Various antibodies binding to human CD16 and / or human CD123 and use thereof

Abstract

Provided are a bispecific antibody comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to human CD123, a single-domain antibody that binds to human CD16, a pharmaceutical composition comprising the bispecific antibody or the single-domain antibody, an antibody-natural killer cell (NK cell) conjugate, and the use thereof.

Description

Antibodies binding to human CD16 and / or human CD123 and uses thereof

[0001] Related Applications

[0002] This application claims priority to and the benefit of Chinese Patent Application No. CN 202411327968.5, filed September 23, 2024, entitled “Antibodies binding to human CD16 and / or human CD123 and uses thereof,” which is incorporated by reference in its entirety for all purposes. Field of the Invention

[0003] The present invention relates generally to the fields of genetic engineering and antibody medicine; in particular, the present application relates to bispecific antibodies binding to human CD16 and human CD123, single domain antibodies binding to human CD16, and uses thereof.

[0004] BACKGROUND

[0005] CD16, also known as FcγRIII, belongs to transmembrane protein, mainly expressed on natural killer cells (NK cells), mast cells, macrophages. CD16 can recognize the Fc part of IgG antibody, mediate NK cells to kill tumor cells through ADCC [1] . NK cells are the third largest class of lymphocytes in addition to T cells and B cells, which are important for the body's immunity.

[0006] CD123, also known as human interleukin-3 (IL-3) receptor alpha chain, belongs to the cytokine receptor superfamily member, with a molecular weight of about 40 KDa, which is a type I transmembrane glycoprotein. The interleukin-3 receptor is a heterodimer formed by the alpha chain (CD123) and the beta chain (CD131). After IL-3 binds to CD123, CD131 provides signal transduction, which in turn regulates the function of hematopoietic cells and immune cells and stimulates endothelial cell proliferation [2] .

[0007] CD123 is mainly expressed in bone marrow progenitor cells, plasmacytoid dendritic cells, monocytes, basophils and a small number of B cell subsets [3] . About 80% of acute myeloid leukemia (AML) patients' blast cells overexpress CD123, and studies have shown that overexpression of CD123 antigen corresponds to poor prognosis and lower remission rate of AML [4] .

[0008] NK cells are the first line of defense against tumors in the body, and have a broad spectrum of killing tumor cells in tumor immunity, and do not depend on antigen stimulation, but kill tumor cells and virus-infected target cells in a non-specific manner.

[0009] Bispecific antibodies (BsAb) are a class of artificial antibodies, which contain two different antigen binding sites, can bridge the target cells and functional molecules (cells), trigger targeted immune response, and have become a research hotspot in the field of antibody engineering, and have broad application prospects in the immunotherapy of diseases. Bispecific antibodies against tumor antigens and CD16 can target NK cells to tumor antigen-positive tumor cells by binding to NK cells through CD16 and tumor cells through tumor antigens, activate NK cells and achieve NK cell killing of tumor cells [5] .

[0010] The development and application of new antibodies that bind to human CD16 and / or human CD123 are needed in the art. Therefore, in view of the wide applicability of anti-human CD16 and / or human CD123 antibodies, based on clinical needs, exploring and developing new anti-human CD16 and / or human CD123 antibodies have important biological and medical significance.

[0011] SUMMARY

[0012] In a first aspect, the present application provides a bispecific antibody comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to a tumor cell surface antigen, wherein the first antigen binding region that binds to human CD16 comprises:

[0013] HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3; or

[0014] HCDR1 as shown in SEQ ID NO: 4, HCDR2 as shown in SEQ ID NO: 5, and HCDR3 as shown in SEQ ID NO: 6;

[0015] Wherein the amino acid sequence of the HCDR is defined according to Kabat.

[0016] In a second aspect, the present application provides a bispecific antibody comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to human CD123.

[0017] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 comprises:

[0018] HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3; or

[0019] HCDR1 as shown in SEQ ID NO: 4, HCDR2 as shown in SEQ ID NO: 5, and HCDR3 as shown in SEQ ID NO: 6;

[0020] wherein the amino acid sequences of the HCDRs and LCDRs are according to the definition of Kabat.

[0021] In some embodiments of the second aspect, the second antigen binding region that binds to human CD123 comprises:

[0022] HCDR1 as shown in SEQ ID NO: 7,

[0023] HCDR2 as shown in SEQ ID NO: 8,

[0024] HCDR3 as shown in SEQ ID NO: 9,

[0025] LCDR1 as shown in SEQ ID NO: 10,

[0026] LCDR2 as shown in SEQ ID NO: 11, and

[0027] LCDR3 as shown in SEQ ID NO: 12.

[0028] wherein the amino acid sequences of the HCDRs and LCDRs are according to the definition of Kabat.

[0029] In some embodiments of the first or second aspect, the first antigen binding region that binds to human CD16 is in the form of a single domain antibody.

[0030] In some embodiments of the first or second aspect, the first antigen binding region that binds to human CD16 comprises a monovalent or multivalent single domain antibody that binds to human CD16.

[0031] In some embodiments of the first or second aspect, the first antigen binding region that binds to human CD16 comprises an amino acid sequence as shown in SEQ ID NO: 13, 14, or 15.

[0032] In some embodiments of the second aspect, the second antigen binding region that binds to human CD123 is in the form of a Fab or a single chain antibody (scFv).

[0033] In some embodiments of the second aspect, the second antigen binding region that binds to human CD123 comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 17.

[0034] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 13; and / or the second antigen binding region that binds to human CD123 comprises a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 17; or

[0035] the first antigen binding region that binds to human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 14; and / or the second antigen binding region that binds to human CD123 comprises a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 17; or

[0036] the first antigen binding region that binds to human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 15; and / or the second antigen binding region that binds to human CD123 comprises a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 17.

[0037] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 and the second antigen binding region that binds to human CD123 are connected by an antibody heavy chain constant region Fc fragment, the antibody heavy chain constant region Fc fragment comprises a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the first Fc fragment are C, S, A and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V, respectively; wherein the antibody constant region amino acid positions are determined according to the EU numbering.

[0038] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 and the second antigen binding region that binds to human CD123 are connected by an antibody heavy chain constant region Fc fragment, the antibody heavy chain constant region Fc fragment comprises a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S, respectively; wherein the antibody constant region amino acid positions are determined according to the EU numbering.

[0039] In some embodiments of the second aspect, the first antigen binding region that binds human CD16 and the second antigen binding region that binds human CD123 are connected by an antibody heavy chain constant region Fc fragment comprising a first Fc fragment and a second Fc fragment, wherein one of the first Fc fragment and the second Fc fragment is connected to the first antigen binding region that binds human CD16 and the other of the first Fc fragment and the second Fc fragment is connected to the second antigen binding region that binds human CD123.

[0040] In some embodiments of the second aspect, the bispecific antibody comprises a first arm that binds human CD16 and a second arm that binds human CD123, wherein

[0041] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39; and / or

[0042] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19, or comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21.

[0043] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or

[0044] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19;

[0045] or

[0046] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or

[0047] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21;

[0048] or

[0049] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or

[0050] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19;

[0051] or

[0052] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or

[0053] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21;

[0054] or

[0055] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or

[0056] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19;

[0057] or

[0058] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or

[0059] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21.

[0060] In a third aspect, the present application provides a single-domain antibody binding to human CD16, comprising

[0061] a HCDR1 as set forth in SEQ ID NO: 1, a HCDR2 as set forth in SEQ ID NO: 2 and a HCDR3 as set forth in SEQ ID NO: 3; or

[0062] a HCDR1 as set forth in SEQ ID NO: 4, a HCDR2 as set forth in SEQ ID NO: 5 and a HCDR3 as set forth in SEQ ID NO: 6;

[0063] wherein the amino acid sequences of the HCDRs are according to the definition of Kabat.

[0064] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as set forth in SEQ ID NO: 13, 14 or 15.

[0065] In a fourth aspect, the present application provides a nucleic acid molecule encoding the bispecific antibody of the first or second aspect or the single-domain antibody of the third aspect.

[0066] In a fifth aspect, the present application provides a pharmaceutical composition comprising the bispecific antibody of the first or second aspect or the single-domain antibody of the third aspect and a pharmaceutically acceptable excipient, diluent or carrier.

[0067] In some embodiments of the fifth aspect, the pharmaceutical composition further comprises natural killer cells (NK cells).

[0068] In a sixth aspect, the present application provides an antibody-natural killer cell (NK cell) conjugate, wherein the antibody is the bispecific antibody of the first or second aspect or the single-domain antibody of the third aspect;

[0069] when the antibody is the bispecific antibody of the first or second aspect, the antibody is coupled to an NK cell via antigen-antibody binding of its first antigen-binding region to CD16 molecules on the NK cell; or

[0070] when the antibody is the single-domain antibody of the third aspect, the antibody is coupled to an NK cell via antigen-antibody binding of the antibody to CD16 molecules on the NK cell.

[0071] In a seventh aspect, the present application provides use of the bispecific antibody of the first or second aspect, the single-domain antibody of the third aspect, the pharmaceutical composition of the fifth aspect, or the antibody-NK cell conjugate of the sixth aspect in the preparation of a medicament for preventing or treating a tumor.

[0072] In an eighth aspect, the present application provides use of the bispecific antibody of the first or second aspect, or the single-domain antibody of the third aspect in the preparation of a product for detecting CD16-positive cells.

[0073] In some embodiments of the present application, the human CD16 is human CD16a or human CD16b.

[0074] SUMMARY

[0075] Figure 1 shows the results of the binding activity of anti-CD16 antibodies to CD16a-His and CD16b-NA1-His, respectively.

[0076] Figure 2 shows the results of anti-CD16xCD123 bispecific antibodies mediating Molm-13 target cell killing by NK cells from different donors. Wherein, A is NK cells from donor 1; B is NK cells from donor 2.

[0077] Figure 3 shows the results of anti-CD16xCD123 bispecific antibodies mediating self-killing of NK cells from different donors. Wherein, A is NK cells from donor 1; B is NK cells from donor 2.

[0078] Figure 4 shows the results of the binding activity of humanized N5G3 antibody N5G3-h5 to CD16a-His, CD16b-NA1-His and CD16b-NA2-His, respectively.

[0079] Figure 5 shows the results of N5G3-h5 x anti-CD123 bispecific antibodies mediating Molm-13 and MV-411 target cell killing by NK cells. Wherein, A is Molm-13 target cells, B is MV-411 target cells.

[0080] Figure 6 shows results of N5G3-h5xanti-CD123 bispecific antibody mediated self- killing of NK cells.

[0081] Figure 7 shows in vivo tumor inhibition effect of N5G3-h5xanti-CD123 bispecific antibody.

[0082] Sequence Description

[0083] SEQ ID NOs: 1-3 show the amino acid sequences of HCDR1, HCDR2, and HCDR3, respectively, of the single domain antibody N5G3 and N5G3-h5.

[0084] SEQ ID NOs: 4-6 show the amino acid sequences of HCDR1, HCDR2, and HCDR3, respectively, of the single domain antibody N1D9.

[0085] SEQ ID NOs: 7-9 show the amino acid sequences of HCDR1, HCDR2, and HCDR3, respectively, of the heavy chain variable region H7A3-h2-m5-VH of the second antigen binding region that binds human CD123.

[0086] SEQ ID NOs: 10-12 show the amino acid sequences of LCDR1, LCDR2, and LCDR3, respectively, of the light chain variable region L27E5-VL of the second antigen binding region that binds human CD123.

[0087] SEQ ID NO: 13 shows the amino acid sequence of the single domain antibody N5G3.

[0088] SEQ ID NO: 14 shows the amino acid sequence of the single domain antibody N5G3-h5.

[0089] SEQ ID NO: 15 shows the amino acid sequence of the single domain antibody N1D9.

[0090] SEQ ID NO: 16 shows the amino acid sequence of the heavy chain variable region H7A3-h2-m5-VH of the second antigen binding region that binds human CD123.

[0091] SEQ ID NO: 17 shows the amino acid sequence of the light chain variable region L27E5-VL of the second antigen binding region that binds human CD123.

[0092] SEQ ID NO: 18 shows the amino acid sequence of N5G3-h5-IgG1m3-FcH1.

[0093] SEQ ID NO: 19 shows the amino acid sequence of anti-CD123-ScFv-IgG1m3-FcK.

[0094] SEQ ID NO:20 shows the amino acid sequence of H7A3-h2-m5-IgGlm3-FcK.

[0095] SEQ ID NO:21 shows the amino acid sequence of the light chain of the second antigen binding region of a human CD123 binding antibody L27E5.

[0096] SEQ ID NO:22 shows the amino acid sequence of a human (homo sapiens) CD16a extracellular domain (hCD16a-ECD).

[0097] SEQ ID NO:23 shows the amino acid sequence of a human (homo sapiens) CD16b-NA1 extracellular domain (hCD16b-NA1-ECD).

[0098] SEQ ID NO:24 shows the amino acid sequence of a human (homo sapiens) CD16b-NA2 extracellular domain (hCD16b-NA2-ECD).

[0099] SEQ ID NO:25 shows the amino acid sequence of a human (homo sapiens) CD123 extracellular domain (CD123-ECD).

[0100] SEQ ID NO:26 shows the amino acid sequence of a His tag.

[0101] SEQ ID NO:27 shows the amino acid sequence of a human (homo sapiens) antibody IgG1 Fc fragment (IgG1-Fc).

[0102] SEQ ID NO:28 shows the amino acid sequence of a mouse (mus musculus) antibody IgG2a Fc fragment (mFc).

[0103] SEQ ID NO:29 shows the amino acid sequence of a human IgG1 subtype antibody Fc fragment mutant IgGlm3-Fc.

[0104] SEQ ID NO:30 shows the amino acid sequence of a human IgG1 subtype antibody Fc fragment mutant IgGlm3-FcHl.

[0105] SEQ ID NO:31 shows the amino acid sequence of the heavy chain of the second antigen binding region of a human CD123 binding antibody H7A3-h2-m5.

[0106] SEQ ID NO:32 shows the amino acid sequence of a single chain antibody fragment anti-CD123-ScFv binding to human CD123.

[0107] SEQ ID NO:33 shows the amino acid sequence of human IgGl subtype antibody Fc fragment mutant IgGl m3-FcK with a hinge region amino acid sequence of EPKSSD.

[0108] SEQ ID NO:34 shows the amino acid sequence of human IgGl subtype antibody Fc fragment mutant IgGl m3-FcK with a hinge region amino acid sequence of EPKSCD.

[0109] SEQ ID NO:35 shows the amino acid sequence of the heavy chain variable region of antibody DP47.

[0110] SEQ ID NO:36 shows the amino acid sequence of the light chain variable region of antibody DP47.

[0111] SEQ ID NO:37 shows the nucleotide sequence of primer PCal-CH2R.

[0112] SEQ ID NO:38 shows the amino acid sequence of N5G3-IgGl m3-FcHl.

[0113] SEQ ID NO:39 shows the amino acid sequence of N1D9-IgGl m3-FcHl.

[0114] DETAILED DESCRIPTION

[0115] The inventors of the present application prepared bispecific antibodies that bind to a first antigen binding region of human CD16 and a second antigen binding region of a tumor cell surface antigen (e.g., human CD123) by genetic engineering, which can target NK cells to tumor cells (e.g., CD123-positive tumor cells) through CD16 binding to NK cells and tumor cell surface antigen (e.g., human CD123) binding to tumor cells, activate NK cells and achieve killing of tumor cells (e.g., CD123-positive tumor cells) by NK cells. In various aspects of the present application, new bispecific antibodies comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to a tumor cell surface antigen (e.g., human CD123), single domain antibodies that bind to human CD16, nucleic acid molecules encoding the bispecific antibodies or the single domain antibodies, vectors comprising the nucleic acid molecules, host cells comprising the nucleic acid molecules or vectors, methods of making and purifying the bispecific antibodies or the single domain antibodies, and medical and biological applications of the bispecific antibodies or the single domain antibodies are provided. According to the sequences of the bispecific antibodies or the single domain antibodies provided in the present application, bispecific antibodies or single domain antibodies that bind to human CD16 and / or bind to a tumor cell surface antigen (e.g., human CD123) can be constructed as drugs for preventing or treating tumors (e.g., CD123-positive tumors) in the clinic, or bispecific antibodies or single domain antibodies that bind to human CD16 and / or bind to a tumor cell surface antigen (e.g., human CD123) can be used to prepare products (e.g., kits, test strips, test cards, or microfluidic devices) for detecting CD16-positive cells.

[0116] Unless otherwise indicated, the practice of the present application employs conventional techniques of molecular biology, microbiology, cell biology, biochemistry and immunology.

[0117] Unless otherwise indicated, the terms used in the present application have the meanings commonly understood by those skilled in the art.

[0118] Definitions

[0119] The term "antibody", as used herein, refers to an immunoglobulin molecule capable of specific binding to a target via at least one antigen recognition site located in the variable region of the immunoglobulin molecule. Targets include, but are not limited to, carbohydrates, polynucleotides, lipids, polypeptides, and the like. "Antibody", as used herein, is intended to include not only intact (i.e., full-length) antibodies, but also binding fragments (e.g., Fab, Fab', F(ab')2, Fv) thereof, variants thereof, fusion proteins comprising an antibody portion, humanized antibodies, chimeric antibodies, bispecific antibodies, linear antibodies, single-chain antibodies, single-domain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies.

[0120] Generally, an intact or full-length antibody comprises two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and a first, second, and third constant region (CH1, CH2, and CH3). Each light chain contains a light chain variable region (VL) and a constant region (CL). The full-length antibody can be of any class, e.g., IgD, IgE, IgG, IgA, or IgM (or a subclass thereof), although the antibody need not be of any particular class. An immunoglobulin can be assigned to a class based on the amino acid sequence of its constant regions. In general, immunoglobulins are of five major classes: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2. The heavy chain constant regions that correspond to the different classes of immunoglobulins are called a, d, e, g, and m, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.

[0121] The term "bispecific antibody" as used herein refers to an antibody that has the ability to bind to two antigen epitopes simultaneously. The two antigen epitopes can be on different antigens or on the same antigen. Bispecific antibodies can have a variety of structural configurations. For example, a bispecific antibody can be composed of two Fc fragments and two binding moieties fused to each of them respectively (similar to a natural antibody, except that the two arms bind to different antigen targets or epitopes), the antigen binding moieties can be single domain antibodies, single chain antibodies (scFv) or Fab fragments. When directed to epitopes of two given antigens, the two different binding moieties of a bispecific antibody are each bound to the N-terminus of one Fc fragment, the antigen binding moieties of the two arms can have four combinations: single domain antibody + Fab fragment, single domain antibody + scFv, scFv + single domain antibody and Fab fragment + single domain antibody. The Fc fragment can contain mutations that can ensure heterodimerization of the heavy chains, KIH technology (knob-in-hole, KIH) is a strategy to solve the heterodimerization of heavy chains. Generally, KIH technology refers to the formation of a structure that is conducive to the pairing of hetero-hybrid antibodies by modifying the amino acid sequence of the CH3 region, which can form a bispecific antibody while maintaining the structure of a normal antibody as much as possible. For guidance on KIH technology, see, for example, "An efficient route to human bispecific IgG", A. Margaret Merchant et al., Nature Biotechnology, Volume 16, 1998 [6] , which is incorporated herein by reference in its entirety.

[0122] The antigen binding region can comprise a heavy chain variable region (VH), a light chain variable region (VL), or both. Each of VH and VL generally contains three complementarity determining regions, CDR1, CDR2, and CDR3.

[0123] It is well known to those skilled in the art that the complementarity determining region (CDR, usually CDR1, CDR2 and CDR3) is the region in the variable region that has the greatest impact on the affinity and specificity of the antibody. There are two common definitions of CDR sequences of VH or VL, namely Kabat definition and Chothia definition. (See, for example, Kabat, "Sequences of Proteins of Immunological Interest", National Institutes of Health, Bethesda, Md. (1991) [7] ; A1-Lazikani et al., J. Mol. Biol. 273:927-948 (1997) [8]Martin et al., Proc. Natl. Acad. Sci. USA 86:9268-9272 (1989)) [9] For a given antibody variable region sequence, the CDR region sequences in the VH and VL sequences can be determined according to the Kabat definition or the Chothia definition. In embodiments of the present application, the CDR sequences are defined using the Kabat definition.

[0124] For a given antibody variable region sequence, the CDR region sequences in the variable region sequence can be analyzed in a number of ways, for example, the online software Abysis can be used (http: / / www.abysis.org / ).

[0125] For a given antibody variable region sequence, the CDR region sequences in the variable region sequence can be analyzed in a number of ways, for example, the online software Abysis can be used (http: / / www.abysis.org / ).

[0126] In bispecific antibody construction, the "antigen binding region" includes, but is not limited to, single domain antibody format, Fab fragment format, and / or single chain antibody (scFv) format.

[0127] The term "single chain antibody (scFv, single chain fragment variable)" as used herein refers to an antibody of a single chain structure, generally constructed using genetic engineering techniques, comprising one polypeptide chain of a heavy chain variable region (VH) and a light chain variable region (VL). A flexible linker is usually designed between the heavy chain variable region and the light chain variable region so that the heavy chain variable region and the light chain variable region can fold into a correct conformation capable of binding to an antigen.

[0128] The term "Fab (fragment antigen binding) fragment", "Fab portion" or similar terms as used herein refer to an antibody fragment capable of binding to an antigen produced after treating an intact antibody with papain, including an intact light chain (VL-CL), a heavy chain variable region and a CH1 fragment (VH-CH1).

[0129] The term "single domain antibody" as used herein refers to a heavy chain single variable domain antibody naturally lacking a light chain, such antibody comprising a heavy chain variable region (VHH) and a conventional CH2 and CH3 region (e.g. one or two sets (heavy chain variable region (VHH) and conventional CH2 and CH3 region)). A VHH structure cloned and expressed alone has a structural stability comparable to that of a native heavy chain antibody and a binding activity to an antigen, and is known as the smallest unit that can bind to a target antigen. Single domain antibodies are also referred to as Nanobodies (Nb).

[0130] The terms "Fc fragment", "Fc domain" and "Fc portion" as used herein are used interchangeably and refer to a portion of an antibody heavy chain constant region, including a Hinge, a CH2 fragment and a CH3 fragment of the heavy chain constant region, and are determined with reference to the EU numbering of a human IgGl antibody.

[0131] The term "specifically binds" as used herein refers to a non-random binding reaction between two molecules, for example an antibody to an epitope of an antigen.

[0132] The term "tumor" as used herein refers to a neoplasm or solid lesion formed by the growth of abnormal cells. A tumor can be benign, pre-malignant, or malignant. In some embodiments of the application, the tumor is a CD123-positive tumor, for example acute myeloid leukemia (AML) or blastic plasmacytoid dendritic cell neoplasm (BPDCN).

[0133] In a first aspect, the present application provides a bispecific antibody comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to a tumor cell surface antigen, wherein the first antigen binding region that binds to human CD16 comprises:

[0134] HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2 and HCDR3 as shown in SEQ ID NO: 3; or

[0135] HCDR1 as shown in SEQ ID NO: 4, HCDR2 as shown in SEQ ID NO: 5 and HCDR3 as shown in SEQ ID NO: 6;

[0136] wherein the amino acid sequences of the HCDRs are according to the definition of Kabat.

[0137] In some embodiments of the first aspect, the tumor surface antigen is selected from the group consisting of CD123, HER1, HER2, HER3, EpCAM, CEA, PSMA, CD19, CD20, CD22, CD38 and BCMA.

[0138] CD123 is a common marker for acute myeloid leukemia (AML).

[0139] HER1 is a common marker for non-small cell lung cancer (NSCLC), triple negative breast cancer (TNBC), head and neck squamous cell carcinoma (HNSCC), and colorectal cancer (CRC).

[0140] HER2 is a common marker for colorectal cancer (CRC) and gastric cancer.

[0141] HER3 is a common marker for breast cancer, ovarian cancer, colorectal cancer, and lung cancer.

[0142] EpCAM is a common marker for gastric cancer, colorectal cancer, esophageal cancer, ovarian cancer, lung cancer, and prostate cancer.

[0143] CEA is a common marker for colorectal cancer, gastric cancer, pancreatic cancer, and non-small cell lung cancer.

[0144] PSMA is a common marker for prostate cancer.

[0145] CD19 is a common marker for multiple myeloma and B-cell lymphoma.

[0146] CD20 is a common marker for multiple myeloma and lymphoma.

[0147] CD22 is a common marker for acute B-lymphoblastic leukemia and non-Hodgkin lymphoma.

[0148] CD38 is a common marker for multiple myeloma and acute B-lymphoblastic leukemia.

[0149] BCMA is a common marker for multiple myeloma.

[0150] In some embodiments of the first aspect, the bispecific antibody of the present application can be used for preventing or treating a tumor selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

[0151] In a second aspect, the present application provides a bispecific antibody comprising a first antigen binding region that binds to human CD16 and a second antigen binding region that binds to human CD123.

[0152] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 comprises:

[0153] HCDR1 as shown in SEQ ID NO: 1, HCDR2 as shown in SEQ ID NO: 2, and HCDR3 as shown in SEQ ID NO: 3; or

[0154] HCDR1 as shown in SEQ ID NO: 4, HCDR2 as shown in SEQ ID NO: 5, and HCDR3 as shown in SEQ ID NO: 6;

[0155] wherein the amino acid sequences of the HCDRs and LCDRs are according to the definition of Kabat.

[0156] In some embodiments of the second aspect, the second antigen binding region that binds human CD123 comprises:

[0157] HCDR1 as shown in SEQ ID NO: 7,

[0158] HCDR2 as shown in SEQ ID NO: 8,

[0159] HCDR3 as shown in SEQ ID NO: 9,

[0160] LCDR1 as shown in SEQ ID NO: 10,

[0161] LCDR2 as shown in SEQ ID NO: 11, and

[0162] LCDR3 as shown in SEQ ID NO: 12.

[0163] wherein the amino acid sequences of the HCDRs and LCDRs are according to the definition of Kabat.

[0164] In some embodiments of the first or second aspect, the first antigen binding region that binds human CD16 is in the form of a single domain antibody.

[0165] In some embodiments of the first or second aspect, the first antigen binding region that binds human CD16 comprises a monovalent or multivalent single domain antibody that binds CD16.

[0166] In some embodiments of the first or second aspect, the first antigen binding region that binds human CD16 comprises a monovalent single domain antibody that binds CD16.

[0167] In some embodiments of the first or second aspect, the first antigen binding region that binds human CD16 comprises an amino acid sequence as shown in SEQ ID NO: 13.

[0168] In some embodiments of the first or second aspect, the first antigen binding region that binds to human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 14.

[0169] In some embodiments of the first or second aspect, the first antigen binding region that binds to human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 15.

[0170] In some embodiments of the second aspect, the second antigen binding region that binds to human CD123 is in a Fab format or a single chain antibody (scFv) format.

[0171] In some specific embodiments of the second aspect, the second antigen binding region that binds to human CD123 is in a Fab format.

[0172] In some specific embodiments of the second aspect, the second antigen binding region that binds to human CD123 is in a single chain antibody (scFv) format.

[0173] In some embodiments of the second aspect, the second antigen binding region that binds to human CD123 comprises a heavy chain variable region with an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region with an amino acid sequence as set forth in SEQ ID NO: 17.

[0174] In some embodiments of the first or second aspect, the amino acid sequence of the first antigen binding region that binds to human CD16 differs from the amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, and / or additions of amino acids.

[0175] In some embodiments of the first or second aspect, the amino acid sequence of the first antigen binding region that binds to human CD16 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15.

[0176] In some embodiments of the first or second aspect, the C-terminal or N-terminal region of the amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids while still retaining similar functionality of the first antigen binding fragment.

[0177] In some embodiments of the first or second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can be added to the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15, and the resulting amino acid sequence still retains similar functionality of the first antigen binding fragment.

[0178] In some embodiments of the first or second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can be added to or deleted from a region other than the C-terminal or N-terminal of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15, as long as the altered amino acid sequence substantially retains similar functionality of the first antigen binding fragment.

[0179] In some embodiments of the second aspect, the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence set forth in SEQ ID NO: 16.

[0180] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen binding region that binds human CD123 differs from the amino acid sequence set forth in SEQ ID NO: 16 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions.

[0181] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen binding region that binds human CD123 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the amino acid sequence set forth in SEQ ID NO: 16.

[0182] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 16 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, and the resulting amino acid sequence still retains similar functionality of the heavy chain variable region of the second antigen binding region that binds human CD123.

[0183] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can be added to the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 16, and the resulting amino acid sequence still retains similar functionality of the heavy chain variable region of the second antigen binding region that binds human CD123.

[0184] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids can be added or deleted outside of the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 16, as long as the altered amino acid sequence substantially retains similar function of the heavy chain variable region of the second antigen binding region that binds human CD123.

[0185] In some embodiments of the second aspect, the second antigen binding region that binds human CD123 comprises a heavy chain variable region of the amino acid sequence set forth in SEQ ID NO: 16.

[0186] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen binding region that binds human CD123 differs from the amino acid sequence set forth in SEQ ID NO: 16 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, and / or additions of amino acids.

[0187] In some embodiments of the second aspect, the amino acid sequence of the heavy chain variable region of the second antigen binding region that binds human CD123 has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more homology to the amino acid sequence set forth in SEQ ID NO: 16.

[0188] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 16 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids, while still retaining similar function of the heavy chain variable region of the second antigen binding region that binds human CD123.

[0189] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids can be added to the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 16, and the resulting amino acid sequence still retains similar function of the heavy chain variable region of the second antigen binding region that binds human CD123.

[0190] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can be added or deleted outside the C-terminus or N-terminus of the amino acid sequence shown in SEQ ID NO: 17, as long as the altered amino acid sequence substantially retains similar function of the light chain variable region of the second antigen binding region that binds human CD123.

[0191] In some embodiments of the second aspect, the first antigen binding region that binds human CD16 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 13; and / or

[0192] the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 17.

[0193] In some embodiments of the second aspect, the first antigen binding region that binds human CD16 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 14; and / or

[0194] the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 17.

[0195] In some embodiments of the second aspect, the first antigen binding region that binds human CD16 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 15; and / or

[0196] the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 17.

[0197] In some embodiments of the second aspect, the first antigen binding region that binds human CD16 and the second antigen binding region that binds human CD123 are connected by an antibody heavy chain constant region Fc fragment, the antibody heavy chain constant region Fc fragment comprises a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the first Fc fragment are C, S, A and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V, respectively; wherein the antibody constant region amino acid positions are determined according to EU numbering.

[0198] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 and the second antigen binding region that binds to human CD123 are connected via an antibody heavy chain constant region Fc fragment, which comprises a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, and the amino acids at positions 349, 366, 368 and 407 of the second Fc fragment are C, S, A and V, respectively; wherein the antibody constant region amino acid positions are determined according to EU numbering.

[0199] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 and the second antigen binding region that binds to human CD123 are connected via an antibody heavy chain constant region Fc fragment, which comprises a first Fc fragment and a second Fc fragment, wherein the amino acids at positions 234, 235 and 331 of the first Fc fragment and the second Fc fragment are F, E and S, respectively; wherein the antibody constant region amino acid positions are determined according to EU numbering.

[0200] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 and the second antigen binding region that binds to human CD123 are connected via an antibody heavy chain constant region Fc fragment, which comprises a first Fc fragment and a second Fc fragment, wherein one of the first Fc fragment and the second Fc fragment is connected to the first antigen binding region that binds to human CD16, and the other of the first Fc fragment and the second Fc fragment is connected to the second antigen binding region that binds to human CD123.

[0201] In some embodiments of the second aspect, the first antigen binding region that binds to human CD16 is connected to the N-terminus of the first Fc fragment (e.g., an amino acid sequence such as SEQ ID NO: 30), e.g., at the C-terminus.

[0202] In some embodiments of the second aspect, the second antigen binding region that binds to human CD123 is connected to the N-terminus of the second Fc fragment (e.g., an amino acid sequence such as SEQ ID NO: 33 or 34), e.g., at the C-terminus.

[0203] In some embodiments of the second aspect, the antibody heavy chain constant region Fc fragment is an Fc fragment of IgG1 subtype. In some embodiments, the first Fc fragment is an Fc fragment of IgG1 subtype; and / or the second Fc fragment is an Fc fragment of IgG1 subtype.

[0204] In some embodiments of the first aspect, the antibody heavy chain constant region Fc fragment is an Fc fragment of IgG1m3 subtype. In some embodiments, the first Fc fragment is an Fc fragment of IgG1m3 subtype; and / or the second Fc fragment is an Fc fragment of IgG1m3 subtype.

[0205] In some embodiments of the second aspect, the bispecific antibody comprises a first arm that binds human CD16 and a second arm that binds human CD123, wherein

[0206] the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39; and / or

[0207] the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19, or comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21.

[0208] In some embodiments of the second aspect, the amino acid sequence of the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39.

[0209] In some embodiments of the second aspect, the amino acid sequence of the first arm differs from an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions, deletions, and / or additions.

[0210] In some embodiments of the second aspect, the amino acid sequence of the first arm has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39.

[0211] In some embodiments of the second aspect, a C-terminal or N-terminal region of an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining similar functionality of the first arm.

[0212] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to a C-terminal or N-terminal region of an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39, and the resulting amino acid sequence still retains similar functionality of the first arm.

[0213] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids can be added or deleted from a region other than the C-terminus or N-terminus of the amino acid sequence set forth in SEQ ID NO: 18, 38, or 39, as long as the altered amino acid sequence substantially retains similar functionality of the first arm.

[0214] In some embodiments of the second aspect, the amino acid sequence of the second arm comprises the amino acid sequence set forth in SEQ ID NO: 19.

[0215] In some embodiments of the second aspect, the amino acid sequence of the second arm differs from the amino acid sequence set forth in SEQ ID NO: 19 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, and / or additions of amino acids.

[0216] In some embodiments of the second aspect, the amino acid sequence of the second arm has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more homology to the amino acid sequence set forth in SEQ ID NO: 19.

[0217] In some embodiments of the second aspect, the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 19 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids, while still retaining similar functionality of the second arm.

[0218] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids can be added to the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 19, while the resulting amino acid sequence still retains similar functionality of the second arm.

[0219] In some embodiments of the second aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids can be added or deleted from a region other than the C-terminus or N-terminus of the amino acid sequence set forth in SEQ ID NO: 19, as long as the altered amino acid sequence substantially retains similar functionality of the second arm.

[0220] In some embodiments of the second aspect, the amino acid sequence of the second arm comprises the amino acid sequence set forth in SEQ ID NO: 20.

[0221] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that differs by up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids in substitution, deletion, and / or addition from the amino acid sequence set forth in SEQ ID NO: 20.

[0222] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the amino acid sequence set forth in SEQ ID NO: 20.

[0223] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that is truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids at the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 20, while still maintaining similar function of the second arm.

[0224] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that is truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids at the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 20, while still maintaining similar function of the second arm.

[0225] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that is truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids at the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 20, while still maintaining similar function of the second arm.

[0226] In some embodiments of the second aspect, the amino acid sequence of the second arm comprises the amino acid sequence set forth in SEQ ID NO: 21.

[0227] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that differs by up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids in substitution, deletion, and / or addition from the amino acid sequence set forth in SEQ ID NO: 21.

[0228] In some embodiments of the second aspect, the second arm comprises an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the amino acid sequence set forth in SEQ ID NO: 21.

[0229] In some embodiments of the second aspect, the second arm comprises an amino acid sequence truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids at the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 21, while still maintaining similar function of the second arm.

[0230] In some embodiments of the second aspect, the second arm comprises an amino acid sequence truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids at the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 21, while still maintaining similar function of the second arm.

[0231] In some embodiments of the second aspect, the second arm comprises an amino acid sequence truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, or more amino acids at the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 21, while still maintaining similar function of the second arm.

[0232] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19.

[0233] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21.

[0234] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19.

[0235] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21.

[0236] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19.

[0237] In some embodiments of the second aspect, the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NOs: 20 and 21.

[0238] In a third aspect, the present application provides a single-domain antibody binding to human CD16, comprising

[0239] a HCDR1 as set forth in SEQ ID NO: 1, a HCDR2 as set forth in SEQ ID NO: 2, and a HCDR3 as set forth in SEQ ID NO: 3; or

[0240] a HCDR1 as set forth in SEQ ID NO: 4, a HCDR2 as set forth in SEQ ID NO: 5, and a HCDR3 as set forth in SEQ ID NO: 6;

[0241] wherein the amino acid sequences of the HCDRs are according to the definition of Kabat.

[0242] In some embodiments of the third aspect, the single-domain antibody binds to human CD16a.

[0243] In some embodiments of the third aspect, the single-domain antibody binds to human CD16b.

[0244] In some embodiments of the third aspect, the single-domain antibody binds to both human CD16a and human CD16b.

[0245] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as set forth in SEQ ID NO: 13.

[0246] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as set forth in SEQ ID NO: 14.

[0247] In some embodiments of the third aspect, the single-domain antibody comprises an amino acid sequence as set forth in SEQ ID NO: 15.

[0248] In some embodiments of the third aspect, the amino acid sequence of the single-domain antibody differs from the amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, and / or additions of amino acids.

[0249] In some embodiments of the third aspect, the amino acid sequence of the single-domain antibody has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology to the amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15.

[0250] In some embodiments of the third aspect, the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15 can also be truncated by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids, while still retaining similar functionality of the single-domain antibody.

[0251] In some embodiments of the third aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15, while the resulting amino acid sequence still retains similar functionality of the single-domain antibody.

[0252] In some embodiments of the third aspect, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 or more amino acids can also be added to or deleted from a region other than the C-terminal or N-terminal region of the amino acid sequence set forth in SEQ ID NO: 13, 14 or 15, as long as the altered amino acid sequence substantially retains similar functionality of the single-domain antibody.

[0253] In a fourth aspect, the present application provides nucleic acid molecules encoding the bispecific antibody of the first or second aspect, or the single-domain antibody of the third aspect.

[0254] In some embodiments of the fourth aspect, the nucleic acid molecules can include DNA molecules and RNA molecules. The nucleic acid molecules can be single-stranded or double-stranded, and can be cDNA.

[0255] In some embodiments of the fourth aspect, the nucleic acid molecules can be operably linked to a regulatory nucleotide sequence, which can be recognized by a host cell transformed with the vector.

[0256] In a fifth aspect, the present application provides pharmaceutical compositions comprising the bispecific antibody of the first or second aspect, or the single-domain antibody of the third aspect, and a pharmaceutically acceptable excipient, diluent or carrier.

[0257] In some embodiments of the fifth aspect, the pharmaceutical compositions further comprise natural killer cells (NK cells).

[0258] In some embodiments of the fifth aspect, the bispecific antibody or the single-domain antibody can be administered together with the NK cells after being mixed, for example, by intravenous injection.

[0259] In some embodiments of the fifth aspect, the bispecific antibody or the single-domain antibody can be administered with the NK cells, respectively, such as by intravenous injection of the NK cells, the bispecific antibody or the single-domain antibody by intraperitoneal injection.

[0260] In some embodiments of the fifth aspect, the pharmaceutical composition is for preventing or treating a tumor, such as a CD123-positive tumor.

[0261] In some embodiments of the fifth aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

[0262] In some embodiments of the fifth aspect, the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple-negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

[0263] In some embodiments of the fifth aspect, the pharmaceutical composition can further comprise one or more of the following: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying agents; suspending agents; preserving agents such as benzalkonium chloride, benzalkonium sulfate, and calcium propionate; sweetening agents and / or flavoring agents, and the like.

[0264] In some embodiments of the fifth aspect, the pharmaceutical composition of the present application can be formulated in a form of a tablet, a pill, a powder, a lozenge, an elixir, a suspension, an emulsion, a solution, a syrup, a suppository, a capsule, and the like.

[0265] In some embodiments of the fifth aspect, the pharmaceutical composition of the present application can be delivered by any physiologically acceptable mode of administration, including but not limited to oral administration, parenteral administration, nasal administration, rectal administration, intraperitoneal administration, intravascular injection, subcutaneous administration, transdermal administration, inhalation administration, and the like.

[0266] In some embodiments of the fifth aspect, the pharmaceutical composition for therapeutic use can be stored in a form of a lyophilized preparation or an aqueous solution by mixing the reagents with the desired purity with the pharmaceutically acceptable carriers, excipients, and the like, as appropriate.

[0267] In a sixth aspect, the present application provides an antibody-natural killer cell (NK cell) conjugate, wherein the antibody is the bispecific antibody of the first or second aspect, or the single-domain antibody of the third aspect.

[0268] when the antibody is the bispecific antibody of the first or second aspect, the antibody is coupled to the NK cell via antigen-antibody binding of its first antigen-binding region to CD16 molecules on the NK cell; or

[0269] when the antibody is the single-domain antibody of the third aspect, the antibody is coupled to the NK cell via antigen-antibody binding of it to CD16 molecules on the NK cell.

[0270] In some embodiments of the sixth aspect, the antibody-NK cell conjugate is used for preventing or treating a tumor, e.g., a CD123-positive tumor.

[0271] In some embodiments of the sixth aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

[0272] In some embodiments of the sixth aspect, the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple-negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

[0273] In some embodiments of the fifth or sixth aspect, the NK cell is obtained from in vitro culture and expansion of peripheral blood mononuclear cell (PBMC)-derived NK cells; the NK cell is obtained from in vitro culture and expansion of umbilical cord blood-derived NK cells; the NK cell is obtained from in vitro culture and expansion of an NK cell line; or the NK cell is obtained from in vitro induction, culture, and expansion from induced pluripotent stem cells (iPSCs) or mesenchymal stem cells (MSCs).

[0274] In some embodiments of the fifth or sixth aspect, the killing activity of the NK cell is mainly through:

[0275] 1) direct lysis of target cells: NK cells release cytotoxic granules such as perforin and granzyme by exocytosis, activate the Caspase pathway to induce target cell necrosis or apoptosis;

[0276] 2) secretion of cytokines: cytokine-mediated killing, NK cells can synthesize and secrete various cytokines such as IFN-γ, TNF-α, IL-1, IL-5, IL-8, IL-10, and G-CSF, etc., to induce target cell apoptosis;

[0277] 3) induction of apoptosis: activated NK cells express Fas (CD95) ligand and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) molecules to induce CD95 +Target cells and target cells positive for TRAIL receptors undergo apoptosis through a cascade of endogenous enzymes;

[0278] 4) ADCC: antibody-dependent cell-mediated cytotoxicity;

[0279] 5) immune checkpoint pathway: expressing programmed death receptor 1 (PD-1) and cytotoxic T lymphocyte-associated protein 4 (CTLA4), etc., and playing a role by inhibiting immune checkpoints.

[0280] The above multiple action mechanisms, as well as the potential for application as a universal product and reliable safety, make NK cell therapy an attractive immunotherapy.

[0281] Activation of CD16 molecules can also promote the maturation, activation and cytokine production of NK cells, which play a key role in immune response and inflammatory processes. Therefore, by targeting CD16 molecules to activate the function of NK cells, it may be an effective immunotherapy strategy, especially in combating cancer and viral infections. In general, CD16 molecules as a key activating receptor on NK cells play a core role in mediating ADCC and enhancing NK cell function. By activating CD16 molecules with specific antibodies, the killing ability of NK cells against tumor cells and virus-infected cells can be significantly improved, providing new possibilities and research directions for immunotherapy.

[0282] In a seventh aspect, the present application provides use of the bispecific antibody of the first or second aspect, the single-domain antibody of the third aspect, the pharmaceutical composition of the fifth aspect, or the antibody-NK cell conjugate of the sixth aspect in the preparation of a medicament for preventing or treating a tumor.

[0283] In some embodiments of the seventh aspect, the tumor is the CD123-positive tumor.

[0284] In some embodiments of the seventh aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

[0285] In some embodiments of the seventh aspect, the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple-negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin's lymphoma), and acute B-lymphoblastic leukemia.

[0286] The bispecific antibody of the first or second aspect, the single domain antibody of the third aspect, the pharmaceutical composition of the fifth aspect, or the antibody-NK cell conjugate of the sixth aspect of the present application are used for preventing or treating a tumor. The tumor can be selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

[0287] In the eighth aspect, the present application provides a method for preventing or treating a tumor, comprising administering to a subject in need thereof the bispecific antibody of the first or second aspect, the single domain antibody of the third aspect, the pharmaceutical composition of the fifth aspect, or the antibody-NK cell conjugate of the sixth aspect.

[0288] In some embodiments of the eighth aspect, the tumor is a CD123-positive tumor.

[0289] In some embodiments of the eighth aspect, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

[0290] In some embodiments of the eighth aspect, the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

[0291] In the ninth aspect, the present application provides use of the bispecific antibody of the first or second aspect, or the single domain antibody of the third aspect in the manufacture of a product for detecting CD16-positive cells.

[0292] In some embodiments of the ninth aspect, the product is a kit, a test strip, a test card, or a microfluidic device.

[0293] In some embodiments of the ninth aspect, the product can further comprise a detection label, such as colloidal gold, a chemiluminescent label, a fluorescent label, a nanoparticle label, etc.

[0294] In some embodiments of the ninth aspect, the product can further comprise other reagents for detection, such as enzymes or colloidal gold-labeled antigens or antibodies, substrates, reference standards, diluents, washing solutions, etc.

[0295] In some embodiments of the ninth aspect, the product can further comprise reagents for processing a biological sample, which can be blood, for detection.

[0296] In some embodiments of the ninth aspect, the product can further comprise product instructions for use.

[0297] The present application also provides vectors comprising nucleic acid molecules encoding the bispecific antibodies of the first or second aspects, or the single domain antibodies of the third aspect, and host cells comprising the nucleic acid molecules or vectors. In other aspects, the present application also provides methods of producing the bispecific antibodies of the first or second aspects, or the single domain antibodies of the third aspect. In some embodiments, the methods of producing the bispecific antibodies of the first or second aspects, or the single domain antibodies of the third aspect comprise culturing the host cells to facilitate expression of the nucleic acid molecules. In some embodiments, the methods of producing the bispecific antibodies of the first or second aspects, or the single domain antibodies of the third aspect further comprise recovering the bispecific antibodies or the single domain antibodies from the host cell culture medium.

[0298] In some embodiments of the present application, the human CD16 can be human CD16a.

[0299] In some embodiments of the present application, the human CD16 can be human CD16b.

[0300] It is to be understood that the foregoing detailed description of the application is not intended to limit the scope of the application. Various modifications and changes can be made thereto by persons of ordinary skill in the art having the benefit of this detailed description.

[0301] The following examples are intended to be illustrative only and are not intended to limit the scope of the present application. Examples

[0302] Example 1: Preparation of recombinant proteins

[0303] 1.1 Preparation of recombinant antigens

[0304] In the process of preparing and identifying anti-CD16 monoclonal antibodies, recombinant antigens human CD16a extracellular domain (hCD16a-ECD, SEQ ID NO: 22), CD16b-NA1 extracellular domain (hCD16b-NA1-ECD, SEQ ID NO: 23) and CD16b-NA2 extracellular domain (hCD16b-NA2-ECD, SEQ ID NO: 24) are needed, and in the process of identifying CD123 antibodies, the extracellular domain of recombinant antigen CD123 (CD123-ECD, SEQ ID NO: 25) is needed. These proteins have post-translational modifications (such as glycosylation or disulfide bonds, etc.), so it is more advantageous to use mammalian cell expression systems to maintain the structure and function of recombinant proteins. In addition, in order to facilitate the purification of recombinant proteins and the identification of the function of monoclonal antibodies, His tag (His, SEQ ID NO: 26) or Fc segment of human antibody IgG1 (IgG1-Fc, SEQ ID NO: 27) or Fc segment of mouse antibody IgG2a (mFc, SEQ ID NO: 28) is added to the C-terminus of these recombinant proteins.

[0305] According to the amino acid sequences of various recombinant proteins of interest in the Uniprot database, the genes of the above-mentioned various recombinant proteins (including His tag or Fc, mFc coding genes) are designed and synthesized. The synthesized genes of various recombinant proteins are cloned into suitable eukaryotic expression vectors (such as pcDNA3.1 of Invitrogen Company, etc.) using conventional molecular biology techniques, and then the prepared recombinant protein expression plasmids are transfected into HEK293 cells (such as HEK293F of Invitrogen Company) using liposomes (such as 293fectin of Invitrogen Company, etc.) or other cationic transfection reagents (such as PEI, etc.). The culture supernatant is harvested by centrifugation after 3-4 days of culture under serum-free suspension culture conditions.

[0306] The recombinant proteins expressed by His tag fusion are purified in one step by metal chelate affinity chromatography column (such as HisTrap FF of GE Company, etc.) to purify the recombinant proteins in the culture supernatant. The recombinant proteins expressed by Fc and mFc fusion are purified in one step by Protein A / G affinity chromatography column (such as Mabselect SURE of GE Company, etc.). Then the recombinant protein storage buffer is replaced with PBS (pH 7.0) or other suitable buffers using desalting column (such as Hitrap desaulting of GE Company, etc.). If necessary, the sample can be filtered to remove bacteria, and then stored at -20°C.

[0307] 1.2 Preparation of recombinant antibodies

[0308] The C-terminus of the heavy chain variable region of the recombinant antibody (including single-domain antibody) is fused with the Fc segment of human antibody IgG1 (IgG1-Fc, SEQ ID NO: 27) or the Fc segment mutant of human antibody IgG1 (IgG1m3-Fc, SEQ ID NO: 29). The synthetic recombinant antibody gene is cloned into a suitable eukaryotic expression vector (such as pcDNA3.1 of Invitrogen Co., etc.) by using conventional molecular biology techniques, and the recombinant antibody is expressed. The prepared recombinant protein expression plasmid is transfected into HEK293 cells (such as HEK293F of Invitrogen Co.) by using liposomes (such as 293fectin of Invitrogen Co., etc.) or other cationic transfection reagents (such as PEI, etc.), and cultured under serum-free suspension culture conditions for 3-4 days. Then the culture supernatant is harvested by centrifugation, etc., and one-step purification is performed by using a Protein A / G affinity chromatography column (such as Mabselect SURE of GE Co., etc.). Then the recombinant antibody storage buffer is replaced with PBS (pH 7.0) or other suitable buffers by using a desalting column (such as Hitrap desaulting of GE Co., etc.). If necessary, the sample can be filtered to remove bacteria, and then stored at -20°C after aliquot.

[0309] Example 2: Screening of camel immune library

[0310] 2.1 Construction of camel immune library

[0311] One healthy adult Bactrian camel was selected, and blood was collected before immunization to obtain background serum. For the first immunization, 1 mg of CD16a-His fusion protein was emulsified with Freund's complete adjuvant and injected subcutaneously at multiple points. Two weeks later, 1 mg of CD16a-His fusion protein was emulsified with Freund's incomplete adjuvant and injected subcutaneously at multiple points for five times of booster immunization. Blood was collected before each immunization for antibody titer analysis. For the seventh immunization, 1 mg of CD16a-His fusion protein was used as an antigen without adjuvant, and the camel was subjected to impact immunization by subcutaneous injection at multiple points. Three days later, 200 mL of peripheral blood was collected for lymphocyte separation.

[0312] Lymphocytes were isolated from 200 mL of camel peripheral blood using a camel peripheral blood lymphocyte isolation kit (Solarbio, CAT#P5750); total RNA was extracted from the lymphocytes using a total RNA extraction kit (Tiangen, CAT#DP430); and a first strand cDNA synthesis kit (Thermo scientific, CAT#K1621) was used to synthesize camel single-domain antibody heavy chain variable regions (VHH) using the extracted total RNA as a template, with a gene-specific primer used as a reverse transcription primer and the primer pairing region located in the antibody heavy chain constant region CH2 domain. The specific sequence was PCal-CH2R: TCCTTCCCCGTCAGCCAGTCCT (SEQ ID NO: 37). The synthesized cDNA was immediately stored at -70°C for later use; then, the cDNA obtained by reverse transcription was used as a template, and a reference

[0010] The primers were synthesized, and a nested PCR was used to amplify and isolate the camel single-domain antibody VHH gene. Finally, the amplified VHH gene was cloned into the vector pADSCFV-S (see Chinese Patent Application No. 201510097117.0

[0011] ), to construct a VHH library with a capacity of 2.4E8 and a correct rate of 70%.

[0313] 2.2 Screening of camel immunization library

[0314] The recombinant protein CD16a-mFc prepared in Example 1 was used as an antigen, and a solid-phase screening strategy (experimental scheme, see Phage Display: A Laboratory Manual, (USA) Clackson, T., (USA) Lowman, H.B. Eds.; Ma Lan et al. Translated, Chemical Industry Press, 2008.5

[0012] ) was used to screen the phage library displaying camel single-domain antibodies constructed above. Through binding, elution, neutralization, infection, and amplification, a total of three rounds of screening were performed, and finally two single-domain antibodies N5G3 (SEQ ID NO: 13) and N1D9 (SEQ ID NO: 15) that specifically bind to CD16a-His were obtained.

[0315] Using conventional molecular biology methods, the nucleotide sequences of the variable regions of N5G3 and N1D9 were cloned into eukaryotic expression vectors (such as pcDNA3.1 from Invitrogen) fused with nucleotide sequences encoding human antibody Fc fragments, and the prepared recombinant plasmids were transfected into HEK293 cells (such as HEK293F from Invitrogen) to express recombinant proteins.

[0316] Example 3: Identification of anti-CD16 single-domain antibodies

[0317] 3.1 Analysis of anti-CD16 antibody binding specificity

[0318] Anti-His tag mouse monoclonal antibody (Beijing Kangwei Century Biotechnology Co., Ltd., CW0286M) was coated on a 96-well ELISA plate, 5 μg / mL, 100 μL / well, 4°C overnight. After blocking with blocking buffer PBS (containing 0.05% Tween 20, 3% milk) at 37°C for 1 hour, 1 μg / mL of recombinant antigen CD16a-His, CD16b-NA1-His was added respectively, and incubated at 37°C for 1 hour. The ELISA plate was washed with PBST buffer (PBS containing 0.1% Tween 20), and each recombinant anti-CD16a monoclonal antibody screened in Example 2.2 (5 μg / mL, 100 μL / well) was added respectively, and incubated at 37°C for 1 hour. The ELISA plate was washed with PBST, and HRP mouse anti-human IgG (Beijing Boao Sun Biotechnology Co., Ltd., bsm-0297M-HRP) was added, and incubated at 37°C for 1 hour. The ELISA plate was washed with PBST buffer, and OPD substrate color developing liquid was added, and after 5-10 minutes, color development was terminated with 1M H2SO4, and the optical density value was determined by enzyme-labeled instrument at 492 nm / 630 nm dual wavelength. The ELISA analysis results are shown in Figure 1, N5G3 has good binding activity with CD16a-His, and does not bind to CD16b-NA1-His; N1D9 binds to both CD16a-His and CD16b-NA1-His.

[0319] 3.2 Affinity analysis of anti-CD16 single domain antibody

[0320] The affinity of anti-CD16 antibodies was determined by surface plasmon resonance technology using Biacore T200. Related reagents and consumables such as Amino Coupling Kit (BR-1000-50), Human Antibody Capture Kit (BR-1008-39), S Series Sensor Chip CM5 Chip (14100530), and 10x HBS-EP pH 7.4 (BR100669) were purchased from Cytiva. According to the instructions in the kit, the carboxylated CM5 chip surface was activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS), and the anti-human IgG (Fc) antibody (capture antibody) was diluted to 25 μg / mL with 10 mM pH 5.0 sodium acetate, and then injected at a flow rate of 10 μL / min to achieve a coupling amount of about 10000 response units (RU). After injecting the capture antibody, 1M ethanolamine was injected to block the unreacted groups. For kinetic measurements, the anti-CD16a antibody was diluted to 0.5-1 μg / mL, injected at 10 μL / min, and about 100 RU of antibody was captured by the anti-human Fc antibody. Then set a series of concentration gradients (e.g. 6.17 nM, 18.5 nM, 55.6 nM, 166.7 nM and 500 nM) for CD16a-His, CD16b-NA1-His, and injected at 30 μL / min from low concentration to high concentration at 25°C, with a binding time of 90 s and a dissociation time of 600 s. Regenerate the chip surface by injecting 3M MgCl2 solution at 10 μL / min for 30 s. Use Biacore T200 evaluation software version 3.0 to calculate the association rate (K on ) and dissociation rate (K off ) by fitting the binding and dissociation sensorgrams with a 1:1 binding model. The dissociation equilibrium constant (K off ) is calculated by the ratio K on / K D ). The fitting results are shown in Table 1 and Table 2, and N5G3 does not bind to CD16b.

[0321] Table 1. Affinity constants of anti-CD16 single domain antibodies binding to CD16a-His

[0322] Table 2. Affinity constants of anti-CD16 single domain antibodies binding to CD16b-His

[0323] 3.3 Preparation of anti-CD16 x CD123 bispecific antibodies

[0324] The C-terminal of the anti-CD16 single-domain antibody was fused with the mutant of the Fc segment of human antibody IgG1 (IgG1m3-FcH1, SEQ ID NO: 30). The antigen binding fragment of human CD123 comprises a Fab fragment (the amino acid sequence of the heavy chain H7A3-h2-m5 is shown in SEQ ID NO: 31; the amino acid sequence of the light chain L27E5 is shown in SEQ ID NO: 21) or a single-chain antibody fragment (the amino acid sequence of anti-CD123-scFv is shown in SEQ ID NO: 32), and the amino acid sequence of the antigen binding fragment of human CD123 is from the Chinese Patent Application No. CN 202010080449.9

[0013] ). The C-terminal of the antigen binding fragment of human CD123 was fused with the mutant of the Fc segment of human antibody IgG1 (IgG1m3-FcK, SEQ ID NO: 33 or 34). Referring to Example 1.2, the eukaryotic expression vectors of each recombinant protein were constructed, and the anti-CD16 x CD123 bispecific antibody was expressed in combination.

[0325] 3.4 Anti-CD16 x CD123 bispecific antibody mediates killing of Molm-13 target cells by NK cells

[0326] Molm-13 cells expressing CD123 on the cell surface were purchased from Nanjing Keyeibio Technology Co., Ltd. NK cells were provided by Beijing Sanyoulikang Cell Technology Co., Ltd., and different donors were from different healthy volunteers. The test medium was N500 serum-free medium (Shenzhen Dakewe Biotechnology Co., Ltd., 6113031) + 2% inactivated FBS. DP47 antibody was a negative control, and the reference was US Patent Application US20160200833A1

[0014] (DP47, the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 35, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 36). Molm-13 cells were resuspended in the test medium to 4*10 5 cells / mL, NK cells were resuspended in the test medium to 2*10 6 cells / mL, and antibodies were diluted in the test medium to 40 nM starting, 4-fold gradient, 10 concentration points. 50 μL of Molm13 cells, 50 μL of NK cells, and 50 μL of antibodies were mixed together and added to a 96-well plate, and the total volume of each well in the experimental group was 150 μL. At the same time, Molm-13 cell wells and Molm13 cell plus NK cell wells were set up, and the volume was made up to 150 μL with the test medium. Incubate in a carbon dioxide incubator (37°C, 5% CO2) for 20 hours. Use CytoTox non-radioactive cytotoxicity detection kit (CytoTox Non-Radioactive Cytotoxicity Assay, Promega, Cat# G1780) to detect antibody- mediated killing of Molm-13 cells by NK cells, and the absorbance was detected at 490 nm using a microplate reader (Biotek, Model 800TS). The data were statistically processed using Graphpad Prism 7.0 software. The calculation formula is:

[0327] Killing rate (%) = {absorbance of experimental group - absorbance of spontaneous release of Molm-13 cells + NK cells) / {absorbance of maximum release of Molm-13 cells - absorbance of spontaneous release of Molm-13 cells} x 100.

[0328] Figures 2A and 2B are graphs showing the killing of Molm-13 cells by different donor NK cells mediated by anti-CD16xCD123 bispecific antibodies, and Table 3 shows the EC 50 values of the killing of Molm-13 cells by NK cells mediated by anti-CD16xCD123 bispecific antibodies. The results show that the N1D9xanti-CD123-Fab bispecific antibody and the N5G3xanti-CD123-Fab bispecific antibody have obvious killing effects.

[0329] Table 3. EC values of the killing of Molm-13 target cells by NK cells mediated by anti-CD16xCD123 bispecific antibodies 50

[0330] 3.5 Self-killing of NK cells mediated by anti-CD16xCD123 bispecific antibodies

[0331] NK cells were provided by Beijing San Yilikang Cell Technology Co., Ltd., and different donors were from different healthy volunteers. The test medium was N500 serum-free medium (Shenzhen Dakewe Biotechnology Co., Ltd., 6113031) + 2% inactivated FBS. DP47 antibody was a negative control. Daratumumab (purchased from Beijing Meixin Kangnian Pharmacy) was a positive control, and it has been reported in the literature that daratumumab can mediate self-killing of NK cells

[0015] . NK cells were resuspended to 1*10 6 / mL with the test medium, and the antibody was diluted to 40 nM starting with a 4-fold gradient, and 10 concentration points. 100 μL of NK cells and 50 μL of antibody were mixed together and added to a 96-well plate, and the total volume of each well in the experimental group was 150 μL. At the same time, a single NK cell well was set up, and the volume was made up to 150 μL with the test medium. Incubation was performed in a carbon dioxide incubator (37°C, 5% CO2) for 20 hours. CytoTox-Glo TM ​Cytotoxicity Detection System (CytoTox-Glo) TM The Cytotoxicity Assay (Promega, catalog number G9291) was used to detect antibody-mediated NK cell self-killing. Full-wavelength fluorescence detection was performed using a Molecular Devices (SpectraMax I3X) reader. Statistical processing of the raw data was performed using Graphpad Prism 7.0 software. The calculation formula is as follows:

[0332] Kill rate (%) = {absorbance value of experimental group - absorbance value of spontaneous release of NK cells} / {absorbance value of maximum release of NK cells - absorbance value of spontaneous release of NK cells} × 100.

[0333] Figures 3A and 3B show the NK cell self-killing mediated by anti-CD16×CD123 bispecific antibodies from different donors. The results show that the N1D9×anti-CD123-Fab bispecific antibody mediates some NK cell self-killing, while the N5G3×anti-CD123-Fab bispecific antibody does not mediate NK cell self-killing.

[0334] Example 4: Humanization and Identification of N5G3 Antibody

[0335] 4.1 Humanization of N5G3 antibody

[0336] N5G3 was humanized to reduce its immunogenicity. The humanization strategy employed a classic framework transplantation approach.

[0016] The amino acid sequence of N5G3 was compared with human antibody germline gene sequences in the IMGT database. Suitable germline gene sequences were selected to provide frame regions 1 to 3 (FR1+FR2+FR3) for the antibody, and a suitable J region gene sequence was selected to provide frame region 4 (FR4). This template can be selected based on various factors, such as the relative total length of the antibody, the size of the CDR, the amino acid residues located at the junction between the antibody frame regions (FR) and hypervariable regions (CDR), and the overall sequence homology. The selected template can be a mixture of multiple sequences or a shared template, with the aim of maintaining the appropriate conformation of the parental complementarity-determining region (CDR) as much as possible. Simultaneously, considering the solubility, stability, and expression yield of the humanized antibody, four hotspot amino acids 37F / 44E / 45R / 47F in FR2 were reverse-mutated, ultimately yielding the humanized molecule N5G3-h5 (SEQ ID NO:14).

[0337] 4.2 Binding characteristics and affinity analysis of humanized N5G3 antibody N5G3-h5

[0338] The binding specificity of N5G3 humanized molecule N5G3-h5 was analyzed by ELISA level according to the method of Example 3.1. The results of ELISA analysis are shown in Figure 4: N5G3-h5 has good binding activity with CD16a, and does not bind to CD16b-NA1-His and CD16b-NA2-His. The Fc fragment in N5G3-h5 antibody is IgG1 segment mutant IgG1m3-Fc.

[0339] According to Example 3.2, affinity analysis of N5G3-h5 was performed by Biacore T200, and the results are shown in Table 4: N5G3-h5 does not bind to CD16b.

[0340] Table 4. Affinity constant of humanized antibody N5G3-h5 binding to human CD16a-His

[0341] Example 5: In vitro activity analysis of N5G3-h5 x anti-CD123 bispecific antibody

[0342] 5.1 Affinity analysis of N5G3-h5 x anti-CD123 bispecific antibody in CD16a and CD123 direction

[0343] According to Example 3.4, N5G3-h5 x anti-CD123 bispecific antibody was prepared, and according to Example 3.2, affinity analysis of N5G3-h5 x anti-CD123 bispecific antibody was performed by Biacore T200, and the results are shown in Table 5 and Table 6.

[0344] Table 5. Affinity constant of N5G3-h5 x anti-CD123 bispecific antibody binding to CD16a-His

[0345] Table 6. Affinity constant of N5G3-h5 x anti-CD123 bispecific antibody binding to CD123-His

[0346] 5.2 N5G3-h5 x anti-CD123-Fab bispecific antibody mediated killing of Molm-13 and MV-411 target cells by NK cells

[0347] Referring to Example 3.5, N5G3-h5xanti-CD123-Fab bispecific antibody-mediated killing of Molm-13 and MV-411 target cells by NK cells was analyzed. FIG. 5A and FIG. 5B are N5G3-h5xanti-CD123-Fab bispecific antibody-mediated killing of Molm-13 cells and MV-411 cells by NK cells, respectively, and Table 7 is EC50values of N5G3-h5xanti-CD123-Fab bispecific antibody-mediated killing of Molm-13 and MV-411 target cells by NK cells 50 The results show that the killing ability of N5G3-h5xanti-CD123-Fab bispecific antibody is substantially equivalent to that of N5G3xanti-CD123-Fab bispecific antibody.

[0348] Table 7. EC50values of N5G3-h5xanti-CD123-Fab bispecific antibody-mediated killing of Molm-13 and MV-411 target cells by NK cells 50

[0349] 5.3 N5G3-h5xanti-CD123-Fab bispecific antibody-mediated self-killing of NK cells

[0350] Referring to Example 3.5, N5G3-h5xanti-CD123-Fab bispecific antibody-mediated self-killing of NK cells was analyzed. FIG. 6 is N5G3-h5xanti-CD123-Fab bispecific antibody-mediated self-killing of NK cells by NK cells, and the results show that neither N5G3-h5xanti-CD123-Fab bispecific antibody nor N5G3xanti-CD123-Fab bispecific antibody mediates self-killing of NK cells.

[0351] Example 6: Analysis of in vivo tumor inhibition effect of N5G3-h5xanti-CD123 bispecific antibody

[0352] ​The in vivo tumor inhibition effect of N5G3-h5xanti-CD123 bispecific antibody was evaluated by using human NK cell reconstituted immunodeficient mice inoculated with Molm-13 tumor cell model. NK cells were provided by Beijing San Yilikang Cell Technology Co., Ltd. NOG mice were purchased from Beijing Vantoll Life Science Co., Ltd., 6 weeks old, female. Molm-13 cells were purchased from Nanjing Kebai Biotechnology Co., Ltd. A total of 50 NOG mice were inoculated with logarithmic growth phase Molm-13 cells at a dose of 1E+04 per mouse by tail vein, and the inoculation date was recorded as day 0. The mice were divided into 5 groups according to body weight, 10 mice in each group. Drug administration was performed 3 times on day 1, day 4 and day 7. The drug administration scheme is shown in Table 8, wherein group 1 is the solvent control group, and in group 3, the elution after mixing of NK cells and N5G3-h5xanti-CD123 bispecific antibody means that after the combination of NK cells and N5G3-h5xanti-CD123 bispecific antibody at 37°C for 1 hour, PBS was used for washing once, and then resuspended for injection.

[0353] Table 8. Drug administration scheme

[0354] The body weight was measured twice a week during the experiment, and the survival of mice was monitored. The survival curve of mice was drawn by statistical software. The results are shown in Figure 7. The mice in group 1 inoculated with tumor cells only without NK cells and N5G3-h5xanti-CD123 bispecific antibody all died at 33 days, the survival of mice in group 5 given NK cells but not N5G3-h5xanti-CD123 bispecific antibody was prolonged compared with group 1, indicating that NK cells had a certain tumor inhibition effect. Groups 2, 3 and 4 were all given NK cells and N5G3-h5xanti-CD123 bispecific antibody, and the survival was significantly prolonged compared with group 5.

[0355] All publications and patent documents cited in this specification are incorporated by reference in their entirety as if each individual publication or patent were specifically and individually indicated to be incorporated by reference. Various modifications and changes can be made to the embodiments of the present disclosure without departing from the true spirit and scope of the present disclosure. Any feature, step or embodiment of the embodiments of the present disclosure can be used in combination with any other feature, step or embodiment, unless the context indicates otherwise.

[0356] Sequence information

[0357] References

[0358] 1. Dixon KJ, Wu J, Walcheck B. Engineering Anti-Tumor Monoclonal Antibodies and Fc Receptors to Enhance ADCC by Human NK Cells. Cancers (Basel). 2021 Jan 16;13(2):312.

[0359] 2. Testa U, Pelosi E, Frankel A. CD123 is a membrane biomarker and a therapeutic target in hematologic malignancies. Biomark Res. 2014 Feb 10;2(1):4.

[0360] 3. Munoz L et al., Haematologica. 86(12): 1261-9.

[0361] 4. Testa U, Riccioni R, Militi S, Coccia E, Stellacci E, Samoggia P, Latagliata R, Mariani G, Rossini A, Battistini A, Lo-Coco F, Peschle C. Elevated expression of IL-3Ralpha in acute myelogenous leukemia is associated with enhanced blast proliferation, increased cellularity, and poor prognosis. Blood. 2002 Oct 15;100(8):2980-8.

[0362] 5. Demaria O, Gauthier L, Debroas G, Vivier E. Natural killer cell engagers in cancer immunotherapy: Next generation of immuno-oncology treatments. Eur J Immunol. 2021 Aug;51(8):1934-1942.16.

[0363] 6. A. Margaret Merchant et al., An efficient route to human bispecific IgG, Nature Biotechnology, Volume 16, 1998.

[0364] 7. Kabat, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, Md. (1991).

[0365] 8. A1-Lazikani et al., J. Mol. Biol. 273:927-948 (1997).

[0366] 9. Martin et al., Proc. Natl. Acad. Sci. USA 86:9268-9272 (1989).

[0367] 10. E., Poignavent, V., Vincke, C., et al. (2018) Ritzenthaler C, Muyldermans S, Monsion B. Construction of High-Quality Camel Immune Antibody Libraries. Methods Mol Biol 1701: 169-187.

[0368] 11. CN 201510097117.0

[0369] 12. Phage Display: A Laboratory Manual / Clackson, T. (US), Lowman, H. B. (US) ; Ma Lan et al. Trans. Chemical Industry Press, 2008.5.

[0370] 13. CN 202010080449.9

[0371] 14. US 20160200833A1

[0372] 15. Tineke Casneuf et al., Blood Adv. 2017 Oct 24; 1(23): 2105-2114.

[0373] 16. Tan, P., Mitchell, D, A., Buss, T, N., et al. (2022) "Superhumanized" antibodies: reduction of immunogenic potential by complementarity-determining region grafting with human germline sequences: application to an anti-CD28. J Immunol 169(2): 1119-1125.

Claims

1. A bispecific antibody comprising a first antigen binding region that binds human CD16 and a second antigen binding region that binds a tumor cell surface antigen, wherein the first antigen binding region that binds human CD16 comprises: a HCDR1 as set forth in SEQ ID NO: 1, a HCDR2 as set forth in SEQ ID NO: 2, and a HCDR3 as set forth in SEQ ID NO: 3; or a HCDR1 as set forth in SEQ ID NO: 4, a HCDR2 as set forth in SEQ ID NO: 5, and a HCDR3 as set forth in SEQ ID NO: 6; wherein the amino acid sequences of the HCDRs are according to the definition of Kabat.

2. The bispecific antibody of claim 1, wherein the first antigen binding region that binds human CD16 is in the form of a single domain antibody; preferably, the first antigen binding region that binds human CD16 comprises a monovalent or multivalent single domain antibody that binds CD16.

3. The bispecific antibody of claim 1 or 2, wherein the tumor surface antigen is selected from the group consisting of CD123, HER1, HER2, HER3, EpCAM, CEA, PSMA, CD19, CD20, CD22, CD38, and BCMA.

4. The bispecific antibody of any one of claims 1-3, wherein the CD16 is CD16a or CD16b.

5. A bispecific antibody comprising a first antigen binding region that binds human CD16 and a second antigen binding region that binds human CD123.

6. The bispecific antibody of claim 5, wherein the first antigen binding region that binds human CD16 comprises: a HCDR1 as set forth in SEQ ID NO: 1, a HCDR2 as set forth in SEQ ID NO: 2, and a HCDR3 as set forth in SEQ ID NO: 3; or a HCDR1 as set forth in SEQ ID NO: 4, a HCDR2 as set forth in SEQ ID NO: 5, and a HCDR3 as set forth in SEQ ID NO: 6; wherein the amino acid sequences of the HCDRs are according to the definition of Kabat.

7. The bispecific antibody of claim 5 or 6, wherein the first antigen binding region that binds human CD16 is in the form of a single domain antibody; preferably, the first antigen binding region that binds human CD16 comprises a monovalent or multivalent single domain antibody that binds human CD16.

8. The bispecific antibody of any one of claims 5-7, wherein the second antigen binding region that binds human CD123 comprises: a HCDR1 as set forth in SEQ ID NO: 7, a HCDR2 as set forth in SEQ ID NO: 8, a HCDR3 as set forth in SEQ ID NO: 9, a LCDR1 as set forth in SEQ ID NO: 10, a LCDR2 as set forth in SEQ ID NO: 11, and a LCDR3 as set forth in SEQ ID NO: 12; wherein the amino acid sequences of the HCDRs and LCDRs are according to the definition of Kabat.

9. The bispecific antibody of any one of claims 5-8, wherein the second antigen binding region that binds human CD123 is in a Fab format or a single chain antibody (scFv) format; preferably, the second antigen binding region that binds human CD123 is in a Fab format.

10. The bispecific antibody of any one of claims 5-9, wherein CD16 is CD16a or CD16b.

11. The bispecific antibody of any one of claims 1-10, wherein the first antigen binding region that binds human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15; and / or the second antigen binding region binds human CD123 and comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO:

17.

12. The bispecific antibody of claim 11, wherein: the first antigen binding region that binds human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 13; and / or the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 17; or the first antigen binding region that binds human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 14; and / or the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO: 17; or the first antigen binding region that binds human CD16 comprises an amino acid sequence as set forth in SEQ ID NO: 15; and / or the second antigen binding region that binds human CD123 comprises a heavy chain variable region having an amino acid sequence as set forth in SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as set forth in SEQ ID NO:

17.

13. The bispecific antibody of any one of claims 5-12, wherein the first antigen binding region that binds human CD16 and the second antigen binding region that binds human CD123 are connected by an antibody heavy chain constant region Fc fragment, which comprises a first Fc fragment and a second Fc fragment.

14. The bispecific antibody of claim 13, wherein the antibody heavy chain constant region Fc fragment is an Fc fragment of IgG1 subtype; preferably, the antibody heavy chain constant region Fc fragment is an Fc fragment of IgG1 m3 subtype. ​ ​ ​ ​ ​ ​ 15. The bispecific antibody of claim 13 or 14, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the first Fc fragment are C, S, A, and V, respectively; and the amino acids at positions 354 and 366 of the second Fc fragment are C and W, respectively, or the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively. wherein Antibody constant region amino acid positions are determined according to EU numbering.

16. The bispecific antibody of claim 15, wherein the amino acids at positions 354 and 366 of the first Fc fragment are C and W, respectively, and the amino acids at positions 349, 366, 368, and 407 of the second Fc fragment are C, S, A, and V, respectively. wherein Antibody constant region amino acid positions are determined according to EU numbering.

17. The bispecific antibody of any one of claims 13-16, wherein the amino acids at positions 234, 235, and 331 of the first Fc fragment and the second Fc fragment are F, E, and S, respectively; and / or one of the first Fc fragment and the second Fc fragment is linked to the first antigen binding region that binds human CD16, and the other of the first Fc fragment and the second Fc fragment is linked to the second antigen binding region that binds human CD123; wherein Antibody constant region amino acid positions are determined according to EU numbering.

18. The bispecific antibody of any one of claims 5-17, comprising a first arm that binds human CD16 and a second arm that binds human CD123, wherein the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18, 38, or 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19, or comprises amino acid sequences as set forth in SEQ ID NO: 20 and 21.

19. The bispecific antibody of claim 18, wherein the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 18; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 38; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 20 and 21; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; or the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NO: 19; ​ ​ ​ the first arm comprises an amino acid sequence as set forth in SEQ ID NO: 39; and / or the second arm comprises an amino acid sequence as set forth in SEQ ID NOs: 20 and 21.

20. A single-domain antibody binding to human CD16, comprising a HCDR1 as set forth in SEQ ID NO: 1, a HCDR2 as set forth in SEQ ID NO: 2, and a HCDR3 as set forth in SEQ ID NO: 3; or a HCDR1 as set forth in SEQ ID NO: 4, a HCDR2 as set forth in SEQ ID NO: 5, and a HCDR3 as set forth in SEQ ID NO: 6; wherein the amino acid sequences of the HCDRs are according to the definition of Kabat.

21. The single-domain antibody of claim 20, wherein the single-domain antibody comprises an amino acid sequence as set forth in SEQ ID NO: 13, 14, or 15.

22. The single-domain antibody of claim 20 or 21, wherein CD16 is CD16a or CD16b.

23. A pharmaceutical composition comprising the bispecific antibody of any one of claims 1-19 or the single-domain antibody of any one of claims 20-22 and a pharmaceutically acceptable excipient, diluent, or carrier.

24. The pharmaceutical composition of claim 23, wherein the pharmaceutical composition further comprises natural killer cells (NK cells); preferably, the NK cells are obtained from in vitro culture and expansion of NK cells derived from peripheral blood mononuclear cells (PBMCs); the NK cells are obtained from in vitro culture and expansion of NK cells derived from umbilical cord blood; the NK cells are obtained from in vitro culture and expansion of a NK cell line; or the NK cells are obtained from in vitro induction, culture, and expansion from induced pluripotent stem cells (iPSCs) or mesenchymal stem cells (MSCs).

25. An antibody-natural killer cell (NK cell) conjugate, wherein the antibody is the bispecific antibody of any one of claims 1-19 or the single-domain antibody of any one of claims 20-22; when the antibody is the bispecific antibody of any one of claims 1-19, the antibody is conjugated to the NK cell via antigen-antibody binding of its first antigen binding region to a CD16 molecule on the NK cell; or when the antibody is the single-domain antibody of any one of claims 20-22, the antibody is conjugated to the NK cell via antigen-antibody binding of the antibody to a CD16 molecule on the NK cell.

26. The antibody-NK cell conjugate of claim 25, wherein the NK cells are obtained from in vitro culture and expansion of NK cells derived from peripheral blood mononuclear cells (PBMCs); the NK cells are obtained from in vitro culture and expansion of NK cells derived from umbilical cord blood; the NK cells are obtained from in vitro culture and expansion of a NK cell line; or the NK cells are obtained from in vitro induction, culture, and expansion from induced pluripotent stem cells (iPSCs) or mesenchymal stem cells (MSCs).

27. Use of the bispecific antibody of any one of claims 1-19, the single-domain antibody of any one of claims 20-22, the pharmaceutical composition of claim 23 or 24, or the antibody-NK cell conjugate of claim 25 or 26 for the manufacture of a medicament for the prevention or treatment of a tumor.

28. The use of claim 27, wherein the tumor is a CD123-positive tumor; preferably, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

29. The use of claim 27, wherein the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

30. The bispecific antibody of any one of claims 1-19, the single-domain antibody of any one of claims 20-22, the pharmaceutical composition of claim 23 or 24, or the antibody-NK cell conjugate of claim 25 or 26 for use in the prevention or treatment of a tumor.

31. The bispecific antibody, single-domain antibody, pharmaceutical composition, or antibody-NK cell conjugate of claim 30, wherein the tumor is a CD123-positive tumor, preferably the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

32. The bispecific antibody, single-domain antibody, pharmaceutical composition, or antibody-NK cell conjugate of claim 30, wherein the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

33. A method of preventing or treating a tumor, the method comprising administering to an individual in need thereof the bispecific antibody of any one of claims 1-19, the single-domain antibody of any one of claims 20-22, the pharmaceutical composition of claim 23 or 24, or the antibody-NK cell conjugate of claim 25 or 26.

34. The method of claim 33, wherein the tumor is a CD123-positive tumor; preferably, the tumor is acute myeloid leukemia or blastic plasmacytoid dendritic cell neoplasm.

35. The method of claim 33, wherein the tumor is selected from the group consisting of acute myeloid leukemia, lung cancer (e.g., non-small cell lung cancer), breast cancer (e.g., triple negative breast cancer), head and neck squamous cell carcinoma, colorectal cancer, gastric cancer, ovarian cancer, esophageal cancer, prostate cancer, pancreatic cancer, multiple myeloma, lymphoma (e.g., B-cell lymphoma, non-Hodgkin lymphoma), and acute B-lymphoblastic leukemia.

36. Use of the bispecific antibody of any one of claims 1-19, or the single-domain antibody of any one of claims 20-22, in the manufacture of a product for detecting CD16-positive cells.

37. The use of claim 36, wherein the product is a kit, a test strip, a test card, or a microfluidic device.

Images