Engineered halomonas strain
By modifying Halomonas bluephagenesis CYL37 to overexpress the phaAB gene, large-diameter PHA particles were prepared, solving the mechanical properties and biocompatibility issues of cosmetic filler materials, and achieving significant filling effects and long-lasting skin improvement.
Patent Information
- Application Number
- PCT/CN2025/122748
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-20
- Filing Date
- 2025-09-19
- Publication Date
- 2026-03-26
AI Technical Summary
Existing cosmetic filler materials such as silicone, hyaluronic acid, and autologous fat have problems such as rejection, unsustainable filling effect, and insufficient mechanical properties. Polyhydroxy fatty acid materials have small particle size and low mechanical properties, making it difficult to meet the needs of cosmetic fillers.
Large-diameter PHA particles were prepared by overexpressing the phaAB gene in Halomonas bluephagenesis CYL37 to enhance mechanical properties, and PHA microspheres were prepared by emulsification.
The prepared PHA material has good biocompatibility, can promote cell growth, and has significant filling effect and long-lasting skin improvement effect, overcoming the defects of existing materials.
Smart Images

Figure CN2025122748_26032026_PF_FP_ABST
Abstract
Description
Engineered halomonas
[0001] Cross-reference to related applications
[0002] This application claims priority to Chinese Patent Application No. 202411314859X, filed on September 20, 2024, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD
[0003] The present disclosure relates to the technical field of biological materials, in particular to an engineered Halomonas, a construction method thereof and a method for producing tissue filling material using the same. BACKGROUND
[0004] Commonly used materials for cosmetic filling at present include silicone, hyaluronic acid and autologous fat. Silicone has good mechanical properties and is not easy to degrade, and has good persistence of filling effect, but it can easily cause rejection reaction and has the risk of infection. Hylauronic acid has good biocompatibility and biodegradability, but its filling effect is less persistent, and repeated injection is required, and it has the defects of single function and high price. Although autologous fat filling can reduce rejection reaction and permanently maintain filling effect, it forms multiple wounds, and in addition, due to the limitation of filling amount and survival rate in a single operation, it also has the defects of low filling efficiency and long time consumption.
[0005] Polyhydroxyalkanoate (PHA) material has good biocompatibility and can promote the growth of human tissues, and has been used as a medical implant material and is a sustainable material accepted by the market. However, PHA prepared by bacterial fermentation as a cosmetic filler has the defects of small particle size and low mechanical properties.
[0006] Therefore, it is urgent to propose a sustainable tissue filling material with good mechanical properties and biocompatibility to meet the growing needs of the cosmetic filling field. SUMMARY
[0007] The present application at least solves one of the problems of the related art from the following aspects.
[0008] The first aspect of the present disclosure provides an engineered Halomonas, which is obtained by overexpressing phaAB gene (SEQ ID NO: 2) through promoter porin59 (SEQ ID NO: 1) in
[0009] Halomonas bluephagenesis CYL37.
[0010] In some embodiments, the Halomonas bluephagenesis CYL37 is obtained by knocking out the sspB gene and inserting a nucleotide sequence as shown in SEQ ID NO: 10 before the terminator of the mreB gene in Halomonas bluephagenesis TD01AphaP1.
[0011] The second aspect of the present disclosure provides a method for constructing the engineered Halomonas bluephagenesis according to any one of the first aspect of the present disclosure, comprising: overexpressing the phaAB gene in Halomonas bluephagenesis CYL37 through the promoter porin59.
[0012] In some embodiments, the overexpressing the phaAB gene in Halomonas bluephagenesis CYL37 through the promoter porin59 comprises: constructing a first plasmid comprising the promoter porin59 and the phaAB gene; removing the original toxin-antitoxin system in the Halomonas bluephagenesis CYL37; and conjugative transforming the first plasmid into the Halomonas bluephagenesis CYL37 from which the original toxin-antitoxin system is removed.
[0013] In some embodiments, the constructing the first plasmid comprising the promoter porin59 and the phaAB gene comprises: inserting the promoter porin59 and the phaAB gene into a pHbPBC vector.
[0014] The third aspect of the present disclosure provides a method for preparing PHA particles, comprising: fermenting PHA using the engineered Halomonas bluephagenesis according to any one of the first aspect of the present disclosure; and extracting PHA particles from the fermented engineered Halomonas bluephagenesis.
[0015] In some embodiments, the extracting PHA particles from the fermented engineered Halomonas bluephagenesis comprises: crushing the fermented engineered Halomonas bluephagenesis and filtering to obtain the PHA particles.
[0016] In some embodiments, the PHA is selected from the group consisting of 3-hydroxybutyric acid homopolymer PHB, 3-hydroxybutyric acid and 4-hydroxybutyric acid binary copolymer P3HB4HB, 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid ternary copolymer PHBV4HB, 3-hydroxybutyric acid and 3-hydroxyhexanoic acid binary copolymer PHBHHx, 3-hydroxypropionic acid homopolymer, and 3-hydroxypropionic acid copolymer, wherein the 3-hydroxypropionic acid homopolymer is P3HP, and the 3-hydroxypropionic acid copolymer is P(3HB-co-3HP) or PHBHP.
[0017] Compared with the related art, the embodiments of the present disclosure at least achieve the following beneficial effects:
[0018] The tissue filling material prepared by the embodiments of the present disclosure has good biocompatibility, can meet the filling needs, and can promote the growth of cells at the filling site. Compared with the existing PHA materials, the PHA particles prepared by the embodiments of the present disclosure have better mechanical properties, can achieve more significant filling effects, and can improve the skin at the filling site due to the cell growth promoting effect of PHA, thereby achieving long-acting filling and skin improvement effects. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present disclosure, and other drawings can also be obtained by those skilled in the art without creative labor.
[0020] FIG. 1 is a transmission electron microscope image of PHA particles in Halomonas bluephagenesis CYL37 in Embodiment 1 of the present disclosure.
[0021] FIG. 2 is a comparison result of cell dry weight and PHA content in recombinant bacteria Halomonas bluephagenesis CYL37 (CYL37) and Halomonas bluephagenesis CYL37-porin59-phaAB (CYL37-phaAB) in Embodiment 1 of the present disclosure.
[0022] FIG. 3 is a scanning electron microscope image of PHA particles extracted from recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB.
[0023] In order to facilitate the understanding of the present disclosure, the implementation process of the present disclosure will be further described below in combination with specific implementation examples. These descriptions are only for further illustrating the features and advantages of the present disclosure, and are not limitations on the claims of the present disclosure. DETAILED DESCRIPTION
[0024] The present application will be further described in conjunction with the specific embodiments, and the examples given are only for the purpose of illustrating the present application and not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.
[0025] In the present application, the term "comprising" is an open-ended expression, i.e. including the content indicated by the present application, but not excluding other aspects.
[0026] The present disclosure is based on the following realization of the inventors:
[0027] The commonly used materials for cosmetic filling at present include silicone, hyaluronic acid and autologous fat, among which silicone has good mechanical properties and is not easy to degrade, and has better filling effect persistence, however, it can easily cause rejection reaction and has the risk of infection; hyaluronic acid has good biocompatibility and biodegradability, however, its filling effect persistence is poor, repeated injection is needed, and it has the defects of single function and high price; although autologous fat filling can reduce rejection reaction and permanently maintain filling effect, the wound formed by autologous fat filling is large, in addition, due to the limitation of filling amount and survival rate in a single operation, there are also defects of low filling efficiency and long time consumption.
[0028] Polyhydroxyalkanoate (PHA) material has good biocompatibility and can promote the growth of human tissues, and has been used as a medical implant material and is a sustainable material accepted by the market. However, PHA prepared by bacterial fermentation as a cosmetic filler has the defects of small particle size and low mechanical properties.
[0029] The Halomonas bluephagenesis CYL37 which has been morphologically modified is selected in the embodiments of the present disclosure, and the diameter of the bacterial body is about 2 to 5 μm (Figure 1), which is significantly higher than the diameter of the bacterial body of the wild type Halomonas bluephagenesis of 0.4 μm, and is more suitable for the preparation of filling materials. On this basis, the phaAB gene related to PHA synthesis is overexpressed by taking porin59 as a promoter, the molecular weight of PHA particles is increased, and the mechanical strength is enhanced.
[0030] The extracted PHA particles are dissolved in an organic solvent, the dispersing agent is dissolved in water, then the water phase and the oil phase are mixed and emulsified to obtain a uniform solution, and the solvent is evaporated under a constant temperature water bath at 37℃, and the PHA microsphere material is obtained after drying.
[0031] The biocompatible material prepared by the method of the embodiments of the present disclosure can not only meet the filling needs, but also promote the growth of cells at the filling site. Compared with existing filling materials, the biocompatible material has better mechanical properties, can achieve more significant filling effects, and can improve the skin at the filling site and maintain the effects for a longer time due to the cell growth promoting effect of PHA.
[0032] The first aspect of the embodiments of the present disclosure provides an engineered Halomonas bluephagenesis, which is obtained by overexpressing a phaAB gene (SEQ ID NO: 2) through a promoter porin59 (SEQ ID NO: 1) in Halomonas bluephagenesis CYL37.
[0033] In the embodiments of the present disclosure, the nucleotide sequence of the promoter porin59 is as follows:
[0034] The nucleotide sequence of the phaAB gene is as follows:
[0035] In some embodiments, the Halomonas bluephagenesis CYL37 is obtained by knocking out an sspB gene and inserting a nucleotide sequence as shown in SEQ ID NO: 10 before the terminator of an mreB gene in Halomonas bluephagenesis TD01ΔphaP1.
[0036] The starting strain used in the embodiments of the present disclosure is Halomonas bluephagenesis TD01ΔphaP1: described in Shen Ret. al, Manipulation of polyhydroxyalkanoate granular sizes in halomonas bluephagenesis. [J]. Metabolic Engineering, 2022.; and the strain can be obtained from Tsinghua University.
[0037] The second aspect of the embodiments of the present disclosure provides a method for constructing the engineered Halomonas bluephagenesis according to any one of the embodiments of the first aspect, comprising: overexpressing a phaAB gene through a promoter porin59 in Halomonas bluephagenesis CYL37.
[0038] In some embodiments, the overexpressing the phaAB gene in Halomonas bluephagenesis CYL37 via the promoter porin59 comprises: constructing a first plasmid comprising the promoter porin59 and the phaAB gene; removing the original toxin-antitoxin system in the Halomonas bluephagenesis CYL37; and conjugative transforming the first plasmid into the Halomonas bluephagenesis CYL37 from which the original toxin-antitoxin system is removed.
[0039] In some embodiments, the constructing the first plasmid comprising the promoter porin59 and the phaAB gene comprises: inserting the promoter porin59 and the phaAB gene into a pHbPBC vector.
[0040] In some embodiments, the constructing the first plasmid comprising the promoter porin59 and the phaAB gene comprises: inserting a nucleotide sequence as set forth in SEQ ID NO: 3 into a pHbPBC vector, wherein SEQ ID NO: 3 is as set forth below:
[0041] Embodiments of the third aspect of the present disclosure provide a method for preparing PHA granules, comprising: fermenting PHA using the engineered Halomonas as described in any of the embodiments of the first aspect above; and extracting PHA granules from the fermented engineered Halomonas.
[0042] In some embodiments, the extracting PHA granules from the fermented engineered Halomonas comprises: disrupting the fermented engineered Halomonas and filtering to obtain the PHA granules.
[0043] In some embodiments, the PHA is selected from the group consisting of: 3-hydroxybutyric acid homopolymer PHB, 3-hydroxybutyric acid and 4-hydroxybutyric acid binary copolymer P3HB4HB, 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid ternary copolymer PHBV4HB, 3-hydroxybutyric acid and 3-hydroxyhexanoic acid binary copolymer PHBHHx, 3-hydroxypropionic acid homopolymer, and 3-hydroxypropionic acid copolymer, wherein the 3-hydroxypropionic acid homopolymer is P3HP, and the 3-hydroxypropionic acid copolymer is P(3HB-co-3HP) or PHBHP.
[0044] The following examples are provided to further illustrate the advantages and features of the present method, and are not intended to limit the present application. In the following examples, the experimental methods are routine methods, and are performed according to the techniques or conditions described in the literature in the art or according to the instructions of the products, unless otherwise specified.
[0045] The schemes of the present application will be explained below in connection with examples. Those skilled in the art will understand that the following examples are only for illustration of the present application and should not be considered as limiting the scope of the present application. If no specific technique or condition is specified in the examples, the technique or condition described in the literature in the art (for example, refer to J. Sambrook et al., Huang Peitang et al. Translated, Guide to Molecular Cloning Experiments, Third Edition, Science Press) or according to the product manual is used. If no manufacturer of the reagent or instrument is specified, it is a conventional product that can be obtained by purchase.
[0046] Unless otherwise specified, the quantitative analysis test in the following examples is set up with three repeated experiments, and the average value is taken.
[0047] Preparation Example 1 Construction of Halomonas bluephagenesis CYL37 (TD01ΔsspBΔphaP1-mreB-ssrA)
[0048] The starting strain used in the embodiments of the present disclosure is Halomonas bluephagenesis TD01ΔphaP1: described in Shen Ret. al, Manipulation of polyhydroxyalkanoate granular sizes in halomonas bluephagenesis. [J]. Metabolic Engineering, 2022.; The public can obtain the bacteria from Tsinghua University.
[0049] (i) Construction of recombinant bacteria TD01ΔsspBΔphaP1
[0050] The construction of the recombinant bacterium Halomonas bluephagenesis TD01ΔsspBΔphaP1 uses the CRISPR / Cas9 genome editing method to edit the genome. In specific embodiments, the plasmid construction method containing sgRNA (atagagagctcgggcgagat (SEQ ID NO: 4)) and a recombinant template is to insert the DNA fragments of the upstream and downstream homologous arms, sgRNA expression module, etc. into the original expression plasmid pSEVA341 (containing kanamycin and spectinomycin resistance genes) by the Gibson method. The sequence of the inserted plasmid is SEQ ID NO: 5, arranged in order as the sgRNA expression module (nucleotides 1-152), the upstream homologous arm (nucleotides 153-652), and the downstream homologous arm (nucleotides 653-1152). The pSEVA341 plasmid expressing sgRNA and the recombinant template and the plasmid expressing Cas9 are transformed into Halomonas bluephagenesis TD01ΔphaP1 (referred to as TD01ΔphaP1) by E. coli S17-1 conjugation. The mutant strain with sspB gene knockout is screened by colony PCR, and confirmed by gene sequencing. Colony PCR is a routine operation. Then, the strain after successful genome editing is continuously and repeatedly subcultured in liquid medium, and the strain with CRISPR plasmid loss is identified by streaking culture on spectinomycin-resistant, chloramphenicol-resistant, and antibiotic-free plates, to facilitate the next round of genome editing. Finally, it is confirmed by colony PCR and gene sequencing that the endogenous sspB gene in the genome of Halomonas bluephagenesis TD01ΔphaP1 (the amino acid sequence is shown as SEQ ID NO: 6, and the nucleotide sequence is shown as SEQ ID NO: 7) has been knocked out. The constructed recombinant bacterium is named TD01ΔsspBΔphaP1.
[0051] Nucleotide sequence comprising sgRNA expression module and upstream and downstream homologous arms:
[0052] Amino acid sequence of endogenous sspB:
[0053] Nucleotide sequence of endogenous sspB:
[0054] (ii) Construction of recombinant bacterium Halomonas bluephagenesis CYL37 (TD01ΔsspBΔphaP1-mreB-ssrA)
[0055] The genome was edited using CRISPR genome editing method. In specific embodiments, the plasmid construction method containing sgRNA (tgtcgagcgactgatcgtag (SEQ ID NO: 8) and recombination template is to insert the DNA fragments of upstream and downstream homologous arms, sgRNA expression module, SsrA21 tag, etc. into the original expression plasmid pSEVA341 (containing kanamycin and spectinomycin resistance genes) by Gibson method. The sequence of the inserted plasmid is SEQ ID NO: 9, arranged in order as sgRNA expression module (nucleotides 1-152), upstream homologous arm (nucleotides 153-652), SsrA21 tag coding sequence (nucleotides 653-694), downstream homologous arm (nucleotides 695-1194).
[0056] The coding sequence comprising sgRNA expression module, upstream and downstream homologous arms, and SsrA21 tag:
[0057] The pSEVA341 plasmid expressing sgRNA and recombination template and the pQ08 plasmid expressing Cas9 were transformed into the recombinant bacteria TD01ΔsspBΔphaP1 by E. coli S17-1 conjugation.
[0058] The mutant strain with SsrA21 tag insertion was screened by colony PCR, and confirmed by gene sequencing. Colony PCR is a routine operation.
[0059] Finally, after colony PCR and gene sequencing confirmation, it was confirmed that the SsrA21 tag coding sequence of nucleotides 653-694 in SEQ ID NO: 9, i.e. GCGgcaaatgacgaaaactacgctcaaggcGCGCAGAGCGCG (SEQ ID NO: 10), was inserted before the stop codon of the mreB gene in the genome of the recombinant bacteria TD01ΔsspBΔphaP1. The constructed recombinant bacteria was named TD01ΔsspBΔphaP1-mreB-ssrA (i.e. Halomonas bluephagenesis CYL37).
[0060] Example 1
[0061] 1.1 Construction of recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB
[0062] 1.11 Knockout of the original toxin-antitoxin system in Halomonas bluephagenesis CYL37 (achieved by making the original plasmid lost).
[0063] 1.12 Construction of the first plasmid overexpressing phaAB gene: The promoter porin59 sequence and phaAB gene fragment were inserted into the original expression plasmid pHbPBC (containing kanamycin and spectinomycin resistance genes) by Gibson method. The sequence of the inserted plasmid is SEQ ID NO: 3, arranged in order as the porin59 promoter module (nucleotides 1-122), phaAB gene (nucleotides 123-912).
[0064] The expression plasmid pHbPBC used in this example is an expression plasmid engineered based on the endogenous plasmid of Halomonas bluephagenesis. Its specific construction process and elements are described in the literature: Construction of a Stable Expression System Based on the Endogenous hbpB / hbpC Toxin-Antitoxin System of Halomonas bluephagenesis, Ren et al., ACS Synth. Biol. 2024, 13, 61-67.
[0065] 1.13 Conjugation transformation: The first plasmid was conjugated and transformed into CYL37 with knocked-out toxin and antitoxin system by E. coli S17-1. Colonies successfully combined with the first plasmid were selected by resistance plates and confirmed by gene sequencing, confirming that CYL37 had carried the first plasmid overexpressing phaAB gene. The constructed recombinant bacteria was named Halomonas bluephagenesis CYL37-porin59-phaAB.
[0066] 1.2 Detection of shake flask fermentation of recombinant bacteria Halomonas bluephagenesis CYL37 and
[0067] Molecular weight of PHA synthesized by Halomonas bluephagenesis CYL37-porin59-phaAB.
[0068] 1.21 Two groups of recombinant strains were inoculated into 20 mL of LB60 medium, cultured for 12-16 h, then transferred to new 20 mL of LB60 medium at a volume ratio of 1%, and cultured for 8-12 h.
[0069] 1.22 Take 2.5 mL from the culture broth of 1.21 as seed bacteria liquid to inoculate into 500 mL conical flask containing 50 mL PHA fermentation medium (formula as follows: urea 0.5 g / L; MgSO40.2 g / L; KH2PO41.5 g / L; and <0.1 g / L of Fe(III)-NH4-Citrate, CaCl2-2H2O, ZnSO4-7H2O, MnCl2-4H2O, H3BO3, CoCl2-6H2O, CuSO4-5H2O, NiCl2-6H2O, NaMoO4-2H2O in total, and add 10-50 g / L glucose as carbon source, add 10-100 g / L sodium chloride to provide osmotic pressure environment required for halophilic bacteria growth, and adjust pH to 8.0-9.0) to carry out shake flask experiment. Each group of experiments is set in triplicate, and the temperature of the shaking table is 37°C, and the rotation speed is 200 rpm. After 48 h of culture, the molecular weight is detected. The results are shown in Table 1 as follows.
[0070] Table 1
[0071] The results show that the recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB has significantly improved weight-average molecular weight of the synthesized PHA particles due to the enhanced expression of phaAB genes and increased supply of precursors compared with the control strain Halomonas bluephagenesis CYL37.
[0072] 1.3 Detect the dry cell weight (DCW) and PHA content of the recombinant bacteria CYL37 and CYL37-porin59-phaAB in shake flask fermentation.
[0073] 1.31 Inoculate the recombinant strain into 20 mL of LB60 medium, and after 12-16 h of culture, transfer it into new 20 mL of LB60 medium at a volume ratio of 1%, and continue to culture for 8-12 h.
[0074] 1.32 Take 2.5 mL from the culture solution of 1.31 as seed bacteria solution to inoculate into 500 mL conical flask containing 50 mL PHA fermentation medium, and carry out shake flask experiment. The temperature of the shaker is 37°C, and the rotation speed is 200 rpm. After 48 h of culture, the dry weight of the bacteria and the PHA content therein are detected, three parallel experiments are set, and the average value is taken, and the results are shown in Figure 2. According to Figure 2, it can be seen that after 48 h of fermentation, compared with Halomonas bluephagenesis CYL37 (CYL37), the dry weight of the recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB (CYL37-phaAB) is increased from 17.1 g / L to 20.8 g / L, and the PHA content is increased from 73.3% to 78.4%, both of which have significant differences.
[0075] Example 2
[0076] 2.1 Extraction of PHA particles in the recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB, including the following steps 2.11 to 2.13.
[0077] 2.11 Take the bacteria solution at the end of fermentation in Example 1, centrifuge the bacteria, wash once with water, and centrifuge the bacteria again.
[0078] 2.12 Add lysozyme to break the cell wall and release the intracellular PHA particles, and separate the PHA particles by filtration.
[0079] 2.13 Wash the PHA particles with hydrogen peroxide to remove residual endotoxins and other substances on the surface, and then wash the PHA particles twice with ethanol, and finally use ddH2O to remove other reagents contained therein.
[0080] Test Example 1
[0081] Particle size analysis of PHA particles in the recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB
[0082] The scanning electron microscope photograph of the PHA particles prepared in Example 2 is shown in Figure 3.
[0083] According to Figure 3, the obtained PHA particles are uniform spherical particles with a diameter distribution of 2 to 5 μm.
[0084] Test Example 2
[0085] Skin allergy analysis of PHA granules in recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB Take 3 mice of 7 weeks old, remove the hair on the back, fix the PHA granules prepared in Example 2 on the back of the mice, and observe the skin allergy at 24h, 48h and 72h respectively.
[0086] The experimental results show that the PHA granules prepared in Example 2 neither induce erythema nor cause edema. In addition, the inventors' previous experiments also found that the PHA material does not appear adverse chronic inflammatory reaction during the implantation period of up to 12 months.
[0087] Test Example 3
[0088] Effect of PHA granules in recombinant bacteria Halomonas bluephagenesis CYL37-porin59-phaAB on cell growth
[0089] The epidermal cells isolated from the mice are incubated on the PHA granules prepared in Example 2, and the PHA granules are replaced every 3 days, and it is found that the cells can proliferate on the PHA granules and retain their phenotype. The cell growth is in good condition and the cell density is also relatively high.
[0090] In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, different embodiments or examples described in the present specification and the features of different embodiments or examples can be combined and combined by those skilled in the art without contradiction.
[0091] Although the embodiments of the present application have been shown and described above, it is understood that the above embodiments are exemplary and cannot be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application.
[0092] All embodiments of the present disclosure can be performed alone or in combination with other embodiments, and are considered to be within the scope of protection required by the present disclosure.
Claims
1. An engineered Halomonas sp. characterized in that, The engineered Halomonas is obtained by overexpressing the phaAB gene (SEQ ID NO: 2) through the promoter porin59 (SEQ ID NO: 1) in Halomonas bluephagenesis CYL37.
2. The engineered Halomonas sp. of claim 1, wherein, The Halomonas bluephagenesis CYL37 is obtained by knocking out the sspB gene and inserting a nucleotide sequence as shown in SEQ ID NO: 10 before the terminator of the mreB gene in Halomonas bluephagenesis TD01AphaP1.
3. A method of constructing an engineered Halomonas as claimed in claim 1 or 2, wherein, The method comprises: overexpressing the phaAB gene through the promoter porin59 in Halomonas bluephagenesis CYL37.
4. The method of claim 3, wherein, The overexpressing the phaAB gene through the promoter porin59 in Halomonas bluephagenesis CYL37 comprises: constructing a first plasmid comprising the promoter porin59 and the phaAB gene; removing the original toxin-antitoxin system in the Halomonas bluephagenesis CYL37; and conjugative transforming the first plasmid into the Halomonas bluephagenesis CYL37 from which the original toxin-antitoxin system is removed.
5. The method of claim 4, wherein, The constructing a first plasmid comprising the promoter porin59 and the phaAB gene comprises: inserting the promoter porin59 and the phaAB gene into a pHbPBC vector.
6. A method of preparing PHA granules, characterized by, The method comprises: fermenting PHA using the engineered Halomonas as claimed in claim 1 or 2; and extracting PHA particles from the fermented engineered Halomonas.
7. The preparation method according to claim 6, characterized in that, The extracting PHA particles from the fermented engineered Halomonas comprises: crushing the fermented engineered Halomonas and filtering to obtain the PHA particles.
8. The preparation method according to claim 6, characterized in that, The PHA is selected from the group consisting of 3-hydroxybutyric acid homopolymer PHB, 3-hydroxybutyric acid and 4-hydroxybutyric acid binary copolymer P3HB4HB, 3-hydroxybutyric acid, 4-hydroxybutyric acid and 3-hydroxyvaleric acid ternary copolymer PHBV4HB, 3-hydroxybutyric acid and 3-hydroxyhexanoic acid binary copolymer PHBHHx, 3-hydroxypropionic acid homopolymer, and 3-hydroxypropionic acid copolymer, wherein the 3-hydroxypropionic acid homopolymer is P3HP, and the 3-hydroxypropionic acid copolymer is P(3HB-co-3HP) or PHBHP.
Citation Information
Patent Citations
Escherichia coli genetically engineered bacterium for producing short-chain carboxylic acid and application of escherichia coli genetically engineered bacterium
CN118086165A
Recombinant halomonas capable of inducing protein self-degradation as well as construction method and application of recombinant halomonas
CN120173844A