Uses of 14-hydroxylated brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance

Abstract

The present application belongs to the technical field of plant regulators, and specifically relates to the uses of 14-hydroxylated brassinosteroid and an anthocyanin extract in promoting plant growth and enhancing plant stress resistance. Provided in the present application are the uses of 14-hydroxylated brassinosteroid and the anthocyanin extract in promoting plant growth and enhancing plant stress resistance, the action concentration of 14-hydroxylated brassinosteroid being 0.001-0.1 ppm, and the action concentration of the anthocyanin extract being 0.005-0.5 ppm. In the present application, 14-hydroxylated brassinosteroid and the anthocyanin extract are used in combination at relatively low concentrations, thereby promoting plant growth, enhancing the stress-resistant capability of plants, and having a significant synergistic effect.

Description

Use of 14-hydroxy brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance

[0001] The present application claims priority to the Chinese patent application No. 202411315451.4 filed on September 20, 2024, and entitled "Use of 14-hydroxy brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance", the content of which is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The present application belongs to the technical field of plant regulators, and specifically relates to the use of 14-hydroxy brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance. BACKGROUND

[0003] Unfavorable conditions in the natural environment, such as drought, salinity, high temperature, low temperature, pests and diseases, often have a serious impact on the growth and yield of crops. Improving the stress resistance of plants is of great significance in ensuring stable agricultural production, adapting to climate change, saving resources and water, protecting the ecological environment, and promoting sustainable agricultural development.

[0004] Regulating the growth and development process of crops is an important means to improve plant stress resistance. 14-hydroxy brassinosteroid is a broad-spectrum, high-activity plant growth regulator that can promote plant growth, increase seed setting rate, increase yield, improve quality, and resist stress. It is widely used in agricultural production. Anthocyanins, also known as anthocyanidins, are water-soluble natural pigments widely found in plants. The main coloring substances in fruits, vegetables, and flowers are mostly related to anthocyanins. In the natural state, anthocyanins exist in the form of glycosides, known as anthocyanins or anthocyanins, which belong to flavonoid polyphenols. This combination makes anthocyanins more stable and water-soluble, making them easier to store and transport in plants. Therefore, the well-known anthocyanin extract is actually an anthocyanin extract. Anthocyanins have antioxidant capacity, can enhance the stress resistance of plants, improve the adaptability of plants to environmental stress, and can regulate the growth and development process of plants, promote the growth and development of plants, and thus improve the yield and quality of plants. However, the extraction efficiency of anthocyanin extract is low, resulting in a very low concentration. Therefore, it is necessary to develop a low-concentration agent that can promote plant growth. SUMMARY

[0005] In order to solve the problems existing in the prior art, the present application provides the use of 14-hydroxy brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance. The use of 14-hydroxy brassinosteroid and anthocyanin extract in combination can promote plant growth and enhance the stress resistance of plants at a lower concentration.

[0006] To achieve the above-mentioned purposes, the present application provides the following technical solutions.

[0007] The present application provides the application of 14-hydroxy rutin sterol and anthocyanin extract in promoting plant growth and enhancing plant stress resistance, characterized in that the concentration of 14-hydroxy rutin sterol is 0.001-0.1 ppm.

[0008] The concentration of anthocyanin extract is 0.005-0.5 ppm.

[0009] Preferably, the 14-hydroxy rutin sterol is used in the form of an ethanol solution of 14-hydroxy rutin sterol; and the anthocyanin extract is used in the form of an aqueous solution of anthocyanin extract.

[0010] Preferably, the application mode of the ethanol solution of 14-hydroxy rutin sterol and the aqueous solution of anthocyanin extract includes seed soaking, coating, leaf spraying, root dipping or root irrigation.

[0011] Preferably, the 14-hydroxy rutin sterol and anthocyanin extract can also be made into agricultural products; the agricultural products further include adjuvants, which include one or more of dispersants, wetting agents, binders, emulsifiers, stabilizers and solvents.

[0012] The dosage form of the agricultural product includes emulsifiable concentrate, suspension concentrate, wettable powder, powder, granule, aqueous agent, mother liquor or mother powder.

[0013] Preferably, the plants include corn, wheat, pepper, cotton, Chinese cabbage, Shanghai green, lettuce, tomato, cucumber, ginger, grape or citrus.

[0014] Preferably, the stress resistance includes one or more of salt-alkali resistance, drought resistance, high-temperature resistance and low-temperature resistance of the plants.

[0015] Preferably, the anthocyanin extract is blueberry anthocyanin extract, grape seed anthocyanin extract, mulberry anthocyanin extract or plant hairy root extract containing anthocyanin and its glycoside derivatives.

[0016] Preferably, the preparation method of the plant hairy root extract containing anthocyanin and its glycoside derivatives includes the following steps:

[0017] The transgenic plant hairy roots producing anthocyanin and its glycoside derivatives are used as extraction raw materials, water extraction is performed, solid-liquid separation is carried out, and the liquid phase is collected;

[0018] The liquid phase is treated by alcohol precipitation method, the precipitate is collected, and the plant hairy root extract containing anthocyanin and its glycoside derivatives is obtained.

[0019] Preferably, the transgenic plant hairy roots containing anthocyanins and their glycoside derivatives include at least one of the following plants: Antirrhinum, Vaccinium, Fragaria, Rubus, Brassica, Daucus, Lactuca and Cucurbitaceae;

[0020] The genes in the transgenic plant hairy roots containing anthocyanins and their glycoside derivatives include at least one of the following transcription factors or mutants thereof: MYB transcription factor, BBX transcription factor, bZIP transcription factor and bHLH transcription factor.

[0021] Preferably, the mass ratio of the extraction raw material to water is 1: (5-100); the temperature of water extraction is 30-100℃; and the time of water extraction is 5-300 min.

[0022] The application provides application of 14-hydroxy brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance, wherein the application concentration of the 14-hydroxy brassinosteroid is 0.001-0.1 ppm; and the application concentration of the anthocyanin is 0.005-0.5 ppm. The 14-hydroxy brassinosteroid and the anthocyanin extract are used in combination at a lower concentration, which can promote plant growth, enhance the stress resistance of plants, and has a significant synergistic effect. DETAILED DESCRIPTION

[0023] The application provides application of 14-hydroxy brassinosteroid and anthocyanin extract in promoting plant growth and enhancing plant stress resistance, wherein the application concentration of the 14-hydroxy brassinosteroid is 0.001-0.1 ppm;

[0024] The application concentration of the anthocyanin extract is 0.005-0.5 ppm.

[0025] As an embodiment, the 14-hydroxy brassinosteroid is used in the form of an ethanol solution of 14-hydroxy brassinosteroid; and the anthocyanin extract is used in the form of an aqueous solution of anthocyanin extract. As an embodiment, the application mode of the ethanol solution of 14-hydroxy brassinosteroid and the aqueous solution of anthocyanin extract includes seed soaking, coating, leaf spraying, root dipping or root irrigation.

[0026] As an embodiment, the 14-hydroxy brassinosteroid and the anthocyanin extract can also be made into agricultural products; and the agricultural products further include adjuvants, which include one or more of dispersants, wetting agents, binders, emulsifiers, stabilizers and solvents.

[0027] As an embodiment, the dosage form of the agricultural products includes emulsifiable concentrate, suspension concentrate, wettable powder, powder, granule, aqueous agent, mother liquor or mother powder.

[0028] As an embodiment, the effective concentration of the 14-hydroxy brassinosteroid is 0.001-0.1 ppm, and in a specific embodiment, the effective concentration of the 14-hydroxy brassinosteroid can be 0.002 ppm; as an embodiment, the effective concentration of the anthocyanin extract is 0.005-0.5 ppm, and in a specific embodiment, the effective concentration of the anthocyanin extract can be 0.01 ppm.

[0029] As an embodiment, the plant includes corn, wheat, pepper, cotton, Chinese cabbage, Shanghai green, lettuce, tomato, cucumber, ginger, grape or citrus. As an embodiment, the stress resistance includes one or more of salt-alkali resistance, drought resistance, high temperature resistance and low temperature resistance.

[0030] As an embodiment, the anthocyanin extract is blueberry anthocyanin extract, grape seed anthocyanin extract, mulberry anthocyanin extract or plant hairy root extract containing anthocyanin and its glycoside derivatives.

[0031] In the present application, the preparation method of the plant hairy root extract containing anthocyanin and its glycoside derivatives includes the following steps:

[0032] Using the transgenic plant hairy root producing anthocyanin and its glycoside derivatives as the extraction raw material, water extraction, solid-liquid separation, and collecting the liquid phase;

[0033] The liquid phase is treated by alcohol precipitation method, and the precipitate is collected to obtain the plant hairy root extract containing anthocyanin and its glycoside derivatives.

[0034] In the present application, the induction method of the transgenic plant hairy root producing anthocyanin and its glycoside derivatives preferably includes the following steps: using Agrobacterium rhizogenes containing an induction gene to infect plant explants, co-culturing, and axenic culture to obtain transgenic hairy roots producing anthocyanin and its glycoside derivatives.

[0035] In the present application, the construction method of Agrobacterium rhizogenes containing an induction gene preferably includes: constructing the induction gene into a vector to obtain a recombinant vector, and transforming the recombinant vector into Agrobacterium rhizogenes to obtain Agrobacterium rhizogenes containing an induction gene.

[0036] The type of the vector is not particularly limited in the present application, and the vector can be a vector with or without a reporter gene. The reporter gene is not particularly limited in the present application, and can be a GUS gene. In specific embodiments, the vector can be pCambia1301 or pCambia1301-GUS. The source of pCambia1301 or pCambia1301-GUS is not particularly limited in the present application, and a conventional commercially available pCambia1301-GUS can be used. In specific embodiments, the inducible gene preferably comprises a gene encoding at least one of the following transcription factors or mutants thereof: MYB transcription factor, BBX transcription factor, bZIP transcription factor, and bHLH transcription factor (see Table 1).

[0037] The gene encoding the MYB transcription factor can be a MYBA1 gene, and the nucleotide sequence is shown in SEQ ID NO. 1. When the inducible gene is a MYBA1 gene, the method for constructing Agrobacterium rhizogenes containing the MYBA1 gene comprises: constructing the MYBA1 gene into a vector to obtain a recombinant vector, which is characterized by a transcription unit containing a strong promoter (such as a 35S promoter) and capable of overexpressing MYBA1. The recombinant vector is transformed into Agrobacterium rhizogenes to obtain Agrobacterium rhizogenes containing the MYBA1 gene. The plants in the plant explants preferably comprise at least one of the following plants: Antirrhinum, Vaccinium, Fragaria, Rubus, Brassica, Daucus, Lactuca, and plants of the family Poaceae, and the specific plant species can be Antirrhinum, Vaccinium uliginosum, blueberry, cranberry, raspberry, strawberry, cabbage, carrot, lettuce, corn, rice, wheat, etc.

[0038] The plant explants are preferably plant stem segments. The Agrobacterium rhizogenes preferably comprises Agrobacterium rhizogenes MSU440. The time of infection is preferably 3-8 min, more preferably 5 min. In an embodiment of the present application, the anthocyanin synthesis gene MYBA1 is transferred to Antirrhinum to accelerate the synthesis of anthocyanins and their derivatives, and the present application creates plant tissues that can realize the biosynthesis of anthocyanins and their derivatives.

[0039] In the present application, the co-culture uses a co-culture medium, which preferably contains 100 μmol / L of acetyl-syringone. The bacteria-free culture preferably uses a bacteria-free culture medium, which preferably contains 100-300 mg / L (200 mg / L) of carbenicillin and timentin. In specific embodiments, the co-culture medium comprises 4.74 g of MS medium, 30 g of sucrose and 8 g of agar per liter, and has a pH value of 5.8; and the concentration of acetyl-syringone in the co-culture medium is 100 μmol / L. In specific embodiments, the bacteria-free culture medium comprises 4.74 g of MS medium, 30 g of sucrose and 8 g of agar per liter, and has a pH value of 5.8; and the mass concentration of timentin in the bacteria-free culture medium is 200 mg / L, and the mass concentration of carbenicillin is 200 mg / L. The induction method can be used to induce transgenic plant hairy roots. The present application uses transgenic plant hairy roots as plant tissues for culture, which can obtain a large amount of transgenic plant hairy roots containing anthocyanins and glycoside derivatives thereof in a short time, and can be subjected to liquid culture to realize the efficient synthesis and production of anthocyanins and glycoside derivatives thereof.

[0040] In the present application, in order to obtain a large amount of extraction material, a method for mass culture of the transgenic plant hairy roots containing anthocyanins and glycoside derivatives thereof is further included, preferably the transgenic hairy roots are subjected to liquid culture, and the temperature of the liquid culture can be 25-29°C, or 26°C, 27°C or 28°C. In specific embodiments, the rotation speed of the liquid culture can be 90-120 rpm, or 100 rpm or 110 rpm. In specific embodiments, the culture medium used in the liquid culture comprises MS liquid medium. Since the hairy roots have biochemical and genetic stability, can grow rapidly in a hormone-free culture medium, have similar biosynthetic capacity to the parent plants, and have a fast biomass growth rate, they can provide sufficient material for the industrialization of anthocyanins and glycoside derivatives thereof, and can quickly and effectively obtain hairy roots for synthesizing anthocyanins and glycoside derivatives thereof, while in the case of limited germplasm resources, anthocyanins and glycoside derivatives thereof can be obtained in a short time and without seasonal influence. The use of the hairy roots of the present application for the production of anthocyanins and glycoside derivatives thereof can further improve the production efficiency and yield.

[0041] In the present application, the mass ratio of the extraction raw material and water is preferably 1:(5-100), more preferably 1:(10-90), further preferably 1:(20-80), still further preferably 1:(30-70), more further preferably 1:(40-60), and most preferably 1:50. The temperature of the water extraction is preferably 30-100℃, further preferably 40-90℃, still further preferably 50-80℃, more further preferably 60-70℃, and most preferably 65℃. The time of the water extraction is preferably 5-300 min, more preferably 30-250 min, further preferably 60-200 min, still further preferably 100-150 min, and most preferably 120 min. The extraction raw material is preferably pulverized before the water extraction. The particle size of the pulverized extraction raw material is preferably 20-100 mesh, more preferably 40-80 mesh, and most preferably 50 mesh. The method of the solid-liquid extraction is preferably filtration. The pore size of the filter cloth for the filtration is not limited, as long as the purpose of the solid-liquid separation is achieved.

[0042] In the present application, the liquid phase is preferably concentrated before the alcohol precipitation method treatment to obtain an extract. The volume of the extract is preferably 0.1-0.8 times, more preferably 0.2-0.5 times, and most preferably 0.3 times the volume of the liquid phase. The volume ratio of the extract and the alcohol solvent during the alcohol precipitation method treatment is preferably 1:(1-10), more preferably 1:(2-8), most preferably 1:(4-6), and most preferably 1:5. The temperature during the alcohol precipitation method treatment is preferably 0-10℃, more preferably 4-6℃. The alcohol solvent is preferably anhydrous ethanol. The method for collecting the precipitate is preferably centrifugation.

[0043] In the present application, the plant hairy root extract containing anthocyanins and glycoside derivatives thereof extracted by the above method is detected. When the transgenic plant hairy root containing the MYBA1 gene is used as the extraction material, the active ingredient is mainly anthocyanins and glycoside derivatives thereof, specifically cyanidin-3-glucoside (C3G). When the transgenic plant hairy root containing anthocyanins and glycoside derivatives thereof is used as the extraction material, the active ingredients mainly include malvidin, cyanidin, pelargonidin, delphinidin, peonidin, and petunidin. The glycoside derivatives of anthocyanins are formed by connecting different glycoside bonds on the basis of the above active ingredients, such as malvidin glycoside derivatives, cyanidin glycoside derivatives, pelargonidin glycoside derivatives, delphinidin glycoside derivatives, peonidin glycoside derivatives, and petunidin glycoside derivatives (see Table 1).

[0044] The technical solutions provided in the present application are described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.

[0045] Example 1

[0046] Preparation of hairy root anthocyanin extract:

[0047] 1.1 Experimental method

[0048] 1) Experimental materials

[0049] Preparation of Amas sterile seedlings

[0050] The Amas seeds collected in the wild were washed with sterile water twice, the upper unsaturated seeds were discarded, 75% alcohol was used for 2 min, sterile water was used for washing 3 times, 5% NaClO was vortexed for 5 min, sterile water was used for washing 5 times, inoculated into MS medium, cultured at 25°C for 16 / 8 h, and when the sterile seedlings reached 6-8 leaves, they were used for hairy root induction.

[0051] 2) Experimental reagents.

[0052] MS medium, sucrose, agar, carrier pCambia1301-GUS (purchased from Newphy Biological), Agrobacterium rhizogenes MSU440 (purchased from Weidi Biological).

[0053] 3) Instrument equipment

[0054] Balance (Sartorius Scientific Instruments, SQP), plant incubator (Shanghai Yiheng Scientific Instruments Co., Ltd.), clean bench (Suzhou Antai Air Technology Co., Ltd. SW-CJ-2FD), high-pressure sterilization pot (Shanghai Boren Instruments Co., Ltd. CT-90B), alcohol lamp, tissue culture bottle, pipette, pipette tip, sealing film, rubber band, culture dish.

[0055] 4) Experimental preparation

[0056] MS medium: weigh MS medium 4.74 g, sucrose 30 g, agar 8 g, add water to constant volume to 1 L, adjust pH to 5.8, sterilize at 121°C for 30 min.

[0057] YEB medium: weigh beef extract 5 g, peptone 5 g, yeast extract powder 1 g, sucrose 5 g, MgSO4·7H2O 4 g, add water to constant volume to 1 L, adjust pH to 7.4, sterilize at 121°C for 30 min.

[0058] Carbenicillin stock solution (CB): prepare a 100 mg / mL stock solution, weigh 5 g of carbenicillin powder, sterilize with water to a constant volume of 50 mL, filter sterilize with a 0.22 μm water filter membrane, after aliquot, store at 4°C.

[0059] Time stock solution (Time): prepare a 100 mg / mL stock solution, weigh 5 g of Time powder, sterilize with water to a constant volume of 50 mL, filter sterilize with a 0.22 μm organic filter membrane, after aliquot, store at 4°C.

[0060] Acetyl-syringone (AS) stock solution: 100 mmol / L stock solution was prepared by dissolving 0.981 g of AS powder in DMSO and diluting with sterilized water to 50 mL. The solution was filtered through a 0.22 μm organic filter, aliquoted and stored at 4°C.

[0061] Co-cultivation medium: 4.74 g of MS medium, 30 g of sucrose and 8 g of agar were weighed, water was added to make up to 1 L, the pH was adjusted to 5.8, and sterilization was performed at 121°C for 30 min. After sterilization, 100 μmol / L of AS was added to the medium when the temperature was appropriate, mixed and poured into a flat plate.

[0062] Sterile culture medium: 4.74 g of MS medium, 30 g of sucrose and 8 g of agar were weighed, water was added to make up to 1 L, the pH was adjusted to 5.8, and sterilization was performed at 121°C for 30 min. After sterilization, 200 mg / L of Time and 200 mg / L of CB were added to the medium when the temperature was appropriate, mixed and poured into a flat plate.

[0063] 1.2 Test method

[0064] 1) Strain activation

[0065] Agrobacterium rhizogenes MSU440 stored in a -80°C refrigerator was inoculated in YEB liquid medium in a clean bench, and incubated in the dark at 200 r / min and 28°C for 16 h. The strain after incubation for 16 h was inoculated in 1 mL of YEB liquid medium in a clean bench, and incubated in the dark at 200 r / min and 28°C for 4-6 h. When the bacterial solution was in the logarithmic growth phase (OD 600 = 0.2-0.8), it was used for infection.

[0066] 2) Infection

[0067] In a clean bench, the cultured Antirrhinum majus sterile seedling stem segments were cut into 0.5 cm with sterilized scissors, and the wounds were treated with a needle. The segments were infected with the activated Agrobacterium rhizogenes for 5 min, during which the segments were shaken to ensure that the bacteria completely contacted the wounds. The excess bacteria solution was absorbed with sterile filter paper, and the segments were inoculated on the co-cultivation medium and incubated in the dark at 25°C for 2 d.

[0068] 3) Sterile culture

[0069] The co-cultured explants were transferred to the sterile culture medium and incubated in the dark at 25°C for 10 d. The induced hairy roots (2-3 cm in length) were cut with sterile scissors and inoculated on the sterile culture medium. The roots were transferred to fresh sterile culture medium every other week until they were completely sterile (1-2 months), and then the roots were transferred to MS liquid medium for proliferation culture.

[0070] 4) Screening and overexpression of anthocyanin inducing factors

[0071] MYBA1 gene (SEQ ID NO. 1, atggacatagttccattgggagtgagaaagggtgcttggactgaggaagaagactgtcttctcaagaagtgcattgagaagcatggagaggggaagtggcaccaagttccttacagggcaggattgaatagatgcaggaaaagttgtaggctgagatggttgaattatctgaggccaaatataaagagaggaaattttgctgtggatgaagttgatctcattatcaggcttcataagctgctaggcaatagatggtcgttaattgcgggtagacttccaggaagaacatcgaacgacgtgaaaaattactggaatacccatctgaaagagaaatcaacggaccaaagtggagaggtacagaaatctaaaacgaccctgaatacgactgaaaggaccacaatcatacggcctcaaccacgaaccttctccaaaaatcgacatgttttgatgggtagtaatgtcattgcagataatattcaaacaagagatccaaatctctccaacccatcccaaacacaaccaccgggggatgatgatggaacattgtggtgggatgacatgttgttcgattatgaaattagcagaggtatgatgacgtggaccaatgacggatcaaatgaggaggccatgatggtggataacggtgaagaagcaaaatcaggtacacaaggagctggtggggatcgttacagttgtgttcaagaagatcagagtgattggagtaacatttttatggacaatgtggacctttgggatattttaggtgatgaacaagcagtactgtaa) was used to construct a vector (pCambia1301) for overexpressing genes, the constructed vector was transferred into Agrobacterium tumefaciens, and plant explants were infected, the infection method was the same as that for inducing hairy roots of Amas sterile seedlings, and transgenic hairy roots stably expressing the MYBA1 gene were obtained.

[0072] The example uses Agrobacterium rhizogenes MSU440 to mediate the transfer of MYBA1 gene into L. japonica explants, and the explants can be degermed after 2 days of co-culture. A large number of hairy roots can be induced in a short time, and the hairy roots can be obtained after 10 days. The induction efficiency is high, and the induction rate is 100%.

[0073] The plant hairy roots prepared above were washed and dried in a forced air drying oven at 80°C. Then, the hairy roots were ground into fine powder using a grinder. A certain amount of the hairy roots was weighed, and 10 times the volume of water was added. The mixture was stirred at 50°C for 60 min. The solid and liquid were separated by filtration. The filtrate was concentrated to 0.3 times the original volume. Five times the volume of anhydrous ethanol was added, and the mixture was precipitated at 4°C overnight. The precipitate was collected by filtration and freeze-dried to obtain the extract. The total anthocyanin content of the obtained extract was determined by the pH color difference method to be 0.3 wt%.

[0074] Example 2 Anti-stress activity test of 14-hydroxybrassicasterone and hairy root anthocyanin extract

[0075] 2.1 Preparation of the agent

[0076] 14-hydroxybrassicasterone was obtained from Chengdu Xinchaoyang Crop Science Co., Ltd., and the content was 80 wt%. The hairy root anthocyanin extract (AN) was obtained from Example 1.

[0077] The hairy root anthocyanin extract (AN) and 14-hydroxybrassicasterone were respectively prepared into 0.1 wt% stock solution (1000 ppm) using water and anhydrous ethanol. Then, the stock solution was diluted according to the concentration designed in Table 1.

[0078] Table 1 Experimental design

[0079] 2.2 Experimental method

[0080] 1) Agent treatment

[0081] The corn seeds were soaked in a 5 wt% sodium hypochlorite solution for 10 min, and then washed with water for 5-6 times to remove the sodium hypochlorite. The surface water was wiped dry with filter paper. The seeds were treated with the agent by soaking, and the agent was made to cover the surface of the seeds. After 16 h of soaking in a 25°C incubator, the surface agent of the seeds was washed away, and the surface water was absorbed with filter paper for standby.

[0082] 2) Preparation of saline-alkali soil

[0083] The nutrient soil and vermiculite were mixed in a mass ratio of 1:1 to obtain the planting soil, and 300 g of the planting soil was weighed into the planting box.

[0084] A 2 wt% NaCl aqueous solution was prepared, and the pH of the NaCl aqueous solution was adjusted to 10.5 with NaOH to obtain the saline-alkali water.

[0085] In each planting box, add 250 mL of saline water, stir evenly and reserve.

[0086] 3) Experimental treatment

[0087] Select uniform and undamaged corn seeds, evenly sow in planting boxes, 20 per pot, 3 replicates per treatment. After 8 days of experimental treatment, investigate root length, plant height, root weight and plant weight of each treatment group.

[0088] 2.3 Experimental results

[0089] The experimental results are shown in Tables 2 and 3. From the experimental results, it can be seen that different concentrations of hairy root anthocyanin extract (AN) and 14-hydroxy brassinosteroid (14-OHBR) can improve the stress resistance of corn seed soaking under saline-alkali conditions and promote the growth of corn aboveground and underground.

[0090] Among them, the optimal concentration of hairy root anthocyanin extract (AN) is 0.1 ppm, compared with the water control, the highest promotion rate of corn plant height, plant weight, root length and root weight is 10.34%, 13.85%, 13.59% and 12.26%; The optimal concentration of 14-hydroxy brassinosteroid (14-OHBR) is 0.02 ppm, compared with the water control, the highest promotion rate of corn plant height, plant weight, root length and root weight is 12.93%, 18.56%, 20.39% and 19.61%.

[0091] Table 2 14-OHBR and AN effect on corn aboveground under saline-alkali conditions

[0092] Table 3 14-OHBR and AN effect on corn underground under saline-alkali conditions

[0093] Example 3 14-OHBR and AN compound stress resistance activity test

[0094] 3.1 Preparation of reagents

[0095] The reagents are the same as in Example 2, and the concentrations are designed according to Table 4 for reagent dilution.

[0096] Table 4 Experimental design

[0097] 3.2 Experimental method

[0098] 1) Reagent treatment

[0099] The corn seeds were soaked in 5wt% sodium hypochlorite solution for 10 minutes, then washed with water for 5-6 times to remove the sodium hypochlorite, and the surface water was wiped dry with filter paper. Then the seeds were treated with different concentrations of the agent, and the liquid was just above the seed surface. After 16 hours of seed soaking in a 25°C incubator, the surface agent of the seeds was washed away, and the surface water was absorbed with filter paper for standby.

[0100] 2) Preparation of saline-alkali soil

[0101] The nutrient soil and vermiculite were mixed in a mass ratio of 1:1 to serve as the planting soil, and 300g of the planting soil was weighed into the planting box.

[0102] A 2wt% NaCl aqueous solution was prepared, and the pH of the NaCl aqueous solution was adjusted to 10.5 with NaOH to obtain a saline-alkali water.

[0103] 250mL of the saline-alkali water was added to each planting box, and the mixture was stirred uniformly for standby.

[0104] 3) Experimental treatment

[0105] Uniform corn seeds without damage were selected and sowed in the planting box, 20 seeds per pot, and 3 replicates per treatment. After 8 days of experimental treatment, the root length, plant height, root weight and plant weight of each treatment group were investigated.

[0106] 3.3 Experimental results

[0107] The experimental results are shown in Tables 5 and 6. According to the experimental results of this experiment combined with the experimental results in Example 1, it can be seen that the effect of 14-hydroxy brassinosteroid (14-OHBR) alone reaches the best at a concentration of 0.02ppm, and the effect of hairy root anthocyanin extract (AN) alone reaches the best at a concentration of 0.1ppm. However, the salt-alkali resistance of corn is weak at a lower concentration (i.e., 14-OHBR 0.002ppm, AN 0.01ppm). However, the salt-alkali resistance of corn is significantly enhanced at a lower concentration (i.e., 14-OHBR 0.002ppm, AN 0.01ppm) of the combination of 14-OHBR and AN.

[0108] Compared with the water control, the promotion rate of (14-OHBR 0.002ppm, AN 0.01ppm) on the plant height, plant weight, root length and root weight of corn reached 15.97%, 21.51%, 21.10% and 22.47%, which was better than the stress resistance effect at the optimal concentration of the two, indicating that the combination of 14-OHBR and AN had obvious synergistic effect on improving the stress resistance of corn under salt-alkali conditions.

[0109] Table 5 Effect of the combination of 14-OHBR and AN on the aerial part of corn under salt-alkali conditions

[0110] Table 6 The effect of 14-OHBR and AN complex on the underground part of corn under saline-alkali conditions

[0111] Example 4 14-OHBR and AN complex promote growth activity test

[0112] 4.1 Experimental design

[0113] The test sample is the same as Example 2, and anthocyanins and 14-OHBR are respectively prepared into 0.1% stock solution (1000ppm) with water and anhydrous ethanol for use, and the concentration is designed according to Table 7 for dilution of the agent.

[0114] Table 7 Experimental design

[0115] 4.2 Experimental method

[0116] 1) A certain weight of vermiculite was weighed, 0.5 times the volume of tap water was added (i.e. 1 kg of vermiculite was added with 500 mL of tap water), and the mixture was thoroughly mixed as planting soil. The planting soil was filled into a black small square pot, the surface was smoothed and pressed to the same height for standby.

[0117] 2) The wheat seeds were disinfected with 5wt% sodium hypochlorite solution for 15 min, rinsed with clean water for 6-7 times, and the disinfectant was washed off thoroughly. Two filter papers were placed in the germination box, the filter papers were moistened with water, and the disinfected wheat seeds were laid flat on the filter papers. The cover was put on, and the germination was carried out in a 25℃ dark environment. After 16h, the wheat seeds started to show white.

[0118] 3) The seeds were selected for sowing, 15 seeds were planted in the center of each small square pot, the planting depth of each seed was about 0.5 cm, and the planting depth of each pot was kept consistent. The soil surface after planting was smoothed gently, and the seeds were completely covered.

[0119] 4) According to the experimental design, 50 mL of agent was poured into each pot with different concentrations of agent, 3 pots of seedlings were set for each treatment, and placed in a 25℃ culture room with light intensity of 10000Lux, 14h light and 10h dark. Ten days after application, the wheat was carefully washed with water to remove the soil from the roots, and 10 seedlings were measured for shoot height and root length.

[0120] 4.3 Experimental results

[0121] The experimental results are shown in Table 8. From the experimental results, it can be seen that 14-hydroxy brassinosteroid (14-OHBR) alone and hairy root anthocyanin extract (AN) alone have weaker effects on wheat root irrigation growth at lower concentrations (i.e., 14-OHBR 0.002 ppm; AN 0.01 ppm), while the combination of 14-OHBR and AN at lower concentrations (i.e., 14-OHBR 0.002 ppm; AN 0.01 ppm) has a significant synergistic effect. Compared with the water control, the promotion rate of wheat height and root length reaches 20.83% and 19.87%, which is significantly better than the effect of each at a lower concentration, indicating that the combination of 14-OHBR and AN has a significant synergistic effect on wheat root irrigation.

[0122] Table 8 14-OHBR and AN combination for wheat root irrigation growth

[0123] Example 5 14-OHBR and different sources of anthocyanin extract combination for stress resistance activity test

[0124] 5.1 Experimental design

[0125] Sample source: 14-OHBR, Chengdu Xinchaoyang Crop Science Co., Ltd., content 80wt%; blueberry anthocyanin extract, Shaanxi Xintianyu Biological Technology Co., Ltd., product number XTYLM; grape seed anthocyanin extract, Shaanxi Danier Biological Technology Co., Ltd., product number DNS23022001; mulberry anthocyanin extract, Shanxi Ruise Biological Technology Co., Ltd., product number RS-0516-254; anthocyanin extract and 14-OHBR were prepared into 0.1% stock solution (1000ppm) with water and anhydrous ethanol respectively for use, and the concentration was designed according to Table 9 for dilution of the agent.

[0126] Table 9 Experimental design

[0127] 5.2 Experimental method

[0128] 1) Agent treatment

[0129] Corn seeds were soaked in 5wt% sodium hypochlorite solution for 10min, then washed with water for 5-6 times, and the surface water was wiped dry with filter paper. Different concentrations of agents were used for seed soaking treatment, so that the seed surface was covered with liquid. After 16h of seed soaking in a 25℃ incubator, the surface agent of the seeds was washed off, and the surface moisture was absorbed with filter paper for standby.

[0130] 2) Preparation of saline-alkali soil

[0131] The nutrient soil and vermiculite were mixed in a mass ratio of 1:1 and uniformly mixed as planting soil, and 300g of planting soil was weighed into the planting box.

[0132] A NaCl aqueous solution with a concentration of 2wt% was prepared, and the pH of the NaCl aqueous solution was adjusted to 10.5 with NaOH to obtain saline water;

[0133] 250mL of the saline water was added to each planting box, and after stirring, it was ready for use.

[0134] 3) Experimental treatment

[0135] Uniformly sized and undamaged corn seeds were selected and evenly sown in the planting boxes, 20 per pot, and 3 replicates per treatment. After 8 days of experimental treatment, the root length, plant height, root weight and plant weight of each treatment group were investigated.

[0136] 5.3 Experimental results

[0137] The experimental results are shown in Tables 10 and 11. From the experimental results, it can be seen that 14-OHBR alone and anthocyanin extract from different sources alone at a lower concentration (i.e. 14-OHBR 0.002ppm, anthocyanin extract from different sources 0.01ppm) are weak in promoting the salt-tolerant ability of corn. When 14-OHBR is compounded with 25% blueberry anthocyanin extract, the promotion rate of corn plant height, plant weight, root length and root weight compared with the water control group reaches 21.62%, 23.16%, 22.77% and 20.36%. When 14-OHBR is compounded with 10% grape seed anthocyanin extract, the promotion rate of corn plant height, plant weight, root length and root weight compared with the water control group reaches 19.80%, 18.36%, 20.72% and 21.75%. When 14-OHBR is compounded with 2% mulberry anthocyanin extract, the promotion rate of corn plant height, plant weight, root length and root weight compared with the water control group reaches 17.82%, 16.36%, 18.02% and 21.19%. It is significantly better than anthocyanin extract from different sources and 14-OHBR alone, indicating that 14-OHBR and anthocyanin extract from different sources at a lower concentration (14-OHBR 0.002ppm, anthocyanin extract from different sources 0.01ppm) have a significant synergistic effect on corn seed soaking and improving the salt-tolerant ability of corn.

[0138] Table 10 Determination of the effect of 14-OHBR (0.002ppm) and anthocyanin extract from different sources (0.01ppm) on the aboveground parts of corn under saline conditions

[0139] Table 11 Determination of the effect of 14-OHBR (0.002ppm) and anthocyanin extract from different sources (0.01ppm) on the underground parts of corn under saline conditions

[0140] Although the above-mentioned embodiments have been described in detail, they are only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the above-mentioned embodiments without creativity, which all belong to the protection scope of the present application.

[0141] Table 1 Information of cyanidin and its glycosides involved in the present application

Claims

1. Use of 14-hydroxyruticulatin and anthocyanin extract for promoting plant growth and enhancing plant stress resistance, characterized in that, The 14-hydroxy brassinosteroid has an effective concentration of 0.001-0.1 ppm; The anthocyanin extract has an effective concentration of 0.005-0.5 ppm.

2. Use according to claim 1, wherein The 14-hydroxy brassinosteroid is used in the form of an ethanol solution of 14-hydroxy brassinosteroid; and the anthocyanin extract is used in the form of an aqueous solution of anthocyanin extract.

3. Use according to claim 2, wherein the compound is ###0002### The ethanol solution of 14-hydroxy brassinosteroid and the aqueous solution of anthocyanin extract are applied in the form of seed soaking, coating, leaf spraying, root dipping or root irrigation.

4. The use according to claim 1, wherein The application is to use the 14-hydroxy brassinosteroid and the anthocyanin extract to prepare an agricultural product; the agricultural product further comprises an auxiliary material, which comprises one or more of dispersants, wetting agents, binders, emulsifiers, stabilizers and solvents. The dosage form of the agricultural product comprises emulsifiable concentrate, suspension concentrate, wettable powder, powder, granule, aqueous solution, mother liquor or mother powder.

5. The use according to claim 1, wherein The plants include corn, wheat, pepper, cotton, Chinese cabbage, Shanghai green, lettuce, tomato, cucumber, ginger, grape or citrus.

6. Use according to any one of claims 1 to 5, characterized in that, The stress resistance includes one or more of salt-alkali resistance, drought resistance, high-temperature resistance and low-temperature resistance.

7. Use according to claim 1 or 2, wherein the compound is ###0002### The anthocyanin extract is blueberry anthocyanin extract, grape seed anthocyanin extract, mulberry anthocyanin extract or plant hairy root extract containing anthocyanin and glycoside derivatives thereof.

8. Use according to claim 7, wherein the compound is ###0002### The preparation method of the plant hairy root extract containing anthocyanin and glycoside derivatives thereof comprises the following steps: The transgenic plant hairy roots for producing anthocyanin and glycoside derivatives thereof are used as extraction raw materials, water extraction, solid-liquid separation, and collection of liquid phase; The liquid phase is treated by alcohol precipitation, and the precipitate is collected to obtain the plant hairy root extract containing anthocyanin and glycoside derivatives thereof.

9. The use according to claim 7, wherein the compound is ###00003### or a pharmaceutically acceptable salt thereof. The plants in the transgenic plant hairy roots for producing anthocyanin and glycoside derivatives thereof include at least one of the following plants: Antirrhinum, Vaccinium, Fragaria, Rubus, Brassica, Daucus, Lactuca and Cobenaceae; The genes in the transgenic plant hairy roots for producing anthocyanin and glycoside derivatives thereof include genes encoding at least one of the following transcription factors or mutants thereof: MYB transcription factor, BBX transcription factor, bZIP transcription factor and bHLH transcription factor.

10. The use according to claim 8, wherein the compound is ###00003### or a pharmaceutically acceptable salt thereof. The mass ratio of the extraction raw materials to water is 1:(5-100); the water extraction temperature is 30-100℃; and the water extraction time is 5-300 min.

11. Use according to claim 8, wherein the compound is ###00003### or a pharmaceutically acceptable salt thereof. The induction method of the transgenic plant hairy roots for producing anthocyanin and glycoside derivatives thereof comprises the following steps: The Agrobacterium rhizogenes containing the induction gene is used to infect plant explants, co-cultured, and bacteria-free cultured to obtain the transgenic hairy roots for producing anthocyanin and glycoside derivatives thereof.

12. The use according to claim 11, wherein the compound is ###0002### The construction method of the Agrobacterium rhizogenes containing the induction gene comprises: constructing the induction gene into a vector to obtain a recombinant vector; and transforming the recombinant vector into the Agrobacterium rhizogenes to obtain the Agrobacterium rhizogenes containing the induction gene.

Images