA treatment at 1 pM [Ca2+]i (blue), with glutamate as the principal internal and external anion; n = 6. *p < 0.05 compared to untreated cells at 1 pM [Ca2+]i. (e, f) I-V relationships in untreated cells (black) and cells upon GAD65 (red) or Bestl (blue) siRNA treatment at 1 pM [Ca2+]i, with glutamate as the principal anion in both internal and external solutions (e) or Cl’ as the only internal anion and GABA as the principal passing ion in the external solution (f); n= 5-8. *p < 0.05 compared to untreated cells. All error bars are presented as mean values + / - SEM; p values are calculated by two-tailed unpaired Student’s t test.
[0019] FIGS. 9a-d show gene expression and knockdown of Bestl and GADs in human RPE cells, (a) Relative mRNA levels of Bestl, GAD65 and GAD67 in BEST1WT / WT\P C- RPE cells measured by RT-PCR; n = 3. (b-d) The relative mRNA levels of Bestl (b) GAD65 (c) and GAD67 (d) in untreated cells and cells treated with a scramble, Bestl-, GAD65-, or GAD67-specific siRNA were analyzed by qRT-PCR and normalized to those in untreated cells; n = 3 for each group; *p < 0.05, compared to the mRNA level in cells treated with the scramble siRNA by two-tailed unpaired Student’s t test. All error bars are presented as mean values + / - SEM.DETAILED DESCRIPTION OF THE INVENTION
[0020] In certain aspects, described herein is a method of enhancing bestrophin-mediated anion currents in a subject, the method comprising administering a stimulator of the interaction between the bestrophin and an isoform of glutamic acid decarboxylase to the subject. In some embodiments, the isoform is GAD65 or GAD67. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some6ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4.Nucleic Acids
[0021] In certain aspects, described herein is a method of promoting bestrophin-mediated Ca2+-dependent Cl’ currents in a subject, the method comprising inserting a nucleic acid encoding an isoform of glutamic acid decarboxylase into cells of the subject. In certain aspects, described herein is a method of promoting bestrophin permeability to glutamate, gluconate, or GABA in a subject, the method comprising inserting a nucleic acid encoding an isoform of glutamic acid decarboxylase into cells of the subject. In each of the aspects described above, the nucleic acid may be a codon-optimized nucleic acid. The nucleic acid may be DNA or RNA, and it may comprise modified nucleosides. For example, an RNA may comprise modified uridines, for example methylpseudouridine or Nl- methylpseudouridine. The RNA may have substantially all or all of its uridines modified. The RNA may also comprise modified cytidines such as 5-methylcytidine. The RNA may have substantially all or all of its cytidines modified.
[0022] In some embodiments, the isoform is GAD65 or GAD67. In some embodiments, the isoform is GAD65. In some embodiments, administration of GAD65 causes the neck and aperture of the bestrophin to open. In some embodiments, administration of GAD65 promotes the permeability of the bestrophin to GABA. In some embodiments, administration of GAD65 promotes the permeability of the bestrophin to glutamate. In some embodiments, the isoform is GAD67. In some embodiments, the cells are retinal pigment epithelium cells. In some embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4. In some embodiments, the bestrophin is Bestl.Delivery Systems
[0023] In some embodiments, the nucleic acid is inserted into the cells via a vector. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an AAV vector or a lentiviral vector. Other delivery vehicles including for example non-viral vectors are contemplated within the scope of the disclosure. These delivery systems may include, but are not limited to, liposomes, lipoplexes, lipid nanoparticles.
[0024] In some embodiments, the nucleic acid is inserted into the cells via a vector. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an AAV vector or a lentiviral vector.7ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025
[0025] In certain aspects, described herein is a method of promoting bestrophin permeability to glutamate, gluconate or GABA in a subject, the method comprising correcting a mutation in the gene encoding an isoform of glutamic acid decarboxylase into cells of the subject. In some embodiments, the correcting is performed using CRISPR / Cas9- based gene editing. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some embodiments, the subject is a human. In some embodiments, the bestrophin is Bestl, Best2, Best3, or Best4.CRISPR / Cas9
[0026] The CRISPR / Cas9 gene editing technique promotes a new human gene therapy strategy by correcting a defect gene at pre-chosen sites without altering the endogenous regulation of the target gene. This system consists of two key components: Cas9 protein and a guide RNA, e.g., a single guide RNA (sgRNA), as well as a correction template when needed. sgRNA contains two components: a 17-20 nucleotide sequence termed crispr RNA that is complementary to the target DNA region, and a tracr RNA that serves as the binding scaffold for a Cas nuclease. The sgRNA recognizes the target DNA and guides the Cas9 nuclease to the region for editing. The Cas9 protein may be a modified Cas9 protein.
[0027] In certain aspects, described herein is a method of reducing Bestl -mediated Camdependent Cl’ currents in a subject, the method comprising administering a suppressor of an isoform of glutamic acid decarboxylase to the subject. In some embodiments, the isoform is GAD65 or GAD67. In some embodiments, the isoform is GAD65. In some embodiments, the isoform is GAD67. In some embodiments, the subject is a human. In some embodiments, the suppressor is an siRNA against the isoform of glutamic acid decarboxylase.Antibodies
[0028] In some embodiments, the suppressor is an antibody against the isoform of glutamic acid decarboxylase. In some embodiments, the suppressor is an antibody against the isoform of glutamic acid decarboxylase. There are five classes of human antibodies (i.e., IgA, IgD, IgE, IgG, and IgM) and each have various isotypes (e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2). In some embodiments, the antibodies disclosed herein belong to the IgG class. IgG can be further divided into four subclasses: IgGl, IgG2, IgG3, and IgG4. Each subclass has a unique profile with respect to antigen binding, immune complex formation, complement activation, triggering of effector cells, half-life, and placental transport. E.g., see8ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025Gestur Vidarsson, et al., IgG Subclasses and Allotypes: From Structure to Effector Functions, 5 Frontiers in Immunology 520 (2014), incorporated by reference herein in its entirety.
[0029] The IgG immunoglobulin molecule consists of four polypeptide chains, two identical light (L) chains and two identical heavy (H) chains. The four chains are joined by disulfide bonds in a “Y” configuration wherein the light chains bracket the heavy chains starting at the mouth of the “Y” and continuing through the variable region to the dual ends of the “Y”. Each L chain is linked to an H chain by one covalent disulfide bond, while the two H chains are linked to each other by one or more disulfide bonds depending on the H chain isotype. Each H and L chain also has regularly spaced intrachain disulfide bridges. Each heavy chain consists of an N-terminal variable domain (VH) and three constant domains (CHI, CH2, CH3), with an additional “hinge region” between CHI and CH2. Similarly, the light chains consist of an N-terminal variable domain (VL) and a constant domain (CL). The variable domains of the heavy chain and light chain may be referred to as “VH” and “VL”, respectively. These domains are generally the most variable parts of the antibody (relative to other antibodies of the same class) and contain the antigen binding sites. The VL is aligned with the VH and the CL is aligned with the first constant domain of the heavy chain (CHI). The pairing of a VH and VL together forms a single antigen-binding site. The part of the antibody formed by the lower hinge region and the CH2 / CH3 domains of the heavy chain is called “Fc” (“fragment crystalline”). See e.g., Basic and Clinical Immunology, 8th Edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw (eds), Appleton & Lange, Norwalk, CT, 1994, page 71 and Chapter 6, incorporated by reference herein in its entirety.
[0030] The variability in an antibody sequence is concentrated in three segments called complementarity determining regions (CDRs) (also called hypervariable regions (HVRs)) both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework regions (FR). The variable domains of native heavy and light chains each comprise four FRs, largely adopting a beta-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the beta-sheet structure. The CDRs in each chain are held together in close proximity by the FRs and, with the CDRs from the other chain, contribute to the formation of the antigen binding site of antibodies. See Kabat et al, Sequences of Immunological Interest, Fifth Edition, National Institute of Health, Bethesda, MD (1991), incorporated by reference in its entirety herein. The constant domains are not involved directly in the binding of antibody9ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
[0031] By way of example, CDRs may be defined using the nomenclature described by Kabat et al. (1991, NIH Publication 91-3242, National Technical Information Service, Springfield, Va.), incorporated by reference in its entirety herein. Specifically, residues 31- 35 (CDR-H1), 50-65 (CDR-H2), and 95-102 (CDR-H3) in the heavy chain variable region and residues 24-34 (CDR-L1), 50-56 (CDR-L2), and 89-97 (CDR-L3) in the light chain variable region.
[0032] However, antibodies are not limited to full-length antibodies. The antibodies of the various embodiments disclosed herein can include one or more of synthetic antibodies, monoclonal antibodies, oligoclonal or polyclonal antibodies, multiclonal antibodies, recombinantly produced antibodies, intrabodies, monospecific antibodies, monovalent antibodies, multispecific antibodies, multivalent antibodies, bispecific antibodies, bivalent antibodies, tetravalent antibodies, human antibodies, humanized antibodies, chimeric antibodies, CDR-grafted antibodies, primatized antibodies, Fab fragments, F(ab’) fragments, F(ab’)2 fragments, Fv fragments, single-chain FvFcs (scFv-Fc), single-chain Fvs (scFv), Dabs, nanobodies, anti -idiotypic (anti-Id) antibodies, and any other immunologically- reactive / antigen-binding fragments thereof. In some embodiments, the bispecific antibody comprises any of the designs described in Figure 2 of Brinkmann U, Kontermann RE, The making of bispecific antibodies, MAbs, 2017 Feb / Mar, 9(2): 182-212, PMID: 28071970 the content of which is hereby incorporated by reference in its entirety.
[0033] In some embodiments, the bispecific antibody is a tetravalent antibody comprising a first and a second heavy chain and a first and a second light chain N-terminal to an Fc region of an antibody, and a third and a fourth heavy chain and a third and a fourth light chain C-terminal to an Fc region of an antibody. In some embodiments, the first and the second heavy chains and the first and the second light chains contain portions that bind to a portion of a first epitope, and the third and the fourth heavy chains and the third and the fourth light chains contain portions that bind to a portion of a second epitope. In some embodiments, the first and the third heavy chains and the first and the third light chains contain portions that bind to a portion of a first epitope, and the second and the fourth heavy chains and the second and the fourth light chains contain portions that bind to a portion of a second epitope. In some embodiments, the bispecific antibody is a tetravalent antibody comprising, a first chain comprising an scFv with specificity for a first epitope, an Fc domain, and a second scFV with10ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 specificity for a second epitope and the second chain comprises an scFv with specificity for the first epitope, and Fc domain, and a second scFV with specificity for the second epitope.
[0034] In some embodiments, the bispecific antibodies disclosed herein contain various modifications, substitutions, additions, or deletions to the variable or binding regions of one or more arms. In some embodiments, the bispecific antibodies disclosed herein may contain substitutions or modifications of the constant region (i.e., the Fc region). The antibodies disclosed herein may contain one or more additional amino acid residue substitutions, mutations and / or modifications, which result in a compound with preferred characteristics including, but not limited to: altered pharmacokinetics, increased serum half-life, increase binding affinity, reduced binding affinity, reduced immunogenicity, increased production, altered Fc ligand binding, enhanced or reduced ADCC or CDC activity, altered glycosylation and / or disulfide bonds and modified binding specificity.Diseases
[0035] The diseases or conditions treated by the disclosure herein may be for any subject. As used herein, a “subject” can be a human, non-human primate, mammal, rat, mouse, cow, horse, pig, sheep, goat, dog, cat, insect and the like. In some embodiments, the subject is a human. In some embodiments, the disease or condition is caused by a dysregulation of one or more bestrophins. In some embodiments, the disease or condition is a Bestrophin (Best)- related disease. In some embodiments, the Bestrophin-related disease is caused by one or more mutations on a gene selected from BEST1, BEST2, BESTS, and BEST4. In some embodiments, the Bestrophin-related disease is a bestrophinopathy. In some embodiments, the disease or condition is Best vitelliform macular dystrophy (BVMD), adult-onset vitelliform macular dystrophy (AVMD), autosomal recessive bestrophinopathy (ARB), autosomal dominant vitreoretinochoroidopathy (ADVIRC), autosomal dominant microcornea, rod-cone dystrophy, early-onset cataract, posterior staphyloma syndrome (MRCS syndrome), age-related macular degeneration (AMD), retinitis pigmentosa (RP), or combinations thereof.
[0036] In some embodiments, the Bestrophin-related disease is associated with increased or decreased intraocular pressure (IOP) in the subject. In some embodiments, the IOP in the subject is above 21 mmHg. In some embodiments, the Bestrophin-related disease is glaucoma, myopia, pigment dispersion syndrome, pseudoexfoliation syndrome, age-related macular degeneration, or combinations thereof.
[0037] In some embodiments, the disease or condition is Alzheimer’s disease.11ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025
[0038] “Treating” or “treatment” as used herein covers the treatment of the disease or condition of interest in a mammal, preferably a human, having the disease or condition of interest, and includes (but is not limited to): a) preventing the disease or condition from occurring in a mammal, in particular, when such mammal is predisposed to the condition but has not yet been diagnosed as having it; b) inhibiting the disease or condition, e.g., arresting its development; c) relieving the disease or condition, e.g., causing regression of the disease or condition (ranging from reducing the severity of the disease or condition to curing the disease of condition); or d) relieving the symptoms resulting from the disease or condition, e.g., relieving pain without addressing the underlying disease or condition. As used herein, the terms “disease” and “condition” can be used interchangeably or can be different in that the particular malady or condition cannot have a known causative agent (so that etiology has not yet been worked out) and it is therefore not yet recognized as a disease but only as an undesirable condition or syndrome, wherein a more or less specific set of symptoms have been identified by clinicians.Routes of Administration and Dosages
[0039] Routes of administration and dosages of effective amounts of the pharmaceutical compositions are also disclosed. The agents of the present invention can be administered in combination with other pharmaceutical agents in a variety of protocols for effective treatment of disease. In some embodiments, the pharmaceutical composition is administered locally via an ophthalmic route of delivery, i.e., administered to a subject’s eye. Ophthalmic routes of delivery include, but are not limited to, topical, periocular (e.g., subconjunctival, sub-Tenon, retrobulbar, and peribulbar), intravitreal and intracam eral. In some embodiments, the pharmaceutical composition is administered topically via eye drops. In some embodiments, the pharmaceutical composition is administered systemically, e.g., via an oral route or a parenteral route.Pharmaceutical compositions
[0040] A “pharmaceutical composition” refers to a formulation of a compound of the invention and a medium generally accepted in the art for the delivery of the biologically active compound to mammals, e.g., humans. Such a medium includes all pharmaceutically12ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 acceptable carriers, diluents or excipients therefor. A pharmaceutical composition may be suitable for any route of administration, including, for example, local or systemic administrations.
[0041] Pharmaceutical compositions are administered to a subject in a manner known in the art. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
[0042] An “effective amount” refers to a therapeutically effective amount or a prophylactically effective amount. A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of a compound can vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the compound to elicit a desired response in the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the compound are outweighed by the therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result, increased life span, increased life expectancy or prevention of the progression of the disease or condition.Typically, a prophylactic dose is used in subjects prior to or at an earlier stage of disease, so that a prophylactically effective amount can be less than a therapeutically effective amount.
[0043] One of ordinary skill in the art will appreciate that a method of administering pharmaceutically effective amounts of the pharmaceutical compositions to a patient in need thereof, can be determined empirically, or by standards currently recognized in the medical arts. The pharmaceutical compositions can be administered to a patient as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents of the pharmaceutical compositions will be decided within the scope of sound medical judgment by the attending physician. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the type and degree of the cellular response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, gender and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific13ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 agent; and like factors well known in the medical arts. It is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.EXAMPLE 1: GAD65 and GAD67 tune the anion channel function of Bestl.
[0044] The human BEST1 gene encodes a Ca2+-activated anion channel (bestrophin-1, Bestl) predominantly expressed in retinal pigment epithelium (RPE)1, and its genetic mutations, of which over 350 have been identified, cause a spectrum of at least five retinal degenerative diseases collectively known as bestrophinopathies2,3. The patients are susceptible to progressive vision loss which may eventually lead to blindness, and no treatments are currently available2'4. Therefore, understanding the physiological properties and cellular regulators of Bestl is critical for the development of treatment strategy for bestrophinopathies.
[0045] A clinical feature manifested by Bestl mutation carriers is abnormal electrooculogram (EOG) light peak (LP), which represents the depolarization of the basolateral membrane of RPE due to the activation of a Cl' conductance triggered by the increase of intracellular Ca2+concentration ([Ca2+]i)5'7. We previously demonstrated that Bestl is the anion channel responsible for conducting this Ca2+-dependent Cl' currents in human RPE8'11. However, several lines of evidence strongly suggest the existence of uncharacterized RPE-specific facilitator(s) of Bestl in vivo.
[0046] Firstly, although the currents in RPE cells conducted by endogenous or exogenously supplemented Bestl are similar to each other, they are significantly bigger compared to those conducted by transiently expressed Bestl in HEK293 cells8,9’12’13. Secondly, Bestl has been shown by cell-based approaches to mediate the transport of essential metabolites / neurotransmitters which are much bulkier in size compared to Cl', such as glutamate in RPE14, as well as GABA and glutamate in astrocytes15'20. However, purified chicken Bestl is impermeable to glutamate21, while Ca2+-bound Bestl structure shows partially open channel gates along the ion conducting pathway, whose sizes are sufficient for Cl' but far insufficient for glutamate or GABA to pass through22. Therefore, we speculate that there are native Bestl facilitator(s) that promote opening of the channel gates to enhance the permeability of Bestl to Cl' and metabolites / neurotransmitters (e.g. glutamate) in RPE.
[0047] In this work, we identified both isoforms of glutamic acid decarboxylases, GAD65 and GAD67, as interacting activators of Bestl. While both isoforms stimulated Bestl -mediated Cl- permeation, GAD65 also increased the permeability of Bestl to14ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 neurotransmitters glutamate and y- Aminobutyric acid (GABA). Physiologically, we demonstrated the activator role of GAD65 for Bestl in RPE cells. Further discussion regarding interactions between GAD65, GAD67, and Bestl can be found in Jiali Wang et al., GAD65 Tunes the Functions of Bestl as a GABA Receptor and a Neurotransmitter Conducting Channel, Nature Communications 15:8051 (2024), the disclosure of which is incorporated herein by reference in its entirety and for all purposes.GAD65 and GAD67 interact with Bestl
[0048] We recently identified glutamine synthetase (GS) as a binding partner and regulator of bestrophin-2 (Best2), a paralog of Bestl within the same protein family, and found that Best2 conducts both glutamate and glutamine, the substrate and product of GS, respectively23. This raises the possibility that Bestl may interact with glutamic acid decarboxylase (GAD), the enzyme whose substrate- glutamate and product- GABA have both been reported to rely on the Bestl channel for transmembrane transport15'20.
[0049] There are two isoforms of GAD enzymes in mammals, namely GAD65 and GAD67. To probe the interaction(s) between Bestl and them, Cerulean-Myc tagged human GAD65 / GAD67 and Venus-His tagged human Bestl were co-transfected into HEK293 cells for co-immunoprecipitation analysis. Both GAD65 and GAD67 were co-immunoprecipitated with Bestl (Fig. la and Fig. 2a), suggesting interactions between these proteins.GAD65 and GAD67 enhance Bestl-mediated Ca2+-dependent Cl- currents
[0050] To examine the functional influences of the GAD proteins on the channel, Bestl was transfected alone or co-transfected with GAD65 or GAD67 into HEK293 cells, and the Ca2+-dependent CF currents were measured by whole-cell patch clamp across a range of free intracellular Ca2+concentrations ([Ca2+]i) with CF as the principal anion in both external and internal patch solutions. From cells expressing Bestl alone, a plot of peak current (evoked with a +100 mV step pulse) as a function of [Ca2+]i displayed Ca2+-dependent activation with the Ca2+half-maximal effective concentration (ECso) at 173 pM (Fig. lb)24. The ECso values measured from cells co-expressing Bestl and GAD65 / GAD67 are similar to that of Bestl alone (152 pM and 133 pM, respectively, Fig. 1c, d), indicating that GAD65 or GAD67 does not affect the Ca2+sensitivity of Bestl. On the other hand, the current amplitudes from cells co-expressing Bestl and GAD65 or GAD67 were significantly bigger compared to those from cells expressing Bestl alone at all tested [Ca2+]is (Fig. Ic-f), indicating a positive influence of GAD65 / GAD67 on CF conductance of Bestl. The overall and membrane-bound15ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 protein levels of Bestl were unaltered upon co-expression of GAD65 or GAD67 (Fig. 2a, b), suggesting that neither GAD65 nor GAD67 promotes Bestl -mediated currents by increasing the protein expression or membrane localization of the channel.GAD65 but not GAD67 promotes Bestl ’s permeability to glutamate and gluconate
[0051] To test whether Bestl alone conducts glutamate, we transfected Bestl into HEK293 cells for whole-cell patch clamp. Very small currents were recorded at 1 pM [Ca2+]i (peak Ca2+) with glutamate as the principal anion in both external and internal patch solutions (Fig. 3a, black), suggesting that Bestl by itself barely conducts glutamate. To measure the relative permeability of glutamate to CF on Bestl, currents were recorded with glutamate and CF as the principal anion in the external and internal solution, respectively. The reversal potential of Bestl was shifted significantly to the right (Erev = 49.7 ± 3.7 mV, Fig. 3b, black), and the relative permeability of glutamate to CF (PGIU / PCI) was calculated to 0.08 by the Goldman-Hodgkin-Katz equation (Fig. 3c, black).
[0052] To probe the influence of GAD65 / GAD67 on Bestl’ s glutamate permeability, Bestl was co-transfected with GAD65 or GAD67 into HEK293 cells and subjected to patch clamp analysis under the same conditions. Strikingly, robust glutamate currents were recorded in cells co-expressing Bestl and GAD65 (Fig. 3a, red solid), but not in those coexpressing Bestl and GAD67 (Fig. 3a, red open). Moreover, the relative permeability of glutamate to CF on Bestl was drastically increased to 0.94 upon GAD65 co-expression, but remained low at 0.13 upon GAD67 co-expression (Fig. 3c, red).
[0053] To further validate these results, the same set of patch clamp experiments were performed with gluconate replacing glutamate in the patch solutions. Consistently, tiny gluconate currents were recorded in cells expressing Bestl alone or co-expressing Bestl and GAD67, in sharp contrast to the robust gluconate currents in cells co-expressing Bestl and GAD65 (Fig. 3d, e). Meanwhile, Poiuc / Pci on Bestl was drastically increased from 0.07 to 0.98 by GAD65, but not altered by GAD67 (Fig. 3f).
[0054] Together, our results suggest that although both isoforms of GAD can interact with Bestl and promote its CF currents, only GAD65 stimulates Bestl to conduct large anions such as glutamate and gluconate.Involvement of the neck and aperture
[0055] The gating of Bestl channel is primarily mediated by two Ca2+-dependent gates, the neck and the aperture, in the ion conducting pathway22,25'27. We previously found that16ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025Ca2+-binding only partially opens the neck and aperture in wild-type (WT) Bestl to a radius of - 2.0 A, which is insufficient to accommodate large anions such as glutamate and gluconate (both with a radius of - 3.5 A). Consistently, Bestl exhibits a very low permeability to glutamate or gluconate (Fig. 3). To investigate the contributions of the neck and aperture in restricting glutamate, we utilized two previously reported Bestl mutants, one with triple alanine substitutions at the neck (I76A / F80A / F84A, or 3 A for abbreviation), and the other with a single alanine substitution at the aperture (I205A)26. The 3 A and I205A mutants are specifically deficient for gating at the neck and aperture, respectively, due to replacement of constriction-forming residues with the shorter side-chained alanine, which mimics a constantly open state22,25,26. Therefore, the involvement of the aperture and neck in glutamate permeation can be separately examined.
[0056] Patch clamp was performed using HEK293 cells transiently expressing Bestl -3 A or Bestl -1205 A alone or co-expressing Bestl-3A / Bestl-I205A plus GAD65 / GAD67, with CF or glutamate as the principal anion in both internal and external solutions. While both isoforms of GAD caused a similar increase of CT currents (Fig. 4a, e), only GAD65 significantly enhanced glutamate currents mediated by either Bestl -3 A or Bestl -1205 A (Fig. 4b, f). Then, currents were recorded with glutamate and CF as the principal anion in the external and internal solution, respectively. Under this bi-ionic condition, the reversal potential was measured as 50.4 ± 7.2 mV and 16.2 ± 1.8 mV for Bestl-3A and Bestl-I205A, respectively (Fig. 4c and 4g, black), corresponding to a relative permeability of glutamate to CF as 0.1 and 0.5, respectively (Fig. 4d and 4h, black). Moreover, the relative permeability of glutamate to CF of Bestl was not significantly affected by GAD67 but drastically increased by GAD65: from 0.1 to 1.0 for Bestl-3A, and from 0.5 to 0.9 for Bestl -1205 A (Fig. 4d and 4h).
[0057] Taken together, these results are consistent with our previous finding that both the neck and aperture play critical roles in channel gating and ion selectivity, and suggest that GAD65 helps open up both the neck and aperture, presumably to a fully open state, for conducting glutamate, whereas GAD67 increases the open probability of both the neck and aperture but they are still in a partially open state to restrict glutamate.The C-terminus of Bestl is critical for GAD-mediated activation
[0058] Bestrophin paralogs are highly conserved in the transmembrane region, which occupies the first -2 / 3 length of the protein, but very diverse in the C-terminal -1 / 3 portion, which constitutes a long intracellular tail. We previously reported that Bestl 1-405, which17ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 contains the first 405 residues of Bestl, conducts Ca2+-dependent Cl’ currents similar to those from the WT Bestl in transiently transfected HEK293 cells22. To examine the involvement of the C-terminal tail in the interactions between Bestl and GAD65 / GAD67, Venus-tagged Bestl 1-405 was co-transfected with Cerulean-tagged GAD65 or GAD67 into HEK293 cells, and subjected to patch clamp and co-immunoprecipitation. Remarkably, Cl’ currents from Bestl 1-405 were not affected by GAD65 or GAD67 (Fig. 5a), and Bestl 1-405 was not coimmunoprecipitated with GAD65 or GAD67 (Fig. 5b and Fig. 2a). These results strongly suggest that the C-terminal tail of Bestl is necessary for the interaction with GAD65 and GAD67, as well as the impact of GAD proteins on Bestl .
[0059] To further delineate the GAD65 / GAD67 effector region(s) on Bestl, we generated C-terminal serial truncations (with the Venus-His tag) containing the first 450 (Bestl 1-450), 490 (Bestl 1-490), or 545 (Bestl 1-545) residues of Bestl, respectively. These truncation mutants were transfected alone or individually co-transfected with Cerulean-Myc tagged GAD65 / GAD67 into HEK293 cells for whole-cell patch clamp. As expected, each of them alone conducted Ca2+-dependent Cl’ currents similar to those from full-length (FL) Bestl (Bestl 1 -585) and Bestl 1-405 (Fig. 5c, d and Fig. 6). Upon co-expression of GAD65 or GAD67, currents from Bestl 1-490 and Bestl 1-545 were gradually increased compared to those from Bestl 1 -405, but still smaller than those from FL Bestl, while currents from Bestl 1-450 were unaffected just like Bestl 1-405 (Fig. 5c, d and Fig. 6). Moreover, none of the Bestl truncations conducted elevated glutamate currents in the presence of GAD65 (Fig. 5e). These results suggest that residues 451-585 in the C-terminus of Bestl are critical for the GAD65 / GAD67- mediated stimulation.GABA’s poor permeability on Bestl
[0060] Since GABA is the product of GAD65 / GAD67, we tested if Bestl is permeable to GABA by patch clamp using transiently transfected HEK293 cells with GABA as the principal passing ion in the external solution and Cl’ as the only anion in the internal solution. The reversal potential of Bestl was drastically shifted to the right (Erev = 51.7 ± 6.2 mV, Fig. 5a, black), corresponding to a low relative permeability of GABA to Cl’ (PGABA / PCI) of 0.09 (Fig. 7b, black). Under the same patch conditions, the PGABA / PCI remained low at 0.05 for Bestl-3A but increased to 1.01 for Bestl-I205A (Fig. 7c-f, black), indicating that the aperture but not the neck plays a critical role in GABA selectivity.18ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025GAD65 but not GAD67 promotes Bestl’s permeability to GABA
[0061] To probe the influence of GAD65 / GAD67 on Bestl’s GABA permeability, Bestl was co-transfected with GAD65 or GAD67 into HEK293 cells and subjected to patch clamp analysis with GABA as the principal passing ion in the external solution and Cl’ as the only anion in the internal solution. The relative permeability of GABA to Cl’ remained at 0.09 in the presence of GAD67, but drastically increased to 0.97 in the presence of GAD65 (Erev = 48.7 ± 4.0 mV and Erev = 0.8 ± 0.9 mV, respectively in Fig. 7a, b). These results strongly suggest that GAD65 but not GAD67 promotes the permeability of Bestl to GABA, which is consistent with the enhancement of glutamate and gluconate permeation on Bestl by GAD65 but not by GAD67 (Fig. 3). As expected, both GAD65 and GAD67 constantly increased inward Cl’ currents under this condition (Fig. 7a), recapturing the promotive effect of both GAD proteins on Bestl -mediated Cl’ conductance (Fig. 1).
[0062] To investigate how GADs affect Bestl channel gates for GABA permeation, we performed the same set of experiments with the Bestl -3 A and Bestl -1205 A mutants. With Bestl -3 A, the relative permeability of GABA to Cl’ was not significantly affected by GAD67 but dramatically increased from 0.05 to 0.98 by GAD65 (Fig. 7c, d), suggesting that GAD65 but not GAD67 fully opens the aperture to accommodate GABA. By contrast, with Bestl - 1205 A, neither GAD65 nor GAD67 had any significant influence on the current amplitude or the relative permeability of GABA to Cl’ (Fig. 7e, f). These results are consistent with the idea that extracellular GABA opens the neck while the 1205 A mutation mimics an open aperture, such that neither GAD65 nor GAD67 would have any additional effect on the already fully opened Bestl -1205 A mutant channel in the presence of extracellular GABA.
[0063] Based on our structural and electrophysiological results, we propose a model for the regulation of Bestl by GADs: both GAD65 and GAD67 facilitate opening of the two Bestl channel gates, resulting in elevated Cl’ currents, but only GAD65 promotes full opening of the gates to accommodate large anions such as GABA and glutamate.Bestl and GADs in RPE cells
[0064] We previously showed that Ca2+-dependent Cl’ currents in RPE cells mediated by endogenously expressed or exogenously supplemented Bestl are significantly bigger compared to those from transiently expressed Bestl in HEK293 cells (Figs. If and 8a, b)8,9,13, strongly suggesting the existence of facilitating co-factor(s) of Bestl in RPE. As GAD65 and GAD67 are promising candidates, we measured the mRNA levels of GAD65 and GAD67 in19ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 donor-derived BEST1WT / WTRPE (WT iPSC-RPE) cells by reverse transcription-polymerase chain reaction (RT-PCR). A much higher level of GAD65 transcripts was detected compared to that of GAD67 (Fig. 9a), suggesting a primary involvement of GAD65. Consistently, GAD65 was pulled down from iPSC-RPE cell lysate by Ni-NTA beads bound with purified Bestl (Fig. 2c). Then, iPSC-RPE cells were transfected with small interference RNA (siRNA) specifically targeting Bestl, GAD65 or GAD67 (Figs. 2d and 9b-d), and subjected to patch clamp analysis. Ca2+-dependent CF currents were completely abolished upon Bestl knockdown and significantly decreased upon GAD65 knockdown but not upon GAD67 knockdown (Fig. 8b, c), suggesting an essential role of GAD65, but not GAD67, in facilitating native Bestl channel function in RPE cells.
[0065] Previously, Bestl has been suggested to mediate glutamate release induced by a PKC-(^ pseudosubstrate in rat RPE cells via indirect measurements14, but Ca2+-dependent glutamate current has never been directly recorded in RPE cells, let alone its biophysical properties and the contribution of Bestl. To fill these gaps, patch clamp was performed in iPSC-RPE cells with glutamate as the principal anion in both internal and external solutions. Robust Ca2+-dependent glutamate currents were recorded in WT iPSC-RPE cells, and were abolished upon Bestl knockdown by siRNA (Fig. 8d), providing a direct evidence that Bestl mediates Ca2+-dependent glutamate release in human RPE. Moreover, the glutamate currents in WT iPSC-RPE cells were diminished upon the treatment of GAD65-specific siRNA (Fig. 8e), consistent with the results from HEK293 cells that GAD65 plays an indispensable role in permitting glutamate permeation through the Bestl channel (Fig. 3).
[0066] To investigate whether RPE cells are capable of conducting GABA through Bestl, patch clamp was performed in WT iPSC-RPE cells with GABA as the principal passing ion in the external solution and CF as the only anion in the internal solution. Robust currents were recorded both inwardly (CF efflux) and outwardly (GABA influx), and were diminished upon Bestl knockdown (Fig. 8f), demonstrating the capacity of Bestl to mediate GABA transport in human RPE. Moreover, GABA (outward) currents in iPSC-RPE cells were diminished upon the treatment of GAD65-specific siRNA, consistent with the results from HEK293 cells that GAD65 plays an indispensable role in facilitating GABA permeation through the Bestl channel (Fig. 7a, b).
[0067] The Bestl channel has been shown to permeate various anions including CF, Br , I", SCN’, NCh’, HCCh’ and CEESCh' in transiently expressed HEK293 cells26,29'32. Here, we report that both isoforms of GAD proteins interact with Bestl via its C-terminal tail on the20ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 intracellular side and regulate the channel function. While they both exhibit a similar stimulating effect on Bestl -mediated Cl’ currents, only GAD65 enhances the permeability of Bestl to large metabolites / neurotransmitters such as glutamate and GABA, presumably by promoting full opening of both the neck and aperture. Importantly, GABA and glutamate may represent the primary anions conducted by Bestl, rather than Cl’, in different cell types.
[0068] As Bestl was originally identified as a Ca2+-activated Cl’ channel, Ca2+has been recognized as the primary activator of Bestl. Our results in this study reveal GAD proteins as novel Bestl activators which are required, in addition to Ca2+, for the full activation of Bestl, as the peak currents conducted by Bestl are significantly bigger in the presence of GAD compared to those in their absence. Although the structures of GAD65- or GAD67-bound Bestl have not been obtained, patch clamp data strongly suggest that both channel gates would adapt to a fully open state upon GAD65 binding, but remain in a partially open state with higher open probability upon GAD67 binding.Our results show that Bestl and GAD65 are co-expressed in RPE cells (Fig. 8 and Figs. 2c, 9a). Besides RPE-specific localization in the eye, Bestl is also expressed in various regions and cell types of the brain, including cortical and hippocampal astrocytes, cerebellar Bergmann glia and lamellar astrocytes, thalamic reticular neurons, meninges, and choroid plexus epithelial cells16,17’19’20’33'41. Notably, Bestl has been suggested to mediate glutamate and tonic GABA release from astrocytes under various physiological or pathological conditions16’17’19’20’36'38’41'44, suggesting the co-existence of Bestl and GAD65 in astrocytes.
[0069] RPE plays an essential role in maintaining metabolic homeostasis of the neural retina, where glutamate and GABA serve as the major excitatory and inhibitory neurotransmitters, respectively. A recent study showed that glutamate can be synthesized from proline in RPE and exported to the neural retina, whereas GABA effluxes from the retina to the RPE45. As GAD65 directly converts glutamate to GABA and drastically enhances the permeability of Bestl to glutamate and GABA, our findings suggest a critical involvement of Bestl in the glutamate-GABA metabolism / recy cling in the eye. We speculate that the deficiency of this balance caused by Bestl mutations may contribute to the pathology of bestrophinopathies.21ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025MethodsCell Lines
[0070] HEK293 cells were purchased from ATCC (CRL-1573), authenticated by short tandem repeat (STR) DNA profiling, and cultured in DMEM (4.5 g / L glucose, Corning 10013CV) supplemented with 100 pg / mL penicillin-streptomycin and 10% fetal bovine serum. HEK293F cells were purchased from Thermo Fisher Scientific (R79007) and cultured in FreeStyle™ 293 Expression Medium supplemented with 2% fetal bovine serum. No mycoplasma contamination was found by DAPI staining.Transfection
[0071] 20-24 h before transfection, cells were split into new 3.5 cm culture dishes at 50% confluency. Plasmid and siRNA transfections were conducted using the PolyJet Transfection Reagent (SignaGen SL100688) and Lipofectamine RNAiMAX Reagent (Invitrogen 13778- 030), respectively. The transfection mix was removed after 4-8 h, and cells were washed with PBS and fed with fresh media until downstream analysis or harvest.Immunoprecipitation
[0072] Cells were harvested 48 h post transfection by centrifugation at 1,000 x g for 5 min at room temperature. Cell pellets were lysed in pre-cooled lysis buffer (150 mM NaCl, 50 mM Tris, 0.5% IGEPAL® CA-630, pH 7.4) supplemented with protease inhibitor cocktails (Roche, 04693159001) for 30 min on ice, and then centrifuged at 15,000 x g for 12 min at 4 °C. The supernatant (300 pg) was collected and mixed with 2 pg His-tag antibody (Thermo Fisher Scientific, MAI-135). After rotating overnight at 4°C, the mixture was incubated with Dynabeads M-280 sheep anti-mouse IgG (Thermo Fisher Scientific, 11202D) for 5 h at 4 °C. After thorough washing of the beads, bound proteins were eluted in lx SDS sample buffer (Bio-Rad, 1610747) by heating for 10 min at 75 °C. Co-immunoprecipitation samples and 1 / 10 of input (30 pg) were then resolved by SDS-PAGE and analyzed by immunoblotting.In vitro pull-down of interacting proteins
[0073] Bestl-Ven-His was purified by affinity chromatography25’47. The protein was bound to Ni-NTA resin by end-over-end rotation for 20-30 min and washed in 5-10 column volumes of buffer containing (in mM): 50 HEPES pH 7.8, 300 NaCl, 40 Imidazole, 5 MgCh, 5% (v / v) glycerol, 0.05% (w / v) n-dodecyl P-d-maltopyranoside (DDM) and then another 5-22ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 202510 column volumes of buffer containing (in mM): 25 HEPES pH 7.8, 500 NaCl, 75 Imidazole, 5% (v / v) glycerol, 0.05% (w / v) DDM.
[0074] iPSC-RPE cells were harvested and the cell pellet was resuspended in the same resuspension buffer as Bestl and homogenized by a motor-driven tissue grinder. The resultant homogenate was lysed by sonication and incubated in 1% (w / v) sol -grade DDM for 1 h with vigorous rotation. The lysate was centrifuged at 15,000 x g for 12 min at 4 °C to pellet non-soluble material. The resultant supernatant and Bestl-bound Ni-NTA resin were incubated with end-to-end rotation overnight at 4 °C.
[0075] On day 2, the pull-down resin was washed with the same buffers and procedures as on Day 1, and subjected to elution with one volume of elution buffer equivalent to the volume of solid Ni-NTA resin. The elution buffer contained (in mM): 25 HEPES, 200 NaCl, 5% (v / v) glycerol, 500 Imidazole, 0.05% (w / v) DDM. The eluted samples were collected for immunoblotting.Immunoblotting
[0076] The M-PER Mammalian Protein Extraction Reagent (Thermo Fisher Scientific 78501) and Mem-PER Plus Membrane Protein Extraction Kit (Thermo Fisher Scientific 89842) were used to prepare the whole-cell lysate and membrane fraction, respectively. After denaturing at 95 °C for 5 min, samples were run on 4-15% gradient SDS-PAGE gel at room temperature, and wet transferred onto nitrocellulose membrane at 4 °C. The membranes were incubated in blocking buffer containing 5% (w / v) non-fat milk for 1 h at room temperature, and subsequently incubated overnight at 4 °C in blocking buffer supplemented with primary antibody. Primary antibodies against the following proteins were used: GFP (1 :1,000, Thermo Fisher Scientific, A-6455), His (1 : 1,000, Thermo Fisher Scientific, PA5-141016), Myc (1 : 1,000, Thermo Fisher Scientific, PA5-141014), GAD65 (1 : 1,000, Thermo Fisher Scientific, 39-8200) and P-Actin (1 : 1,000, Thermo Fisher Scientific MA5-15739). IRDye® 680RD Goat anti-Mouse IgG (LI-COR, 926-68070) and IRDye® 800CW Donkey antiRabbit IgG (LI-COR, 925-32213) were used at a concentration of 1 : 10,000 and an incubation time of 1 h at room temperature, followed by infrared imaging on a Bio-Rad ChemiDoc system.Electrophysiology
[0077] Whole-cell patch clamp recording was conducted 24-96 h after splitting of RPE cells or transfection of HEK293 cells with EPC 10 patch clamp amplifier (HEKA Electronics)23ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025 controlled by Patchmaster v2x90.5 (HEKA)9,13. Micropipettes were pulled and fashioned from filamented 1.5 mm thin-walled glass (WPI Instruments). Series resistance was typically 1.5-2.5 M , with no electronic series resistance compensation. Experiments were conducted at room temperature (23 ± 2 °C). Liquid junction potentials were measured and corrected using HEKA built-in functions. The standard zero Ca2+pipette (internal) solution contained (mM): 146 CsCl, 2 MgCh, 5 EGTA, 2 MgATP (added fresh), 10 HEPES, pH 7.3 adjusted with NMDG. Solutions with various free Ca2+concentrations were made by mixing CaCh with EGTA as calculated by the MaxChelator Program, and the free Ca2+concentration was verified using a Ca2+ion-selective electrode. The standard extracellular solution contained (mM): 140 NaCl, 5 KC1, 2 CaCh, 1 MgCh, 15 glucose, 10 HEPES, pH 7.4 with NMDG. In glutamate containing solutions, 140 mM Cl’ was replaced with 140 mM glutamate in the standard external solution, and 146 Cl’ was replaced with 146 mM glutamate in the standard internal solution. In gluconate containing solutions, 140 mM Cl’ was replace with 140 mM gluconate in the standard external solution, and 146 Cl’ was replaced with 146 mM gluconate in the standard internal solution. In GABA containing solutions, 140 mM, 20 mM, 100 pM, 10 pM, 1 pM, 100 nM, 10 nM or 1 nM Cl’ was replaced with the same concentration of GABA in the standard external solution, and 20 mM Cl’ was replaced with 20 mM GABA in the standard internal solution. Solution osmolarity was adjusted to 290-310 mOsm / L with glucose, and -5 mOsm lower in the internal solutions than the external solutions of the same experiment. The low and high Ca2+solutions in the same set of experiments were adjusted to the exact same osmolarity. Solution changes were performed manually.Electrophysiological Data Collection and Analyses
[0078] Traces were acquired at a repetition interval of 4 s28. Currents were sampled at 25 kHz and filtered at 5 or 10 kHz. I-V curves were generated from a group of step potentials (- 100 to +100 mV from a holding potential of 0 mV). Data were processed off-line in Patchmaster. Statistical analyses were performed using built-in functions in OriginPro 8.5. Relative permeability was calculated according to the Goldman-Hodgkin-Katz equation. The relative GABA / C1’ (with GABA or Cl’ in the external solution) inward movement (outward current) conductance (GGABA with BX-GABA / GCI with ex-ci) was measured as slope conductance at the reversal potential plus 50 mV. The trans effect, representing the relative Cl’ (in the internal solution) outward movement (inward current) conductance (Gci with BX-GABA / GCI with ex- ci) was measured as slope conductance at the reversal potential minus 50 mV. The “n” value in patch clamp recording figure legends indicates the total number of individual cells.24ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025Molecular Cloning
[0079] All constructs were made by site-directed mutagenesis PCR with the In-fusion Cloning Kit (Takara, 638948) and verified by sequencing. siRNAs
[0080] Predesigned gene-specific and negative control siRNAs were purchased from MilliporeSigma: Bestl (SASI_Hs01_00055652), GAD65 (SASI_Hs01_00094409), GAD67 (SASI_Hs01_00039951) and scramble (SIC001). qRT-PCR
[0081] Total RNA was extracted from cell pellets with the PureLink RNA Mini Kit (Thermo Fisher Scientific, 12183020) and subjected to cDNA synthesis using the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific, K1621). The resultant cDNA was used as the template for qPCR amplification with gene-specific primer sets: Bestl, CTGCTGCTGTGCTGGC and GTTCTTCCGTGAGGGCCAG; GAD65, GGGAATTGGCAGACCAACCAC and CCAGTCTGCTGCTAATCCAACCA; GAD67, GGATGCACCAGAAAACTGGGG and GCAGGTTCTTGGAGGATTGCC; P-Actin, CACCATTGGCAATGAGCGGTTC and AGGTCTTTGCGGATGTCCACGT.Statistics and Reproducibility
[0082] A sufficient number of samples were examined to reach statistical conclusion according to the specific method utilized in that experiment. Statistically significant differences (p < 0.05) between means of two groups were determined by two-tailed unpaired
[0083] Student’s / test. Data are presented as means values + / - SEM. Immunoblotting and pull down experiments were biologically replicated three times with similar results.
[0084] References1 Owji, A. P., Kittredge, A., Zhang, Y. & Yang, T. Structure and Function of the Bestrophin family of calcium-activated chloride channels. Channels (Austin) 15, 604- 623, doi: 10.1080 / 19336950.2021.1981625 (2021).2 Johnson, A. A. el al. Bestrophin 1 and retinal disease. Progress in retinal and eye research, doi: 10.1016 / j.preteyeres.2017.01.006 (2017).3 Petrukhin, K. et al. Identification of the gene responsible for Best macular dystrophy. Nat Genet 19, 241-247, doi: 10.1038 / 915 (1998).25ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 20254 Yang, T., Justus, S., Li, Y. & Tsang, S. H. BEST1 : the Best Target for Gene and Cell Therapies. Molecular therapy : the journal of the American Society of Gene Therapy 23, 1805-1809, doi: 10.1038 / mt.2015.177 (2015).5 Fujii, S., Gallemore, R. P., Hughes, B. A. & Steinberg, R. H. Direct evidence for a basolateral membrane Cl- conductance in toad retinal pigment epithelium. The American journal of physiology 262, C374-383 (1992).6 Gallemore, R. P. & Steinberg, R. H. Light-evoked modulation of basolateral membrane Cl- conductance in chick retinal pigment epithelium: the light peak and fast oscillation. Journal of neurophysiology I , 1669-1680 (1993).7 Gallemore, R. P. & Steinberg, R. H. Effects of DIDS on the chick retinal pigment epithelium. II. Mechanism of the light peak and other responses originating at the basal membrane. The Journal of neuroscience : the official journal of the Society for Neuroscience 9, 1977-1984 (1989).Li, Y. et al. Patient-specific mutations impair BESTROPHINl's essential role in mediating Ca2+-dependent Cl- currents in human RPE. eLife 6, doi: 10.7554 / eLife.29914 (2017).9 Zhao, Q. et al. Distinct expression requirements and rescue strategies for BEST1 loss- and gain-of-function mutations. eLife 10, doi: 10.7554 / eLife.67622 (2021).10 Kittredge, A., Ji, C., Zhang, Y. & Yang, T. Differentiation, Maintenance, and Analysis of Human Retinal Pigment Epithelium Cells: A Disease-in-a-dish Model for BEST1 Mutations. J Vis Exp, doi: 10.3791 / 57791 (2018).11 Kittredge, A., Zhang, Y. & Yang, T. Evaluating BEST1 mutations in pluripotent stem cell-derived retinal pigment epithelial cells. Methods in enzymology 654, 365-382, doi: 10.1016 / bs.mie.2021.01.004 (2021).12 Zhang, Y. et al. ATP activates bestrophin ion channels through direct interaction.Nature communications 9, 3126, doi: 10.1038 / s41467-018-05616-4 (2018).13 Ji, C. et al. Investigation and Restoration of BEST1 Activity in Patient-derived RPEs with Dominant Mutations. Scientific reports 9, 19026, doi : 10.1038 / s41598-019- 54892-7 (2019).14 Lee-Rivera, I., Lopez, E., Alvarez-Arce, A. & Lopez-Colome, A. M. The PKC-zeta pseudosubstrate peptide induces glutamate release from retinal pigment epithelium cells through kinase- independent activation of Bestl. Life Sci 265, 118860, doi: 10.1016 / j.lfs.2020.118860 (2021).26ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 202515 Han, K. S. et al. Channel-mediated astrocytic glutamate release via Bestrophin-1 targets synaptic NMD ARs. Molecular brain 6, 4, doi: 10.1186 / 1756-6606-6-4 (2013).16 Jo, S. et al. GABA from reactive astrocytes impairs memory in mouse models of Alzheimer's disease. Nature medicine 20, 886-896, doi: 10.1038 / nm.3639 (2014).17 Lee, S. et al. Channel-mediated tonic GABA release from glia. Science 330, 790-796, doi: 10.1126 / science.1184334 (2010).18 Oh, S. J. et al. Protease activated receptor 1 -induced glutamate release in cultured astrocytes is mediated by Bestrophin-1 channel but not by vesicular exocytosis. Molecular brain 5, 38, doi:10.1186 / 1756-6606-5-38 (2012).19 Park, H. et al. High glutamate permeability and distal localization of Bestl channel in CAI hippocampal astrocyte. Molecular brain 6, 54, doi: 10.1186 / 1756-6606-6-54 (2013).20 Woo, D. H. et al. TREK-1 and Bestl channels mediate fast and slow glutamate release in astrocytes upon GPCR activation. Cell 151, 25-40, doi: 10.1016 / j. cell.2012.09.005 (2012).21 Vaisey, G., Miller, A. N. & Long, S. B. Distinct regions that control ion selectivity and calcium-dependent activation in the bestrophin ion channel. Proceedings of the National Academy of Sciences of the United States of America 113, E7399-E7408, doi: 10.1073 / pnas.1614688113 (2016).22 Owji, A. P. et al. Structures and gating mechanisms of human bestrophin anion channels. Nature communications 13, 3836, doi: 10.1038 / s41467-022-31437-7 (2022).23 Owji, A. P. et al. Bestrophin-2 and glutamine synthetase form a complex for glutamate release. Nature 611, 180-187, doi: 10.1038 / s41586-022-05373-x (2022).24 Qu, Z., Fischmeister, R. & Hartzell, C. Mouse bestrophin-2 is a bona fide Cl(-) channel: identification of a residue important in anion binding and conduction. The Journal of general physiology 123, 327-340, doi: 10.1085 / jgp.200409031 (2004).25 Owji, A. P. et al. Structural and functional characterization of the bestrophin-2 anion channel. Nature structural & molecular biology 27, 382-391, doi: 10.1038 / s41594- 020-0402-z (2020).26 Ji, C. et al. Dual Ca(2+)-dependent gates in human Bestrophinl underlie diseasecausing mechanisms of gain-of-function mutations. Commun Biol 2, 240, doi : 10.1038 / s42003 -019-0433 -3 (2019).27ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 202527 Yang, T. et al. Structure and selectivity in bestrophin ion channels. Science 346, 355- 359, doi: 10.1126 / science.1259723 (2014).28 Kane Dickson, V., Pedi, L. & Long, S. B. Structure and insights into the function of a Ca(2+)-activated Cl(-) channel. Nature 516, 213-218, doi: 10.1038 / naturel3913 (2014).29 Qu, Z. & Hartzell, H. C. Bestrophin Cl- channels are highly permeable to HCO3.American journal of physiology. Cell physiology 294, C1371-1377, doi: 10.1152 / ajpcell.00398.2007 (2008).30 Sun, H., Tsunenari, T., Yau, K. W. & Nathans, J. The vitelliform macular dystrophy protein defines a new family of chloride channels. Proceedings of the National Academy of Sciences of the United States of America 99, 4008-4013, doi : 10.1073 / pnas.052692999 (2002).31 Xiao, Q., Prussia, A., Yu, K., Cui, Y. Y. & Hartzell, H. C. Regulation of bestrophin Cl channels by calcium: role of the C terminus. The Journal of general physiology 132, 681-692, doi:10.1085 / jgp.200810056 (2008).32 Yu, K., Cui, Y. & Hartzell, H. C. The bestrophin mutation A243V, linked to adultonset vitelliform macular dystrophy, impairs its chloride channel function.Investigative ophthalmology & visual science 47, 4956-4961, doi: 10.1167 / iovs.06- 0524 (2006).33 Al-Jumaily, M. et al. Expression of three distinct families of calcium-activated chloride channel genes in the mouse dorsal root ganglion. Neuroscience bulletin 23, 293-299, doi:10.1007 / sl2264-007-0044-8 (2007).34 Barro Soria, R., Spitzner, M., Schreiber, R. & Kunzelmann, K. Bestrophin-1 enables Ca2+-activated Cl- conductance in epithelia. The Journal of biological chemistry 284, 29405-29412, doi: 10.1074 / jbc.M605716200 (2009).35 Jung, J. Y., Lee, S. E., Hwang, E. M. & Lee, C. J. Neuronal Expression and Cell- Type-Specific Gene-Silencing of Bestl in Thalamic Reticular Nucleus Neurons Using pSico-Red System. Experimental neurobiology 25, 120-129, doi: 10.5607 / en.2016.25.3.120 (2016).36 Kwak, H. el al. Astrocytes Control Sensory Acuity via Tonic Inhibition in the Thalamus. Neuron 108, 691-706 e610, doi: 10.1016 / j. neuron.2020.08.013 (2020).28ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 202537 Park, H. et al. Channel-mediated astrocytic glutamate modulates hippocampal synaptic plasticity by activating postsynaptic NMDA receptors. Molecular brain 8, 7, doi : 10.1186 / s 13041 -015-0097-y (2015).38 Park, H. et al. Bestrophin-1 encodes for the Ca2+-activated anion channel in hippocampal astrocytes. The Journal of neuroscience : the official journal of the Society for Neuroscience 29, 13063-13073, doi:10.1523 / JNEUROSCI.3193-09.2009 (2009).39 Pineda-Farias, J. B. et al. Role of anoctamin-1 and bestrophin-1 in spinal nerve ligation-induced neuropathic pain in rats. Molecular pain 11, 41, doi: 10.1186 / sl2990- 015-0042-1 (2015).40 Tochitani, S. & Kondo, S. Immunoreactivity for GABA, GAD65, GAD67 and Bestrophin-1 in the meninges and the choroid plexus: implications for non-neuronal sources for GABA in the developing mouse brain. PloS one 8, e56901, doi: 10.1371 / journal. pone.0056901 (2013).41 Woo, J. et al. Control of motor coordination by astrocytic tonic GABA release through modulation of excitation / inhibition balance in cerebellum. Proceedings of the National Academy of Sciences of the United States of America 115, 5004-5009, doi : 10.1073 / pnas.1721187115 (2018).42 Oh, S. J. & Lee, C. J. Distribution and Function of the Bestrophin-1 (Bestl) Channel in the Brain. Experimental neurobiology 26, 113-121, doi: 10.5607 / en.2017.26.3.113 (2017).43 Pandit, S. et al. Bestrophinl-mediated tonic GABA release from reactive astrocytes prevents the development of seizure-prone network in kainate-injected hippocampi. Glia 68, 1065-1080, doi: 10.1002 / glia.23762 (2020).44 Yoon, B. E. et al. The amount of astrocytic GABA positively correlates with the degree of tonic inhibition in hippocampal CAI and cerebellum. Molecular brain 4, 42, doi: 10.1186 / 1756-6606-4-42 (2011).45 Zhu, S. et al. Proline provides a nitrogen source in the retinal pigment epithelium to synthesize and export amino acids for the neural retina. bioRxiv, doi: 10.1101 / 2023.04.18.537355 (2023).46 Moraes, T. F. & Reithmeier, R. A. Membrane transport metabolons. Biochimica et biophysica acta 1818, 2687-2706, doi: 10.1016 / j.bbamem.2012.06.007 (2012).29ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 202547 Kittredge, A., Ward, N., Hopiavuori, A., Zhang, Y. & Yang, T. Expression and Purification of Mammalian Bestrophin Ion Channels. J Vis Exp, doi: 10.3791 / 57832 (2018).30ActiveUS 211451874
Claims
Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 2025CLAIMSWhat is claimed is:
1. A method of enhancing bestrophin-mediated anion currents in a subject, the method comprising administering a stimulator of the interaction between the bestrophin and an isoform of glutamic acid decarboxylase to the subject.
2. The method of claim 1, wherein the isoform is GAD65 or GAD67.
3. The method of claim 1, wherein the isoform is GAD65.
4. The method of claim 1, wherein the isoform is GAD67.
5. The method of any of claims 1-4, wherein the subject is a human.
6. The method of claim 5, wherein the bestrophin is Bestl, Best2, Best3, or Best4.
7. The method of claim 5, wherein the bestrophin is Bestl .
8. A method of promoting bestrophin permeability to glutamate, gluconate or GABA in a subject, the method comprising inserting a nucleic acid encoding an isoform of glutamic acid decarboxylase into cells of the subject.
9. The method of claim 8, wherein the nucleic acid is inserted into the cells via a vector.
10. The method of claim 9, wherein the vector is a viral vector.
11. The method of claim 10, wherein the viral vector is an AAV vector or a lentiviral vector.
12. The method of any of claims 8-11, wherein the isoform is GAD65.
13. The method of claim 12, wherein administration of GAD65 causes the neck and aperture of the bestrophin to open.
14. The method of any of claims 12-13, wherein administration of GAD65 promotes the permeability of the bestrophin to GABA.
15. The method of any of claims 12-13, wherein administration of GAD65 promotes the permeability of the bestrophin to glutamate.
16. The method of any of claims 8-11, wherein the isoform is GAD67.
17. The method of any of claims 8-15, wherein the cells are retinal pigment epithelium cells.
18. The method of any of claims 7-15, wherein the subject is a human.
19. The method of claim 17, wherein the bestrophin is Bestl, Best2, Best3, or Best4.
20. The method of claim 17, wherein the bestrophin is Bestl.31ActiveUS 211451874Attorney Docket No.: 19240.01332WO2 Date of Electronic Filing: September 9, 202521. A method of promoting bestrophin permeability to glutamate, gluconate or GABA in a subject, the method comprising correcting a mutation in the gene encoding an isoform of glutamic acid decarboxylase into cells of the subject.
22. The method of claim 21, wherein the correcting is performed using CRISPR / Cas9- based gene editing.
23. The method of any of claims 21-22, wherein the isoform is GAD65.
24. The method of any of claims 21-22, wherein the subject is a human.
25. The method of claim 24, wherein the bestrophin is Bestl, Best2, Best3, or Best4.
26. The method of claim 24, wherein the bestrophin is Bestl.
27. A method of reducing Bestl -mediated Ca2+-dependent Cl’ currents in a subject, the method comprising administering a suppressor of an isoform of glutamic acid decarboxylase to the subject.
28. The method of claim 27, wherein the isoform is GAD65 or GAD67.
29. The method of claim 28, wherein the isoform is GAD65.
30. The method of claim 28, wherein the isoform is GAD67.
31. The method of any of claims 21-30, wherein the subject is a human.
32. The method of any of claims 21-31, wherein the suppressor is an siRNA against the isoform of glutamic acid decarboxylase.
33. The method of any of claims 21-31, wherein the suppressor is an antibody against the isoform of glutamic acid decarboxylase.
34. The method of any of claims 1-32, wherein the subject has a bestrophin-related disease.
35. The method of claim 34, wherein the bestrophin-related disease is Best vitelliform macular dystrophy (BVMD), adult-onset vitelliform macular dystrophy (AVMD), autosomal recessive bestrophinopathy (ARB), autosomal dominant vitreoretinochoroidopathy (ADVIRC), or retinitis pigmentosa (RP).32ActiveUS 211451874