Means and methods for modulating immune responses

Engineering thymic cells with AIRE and lineage-defining transcription factors addresses the limitations of current treatments by inducing immune tolerance, reducing autoimmune responses and enhancing therapeutic efficacy.

WO2026068582A1PCT designated stage Publication Date: 2026-04-02GWYIP BV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-25
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current treatments for autoimmune diseases, allergies, and immune responses to non-self therapeutic proteins are limited by the side effects of immunosuppressive agents and the inability to induce lasting tolerance, leading to adverse events and reduced therapeutic efficacy.

Method used

Engineering thymic cells with exogenous nucleic acid sequences encoding AIRE and an antigen or lineage-defining transcription factor, such as PDX1, to educate the immune system and induce tolerance by eliminating reactive T-cells and promoting regulatory T-cells.

Benefits of technology

This approach reduces harmful immune responses by educating the immune system to tolerate specific antigens, potentially preventing or reversing autoimmune diseases like type 1 diabetes and inducing tolerance to therapeutic proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2025077415_02042026_PF_FP_ABST
    Figure EP2025077415_02042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention provides for means and methods for modulating immune responses. Means and methods are provided with which thymus tissue can be advantageously engineered, which is highly useful for the treatment of auto-immune diseases or the like. By providing thymic cells with an exogenous nucleic acid sequence encoding AIRE and an exogenous nucleic acid sequence encoding an antigen or a nucleic acid sequence stimulating expression of antigen or a lineage defining transcription factor, engineered thymic cells or thymus tissue can be obtained, which are capable of educating the immune system of a subject, to thereby induce immune tolerance against the antigen.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Means and methods for modulating immune responses

[0002] Introduction

[0003] The immune system stands as one of the most complex and remarkable systems within the human body. It has the ability to identify and destroy invading pathogens, yet it remains tolerant to the body's own tissues. This intricate balance of immune responsiveness and tolerance is crucial to maintaining health. However, in certain instances, the immune system's function can be disrupted, which can lead to undesirable immune responses, resulting in autoimmune disorders.

[0004] In the context of autoimmunity, the immune system aberrantly targets the body’s own tissues. For instance, in type 1 diabetes mellitus (T1 D), there is an immune-mediated destruction of pancreatic beta cells. At present, there is no treatment available that would prevent the destruction of pancreatic beta cells. Once the disease has been established in a patient / subject, the treatment available to patients / subjects to manage the disease involves closely monitoring blood glucose and administration of insulin.

[0005] Beyond autoimmunity, there are other conditions wherein the induction of an undesired immune response occurs in subjects, for example in allergies. This similarly applies to therapies comprising non-self therapeutic proteins, such as in enzyme replacement therapy, where subjects receiving treatment may develop over time an immune response against the therapeutic protein, e.g. upon repeated administrations, which may ultimately reduce efficacy of such therapies. This is for example relevant to enzyme replacement therapies for haemophilia or metabolic diseases such as Fabry disease or lysosomal storage diseases such as Pompe disease. In the emerging field of gene therapy, acceptance of an exogenous expressed gene product is vital to allow for maintaining long-term efficacy of such potentially life-saving cures. Moreover, the gene therapy product itself, may evoke an unwanted immune response as well, which may impact eligibility for treatment or repeat treatment, of such advantageous treatments.

[0006] Current methodologies for the treatment of autoimmune diseases, aimed at avoiding undesired immune responses and / or treatment of autoimmune diseases, allergies and / or avoiding undesired immune responses have limitations. Such treatments at present focus on the use of immunosuppressive agents like cyclosporin, and TNF-alpha blockers. Though these may be efficacious in attenuating immune responses, these also exhibit broad-spectrum activity, increasing susceptibility to infections and neoplasms, in addition to toxicity. Chronic administration of such agents is also associated with adverse events, including nephrotoxicity. Small molecules, such as low-dose IL2, present challenges in achieving optimal therapeutic windows to prevent excessive immunosuppression. The therapeutic application of monoclonal antibodies like anti-CTLA-4 and anti-PD-1 , which modulate immunological checkpoints, has demonstrated efficacy, but concerns regarding off-target effects and severe immune-mediated reactions persist. Likewise, allergies are treated as well with immunosuppressive medications. In addition, presently, strategies aimed at inducing tolerance against an allergen include repeated and / or incremental administration of low doses of allergen. However, such administrations can induce severe adverse effects, and although some tolerance to the allergen may be induced in subjects, it does not provide for a cure. Hence, subjects remain allergic, though the extent of allergic reactions in subjects can be reduced.

[0007] In light of the aforementioned challenges, there remains a substantial unmet need in the field to provide for novel means and methods for modulating immune responses in subjects, in particular for conditions such as auto immune diseases, allergies, or the like.

[0008] Summary of the invention

[0009] The present inventors now provide for means and methods with which thymus tissue can be advantageously engineered, which is highly useful for the treatment of autoimmune diseases or the like. By providing thymic cells with an exogenous nucleic acid sequence encoding AIRE and an exogenous nucleic acid sequence encoding an antigen, engineered thymic cells or thymus tissue can be obtained, which is capable of educating the immune system of a subject, to thereby induce immune tolerance against the antigen. No such engineering, nor such engineered thymic cells, is known in the art, nor are any of the advantageous effects with regard to modulating an immune response, with such engineered thymic cells, as described herein. Such engineered thymic cells, because of AIRE and antigen expression, present antigen peptides via MHC receptors, which can interact with T-cells, which, without being bound by theory, subsequently eliminate reactive T-cells against presented antigen peptides, and / or, induce development of T-cells with affinity towards the antigen peptides into regulatory T-cells. This way, the immune system of the subject is educated such that immune responses against the antigen can be lessened or avoided. Likewise, thymic cells can be provided with an exogenous nucleic acid sequence encoding AIRE and an exogenous nucleic acid sequence encoding a lineage defining transcription factor, such that engineered thymic cells or thymus tissue can be obtained, which are capable of educating the immune system of a subject, to thereby advantageously induce immune tolerance. Because of expression of the lineage defining transcription factor, which can be advantageously further combined with AIRE expression, gene expression is induced in the engineered thymic cells such that antigenic peptides related to the proteins expressed by the lineage are presented, i.e. mimicking from an antigen presenting perspective a cell or tissue found in the periphery of the subject related to the same lineage defining transcription factor. This is achieved while retaining thymic identity, immune co-factors and function useful for educating immune cells. Providing an AIRE nucleic acid sequence to thymic epithelial progenitor cells (TEPC) can have an added benefit to trigger the mTEC fate. Without being bound by theory, within the context of the invention AIRE is advantageous for the developmental program of mTECs, including Aire-positive cells themselves. Hence, the engineered thymic cells as provided with the means and methods in accordance with the invention are understood to be engineered thymic mimetic cells, which means that these cells mimic from an antigen presenting perspective cells or tissue of the subject, e.g. cells against which an auto immune reaction occurs.

[0010] By expression of a lineage defining transcription factor, antigen peptides of the lineage are presented by MHC on the engineered thymic cell (e.g. when a lineage defining transcription factor is of a muscle cell, neuron, or pancreatic cell, antigen peptides of proteins representative of the muscle cell, neuron, or pancreatic cell, respectively), which can interact with T-cells, which, without being bound by theory, subsequently can eliminate reactive T-cells against such presented antigen peptides, and / or, induce development of T-cells with intermediate affinity towards such antigen peptides into regulatory T-cells. This way, the immune system of the subject is educated such that immune responses against the antigenic peptides of the lineage (i.e. e.g. muscle cell, neuron, or pancreatic cell) can be lessened or avoided.

[0011] Any lineage defining transcription factor may be selected, for example, a lineage defining transcription factor may be selected associated with cells or types of cells against which an auto-immune disease can occur. It is highly preferred in accordance with the invention to select for type 1 diabetes a lineage defining transcription factor for pancreatic cells, such as PDX1 , or the like, as such expression can induce tolerance e.g. against insulin, which is highly advantageous for preventing, or delaying, stopping, or reversing type 1 diabetes. No such engineered thymic cells or engineered thymic mimetic cells comprising exogenous PDX1 (which may include exogenous AIRE as well) were made and tested in the art, nor has type 1 diabetes been suggested to be benefit from such engineered thymic (mimetic) tissue, when implanted in a subject, as described herein.

[0012] It is understood that with regard to the terms engineered or exogenous, in the context of the invention is meant that thymic cells are provided with nucleic acids, that are exogenous to the thymic cells, and hence, these thymic cells are different from thymic cells of the subject to be treated. It is understood that it is highly preferred that the thymic cells that are to be engineered are autologous to the subject that is to be treated. Moreover, the thymic cell is preferred to be provided with both the exogenous AIRE nucleic acid sequence and the lineage defining transcription factor nucleic acid sequence, though it may be advantageous to provide solely a lineage defining transcription factor nucleic acid sequence. Highly advantageously and preferably, such may be achieved by the use of lentiviral vectors that are constructed such that these express both AIRE and lineage defining transcription factor, or lineage defining transcription factor, upon transduction of thymic cells. Hence, no such engineering with regard to using lentiviral vectors, to deliver both AIRE and lineage defining transcription factor, or lineage defining transcription factor, to thymic cells, is contemplated in the art, nor suggested, let alone that in the art, using lentiviral vectors or the like, was contemplated to obtain engineered thymic cells as described herein, which, when e.g. implanted in a subject, allow to induce tolerance in the subject. This is highly advantageous in subjects at risk of or suffering from e.g. an autoimmune disease. Providing engineered thymic tissue comprising a nucleic acid sequence of a lineage defining transcription factor, or a nucleic acid sequence of a lineage defining transcription factor and a nucleic acid sequence encoding AIRE, is thus highly useful in medical treatments in which it is advantageous to induce tolerance against peripheral cells of the lineage associated with the lineage defining transcription factor. Hence, as outlined herein, the means and methods in accordance with the invention, as exemplified in the examples (e.g. by providing lentiviral vector(s) expressing AIRE and / or lineage defining transcription factor), allow to engineer thymic cells, such that these can be used to educate the immune system of the subject, such that advantageously tolerance can be induced, as exemplified in the examples (e.g. to induce tolerance against pancreatic cells, including inducing tolerance against insulin).

[0013] In a particular advantageous embodiment of the invention, and related to providing thymic cells with an exogenous nucleic acid sequence encoding AIRE and an exogenous nucleic acid sequence encoding an antigen, it is preferred to have both AIRE and insulin expressed, as expression of the antigen insulin in accordance with the invention highly advantageously is useful for preventing, delaying or treating type 1 diabetes. It is thus preferred in accordance with the invention to select for type 1 diabetes the antigen insulin, as expression thereof can induce tolerance against insulin, which is highly advantageous for preventing, delaying, stopping, or reversing disease. No such engineered thymic cells or engineered thymic tissue were made and tested in the art, nor has type 1 diabetes been suggested to be benefit from such engineered thymic tissue, when implanted in a subject, as described herein.

[0014] It is understood that it is highly preferred that the thymic cells that are to be engineered are autologous to the subject that is to be treated, moreover, a thymic cell is highly preferred to be provided with both the exogenous AIRE nucleic acid sequence and the antigen nucleic acid sequence. Highly advantageously and preferably, such may be achieved by the use of lentiviral vectors that are constructed such that these express both AIRE and antigen, upon transduction of thymic cells. Hence, no such engineering, in particular with regard to using lentiviral vectors to deliver both AIRE and antigen to thymic cells, is contemplated in the art, nor suggested, let alone that by using lentiviral vectors or the like, engineered thymic cells can be obtained, which, when e.g. implanted in a subject, allow to induce tolerance against the antigen in the subject.

[0015] This is highly advantageous in subjects at risk of or suffering from e.g. an autoimmune disease. Such may also be advantageous e.g. in subjects at risk of or suffering from allergies, or in subjects which are to be exposed to non-self proteins. Providing a nucleic acid sequence encoding an allergen, e.g. a non-self-protein, an allergenic protein, or a protein associated with an auto-immune disease, and a nucleic acid sequence encoding AIRE, may thus be useful in medical treatments in which it may be advantageous to induce tolerance against the antigen in the subject. As outlined herein, the means and methods in accordance with the invention, as exemplified in the examples (e.g. by providing lentiviral vector(s) expressing AIRE and / or an antigen), allow to induce tolerance against an antigen in a subject, as exemplified in the examples (i.e. induce tolerance against the expressed antigen, i.e. insulin).

[0016] Figures Figure 1 : Schematic overview of aspects of the invention, to which may also be referred to as Tolerance technology. Type 1 diabetes (T1 D) is an exemplary autoimmune disease. In T1 D, it is understood that the mechanism of action relates to a central tolerance mechanism which has failed, causing autoreactive T-cells to insulin to be generated by the thymus. These cells are believed to be key in the processes leading to beta-cell destruction and subsequent hyperglycemia. The escape of autoreactive T cells from the T1 D thymus is known to be due to a defective presentation of insulin peptides on antigen presenting cells and mTECs in the thymus. The Tolerance technology repairs the defective presentation of the insulin peptides, by expression of AIRE and insulin, and may i.a. reduce, or ultimately, block production of autoreactive T-cells against pancreatic cells from the thymus. Importantly, the Tolerance technology may allow production of insulin-specific T-regulatory cells that are known to be capable of dampening autoimmune responses.

[0017] Figure 2: A) Schematics of the three expression constructs EFS-comAIRE-T2A- zsGreen, EFS-Prolnsulin2-T2A-zsGreen and EFS-comAIRE-T2A-Prolnsulin2-P2A- zsGreen. The exemplary promoter used to drive the gene(s) of interest is the EF-1 alpha short (EFS) promoter. EF-1 stands for elongation factor 1. The sequence T2A and P2A are used to promote a transcriptional jump by ribosomes ensuring that the translated sequences upstream and downstream of T2A and P2A produce two distinct proteins upon expression. The construct EFS-comAIRE-T2A-Prolnsulin2-P2A- zsGreen aims to drive the expression of three separate proteins, Aire, Insulin-2 and zsGreen (used as a reporter). The construct EFS-comAIRE-T2A-zsGreen drives the expression of the gene Aire with zsGreen and the construct EFS-Prolnsulin2-T2A- zsGreen drives the expression of the gene Insulin-2 with zsGreen. In B) a plasmid map is depicted in which the expression cassettes depicted in A) are inserted to provide for plasmids expressing lentiviral vector genomes. The expressed AIRE protein is a codon-optimized mouse (com)AIRE protein of amino acid sequence NP_033776.1 , nucleotides 88-1746 of NM_009646.2 represent a mouse endogenous nucleic acid sequence, and the expressed insulin protein is an insulin type 2 mouse protein of amino acid sequence NP_001172013.1 , as encoded by nucleotides 194-526of NM_001185084.1.

[0018] Figure 3: Production and quality assessment of gene therapy lentiviral vectors such as depicted in Figure 2. EFS-comAIRE-T2A-zsGreen and EFS-Prolnsulin2-T2A- zsGreen are i.a. control vectors for the combination vector EFS-comAIRE-T2A- Prolnsulin2-zsGreen. (A) Physical titer of lentiviruses produced, including a further additional control lentivirus: EFS-zsGreen, a lentiviral vector only expressing the reporter protein (zsGreen) under the EFS promoter, provided for a high titer of the gene therapy vector suitable for preclinial and clinical studies. Physical titers were measured as virus particle (VP) per milliliter (mL). (B) Functional titer of the lentiviral vector EFS-comAIRE-T2A-Prolnsulin2-zsGreen measured by flow cytometry. The percentage of transduced cells (measured by zsGreen) increased as more virus was provided. (C) Quantification of the functional titer of EFS-comAIRE-T2A-Prolnsulin2- zsGreen. 80% transduction was achieved with 20 uL of virus supernatant (representative image shown on the right). (D) Functional titer shown as transducing units (Til) per mL calculated for all lentiviruses. (E) From the transduction percentage, the functional titer can be evaluated as transducing unit (Til) per mL.

[0019] Figure 4. Schematic outline of an experiment demonstrating in vivo proof-of principle of modulating an immune response. (1) The thymus is isolated from NOD / ShitLj mouse pups either prenatally or shortly after birth and (2) transduced ex vivo with lentiviral vector. Prior to transduction, thymocytes are removed using deoxyguanosine (dGUO constructs encoding comAIRE and Pro-insulin2, alongside the zsGreen fluorescent reporter). (3) The transduced thymic tissues are then implanted under the kidney capsule of athymic Balb / C nude mice. (4) T cell development is monitored over time in the blood, assessing both the reduction of insulin-specific conventional T cells and the increase of insulin-specific Tregs. (5) This process ultimately leads to a reduction in insulitis. This experimental set-up is an accepted model for Type 1 Diabetes (T1 D) development.

[0020] Figure 5: Schematic overview of aspects of the invention, also referred to as Mimetic technology. Presentation of tissue-restricted antigens in the thymus is key for central tolerance. For example, in type 1 diabetes (T 1 D), it is understood that central tolerance has failed and autoreactive T-cells to insulin and beta cells escape negative selection in the thymus. These cells are known to be key in the processes leading to beta-cell destruction and subsequent hyperglycemia. The Mimetic technology aims to generate engineered thymic mimetic cells, which are specialized cells that express tissue- restricted antigen(s) majorly from one specific tissue. In this scheme, pancreatic mimetic cells are generated using the lineage defining factor Pdx1 combined with the Aire gene. The engineered mimetic cells are to restore defective presentation of the insulin peptides, and / or pancreatic peptides, (observed in T1 D) which is educate the immune system, e.g. by inducing apoptosis of autoreactive T-cells from the thymus. Importantly, the engineered mimetic cells may also induce regulatory T cells that are specific for beta-cells (including insulin-specific T regulatory cells). Regulatory T cells are believed to be important to dampen autoimmune responses. Figure 6: A) Schematics of the three expression constructs used in the examples, EFS- comAI RE-T2A-zsGreen, EFS-PDX-1-T2A-zsGreen and EFS-comAI RE-T2A-PDX-1- P2A-zsGreen. The promoter used to drive the gene(s) of interest is the EF-1 alpha short (EFS) promoter. EF-1 stands for elongation factor 1. The sequences T2A and P2A are used to promote a transcriptional jump by ribosomes ensuring that the translated sequences upstream and downstream of T2A and P2A produce two district proteins upon expression. The construct EFS-comAIRE-T2A-PDX1-P2A-zsGreen aims to drive the expression of three separate proteins, Aire, Pdx1 and zsGreen (used as a reporter gene). The construct EFS-comAIRE-T2A-zsGreen drives the expression of the gene Aire with zsGreen and the construct EFS-PDX1-T2A-zsGreen drives the expression of the gene PDX1 with zsGreen. In B) a plasmid map is depicted in which the expression cassettes depicted in A) are inserted to provide for plasmids expressing lentiviral vector genomes. The expressed AIRE protein is a mouse AIRE protein of amino acid sequence NP_033776.1 ,as encoded by nucleotides 88-1746 of NM_009646.2, a mouse endogenous sequence, in the construct generated a codon optimized version was used instead, and the expressed transcription factor PDX-1 is mouse PDX-1 of amino acid sequence NP_032840.1 , as encoded by nucleotides 143- 997 of NM_008814.4.

[0021] Figure 7: Production and quality assessment of gene therapy lentiviral vectors such as depicted in Figure 6. EFS-comAIRE-T2A-zsGreen and EFS-PDX1-T2A-zsGreen are control vectors for a mimetic combination gene therapy vector EFS-comAI RE-T2A- PDX1-P2A-zsGreen. (A) Physical titer of lentiviruses produced, including a further additional control lentivirus: EFS-zsGreen, a lentiviral vector only expressing the reporter protein (zsGreen) under control of the EFS promoter, provided for a high titer of gene therapy vectors suitable for preclinial and clinical studies. Physical titers were measured as virus particle (VP) per mililiter (mL). (B) Functional titer of the lentiviral vector EFS-comAI RE-T2A-PDX1-P2A-zsGreen as measured by flow cytometry. The percentage of transduced cells (measured by zsGreen) increased as more virus was provided. (C) Quantification of the functional titer of EFS-comAI RE-T2A-PDX1-P2A- zsGreen. 80% transduction was achieved with 20 uL of virus supernatant (representative image shown on the right). (D) Functional titer shown as transducing units (Til) per mL calculated for all lentiviruses. (E) From the transduction percentage, the functional titer can be evaluated as transducing unit (Til) per mL.

[0022] Figure 8. Schematic outline of an experiment demonstrating in vivo proof-of-concept of immune education. (1) The thymus is isolated from NOD / ShitLj mouse pups either prenatally or shortly after birth and (2) transduced ex vivo with lentiviral vector constructs encoding comAIRE and PDX1 , alongside the zsGreen fluorescent reporter. Prior to transduction, thymocytes are removed using deoxyguanosine (dGUO). (3) The transduced thymic tissues are then transplanted under the kidney capsule of athymic Balb / C nude mice. (4) T cell development is monitored over time in the blood, assessing both the reduction of 'pancreas’-specific conventional T cells and the increase of ‘pancreas’-specific Tregs. (5) This process ultimately leads to a reduction in insulitis. This experimental set-up is an accepted model for Type 1 Diabetes (T1 D) development.

[0023] Figure 9: Schematic, production and quality assessment of the gene therapy lentiviral vectors carrying HNF4 transcription factor. (A) Schematic of EFS-HNF4G-T2A- zsGreen and EFS-comAIRE-T2A-HNF4G-P2A-zsGreen vectors. (B) Physical titer of lentiviruses produced. (C) Functional titer of lentiviruses produced. Til: transducing unit; VP: vector particle.

[0024] Figure 10: Characterization of medullary thymic epithelial cell (mTEC) lineages at embryonic day 16.5 (E16.5). Flow cytometry of fresh fetal thymic tissue (following CD45 depletion) demonstrates the cellular composition at E16.5 (also referred to here as day 0 -dO- which is the start of the ex-vivo experiment). Within the viable single-cell population, EpCAM+epithelial cells are clearly separated from the CD45+immune fraction. Among EpCAM+CD45“ cells, mTECs are identified by UEA-1 expression and further subdivided based on MHC-II and CD80 expression into mTEC Io (“immature” CD80- MHC-II+ / -) and mTEC hi (“mature” CD80+MHC-II+) populations. The mTEChi subset is characterized by AIRE expression, which is absent in mTEC Io cells.

[0025] Figure 11 : Fetal thymic tissue does not contain regulatory T cells (CD3+FOXP3+) at embryonic day 16.5 (E16.5). Flow cytometry analysis of the immune population (CD45+) from fetal thymic tissue shows the absence of CD3+FOXP3+cells, indicating that regulatory T cells are not yet present at this embryonic stage.

[0026] Figure 12: Fetal thymic tissues are transduced with the lentiviral vector EFS-PDX1- T2A-zsGreen. The fluorescence of zsGreen is imaged over a period of 6 days posttransduction. Shown here are three different fetal thymic pieces imaged at 4-, 5-, and 6-days post-transduction. A clear signal is observed, indicating successful transduction of the fetal thymic tissues. Figure 13: Fetal thymic tissues transduced with the lentiviral vector EFS-comAIRE- T2A-PDX1-P2A-zsGreen expressed PDX1 and insulin. Histological analyses are performed to detect PDX1 and insulin at the protein level. PDX1 is detected using both immunofluorescence and histochemistry, whereas insulin is detected using histochemistry only. Brown signals indicate protein expression. This indicates that PDX1 transduction induces the expression of one of its downstream targets (insulin).

[0027] Figure 14: Fetal thymic tissues transduced with the lentiviral vector EFS-comAIRE- T2A-PDX1-P2A-zsGreen expressed Foxp3 5 days post-transduction. (A) Control staining using secondary antibody only. (B) Histological analysis shows the expression of Foxp3 exclusively in the transduced condition, whereas (C) untransduced controls lack Foxp3 expression. These findings suggest that transduction with EFS-comAIRE- T2A-PDX1-P2A-zsGreen may promote the emergence of Foxp3+ cells.

[0028] Figure 15: Gene expression analysis by dPCR and RNA-seq shows the expression of transcription factor and organ-related genes upon lentivirus transduction. (A) Lentivirus transduction of EFS-PDX1-T2A-zsGreen and EFS-comAIRE-T2A-PDX1- P2A-zsGreen induced the expression of Neurog3 and Trpm3, whereas only EFS- comAIRE-T2A-PDX1-P2A-zsGreen induced the expression of Adgrgl. Neurog3, Trpm3 and Adgrgl are known to be expressed either in developing pancreas or in mature pancreas. (B) Lentivirus transduction of EFS-comAIRE-T2A-HNF4G-P2A- zsGreen, but not EFS-HNF4G-P2A-zsGreen, induced the expression of Muc13, Apob and Tkfc, genes that are known to be expressed in the liver. These findings suggest that AIRE tentatively influences the expression of downstream targets of PDX1 , while its role is more prominent in the induction of downstream targets of HNF4G.

[0029] Detailed description

[0030] In subjects, such as in humans, B-cells and T-cells, which are cells of hematopoietic origin, are involved in the adaptive immune response. B-cells can generate antibodies against foreign antigens. T-cells interact with MHC receptors on cells of the subject. Cells of the subjects which are infected or aberrant (such as cancer cells), will present different peptides on their MHC receptors than healthy cells, which can be recognized by the T-cells which subsequently are able to eradicate the infected or aberrant cells. In a healthy immune system, self-reactive T-cells and / or B-cells are eliminated. T cell development, maturation and subsequent export of the T-cells, occurs in the thymus. Thymus function includes elimination of self-reactive T-cells. Furthermore, T-cells expressing TCRs with intermediate- to high affinity for self-antigens can differentiate into regulatory T cells (T reg) in the thymus, which play an important role in suppressing immunological responses to self-antigens as well Hsieh and Lio, Nature Rev Immunol; Vol.12 (2012)). The elimination and / or suppression of undesirable immune responses against antigens, such as self-antigens, as presented by cells of certain tissue types in the periphery, is referred to in the art as inducing tolerance. In case the immune system fails to eliminate self-reactive immunity and / or fails to develop regulatory T- cells, auto-immune disease may develop in a subject, in which the subjects immune system may end up eradicating certain cell types. Such occurs for example in type 1 diabetes, in which the immune system eradicates pancreatic cells.

[0031] The present invention provides for means and methods that may provide thymus function, to subjects, by which undesirable immune responses against antigens or against certain cells, at least in part, can advantageously be avoided and / or reduced in subjects. This way, immune responses that are otherwise harmful to the subject can be reduced or avoided. As said, to such an effect may be referred to, as is well known in the art, as to induce tolerance in a subject, at least in part, against said antigen or against said cells, tissue, organ, or the like. Hence, the engineered thymic tissue provides for at least one tolerogenic function as found in a thymus as occurring in healthy subjects, which can be highly useful for subjects having e.g. an impaired tolerogenic function, as shown e.g. by an undesirable (auto-)immune response against cells or tissue endogenous to the subject or in subjects being at risk thereof, or in subjects in which a defined tolerance would be beneficial.

[0032] Without being bound by theory, with the means and methods as described herein, as a result from the treatment, subjects may generate cells which can educate the immune system, e.g. regulatory T-cells or suppressive T cells, to induce tolerance against one or more antigens induced by expression of the a lineage defining transcription factor in the subject and / or the treatment may reinstate negative selection. Potential markers for suppressive T cells include FOXP3, CD25, CTLA-4, LAG3, TIGIT, PD-1 , CD39 and CD73, IL-10, TGF-beta and IL-35. In mice, regulatory T cells can be identified by CD4+ and FOXP3 (in some cases CD8+ FOXP3), often in combination with Helios (a marker for thymic-derived Tregs) and CD25. In humans, FOXP3 expression does not immediately reflect immunosuppressive Tregs. Markers for regulatory T cells in humans include CD45RO, CD127-low, CD4+ CD25hi, FOXP3, CTLA-4, TIGIT. It is remarked though that, besides FOXP3, all these markers are also shared with conventional T cells, and therefore do not immediately classify a T-cell as a suppressive or regulatory T cell.

[0033] Accordingly, in one embodiment, the invention provides for a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment. In another embodiment, the invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence. In yet another embodiment, the invention provides for a nucleic acid encoding an AIRE sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence. In another embodiment, the invention provides for a nucleic acid encoding a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence.

[0034] In one embodiment, the invention is characterised by the remarkable observation that engineered thymic tissue or thymic epithelial cells, when transduced with a nucleic acid encoding a lineage-defining transcription factor, such as PDX1 , in combination with AIRE, result in the emergence of FOXP3-positive cells within the thymic tissue. This finding is particularly significant, as FOXP3 is a well-established marker of regulatory T cells (Tregs), which play a central role in the maintenance of immune tolerance and the prevention of autoimmunity. In the context of the invention, the presence of FOXP3-positive cells following genetic engineering of thymic tissue demonstrates that the provided means and methods not only induce the expression and presentation of tissue-restricted antigens, but also actively promote the development of regulatory T cells specific for those antigens. This is evidenced by the detection of FOXP3 expression in thymic tissue transduced with both AIRE and a lineage-defining transcription factor, whereas untransduced control tissue lacks such FOXP3-positive cells. The induction of FOXP3-positive regulatory T cells within the engineered thymic tissue is a key mechanistic feature of the invention, as these cells are capable of suppressing undesirable immune responses against self-antigens or tissue-restricted antigens, thereby conferring immune tolerance. This effect is particularly advantageous for the prevention or treatment of autoimmune diseases, as well as for enabling tolerance to therapeutic proteins or gene therapy products. Accordingly, in one embodiment, the invention provides engineered thymic tissue or thymic epithelial cells, obtainable by transduction with a nucleic acid encoding AIRE and a nucleic acid encoding a lineage-defining transcription factor, wherein the engineered tissue or cells are characterised by the presence of FOXP3-positive regulatory T cells. The emergence of these FOXP3-positive cells within the engineered thymic environment is a direct consequence of the antigenic education provided by the invention, and represents a critical step in the establishment of central immune tolerance. The engineered thymic tissue or engineere thymic epithelial cells according to the invention and when transplanted into an immunodeficient or athymic recipient, can thus induce the development of regulatory T cells specific for the tissue-restricted antigens.

[0035] In another embodiment, the invention provides for a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence, for use in medical treatment. In another embodiment, the invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence. In yet another embodiment, the invention provides for a nucleic acid encoding an AIRE sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence. In another embodiment, the invention provides for a nucleic acid encoding a nucleic acid encoding an antigen sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence.

[0036] As outlined herein, it is understood that the nucleic acid encoding an AIRE sequence, the nucleic acid encoding an antigen sequence or the nucleic acid encoding a lineage defining transcription factor sequence, refer to nucleic acid, such as DNA or RNA, which comprise the genetic code, with which, when provided as or transcribed into a messenger RNA, can be translated, respectively, into an AIRE protein, an antigen protein or a lineage defining transcription factor protein. It is understood that the AIRE sequence, the antigen sequence or a lineage defining transcription factor protein in this context refers thus to the amino acid sequence of the polypeptides, i.e. proteins, that are encoded by the provided nucleic acid. Hence, instead of AIRE sequence, antigen sequence or lineage defining transcription factor sequence, reference may also be made to AIRE amino acid sequence, antigen amino acid sequence or lineage defining transcription factor amino acid sequence instead. It is understood that the nucleic acids encoding the AIRE sequence and the antigen sequence or the lineage defining transcription factor sequence, may be provided separately, e.g. as shown in the non-limiting examples herein in two separate lentiviral vectors each comprising an expression cassette for AIRE , or, these may be provided in a single nucleic acid, e.g. as shown in the examples herein in a single lentiviral vector comprising a single expression cassette for both AIRE and antigen or a lineage defining transcription factor sequence. As long as the nucleic acids as provided allow the AIRE sequence and antigen sequence or lineage defining transcription factor sequence to be expressed, i.e. allow to provide for an AIRE protein and an antigen (i.e. protein) or lineage defining transcription factor protein such nucleic acids are contemplated in accordance with the invention. Hence, it is understood that nucleic acids, and nucleic acid sequences encoding AIRE and / or antigen, respectively AIRE and / or lineage defining transcription factor in accordance with the invention refer to exogenous nucleic acid sequences, preferably engineered nucleic acid sequences, nucleic acid constructs, that allow for expression of either exogenous AIRE protein and exogenous antigen, or exogenous AIRE protein and exogenous lineage defining transcription factor protein. Engineered nucleic acid sequences include expression constructs, which encode for AIRE protein and / or antigen amino acid sequence, respectively AIRE protein and / or lineage defining transcription factor protein and which may include codon-optimized nucleic acid sequences. It is understood that with the term exogenous in the context of the invention is understood that this refers to not having its origin in the genome of the subject, but that nevertheless, the amino acid sequence of AIRE and / or antigen, respectively AIRE and / or lineage defining transcription factor protein may be identical to AIRE and / or antigen, respectively AIRE and / or lineage defining transcription factor protein, as expressed by (unmodified) cells of the subject.

[0037] “AIRE” in accordance with the invention refers to the autoimmune regulator (AIRE), which is encoded by the AIRE gene. In humans it is a 13kbp gene on chromosome 21q22.3 that encodes 545 amino acids. A human AIRE protein sequence, is provided by NCBI Reference Sequence: NP_000374.1 , as encoded by nucleotides 132-1769 of NM_000383.4. Suitable human AIRE proteins may include all human isoforms thereof. Corresponding mouse AIRE protein sequences, are provided by i.a. NP_033776.1 , NP_001258478.1 , NP_001258479.1 , NP_001258480.1 ,

[0038] NP-001258481.1 , NP_001258482.1 , NP_001258483.1 , NP_001258484.1 ,

[0039] NP_001258485.1 , NP_001258486.1 , NP_001258487.1 , NP_001258488.1 , which are encoded by NM_009646.2 and N M_001271549.1 N M_001271550.1 ,

[0040] NM-001271551.1 , NM-001271552.1 , NM_001271553.1 , NM_001271554.1 ,

[0041] NM-001271555.1 , NM-001271556.1 , NM_001271557.1 , NM_001271558.1 ,

[0042] NM-001271559.1 , respectively. These are suitable mouse AIRE nucleic acid sequences in accordance with the invention, and NM_009646.2 was used in the examples herein. AIRE is a transcription factor which is expressed in the medulla

[0043] (inner part) of the thymus. AIRE expression is to regulate tissue-restricted antigen expression. The medulla is part of the mechanism which eliminates self-reactive T cells that would cause autoimmune disease. It exposes T cells to (processed) proteins from all parts of the body, and T cells that react to MHC derived peptides from such proteins may be destroyed or develop into regulatory T cells.

[0044] Accordingly “AIRE” in accordance with the invention includes AIRE proteins with amino acid sequences as found in nature, such a human or mouse AIRE protein sequence, and (engineered) functional equivalent variants thereof, which, when expressed provides for a functional transcription factor. The skilled person is hence well capable of selecting a suitable AIRE protein, for which a suitable nucleic acid can be provided, that can be used in the means and methods in accordance with the invention, as outlined herein.

[0045] Without being bound by theory, with the means and methods as described herein, as a result from the treatment, subjects may generate cells, i.e. engineered (mimetic) thymic cells, which can educate the immune system, e.g. regulatory T-cells or suppressive T cells, to induce tolerance against one or more antigens induced by expression of the lineage defining transcription factor and / or the treatment may reinstate negative selection. Further, the means and methods as described herein, as a result from the treatment, subjects may generate i.a. regulatory T-cells or suppressive T cells which are to induce tolerance against the antigen in the subject and / or the treatment may reinstate negative selection. Potential markers for suppressive T cells include FOXP3, CD4, CD25, CTLA-4, LAG3, TIGIT, PD-1 , CD39 and CD73, IL-10, TGF-beta and IL-35. In mice, regulatory T cells can be identified by CD4+ and FOXP3 (in some cases CD8+ FOXP3), often in combination with Helios (a marker for thymic-derived Tregs) and CD25. In humans, FOXP3 expression also reflects immunosuppressive Tregs, in addition to the following markers for regulatory T cells, including CD45RO, CD127-low, CD4+ CD25hi, FOXP3, CTLA-4, TIGIT. It is remarked though that, besides FOXP3, such markers are also shared with conventional T cells, and therefore in itself do not classify a T-cells as a suppressive or regulatory T cell.

[0046] Instead of AIRE, other transcription factors may be contemplated that are capable of inducing tissue-restricted antigens (TRAs) expression as well. Any of AIRE, FEZf2 (such as NM_080433.3 and corresponding amino acid sequence NP_536681.2), and PRDM1 (such as nucleic acids NM_007548.5, N M_001405936.1 , NM_001405935.1 , NM_001405934.1 , NM_001405933.1 , NM_001405932.1 , NM_001405931.1 , NM_001405930.1 , NM_001405929.1 , which encode corresponding PRDM1 amino acid sequences NP_031574.2, NP_001392865.1 , NP_001392864.1 , NP_001392863.1 , NP_001392862.1 , NP_001392861.1 , NP_001392860.1 ,

[0047] NP_001392859.1 , NP_001392858.1), or another variant, isoform, or functional equivalent thereof) may suffice. Suitable transcription factors that may be contemplated include human AIRE, human FEZf2 and human PRDM1. Such includes other variants, isoforms, or functional equivalents thereof. As long as a suitable transcription factor is provided to provide for tissue-restricted antigen expression, such a transcription factor may be contemplated instead of AIRE. It is however preferred, in accordance with the invention, to select AIRE.

[0048] With regard to the nucleic acid sequences encoding AIRE, or other suitable transcription factors as described above, it is understood that these can be codon optimized, which can be preferred if one wishes to increase expression levels, though both a codon optimized AIRE nucleic acid sequence or native nucleic acid sequence may be contemplated.

[0049] As described herein, it is understood that, without being bound by theory, the combination of AIRE and an lineage defining transcription factor is believed to be in particular advantageous. This is because AIRE is a key transcription factor of a subset of medullary thymic epithelial cells (mTEC) that allows expression of tissue-restricted genes in the thymus. By overexpressing AIRE together with e.g. Pdx1 , peptide presentation of genes downstream of Pdx1 (including insulin) is induced, with which the immune system can be educated, therewith restoring / inducing central tolerance for targets of Pdx1 , which are representative of the pancreatic cells in the periphery. Yet, in an alternative embodiment, it may be contemplated not to provide for overexpression of AIRE by providing an exogenous nucleic acid encoding AIRE, but solely provide a nucleic acid encoding a lineage defining transcription factor instead, as such in itself, may be sufficient to provide for engineered thymic mimetic cells which may educate the immune system in accordance with the invention. Hence, in this alternative embodiment, instead of providing a medical treatment wherein a combination of AIRE and a lineage defining transcription factor is used, solely the nucleic acid encoding the lineage defining transcription factor provided in the medical treatment. Hence, in any of the embodiments as described herein related to the combination of AIRE and lineage defining transcription factor, in these embodiments this combination can be replaced with solely the lineage defining transcription factor. Hence, in these alternative embodiments, the invention provides for a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment. In a further alternative embodiment, the invention thus provides for a nucleic acid encoding a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment, wherein the medical treatment comprises the use of the nucleic acid encoding a lineage defining transcription factor sequence and does not comprise the use of a nucleic acid encoding an AIRE sequence. In yet a further alternative embodiment, the invention provides for a nucleic acid encoding a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment, wherein the medical treatment consists of the use of the nucleic acid encoding a lineage defining transcription factor sequence, and constructs and vectors comprising the nucleic acid encoding a lineage defining transcription factor sequence.

[0050] With regard to the lineage defining transcription factor sequence, there is in principle no limitation with regard to the type of lineage defining transcription factor that is to be expressed, as long as it represents a lineage defining transcription factor sequence, for which it is considered to be advantageous to induce tolerance against the lineage of cells that it is to define in a subject, such a lineage defining transcription factor amino acid sequence can be contemplated in accordance with the invention.

[0051] With regard to the antigen sequence, there is in principle no limitation with regard to the type of antigen that is to be expressed, as long as it represents an antigen, for which it is considered to be advantageous to induce tolerance in a subject, such an antigen amino acid sequence can be contemplated in accordance with the invention.

[0052] In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with the invention is provided, wherein in the medical treatment, thymus tissue is provided, and the thymus tissue cells are provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding an antigen sequence. As outlined above, the nucleic acids encoding AIRE and / or antigen, can be advantageously used to provide thymus tissue, of which thymus tissue cells are provided with (exogenous) nucleic acid encoding AIRE and antigen (either from a single nucleic acid or from separate nucleic acids), such that the AIRE protein and antigen encoded by the nucleic acid are expressed by the thymus tissue cells.

[0053] Likewise, in another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with the invention is provided, wherein in the medical treatment, thymus tissue is provided, and the thymus tissue cells are provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence. As outline above, the nucleic acids encoding AIRE and / or lineage defining transcription factor , can be advantageously used to provide thymus tissue, of which thymus tissue cells are provided with (exogenous) nucleic acid encoding AIRE and lineage defining transcription factor (either from a single nucleic acid or from separate nucleic acids), such that the AIRE protein and lineage defining transcription factor encoded by the nucleic acid are expressed by the thymus tissue cells.

[0054] It is understood that thymus tissue can be derived from a thymus biopsy. It is understood that thymus tissue can also be derived from pluripotent stem cells. Hence, accordingly, in one embodiment, the invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen, for use in a medical treatment, wherein the thymus tissue is derived from a thymus biopsy or from pluripotent stem cells. In another embodiment, the invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor, for use in a medical treatment, wherein the thymus tissue is derived from a thymus biopsy or from pluripotent stem cells.

[0055] Thymus tissue in accordance with the invention includes tissue originating from the thymus (see e.g. Fundamental of Anatomy and Physiology, Nartini & Nath, 2023 12thedition, and The immune system, Peter Parham, 2023, 5thedition). As outlined herein and as known in the art, the thymus is an organ found in mammals which has an important role in immunity, primarily in educating immune cells. Immature thymocytes, originating from the bone marrow, develop in the thymus into functional T-lymphocytes. T cell development, maturation and subsequent export of the T-cells, occurs in the thymus. Thymus function includes elimination of self-reactive T-cells. Furthermore, T-cells expressing TCRs, with e.g. intermediate affinity for self-antigens can differentiate into regulatory T cells (Treg) in the thymus, which play an important role in suppressing immunological responses to self-antigens as well (Hsieh and Lio, Nature Rev Immunol; Vol.12 (2012). Thymus tissue can be obtained from a thymus of a subject. Thymus tissue can also be prepared from cells obtained of a subject, which are subsequently engineered and / or subjected to stimulatory and inhibitory factors such that these cells develop in vitro into thymus tissue, i.e. when characterized with regard to structure and marker expression, such engineered thymus tissue is highly similar to thymus tissue as obtained from the subject, and, upon transplantation in a subject, provides for a similar or the same function, as compared with the tolerogenic functions of thymus tissue obtained from a subject, i.e. having at least one function as described in Fundamentals of Anatomy and Physiology, Nartini & Nath, 2023 12thedition or The immune system, Peter Parham, 2023, 5thedition,. Such thymus tissue can be generated in vitro, e.g. from mouse or human induced pluripotent stem cells, upon genetic engineering and / or stimulation with stimulatory and inhibitory factors, allowing the iPSCs to differentiate until the thymic epithelial progenitor cell stage, upon which these cells are aggregated to form thymus tissue. Generation of thymus tissue from iPSC is known in the art see i.a. in Chhatta et al. 2021 , J Immunology and Regenerative Medicine; Paia et al., J Exp Med (2024) 221 (10): e20230892), and Provin and Giraud, 2023, Front Immunol; 13: 930963.

[0056] Hence, thymus tissue generated from iPSC, or pluripotent stem cells, of a subject, or thymus tissue obtained from a subject, may be contemplated in accordance with the invention. Thus, in another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence is provided, for use in a medical treatment in accordance with the invention, wherein the thymus tissue is derived from induced pluripotent stem cells (iPSCs). In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor is provided, for use in a medical treatment in accordance with the invention, wherein the thymus tissue is derived from induced pluripotent stem cells (iPSCs).

[0057] For example, pluripotent cells, such as induced pluripotent cells (iPSC) can be seeded for the induction of definitive endoderm (DE). This can be done by modulating the wingless (wnt) pathways, as well as nodal signaling via the use of Activin A. Cells with a commitment to DE can be obtained within a timeframe of 2 to 6 days (typically 3-4 days). DE-committed cells may then be further subjected to anteriorization for the specification of the anterior foregut endoderm (AFE). This can be induced by for example modulating TGF-b and BMP signaling for a period of 3 to 7 days. Further specification of AFE-cells into thymic epithelial cells (TEPCs) can be done by modulating pathways such as sonic hedgehog (SHH), Wnt, BMP, FGF, and RA pathways. To assess the efficacy of the differentiation, FOXN1 gene expression can monitored from the stem cell stages until the desired final stage, that can be thymic epithelial progenitor cell stage (TEPC) or medullary thymic epithelial progenitor cells (mTECs). Subsequently, the TEPC or mTECs cells can be formed in a structure similar to a structure found in thymus, by aggregating the cells, e.g. by forming a spheroid or organoid. Such an organoid or spheroid my further comprise ECM and / or other scaffold material as well as non-epithelial cells such as cells from haematopoietic lineage, including but not limited to haematopoietic stem cells, thymus-seeding progenitors, or T-cell progenitors, or stromal cells, including but not limited to fibroblasts, mesenchymal stromal cells or progenitors or progeny of any of said cells. This way, thymus-like tissue can be obtained in vitro. Thymic cells, or thymus tissue, in another embodiment, can also envisioned to be generated from other cell types, i.e. not necessarily from pluripotent stem cells from any type of cells or tissue, which may be transdifferentiated in vitro into appropriate thymic cells or thymic tissue by providing appropriate stimuli (such as described in Bredenkamp et al. Nature cell biology vol. 16,9 (2014): 902-8).

[0058] Of course, it may also be contemplated to transfer the nucleic a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence as provided in accordance with the invention, directly into the thymus of the subject, such that the thymic cells of the subject are provided with the nucleic acids in vivo, as opposed to the providing thymic cells in thymus tissue, from a biopsy or derived from pluripotent stem cells, with the nucleic acids in vitro. Likewise, it may also be contemplated to transfer the nucleic a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence as provided in accordance with the invention directly into the thymus of the subject, such that the thymic cells of the subject are provided with the nucleic acids in vivo, as opposed to the providing thymic cells in thymus tissue, from a biopsy or derived from pluripotent stem cells, with the nucleic acids in vitro. It is however preferred to provide nucleic acids to thymus tissue in vitro, as such may be less invasive to the subject that is to be undergoing the medical treatment.

[0059] Providing an AIRE nucleic acid sequence (with or without a nucleic acid encoding an antigen sequence) to thymic epithelial progenitor cells (TEPC) can have an added benefit to trigger the mTEC fate. Without being bound by theory, within the context of the invention AIRE is advantageous for the developmental program of mTECs, including Aire-positive cells themselves. In any case, as long as the nucleic acid encoding AIRE and antigen sequence, or as long as the nucleic acid encoding AIRE and lineage defining transcription factor sequence, are provided to thymic cells (i.e. cells of thymus tissue or of the thymus, or of thymus tissue generated in vitro from (induced) pluripotent stem cells), such is contemplated in accordance with the invention. With regard to providing thymic cells with nucleic acid, which can be RNA or DNA, it is understood that any type of transfer of nucleic acid to the thymic cells can be contemplated in accordance with the invention, as long as the transfer of the nucleic acid allows for expression of the encoded sequences (of AIRE protein or antigen or lineage defining transcription factor). It is thus understood that the nucleic acids in accordance with the invention may be provided, i.e. engineered, with all the necessary elements that allow for expression, such as promoter and / or enhancer elements, 5’ and 3’ UTR encoding sequences, intron sequences (which may be interspersed within the open reading frame of an encoding sequence), polyA signal and / or other RNA regulatory elements known in the art, such as PRE, WPRE, CTE or the like. It is understood that providing nucleic acid to thymic cells includes any means that allows for transfer of nucleic acids to cells, such as transfection methods (e.g. with PEI (polyethylenimine), calcium phosphate transfection or lipid nanoparticles such as lipofectamine) or viral vector mediated transfer (e.g. a parvoviral vector, e.g. AAV, or retroviral, e.g. lentiviral vector (such as described in the examples herein). In case of viral vectors, suitable necessary sequences, e.g. for packaging of vector genomes, and, in case of retroviral vectors, for reverse transcription, may be included in de nucleic acids as well. Hence, any suitable gene delivery method and / or nucleic acid delivery technology known in the art may be contemplated to transfer nucleic acid to the thymic cells.

[0060] With regard to the nucleic acid sequence encoding the antigen, it is highly preferred that the nucleic acid sequence encoding the antigen protein is as it occurs naturally, as protein synthesis and subsequent folding and processing from an mRNA template are linked, and, a codon optimized sequence may affect protein synthesis, folding, and subsequent processing of the translated protein by the cell into peptides for antigen presentation via MHC.

[0061] In one embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with the invention is provided, wherein the antigen sequence, when expressed in a cell, is processed by the cell to provide for MHC molecules presenting one or more peptide fragments derived from the expressed antigen sequence. In a further embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with invention is provided, wherein the one or more peptide fragments are one or more T-cell epitopes. It is understood that with the expression of the AIRE and the antigen sequence, the objective is to have at least thymic cells to present within thymus tissue, peptide fragments on their cell surface at MHC receptors. Such one or more peptide fragments preferably are one or more T-cell epitopes.

[0062] In one embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with the invention is provided, wherein the lineage defining transcription factor induces expression of proteins corresponding with a peripheral cell phenotype. It is understood such induction of expression of proteins includes expression of one or more proteins. As outlined above, the expression of the lineage defining transcription factor is to induce expression of proteins that are associated with the peripheral phenotype, e.g. in case the peripheral phenotype is muscle cells, proteins associated with the muscle phenotype are expressed. Hence, it is understood that peripheral cells are cells outside of the thymus, and which are of a certain phenotype, e.g. cells of a certain tissue or organ, or part thereof. Accordingly, in another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with the invention is provided, wherein the lineage defining transcription factor sequence, when expressed in a thymus cell, induces expression of proteins associated with a peripheral phenotype, which induced expressed proteins are processed by the cell to provide for MHC molecules presenting one or more peptide fragments derived therefrom. It is understood that the lineage defining transcription factor which is expressed determines the proteins that are expressed associated with the peripheral phenotype. The expressed proteins are subsequently processed by the cellular machinery such that peptide fragments are presented by MHC molecules on the thymic cells. Such peptide fragments preferably are one or more T-cell epitopes. This way, the cells of the thymus can present a repertoire of antigens associated with a certain peripheral phenotype.

[0063] It is understood that as peptide fragments presented by MHC are, for MHC I, about 8-11 amino acid in lengths and for MHC II, about 13-25. Hence, an antigenic protein that is expressed can provide for one or more peptide fragments, upon processing by the cells, that are presented by MHC. Also, the lineage defining transcription factor sequence, which induces expression of proteins associated with a peripheral phenotype, are processed such that one or more peptide fragments, upon processing by the cells, representative of the proteins associated with the peripheral phenotype, are presented by MHC. This way, advantageously, instead of aiming to induce tolerance against a defined antigen in a subject, or a collection of defined antigens in a subject, which would have e.g. to be determined prior to inducing tolerance in a subject (e.g. by repeated administration of low and / or increasing amounts of antigens), the subject is provided with the complete or more complete repertoire of antigens, representative of the repertoire as presented by the cells of the periphery against which tolerance is to be induced.

[0064] The engineered thymic cells provided, comprising an AIRE sequence and a lineage specific transcription factor sequence, may be referred to as mimetic cells, and because these are made by engineered can be referred to as engineered mimetic cells or engineered thymic mimetic cells. The term mimetic indicating that these cells mimic peripheral cells from an antigen presenting perspective. These engineered thymic cells have important thymic properties, e.g. as induced by expressed exogenous AIRE, allowing the engineered thymic cells to educate the immune system as outlined herein. Hence, accordingly, by providing thymic cells with a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence as described herein (or, alternatively, solely a lineage defining transcription factor sequence), the invention provides for engineered thymic mimetic cells.

[0065] In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with the invention is provided, wherein in the thymus tissue, the antigen and AIRE is expressed in medullary thymic epithelial cells (mTECs). In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with the invention is provided, wherein the lineage defining transcription factor is expressed in a thymus cell, which preferably is a medullary thymic epithelial cell (mTEC). Without being bound by theory, it is understood that expression of AIRE and the antigen, or AIRE and the lineage defining transcription factor, is to be in particular advantageous in mTEC cells, of the thymus tissue, as this type of cells are understood to play an important role in the clonal deletion (also referred to as negative selection) of potentially autoreactive T cells and the generation of regulatory T cells. Medullary thymic epithelial cells, as its name implies are located within the thymus. These thymic cells in the mouse may be EpCAM+ CD45- Ly51- LIEA-1+, and can further be differentiated into CD80 I MHC-II Io and hi, based on their maturation state, of which the latter also expresses AIRE (as described in Kadouri, Nevo and Abramson, Nat. Rev. Immunol Vol 20 (2020). Likewise, in human, mTECs are less specifically defined by flow cytometry, and can be EpCAM+ PDPN+ CD45-, AIRE+ CK8+ and CD200+ (as described in Haunerdinger et al, Front. Immunol. Vol 12, (2021). mTECs are found in thymic biopsies, and can be also found in thymic cells generated in vitro from pluripotent stem cells.

[0066] It is understood that it may be contemplated to isolate from thymus tissue, mTEC cells (for example via FACS sorting or the like utilizing mTEC specific markers), and to transfer the nucleic acids encoding AIRE and antigen sequence to these cells separately, or to transfer the nucleic acids encoding AIRE and lineage defining transcription factor sequence to these cells separately, after which these cells may be combined with the thymus tissue cells from which the mTEC cells were separated from, i.a. cortical thymus epithelial cells (cTEC) , and subsequently aggregated to provide for thymus tissue generated in vitro.

[0067] In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with the invention is provided, wherein the lineage defining transcription factor is expressed in a thymus cell, therewith providing for mimetic cells. As outlined above, by expressing a lineage defining transcription factor in thymic cells, combined with AIRE, the thymic cells are thus mimicking, or closely mimicking, antigen presentation as would be occurring in the corresponding cells in the periphery (i.e. certain types of cells or tissue) associated with the lineage defining transcription factor. Such cells may be referred to as mimetic cells, with which mimetic is understood to refer to the antigen presenting aspect of the cells of the periphery.

[0068] As said, it is preferred to provide nucleic acids to thymus tissue in vitro, as such may be less invasive to the subject that is to be undergoing the medical treatment. As is clear from the above, and as outlined herein, the present invention thus provides for thymus, as defined herein, which is provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding an antigen sequence for use in a medical treatment. Hence, the present invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, as defined herein, for use in a medical treatment in accordance with the invention, wherein the medical treatment comprises administering the thymus tissue provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding an antigen sequence to a subject. Likewise, the present invention also thus provides for thymus, as defined herein, which is provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence for use in a medical treatment. Hence, the present invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, as defined herein, for use in a medical treatment in accordance with the invention, wherein the medical treatment comprises administering the thymus tissue provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence to a subject.

[0069] In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance invention is provided, wherein the thymus tissue is autologous thymus tissue. It is understood that it is highly preferred that the thymus tissue that is provided, and which is to comprise the nucleic acid encoding an AIRE sequence and i) a nucleic acid encoding an antigen sequence or ii) a nucleic acid encoding a lineage defining transcription factor sequence, is autologous thymus tissue of the subject that is to receive the medical treatment. This is highly preferred as this is both from a risk perspective (host-versus- graft and graft-versus-host ) and from an efficacy perspective (i.e. MHC II peptides presented by autologous thymus tissue will be presented as presented by e.g. host tissue) believed to be optimal. For example, insulin antigens presented by the thymus tissue will be presented as they are presented by the pancreatic cells of the subject to which the thymus tissue is administered. Or, for example, in case of the selection of a lineage defining transcription factor sequence for cells of the pancreas (e.g. as shown in the examples herein), in accordance with the invention, the same pancreatic antigens presented by the thymus tissue will be presented by the same MHC receptors as they are presented by the pancreatic cells of the subject to which the thymus tissue is administered. This way, tolerance may be best induced.

[0070] Nevertheless, although less preferred, there can be circumstances that could allow for the use of allogenic thymic tissue. Hence, in another embodiment, a nucleic acid encoding an AIRE sequence and / or i) a nucleic acid encoding an antigen sequence or ii) a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance the invention is provided, wherein the thymus tissue is allogenic thymus tissue. The source of the allogenic thymic tissue can be e.g. cell and tissue banks. In addition, it is not necessarily required that the allogenic thymic tissue represents thymic cells or thymus tissue directly obtained from a donor. Thymus tissue or thymic cells generated from iPSC, or pluripotent stem cells, of an allogenic subject, as described herein, may be contemplated in accordance with the invention. Such can also be envisioned to be generated from other cell types, i.e. from any type of cells or tissue, which may be transdifferentiated in vitro into appropriate thymic cells or thymus tissue by providing appropriate stimuli (Such as described in Bredenkamp et al. Nature cell biology vol. 16,9 (2014): 902-8). Hence, any type of donor cell may be contemplated, which may include donor cells obtained or isolated e.g. from umbilical cord, blood, gut. Of course, it is highly preferred that such allogenic thymus tissue is HLA matched tissue, at least in part, e.g. in case of acceptable mismatches, but highly preferably the allogenic tissue is fully matched.

[0071] As described herein, it is understood that, without being bound by theory, the combination of AIRE and an antigen is believed to be in particular advantageous. This is because AIRE in the context of the invention is a key transcription factor of a subset of medullary thymic epithelial cells (mTEC) that allows expression of tissue-restricted genes in the thymus. By overexpressing AIRE together with e.g. insulin, antigenic- peptide presentation of insulin is induced, with which the engineered thymic cells can educate the immune system, therewith restoring / inducing central tolerance for insulin, highly useful in the subjects at risk of or suffering from type 1 diabetes. Yet, in an alternative embodiment, it may be contemplated not to provide for overexpression of AIRE by providing an exogenous nucleic acid encoding AIRE, but solely provide a nucleic acid encoding an antigen instead, as such in itself, as such may be sufficient to provide for engineered thymic cells that can educate the immune system in accordance with the invention. Hence, in this alternative embodiment, instead of providing a medical treatment wherein a combination of AIRE and an antigen is used, solely the nucleic acid encoding the antigen is provided in the medical treatment. Hence, in any of the embodiments as described herein related to the combination of AIRE and antigen, and thymic cells or tissue engineered therewith, in these embodiments this combination can be replaced with solely the antigen. Hence, in these alternative embodiments, the invention provides for a nucleic acid encoding antigen, for use in medical treatment, in particular for engineering thymus tissue or thymic cells as described herein. In further alternative embodiments, the invention thus provides for a nucleic acid encoding a nucleic acid encoding an antigen sequence, for use in medical treatment, wherein the medical treatment comprises the use of the nucleic acid encoding an antigen sequence and does not comprise the use of a nucleic acid encoding an AIRE sequence. In yet further alternative embodiments, the invention provides for a nucleic acid encoding an antigen sequence, for use in medical treatment, wherein the medical treatment consists of the use of the nucleic acid encoding an antigen sequence, and constructs and vectors comprising the nucleic acid encoding antigen sequences. Such alternative embodiments relate in particular to the means and methods as described herein for engineering of thymic cells or thymus tissue as described herein, and / or subsequent applications of such engineered thymic cells or thymus tissue.

[0072] As said, and as outlined herein, the present invention provides for a nucleic acid encoding an AIRE sequence and / or i) a nucleic acid encoding an antigen sequence or ii) a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment, wherein the medical treatment is for inducing immune tolerance for i) the antigen or ii) the lineage of cells as induced by the lineage defining transcription factor in the subject. Inducing immune tolerance to an antigen can be advantageous for various medical conditions. Likewise, inducing immune tolerance to certain cell types can be advantageous for various medical conditions. Such medical conditions may involve not necessarily a single antigen or a single type of cells, and it is thus contemplated in accordance with the invention that the immune tolerance is induced against one or more antigens or against one or more types of peripheral cells or lineages, which necessarily implies providing one or more nucleic acids encoding one or more antigens, or providing one or more nucleic acids encoding one or more lineage defining transcription factors. Such one or more nucleic acids encoding one or more lineage defining transcription factors may be used to engineer thymic cells individually, therewith providing one or more engineered thymic cells, of which each thymic cell is provided with one of the one or more lineage defining transcription factors, or these may be combined, instead, which may be less preferred.

[0073] Accordingly, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with the invention is provided, wherein immune tolerance is induced against the peripheral cells associated with the lineage defining transcription factor.

[0074] Medical conditions in which induction of tolerance is advantageous, includes autoimmune disease. In one embodiment, the present invention thus provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment as described herein, wherein the antigen is an antigen involved in an autoimmune disease.

[0075] In a further embodiment, the use in a medical treatment comprises an autoimmune disease selected from diabetes type 1 , coeliac disease, Rheumatoid arthritis, Multiple sclerosis, Systemic lupus erythematosus (SLE), psoriasis, Myasthenia gravis (MG), Idiopathic inflammatory myopathy, Polymyositis, Dermatomyositis, Sjogren’s syndrome, Autoimmune hepatitis (type I and II), Vasculitis, such as autoimmune renal vasculitis, and Goodpasture’s syndrome.

[0076] Hence, without being bound by theory, any autoimmune disease in which involvement of autoantigens are implicated or identified may advantageously be a suitable candidate for a medical treatment as outlined herein. For the treatment of coeliac disease, one or more antigens may be selected in accordance with the invention, from gluten or (modified) peptides thereof, such as gliadins or glutenin. . For the treatment of Rheumatoid arthritis, one or more antigens may be selected in accordance with the invention from Collagen II, human cartilage-gp 39, hnRNP A2, immunoglobulin, HSP, citrullinated: H3, H4, a-enolase, vimentin, collagen II, aggrecan, peptidyl arginine deiminase 4 and cartilage intermediate-layer protein. For the treatment of Multiple sclerosis, one or more antigens may be selected in accordance with the invention from a-Enolase, p-arrestin, myelin basic protein, myelin, oligodendrocyte glycoprotein, PLP, S100B, and RASGRP2 (i.e. CalDAG-GEFI). For Systemic lupus erythematosus one or more antigens may be selected in accordance with the invention from nucleosomal histones, small nuclear ribonucleoproteins, poly(ADP-ribose) polymerase, Smith antigens of U-1 ribonucleoproteins, and phospholipid-p-2 glycoprotein I. For psoriasis, one or more antigens may be selected in accordance with the invention from the cathelicidin antimicrobial peptide (LL37 or CAMP), the melanocytic antigen ADAMTS-like protein 5 (ADAMTSL5), the lipid antigen PLA2G4D and keratin 17. In Myasthenia gravis (MG), the antigen(s) that may be selected in accordance with the invention can be the nicotinic acetylcholine receptor (nAChR) and / or muscle specific kinase (MuSK). In Idiopathic inflammatory myopathy or Polymyositis, one or more antigens that may be selected in accordance with the invention can be from Histidyl tRNA synthetase, aminoacyl tRNA synthetases and signal recognition particle. In Dermatomyositis, the antigen(s) that may be selected in accordance with the invention can be Transcription intermediary factor 1 y and / or transcription intermediary factor 1 a. In Sjogren’s syndrome, one or more antigens that may be selected in accordance with the invention can be from Ro, La, muscarinic acetylcholine receptor, Systemic sclerosis, DNA topoisomerase I, RNA polymerase III, fibrillarin, Th / To ribonucleoprotein, and centromere proteins. In Autoimmune hepatitis (type I and II), one or more antigens that may be selected in accordance with the invention can be from asialoglycoprotein receptor, cytochrome P450 2D6, and anti-soluble liver antigen. In Vasculitis, such as autoimmune renal vasculitis, or Goodpasture’s syndrome, one or more antigens that may be selected in accordance with the invention can be from glomerular basement membrane, collagen IV a3 135-145, MPO, and PR3.

[0077] As medical conditions in which induction of tolerance is advantageous, includes autoimmune disease, in a further embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with any of claims is thus provided, wherein the treatment is of an autoimmune disease.

[0078] In a further embodiment, the use in a medical treatment comprises an autoimmune disease selected from diabetes type 1 , rheumatoid arthritis, multiple sclerosis, and SLE. Such diseases may advantageously benefit from the means, methods, and medical uses as outlined herein, provided that suitable lineage defining transcription factors are provided for the type of cells or tissue against which autoimmunity is directed.

[0079] Lineage defining transcription factors that may be selected for inducing tolerance against certain peripheral cells, which can find use in the treatment of autoimmune diseases are listed below in table 1. Hence, accordingly, in one embodiment, a lineage defining transcription factor is selected from the group as listed in table 1. Accordingly, in another embodiment, one or more lineage defining transcription factors are selected from the group as listed in table 1. Hence, any autoimmune disease in which a certain peripheral cell as listed below is implicated, may provide for a suitable lineage defining transcription factor suitable for the means, methods and medical uses as outlined herein. The present invention thus providing for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment as described herein, wherein the lineage defining transcription factor is for example selected from a group as listed in Table 1.

[0080] Table 1. Non-exhaustive list of lineage defining transcription factors

[0081] Such transcription factors may be useful to study for example the effect of engineered mimetic thymic cells or thymus tissue in animal models. In addition, certain lineage defining transcription factors have been implicated as risk factors for autoimmune diseases. Without being bound by theory, the use of such lineage defining transcription factors in accordance with the invention, may also be advantageous and benefit such auto-immune diseases. For example, HNF4A is associated with inflammatory bowel disease (Barrett, J.C. et al. (2009) Nat. Genet. 41 , 1330-1334), SPIB is associated with primary biliary cirrhosis (Liu, X. et al. (2010) Nat. Genet. 42, 658-660) and SOX8 is associated with multiple sclerosis (Int. MS Genet. Cons, and Wellcome Tr. CCC 2 (2011) Nature 476, 214-219). In the context of the invention, HNF4G (Hepatocyte Nuclear Factor 4 Gamma) serves as a lineage-defining transcription factor that is used to engineer thymic epithelial cells or thymic tissue to mimic the antigenic profile of peripheral tissues, particularly those of hepatic (liver) or intestinal origin. The invention is based on the principle that by introducing exogenous nucleic acids encoding both AIRE and a selected lineage-defining transcription factor into thymic cells, it is possible to induce the expression and presentation of tissue- restricted antigens (TRAs) that are normally specific to certain peripheral organs. This engineered antigen presentation in the thymus can educate developing T cells, promoting central immune tolerance to those antigens and thereby reducing or preventing autoimmune responses against the corresponding peripheral tissues. In the present invention, HNF4G is a transcription factor that, when overexpressed in thymic epithelial cells (for example, via lentiviral transduction), induces the expression of genes and antigens characteristic of liver and gut epithelia. The inventors have shown that transduction of thymic epithelial cells with HNF4G, particularly in combination with AIRE, leads to the upregulation of liver-associated genes such as Muc13, Apob, and Tkfc. This demonstrates that HNF4G can direct thymic cells to present a repertoire of antigens representative of hepatic or intestinal cells. Thus, it is demonstrated that by engineering thymic tissue with HNF4G (and optionally AIRE), it is possible to induce immune tolerance to liver- or gut-specific antigens. This approach could be used, for example, to prevent or treat autoimmune diseases targeting the liver or gut, or to enable tolerance to therapeutic proteins or gene therapy products expressed in these tissues. Therefore, in the context of the present invention, HNF4G acts as a tool to reprogramme thymic epithelial cells to present liver- or gut-specific antigens, thereby enabling the thymus to educate the immune system and induce tolerance to these antigens, with potential therapeutic benefit in autoimmunity and other immune-mediated conditions. Hence, in one embodiment, the auto immune disease is an inflammatory bowel disease, and the lineage defining transcription factor is HNF4A. In another embodiment, the auto immune disease is a primary biliary cirrhosis, and the lineage defining transcription factor is SPIB. In yet another embodiment, the auto immune disease is multiple sclerosis, and the lineage defining transcription factor is SOX8.

[0082] In yet another embodiment, and a particularly preferred embodiment, as this is outlined herein in the example section herein, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with the invention is provided, wherein the autoimmune disease is diabetes type 1. Preferably, lineage defining transcription factor is a transcription factor for the peripheral pancreatic cells, and / or the lineage defining transcription factor is PDX1.

[0083] PDX1 is a known lineage defining transcription factor for pancreatic cells. A human PDX1 nucleic acid sequence is e.g. found in Genbank Ref. NM_000209.4, CDS sequence encoded by nucleotides 140-991 thereof, and corresponding PDX1 amino acid sequence is NP_000200.1. This includes, human variants, human isoforms, or functional equivalents thereof. A corresponding mouse PDX1 nucleic acid sequence and encoded PDX1 amino acid sequence is found in Genbank Ref. NM_008814.4 and NP_032840.1 (which sequence was also used in the examples herein).

[0084] The PDX1 transcription factor targets transcription factors Ptfla (primarily important for development of exocrine acinar cells), Ngn3 and NeuroD (important for endocrine alpha en beta cell development). Hence, it is understood that instead of using the PDX transcription factor, instead one of the transcription factors Ptfla, Ngn3 and NeuroD may be selected instead. Furthermore, one or more of the the transcription factors Ptfla, Ngn3 and NeuroD may be selected, such as Ptfla and Ngn3; or Ngn3 and NeuroD; or Ptfla, and NeuroD; or Ptfla, Ngn3 and NeuroD. As exemplified by the latter embodiment, it is understood that thymic cells may be provided in accordance with the invention with one or more lineage defining transcription factors, i.e. each cells may express the one or more lineage defining transcription factors. It is also understood that thymic cells may be provided separately with the one or more lineage defining transcription factors, i.e. one or more thymic cells may have one lineage defining transcription factor, and one or more other thymic cells may another lineage defining transcription factor. The latter embodiment meaning that one or more different mimetic thymic cells are provided. Either way, engineered mimetic thymic cells are provided that can be well capable of sufficiently educating the immune system.

[0085] In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with the invention is provided, wherein the nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence is comprised in a vector, such as a viral vector, preferably a lentiviral vector. As shown in the examples herein, having the nucleic acid nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence comprised in a suitable lentiviral vector may in particular be advantageous as such a gene delivery vehicle allows for efficient transfer to thymic cells, including mTEC. It is understood that one or two (or more) lentiviral vectors may be used to comprise the AIRE encoding sequence and the (one or more) lineage defining transcription factor encoding sequence. The lentiviral vector design as described in the example section may be a suitable design, but other engineered lentiviral vector constructs may be contemplated. Preferred are any means of transfer vehicle comprising means that allow for integration of the nucleic acid(s). Lentiviral vectors are preferred because these allow for integration into non-dividing cells. In the examples as shown herein, reporter genes were included, which are highly preferably to be excluded in case of a medical use, as no such reporter gene would be required.

[0086] In any case, the above list of autoimmune diseases and corresponding (putative) self-antigens is understood to be non-limiting. In case a subject is suffering from an autoimmune disease, such as one of the autoimmune diseases as listed above, such a subject may advantageously be treated in accordance with the invention as outlined herein. For example, the one or more antigens that are implicated in an autoimmune disease of a subject, may be identified as part of the diagnosis (e.g. autoantibodies are detected or reactive T-cell clones are identified). Such antigen(s) may thus be used in a medical treatment in accordance with the invention as outlined herein, such that in the subject tolerance, at least in part, against the antigen(s) can be induced which may be advantageous to the subject, i.e. the condition of the subject is at least improved.

[0087] It is thus also understood that, in addition to the methods as outline above for the manufacturing of one or more vectors in accordance with the invention, such methods of manufacturing can also include the selection of an antigen. Such a selection of an antigen may be instigated by diagnosing a subject, e.g. with an autoimmune disease and / or by detecting an immune response against an antigen, e.g. an autoantigen, upon which diagnosis and / or detection of an immune response against an antigen allows for the selection of an antigen. Of course, this may also include one or more antigens as outlined herein. As is understood in accordance with the invention, AIRE encoding sequence and antigen sequence (including one or more antigen sequences) are preferably provided in a single construct, but may also be separately provided. Such may be advantageous as e.g. one (lentiviral) vector may be dedicated for AIRE expression, while the other for antigen sequence(s).

[0088] Auto immune diseases such as auto-immune thyroiditis or Graves’ disease, which has the TSH receptor as a sole auto-antigen implicated, and Hashimoto’s thyroiditis, which has thyroid peroxidase as sole antigen implicated, may be highly useful and eligible for a medical treatment in accordance with the invention, with the use of nucleic acids and / or thymus tissue as outlined herein.

[0089] In one particular embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with the invention is provided, wherein the autoimmune disease is diabetes type 1. In a further embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with the invention is provided, wherein the autoimmune disease is diabetes type 1 , and the antigen is selected from the group of ChgA, proinsulin, glutamic decarboxylase 65 (GAD65), IA- 2, glucose-6-phosphatase, catalytic subunit 2 (G6PC2); formerly islet-specific glucose-6-phosphatase catalytic subunit-related protein (IGRP), and zinc transporter 8 (ZnT8).

[0090] For the treatment of the autoimmune disease diabetes type 1 , the antigen may preferably be proinsulin. As shown in the example herein, in particular useful may be to provide a nucleic acid encoding insulin as the antigen in accordance with the invention. Preproinsulin is initially synthesized in the cell as inactive precursor molecule. This preproinsulin is directly translated into the rough ER, where the signal peptide is removed to provide for proinsulin. The proinsulin subsequently folds and is transferred through the Golgi apparatus to be packaged into specialized secretory vesicles. In these vesicles, the proinsulin is further cleaved and the middle part (the C-peptide) is removed, leaving the insulin A- and B- chains, which are connected via two disulfide bonds. The resulting mature insulin is finally packaged into mature granules which upon metabolic signalling are exocytosed from the cell into the circulation. The nucleic acid in accordance with the invention which encodes insulin highly preferably encodes preproinsulin. Mice have two insulin genes, Ins1 and Ins2, which encode two distinct proteins, differing in two amino acids. Insulin 2 is primarily expressed within the thymus (and also in the pancreas), whereas insulin 1 is expressed in the pancreas, and Ins2 expression in mice leads to T cell tolerance to an epitope shared between ins1 and ins2 (Emil llnanue, Annu. Rev. Immunol. 2014.32:579-608). As shown in the examples, Insulin as encoded by Genbank references NM_001185084.1 and NP_001172013.1 (representing respectively mRNA and its corresponding amino acid sequence) is a suitable insulin 2 encoding sequence from mouse. Likewise, similarly suitable mouse insulin 2 sequences are NM_008387.5 and NP_032413.1 , and, NM_001185083.2 and NP_001172012.1 . Suitable human insulin sequences in accordance with the invention may be provided by Genbank references NM_001291897.2, NM_001185098.2, NM_001185097.2, and NM_000207.3, which provide for human mRNA sequences encoding preproinsulin, and Genbank references NP_001278826.1, NP_001172027.1 , NP_001172026.1 , NP_000198.1 , which provide for human preproinsulin sequences. The skilled person is well capable of selecting an appropriate insulin sequence for type 1 Diabetes, for use in means and methods in accordance with the invention. In addition to auto immune disorders, further diseases which subjects have, or may be at risk for, may also be advantageously benefit from the means and methods as described herein. For example, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with the invention may be provided, wherein the antigen is an antigen involved in an allergy. Allergies, for which immune tolerance may be advantageously be induced, include, for example peanut allergy, bee or wasp allergy, sesame allergy, hay fever. In any case, an allergen, or one or more allergens associated with an allergy may be expressed as an antigen in accordance with the invention, in the means and methods in accordance with the invention as described herein, in order to provide for immune tolerance in a subject having an allergy, or being at risk thereof. As is understood in the art, allergies are indications that relate to an undesired immune response against an allergen, e.g. in case of a food allergy. Intolerances are diseases which can cause some of the same signs and symptoms as an allergy, but do not involve an undesired immune response. Intolerances, such as food intolerances against certain food components in general involve enzyme deficiencies, and are not allergies. It is understood that immune tolerance that can be induced against an antigen, e.g. an allergen, in accordance with the invention, does not relate to (food) intolerances.

[0091] Further uses for the means and methods for the medical treatments as described herein include proteins for use in protein replacement therapies, wherein the protein is expressed as an antigen for which tolerance is to be induced in accordance with the invention. Patients to which such proteins are administered may be at risk of developing, or may have developed, undesired immune responses against such proteins, and may benefit from immune tolerance against such proteins. Likewise, proteins, which are expressed upon treatment with gene therapy, may benefit from such induced tolerance as well. Such expressed proteins may be proteins that are typically used e.g. in protein replacement therapies. Such proteins may also be engineered. Providing immune tolerance to a subject to expressed proteins upon gene therapy treatment may provide for a (more) durable gene therapy. Moreover, this may also allow for durable gene therapies for subjects which do not have any expression of the corresponding endogenous (dysfunctional) protein and which as a consequence thereof, may at present not be a candidate for a gene therapy for that protein because the expressed protein upon the gene therapy treatment will be recognized by the subject as foreign from an immunological perspective.

[0092] In addition, gene therapy vehicles, and protein components thereof, may also represent antigens for which it may be advantageous to induce tolerance to in a subject. Gene therapy vehicles can include e.g. parvoviral capsids. Antigens against which tolerance may be advantageously be induced may include thus parvoviral capsid protein, such as from AAV, or engineered variants thereof. Subjects may not be eligible for a gene therapy treatment because of pre-existing immunity against a particular capsid used in the treatment. Such pre-existing immunity can be originating either from natural immunity or from earlier (gene therapy) treatment with engineered parvoviruses. Such subjects may benefit from immune tolerance against such (engineered) parvovirus capsids as such may allow (repeated) administration of the parvoviral based gene therapy vectors. Accordingly, the present invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence (or one or more antigens), or thymus tissue, for use in a medical treatment in accordance with the invention, wherein the antigen is an exogenous protein for use in a medical treatment, such as administered to a subject in protein replacement therapy and / or as expressed in a subject upon gene therapy.

[0093] In any case, any antigen against which a subject may develop, or is at risk of developing, undesired immunity, such an antigen, or part thereof, may be contemplated in accordance with the invention, and may be used in means and methods, and medical uses, as described herein.

[0094] In another embodiment, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with the invention is provided, wherein the nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence is comprised in a vector, such as a viral vector, preferably a lentiviral vector. As shown in the examples herein, having the nucleic acid nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence comprised in a suitable lentiviral vector may in particular be advantageous as such a gene delivery vehicle allows for efficient transfer to thymic cells, including mTEC. It is understood that one or two (or more) lentiviral vectors may be used to comprise the AIRE encoding sequence and the (one or more) antigen encoding sequence. The lentiviral vector design as described in the example section may be a suitable design, but other engineered lentiviral vector constructs may be contemplated. Preferred are any means of transfer vehicle comprising means that allow for integration of the nucleic acid(s).

[0095] It is understood that wherein herein reference is made to a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, per se, or for use in a medical treatment as contemplated herein, this is understood to relate to nucleic acid constructs, i.e. engineered and / or man-made nucleic acids, such as vectors. Hence, wherein herein reference is made to a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, instead, this can be understood to refer to one or more vectors comprising a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence. Likewise, wherein herein reference is made to a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor, instead, this can be understood to refer to one or more vectors comprising a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor.

[0096] Moreover, in another embodiment, the present invention furthermore provides for a method for manufacturing one or more vectors comprising an AIRE sequence and / or a nucleic acid encoding an antigen sequence, comprising the steps of:

[0097] Providing a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence;

[0098] Providing a vector;

[0099] Inserting the nucleic acid encoding an AIRE sequence and / or the nucleic acid encoding an antigen sequence in the vector to therewith provide for a vector encoding an AIRE sequence and / or an antigen sequence.

[0100] In another embodiment, the present invention provides for a method for manufacturing a vector comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, comprising the steps of:

[0101] Providing a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence;

[0102] Providing a vector;

[0103] Inserting the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence in the vector to therewith provide for a vector encoding an AIRE sequence and / or a nucleic acid sequence.

[0104] Also, in another embodiment, the present invention furthermore provides for a method for manufacturing one or more vectors comprising an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor, comprising the steps of:

[0105] Providing a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor Providing a vector;

[0106] Inserting the nucleic acid encoding an AIRE sequence and / or the nucleic acid encoding a lineage defining transcription factor in the vector to therewith provide for a vector encoding an AIRE sequence and / or a lineage defining transcription factor.

[0107] In another embodiment, the present invention provides for a method for manufacturing a vector comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, comprising the steps of:

[0108] Providing a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence; Providing a vector;

[0109] Inserting the nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence in the vector to therewith provide for a vector encoding an AIRE sequence and / or a lineage defining transcription factor sequence.

[0110] It is understood that the sequences may be inserted using standard recombinant nucleic acid technology known in the art. It is understood that further steps can include manufacturing of the vector. For example in case the vector that is to be produced encodes a lentiviral vector genome, such as outlined in the examples herein. Hence, in another embodiment, the invention provides for a method for manufacturing a viral vector comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, in accordance with the invention, comprising the steps of:

[0111] Providing a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence;

[0112] Providing a transfer plasmid encoding a viral vector genome;

[0113] Inserting the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence in the viral vector genome sequence to therewith provide a transfer plasmid encoding a viral vector genome which viral vector genome is constructed such that it is capable of expressing AIRE and antigen protein;

[0114] - transferring the transfer plasmid to a cell, which comprises the viral vector genome replication and / or packaging components, to allow for manufacturing of the viral vector.

[0115] Further, in another embodiment, the invention provides for a method for manufacturing a viral vector comprising an AIRE sequence and a nucleic acid encoding an lineage defining transcription factor, in accordance with the invention, comprising the steps of:

[0116] Providing a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an a lineage defining transcription factor sequence;

[0117] Providing a transfer plasmid encoding a viral vector genome;

[0118] Inserting the nucleic acid encoding an AIRE sequence and the nucleic acid encoding lineage defining transcription factor seqence in the viral vector genome sequence to therewith provide a transfer plasmid encoding a viral vector genome which viral vector genome is constructed such that it is capable of expressing AIRE and a lineage defining transcription factor; transferring the transfer plasmid to a cell, which comprises the viral vector genome replication and / or packaging components, to allow for manufacturing of the viral vector.

[0119] It is understood that a preferred viral vector is a lentiviral vector, for which means and methods, including suitable transfer plasmids encoding lentiviral vector genomes, are known in the art and widely available.

[0120] Lentiviral vectors are preferred because these allow for integration into nondividing cells. In the examples as shown herein, reporter genes were included, which are highly preferably to be excluded in case of a medical use, as no such reporter gene would be required.

[0121] With regard to construct design for expression of AIRE and / or the antigen, or for expression of AIRE and / or the lineage defining transcription factor, it is preferred to have a non-viral promoter, more preferably a non-viral mammalian promoter. Expression preferably is constitutive. Such promoters may be preferred because promoters that induce high expression, such as virus or virus derived promoters, may be associated with undesirable effects, such as leukemia or the like. Having an endogenous promoter, or functional equivalent thereof, may be preferred, moreover because such promoters may be less prone to silencing. Hence, promoters such as the PGK, EF1 alpha or EFS promoter may be preferred. For human use, the human PGK, human EF1 alpha or human EFS promoter may be preferred. In general, the construct design is such that the size of the expression construct is not too large, e.g. at most about 12 kb. Such a size allows to incorporate it in a lentiviral vector genome, while allowing for efficient manufacturing of vector. It is preferred to minimize the expression construct as much as possible to optimise integration and expression, hence, transcription regulatory elements may be preferably selected that are small in size. Hence, the human EFS promoter may be highly preferred because it is a small in size, and regulatory elements such as T2A or P2A, which allow for expression of separate proteins from a single transcript, may be preferred as these are efficient and relatively smaller, as opposed to generally larger elements such as an internal ribosomal entry site (IRES) or the like.

[0122] With regard to the nucleic acid sequences encoding AIRE, or the like, it is understood that these can be codon optimized, which can be preferred if one wishes to increase expression levels, though both a codon optimized AIRE nucleic acid sequence or native nucleic acid sequence may be contemplated. With regard to the nucleic acid sequences encoding the lineage defining transcription factor, it is understood that these can be codon optimized, which can be preferred if one wishes to increase expression levels, though both a codon optimized lineage defining transcription factor nucleic acid sequence or native nucleic acid sequence may be contemplated.

[0123] In another aspect, a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding i) an antigen sequence or ii) a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment is provided in accordance with the invention, wherein the thymus tissue is implanted to the subject. As outlined herein, the medical use preferably comprises implantation of thymus tissue in subjects, which may include implantation such as outlined herein in the example section. Any particular suitable location or route of administration may suffice, and it is highly preferably to select a location which is accessible and allows for a procedure that is not too invasive and which allows for vascularisation of the implanted thymic tissue. This includes implantation into striated muscle bundles, such as for example in the thigh of a subject, for example in the quadriceps muscle.

[0124] Subjects that are in particular eligible for the medical treatment as outlined herein are human subjects. It is understood that when human subjects are selected for treatment, highly preferable, a human AIRE protein is selected for the treatment, and, in case tolerance against one or more antigens endogenous to the human to be treated is to be induced, such (one or more) antigens are highly preferable to be human protein as well. Likewise, in case tolerance against one or more lineages of cells is to be induced, one or more lineage defining transcription factors endogenous to the human to be treated, such (one or more) lineage defining transcription factors may be preferred as well. Furthermore eligible for treatment may be non-human animals, and likewise, AIRE protein endogenous to such animals are preferred and / or i) antigens or ii) lineage defining transcription factors endogenous to the non-human animal are highly preferable to be endogenous to such animals as well. Suitable non-human animals include i.a. domestic animals, such as cats, dogs, horses, and camels, or any other kind of domesticated animal which may benefit from the means and methods in accordance with the invention e.g. once identified as being at risk of auto-immune diseases, or suffering from an auto-immune disease, or the like. For example, domestic animals, such as dogs and cats, can suffer as well from type 1 diabetes, hence are eligible for the means and methods as outlined herein, in particular when being at risk of or being diagnosed with diabetes type 1. Hence in another embodiment, the present in invention provides for a nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding i) an antigen sequence or ii) a lineage defining transcription factor, or thymus tissue, for use in a medical treatment as described herein, wherein the subject to be treated is a human or a non-human animal.

[0125] As outlined herein, the present invention hence provides for a combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence or an lineage defining transcription factor sequence, wherein the nucleic acid encoding an AIRE sequence and the nucleic acid encoding either an antigen sequence or an lineage defining transcription factor sequence are comprised in separate vectors or in a single vector. It is understood that the nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence or an lineage defining transcription factor sequence, are preferably comprised in one or more nucleic acid constructs, such as one or more expression constructs. Furthermore, in a preferred embodiment, the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence or an lineage defining transcription factor sequence in accordance with the invention, comprised in separate vectors are lentiviral vectors or when comprised in a single vector, is a lentiviral vector. Moreover, in the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence or an lineage defining transcription factor sequence in accordance with the invention as provided herein, preferably the AIRE sequence and either the antigen sequence or the lineage defining transcription factor sequence are constitutively expressed. Suitable constitutive promoters are known in the art, and may be selected from PGK, EFS, EF1- alpha, CMV, SV40, MND, CAG which are suitable for mammalian gene expression, such as in non-human animals and in humans. The EFS promoter (i.e. EF-1 Alpha short promoter, which is used to drive both AIRE and antigen expression in the examples herein, may be preferred. Moreover, an inducible promoter can be contemplated, as such may allow for control of expression. In addition, the AIRE and antigen encoding sequences may be comprised in a single expression cassette, such that a single expressed transcript provides for AIRE and either antigen or lineage defining transcription factor. Such can e.g. be obtained by separating the AIRE coding sequence and antigen or lineage defining transcription factor coding sequence by an IRES (internal ribosome entry site) or sequences that induce ribosome skipping, such as 2A peptides, of which T2A or P2A may be preferred. Furthermore, the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence or an lineage defining transcription factor sequence provided herein, has the nucleic acids encoding an AIRE sequence and / or antigen or lineage defining transcription factor sequence codon optimized. It is understood that codon optimization is well known in the art and various means and methods to do that are available to the skilled person. Instead of utilizing a codon sequence comprised in an endogenous nucleic acid sequence, alternative codons may be selected, resulting in the same amino acid sequence. Codon optimization is a process that can be used by the skilled person to improve gene expression and increase translational efficiency of an expressed transgene by accommodating codon bias of the host organism.

[0126] Preferably, as outlined herein, the present invention provides for a combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence, wherein the AIRE sequence and / or antigen sequence is human. Likewise, the present invention provides for a combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, wherein the AIRE sequence and / or lineage defining transcription factor sequence is human. In one embodiment, the AIRE sequence corresponds with a human AIRE amino acid sequence, preferably a human AIRE sequence encoded by NP_000374.1. Furthermore is provided a combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with the invention, wherein the nucleic acid encoding an antigen sequence, encodes an antigen as defined herein above. In a particular embodiment, said combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence that is provided in accordance with the invention, comprises a nucleic acid encoding an antigen sequence which encodes insulin. Preferably, said combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with the invention, comprises an insulin sequence, which is a human insulin amino acid sequence, preferably a human insulin amino acid sequence as encoded by AH002844.2. In one particular embodiment, the AIRE sequence corresponds with a human AIRE amino acid sequence, preferably a human AIRE sequence encoded by NP_000374.1 , and the insulin sequence is a human insulin amino acid sequence, preferably a human insulin amino acid sequence encoded by AH002844.2. Likewise, furthermore is provided a combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with the invention, wherein the nucleic acid encoding a lineage defining transcription factor sequence, encodes a lineage defining transcription factor as defined herein above. In a particular embodiment, said combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence that is provided in accordance with the invention, comprises a nucleic acid encoding a lineage defining transcription factor sequence which encodes PDX-1. Preferably, said combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with the invention, comprises an PDX-1 sequence, which is a human PDX-1 amino acid sequence, preferably a human PDX-1 amino acid sequence as encoded by NM_000209.4. In one particular embodiment, the AIRE sequence corresponds with a human AIRE amino acid sequence, preferably a human AIRE sequence encoded by NP_000374.1 , and the PDX-1 sequence is a human PDX-1 amino acid sequence, preferably a human PDX-1 amino acid sequence encoded by NM_000209.4. The present invention furthermore provides, as outlined herein, nucleic acids encoding an AIRE sequence as defined herein, as such may be highly useful in itself.

[0127] In yet further embodiments in accordance with the invention, methods are provided in accordance with the invention for providing thymus tissue comprising an AIRE sequence and a nucleic acid encoding an antigen sequence. Likewise, in further embodiments in accordance with the invention, methods are provided in accordance with the invention for providing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence. It is understood that in accordance with the invention, one or more nucleic acids encoding one or more antigen sequences may be contemplated, dependent on the tolerance that is to be induced in a subject. It is also understood that one or more nucleic acids encoding one or more lineage defining transcription factor sequences may be contemplated, dependent on the tolerance that is to be induced in a subject, e.g. in case one or more lineage defining transcription factors are required for a particular lineage and / or in case one or more lineage defining transcription factors are required for one or more different types of cells, i.e. different lineages. In one embodiment, a method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, as defined herein is provided, wherein the method comprises the steps of: providing thymus tissue, by providing a biopsy of a thymus obtained from a subject; or, providing pluripotent stem cells of a subject and inducing the pluripotent stem cells to develop into thymus tissue to therewith provide thymus tissue; provide a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence; transfer the provided nucleic acid(s) to the cells of the thymus tissue.

[0128] In a further embodiment, the method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, in accordance with the invention, comprises the further steps of:

[0129] - preparing a single cell suspension of the provided thymus tissue, prior to the transfer of the provided nucleic acid(s); and

[0130] - reaggregating the cells of the thymus tissue, after the transfer of the provided nucleic acid(s) to the cells of the thymus tissue.

[0131] In another embodiment, a method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, as defined herein is provided, wherein the method comprises the steps of: providing thymus tissue, by providing a biopsy of a thymus obtained from a subject; or, providing pluripotent stem cells of a subject and inducing the pluripotent stem cells to develop into thymus tissue to therewith provide thymus tissue; provide a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence; transfer the provided nucleic acid(s) to the cells of the thymus tissue.

[0132] In yet a further embodiment, the method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, in accordance with the invention, comprises the further steps of:

[0133] - preparing a single cell suspension of the provided thymus tissue, prior to the transfer of the provided nucleic acid(s); and

[0134] - reaggregating the cells of the thymus tissue, after the transfer of the provided nucleic acid(s) to the cells of the thymus tissue.

[0135] It is understood that the single cell suspension highly preferably comprises TEC cells. TEC cells typically include cortical and medullary thymic epithelial cells. As it may be preferred to have expression in medullary thymic epithelial cells, it may be contemplated to isolate these cells, and perform the transfer of the provided nucleic acid(s) to the cells of the mTEC separately, and subsequently, perform any suitable reaggregation method with all the necessary components to provide for thymus tissue with an appropriate structure. Of course, it may be contemplated not to prepare a single cell suspension, and simply homogenize or otherwise suspend provided thymus tissue or the like, but having a single cell suspension is advantageous for the next step of aggregation and / or may aid in transfer of the provided nucleic acids, e.g. via lentiviral vector(s).

[0136] Once the thymus tissue is prepared, it may be preferred to encapsulate the tissue, prior to implantation, as such may be advantageous as it may allow to keep the genetically modified tissue physically contained, which allows to keep it separate from the tissue of the subject and / or allows for ease of manipulation, e.g. when implanting the thymus tissue in the subject. Moreover, in case of any suspicion of any adverse effects, having the engineered thymus tissue separate may allow to (substantially) remove implanted tissue. Of course, such a container must allow for lymphocyte progenitor cells to migrate into the thymus tissue, migrate from cortex to the medulla, upon which lymphocytes mature and egress into the periphery. Hence, in one embodiment, the method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, in accordance with the invention, further comprises the step of encapsulating the prepared thymic tissue, preferably in a siliconized polyethylene tube. Likewise, in one embodiment, the method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor, in accordance with the invention, further comprises the step of encapsulating the prepared thymic tissue, preferably in a siliconized polyethylene tube.

[0137] The present invention thus provides for thymus tissue, comprising the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding either an antigen sequence, as obtained with a method comprising the steps as outlined above. The thymus tissue thus obtained, is, as outlined herein for use in a medical treatment, such as all the medical treatments as described herein in accordance with the invention. Furthermore, the invention provides for non-human animals, comprising engineered thymus tissue, comprising the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence (or one or more antigen sequences) as defined herein, and / or thymus tissue as obtained with the method as described. Likewise, the present invention provides for thymus tissue, comprising the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, as obtained with a method comprising the steps as outlined above. Such thymus tissue obtained, may be referred to, or comprising, engineered thymic mimetic cells. The thymus tissue thus obtained, is, as outlined herein for use in a medical treatment, such as all the medical treatments as described herein in accordance with the invention. Furthermore, the invention provides for non-human animals, comprising engineered thymus tissue, comprising the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence (or one or more lineage defining transcription factor sequences) as defined herein, and / or thymus tissue as obtained with the method as described.

[0138] Embodiments

[0139] 1. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence, for use in medical treatment.

[0140] 2. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence.

[0141] 3. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with any of embodiments 1-3, wherein in the medical treatment, thymus tissue is provided, and the thymus tissue cells are provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding an antigen sequence.

[0142] 4. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen, for use in a medical treatment in accordance with embodiments 4, wherein the thymus tissue is derived from a thymus biopsy or from pluripotent stem cells.

[0143] 5. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with any of embodiments 4-5, herein the thymus tissue is derived from induced pluripotent stem cells (iPSCs). A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with any of embodiments 1-5, wherein the antigen sequence, when expressed in a cell, is processed by the cell to provide for MHC molecules presenting one or more peptide fragments derived from the expressed antigen sequence. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, for use in a medical treatment in accordance with embodiment 6, wherein the one or more peptide fragments are one or more T- cell epitopes. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-7, wherein in the thymus tissue, the antigen and AIRE is expressed in medullary thymic epithelial cells (mTECs). The thymus tissue, as defined in any of embodiments 4-8, provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding an antigen sequence for use in a medical treatment. The nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence of any of embodiments 1-7, or the thymus tissue of embodiment 9, for use in a medical treatment in accordance with any of embodiments 4-9, wherein the medical treatment comprises administering the thymus tissue provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding an antigen sequence to a subject. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 10, wherein the thymus tissue is autologous thymus tissue. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-11 , wherein the medical treatment is for inducing immune tolerance for the antigen in the subject.

[0144] 13. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-12, wherein the antigen is an antigen involved in an autoimmune disease.

[0145] 14. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 13, wherein the autoimmune disease is selected from diabetes type 1 , coeliac disease, rheumatoid arthritis, multiple sclerosis, SLE and psoriasis.

[0146] 15. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 13, wherein the autoimmune disease is diabetes type 1 , and the antigen is selected from the group of ChgA, proinsulin, glutamic decarboxylase 65 (GAD65), IA-2, glucose-6-phosphatase, catalytic subunit 2 (G6PC2); formerly islet-specific glucose-6-phosphatase catalytic subunit- related protein (IGRP), and zinc transporter 8 (ZnT8) .

[0147] 16. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 13, wherein the autoimmune disease is diabetes type 1 , and the antigen is proinsulin.

[0148] 17. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-12, wherein the antigen is an antigen involved in an allergy.

[0149] 18. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-12, wherein the antigen is an exogenous protein for use in a medical treatment, such as administered to a subject in protein replacement therapy and / or as expressed in a subject upon gene therapy.

[0150] 19. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-19, wherein the nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence is comprised in a vector, such as a viral vector, preferably a lentiviral vector.

[0151] 20. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-19, wherein the thymus tissue is implanted to the subject.

[0152] 21. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 1-20, wherein the subject is a human or a non-human animal.

[0153] 22. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence, wherein the nucleic acid encoding an AIRE sequence and the nucleic acid encoding an antigen sequence are comprised in separate vectors or in a single vector.

[0154] 23. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with embodiment 22, wherein the separate vectors are lentiviral vectors or the single vector is a lentiviral vector.

[0155] 24. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with embodiment 22 or 23, wherein the AIRE sequence and antigen sequence are constitutively expressed. 25. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with any of embodiments 22-24, wherein the nucleic acids encoding an AIRE sequence and / or antigen sequence is not codon optimized.

[0156] 26. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with any of embodiments 22-25, wherein the AIRE sequence and / or antigen sequence is human.

[0157] 27. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with any of embodiments 22-26, wherein the AIRE amino acid sequence corresponds with a human AIRE amino acid sequence, preferably a human AIRE sequence encoded by NP_000374.1

[0158] 28. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with any of embodiments 22-27, wherein the nucleic acid encoding an antigen sequence, encodes an antigen as defined in any of embodiments 13-17.

[0159] 29. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with any of embodiments 22-28, wherein the nucleic acid encoding an antigen sequence encodes insulin.

[0160] 30. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence in accordance with embodiment 22-28, wherein the insulin sequence is a human insulin amino acid sequence, preferably a human insulin amino acid sequence selected from one of NP_001278826.1 , NP_001172027.1 , NP_001172026.1 , NP_000198.1.

[0161] 31. A nucleic acid encoding an AIRE sequence as defined in any of embodiments 1-31.

[0162] 32. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding an antigen sequence in accordance with any of embodiments 22-31 , for use in a medical treatment in accordance with any of embodiments 1-21. 33. Method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, as defined by any of embodiments 4-30, comprising the steps of: providing thymus tissue, by providing a biopsy of a thymus obtained from a subject; or, providing pluripotent stem cells of a subject and inducing the pluripotent stem cells to develop into thymus tissue to therewith provide thymus tissue; provide a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence; transfer the provided nucleic acid(s) to the cells of the thymus tissue.

[0163] 34. The method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding an antigen sequence, in accordance with embodiment 33, comprising the further steps of:

[0164] - preparing a single cell suspension of the provided thymus tissue, prior to the transfer of the provided nucleic acid(s); and

[0165] - reaggregating the cells of the thymus tissue, after the transfer of the provided nucleic acid(s) to the cells of the thymus tissue.

[0166] 35. Thymus tissue, comprising the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an antigen sequence, as obtained with the method in accordance with any of embodiments 33-34.

[0167] 36. The thymus tissue, in accordance with embodiment 35, for use in a medical treatment.

[0168] 37. The thymus tissue, in accordance with embodiment 36, wherein the medical treatment is as defined in any of embodiments 4-21 .

[0169] 38. A non-human animal comprising thymus tissue as defined by embodiment 35. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment, wherein the medical treatment comprises the use of a combination of the nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with embodiment 39 or embodiment 40, wherein in the medical treatment, thymus tissue is provided, and the thymus tissue cells are provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with embodiment 41 , wherein the thymus tissue is derived from a thymus biopsy or from pluripotent stem cells. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with embodiment 41 or embodiment 42, herein the thymus tissue is derived from induced pluripotent stem cells (iPSCs). A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of embodiments 39-43, wherein the lineage defining transcription factor induces expression of proteins corresponding with a peripheral phenotype. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of embodiments 41-44, wherein the lineage defining transcription factor sequence, when expressed in a thymus cell, induces expression of proteins associated with a peripheral phenotype, which induced expressed proteins are processed by the cell to provide for MHC molecules presenting one or more peptide fragments derived therefrom. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with embodiment 45, wherein the one or more peptide fragments are one or more T-cell epitopes. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of embodiments 39-46, wherein the lineage defining transcription factor is expressed in a thymus cell, which preferably is a medullary thymic epithelial cell. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of embodiments 39-47, wherein the lineage defining transcription factor is expressed in a thymus cell, therewith providing for mimetic cells. The thymus tissue, as defined in any of embodiments 41-48, provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment. The nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence of any of embodiments 39-48, or the thymus tissue of embodiment 49, for use in a medical treatment in accordance with any of embodiments 41-49, wherein the medical treatment comprises administering the thymus tissue provided with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence to a subject. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 50, wherein the thymus tissue is autologous thymus tissue. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 39-51 , wherein the treatment is for inducing immune tolerance in the subject. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 39-52, wherein immune tolerance is induced against the peripheral cells associated with the lineage defining transcription factor. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 39-52, wherein the treatment is of an autoimmune disease. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 54, wherein the autoimmune disease is diabetes type 1. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 52-55, wherein the autoimmune disease is diabetes type 1 , and the peripheral cells are pancreatic cells and / or the lineage defining transcription factor is PDX1. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with embodiment 52-54, wherein the lineage defining transcription factor is selected from the group as listed in Table 1.

[0170] 58. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 39-57, wherein the thymus tissue is implanted to the subject.

[0171] 59. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence, or thymus tissue, for use in a medical treatment in accordance with any of embodiments 39-58, wherein the subject is a human or a non-human animal.

[0172] 60. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, wherein the nucleic acid encoding an AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence are comprised in separate vectors or in a single vector.

[0173] 61 . A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with embodiment 60, wherein the separate vectors are lentiviral vectors or the single vector is a lentiviral vector.

[0174] 62. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with embodiment 60 or 61 , wherein the AIRE sequence and lineage defining transcription factor sequence are constitutively expressed.

[0175] 63. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of embodiments 60-62, wherein the nucleic acids encoding an AIRE sequence and / or lineage defining transcription factor sequence is codon optimized. 64. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of embodiments 60-63, wherein the AIRE sequence and / or lineage defining transcription factor sequence is human.

[0176] 65. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of embodiments 60-64, wherein the AIRE amino acid sequence is as encoded by NP_000374.1.

[0177] 66. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of embodiments 60-65, wherein the nucleic acid encoding a lineage defining transcription factor sequence, encodes a lineage defining transcription factor as defined in embodiment 57.

[0178] 67. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of embodiments 60-65, wherein the nucleic acid encoding a lineage defining transcription factor encodes PDX1.

[0179] 68. A combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with embodiment 67, herein the PDX1 sequence is a human PDX-1 amino acid sequence encoded by NM_000209.4.

[0180] 69. A nucleic acid encoding an AIRE sequence as defined in any of embodiments 39-68.

[0181] 70. A nucleic acid encoding an AIRE sequence and / or a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of embodiments 60-69, for use in a medical treatment in accordance with any of embodiments 39-59. Method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, as defined by any of embodiments 42-67, comprising the steps of: providing thymus tissue, by providing a biopsy of a thymus obtained from a subject; or, providing pluripotent stem cells of a subject and inducing the pluripotent stem cells to develop into thymus tissue to therewith provide thymus tissue; provide a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence; transfer the provided nucleic acid(s) to the cells of the thymus tissue. The method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, in accordance with embodiment 71 , comprising the further steps of: preparing a single cell suspension of the provided thymus tissue, prior to the transfer of the provided nucleic acid(s); and reaggregating the cells of the thymus tissue, after the transfer of the provided nucleic acid(s) to the cells of the thymus tissue. The method in accordance with any of embodiments 71-72, wherein the a nucleic acid encoding a lineage defining transcription factor sequence is selected from the group listed in Table 1. Thymus tissue, comprising the combination of a nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, as obtained with the method in accordance with any of embodiments 71-73. The thymus tissue, in accordance with embodiment 74, for use in a medical treatment. The thymus tissue, in accordance with embodiment 75, wherein the medical treatment is as defined in any of embodiments 42-59. A non-human animal comprising thymus tissue as defined by embodiment 74. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding a lineage-defining transcription factor, for use in a medical treatment, wherein the lineage-defining transcription factor is selected to induce expression of tissue-restricted antigens representative of a peripheral tissue or organ. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding a lineage-defining transcription factor and a nucleic acid encoding AIRE, for use in a medical treatment, wherein the co-expression of the lineage-defining transcription factor and AIRE induces the expression and presentation of tissue-restricted antigens and promotes the development of FOXP3-positive regulatory T cells. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding PDX1 and a nucleic acid encoding AIRE, for use in a medical treatment, wherein the engineered tissue or cells are capable of inducing immune tolerance to pancreatic antigens, including insulin, and promote the emergence of FOXP3-positive regulatory T cells. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding HNF4G and a nucleic acid encoding AIRE, for use in a medical treatment, wherein the engineered tissue or cells are capable of inducing immune tolerance to liver- or gut-specific antigens by upregulating the expression of genes such as Muc13, Apob, and Tkfc. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding a lineage-defining transcription factor, for use in a medical treatment, wherein the engineered tissue or cells are characterised by the upregulation of one or more genes associated with the peripheral tissue defined by the transcription factor, as determined by gene expression analysis. 83. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding PDX1 and a nucleic acid encoding AIRE, for use in a medical treatment, wherein the engineered tissue or cells induce the expression of Neurog3, Trpm3, and Adgrgl , and promote the development of FOXP3-positive regulatory T cells.

[0182] 84. Thymic tissue or thymic epithelial cells engineered by transduction with a nucleic acid encoding HNF4G and a nucleic acid encoding AIRE, for use in a medical treatment, wherein the engineered tissue or cells induce the expression of Muc13, Apob, and Tkfc, and promote immune tolerance to hepatic or intestinal antigens.

[0183] 85. A method for preparing engineered thymic tissue or thymic epithelial cells, comprising the steps of: providing thymic tissue or thymic epithelial cells; transducing the tissue or cells with a nucleic acid encoding a lineage-defining transcription factor, optionally in combination with a nucleic acid encoding AIRE; and culturing the tissue or cells under conditions suitable for the expression of the introduced nucleic acids.

[0184] 86. The method according to embodiment 85, wherein the thymic tissue is fetal thymic tissue, and the transduction is performed ex vivo using a lentiviral vector encoding PDX1 and AIRE, followed by culture and analysis for the emergence of FOXP3-positive regulatory T cells.

[0185] 87. The method according to embodiment 85 or 86, wherein the engineered thymic tissue or thymic epithelial cells are characterised by the upregulation of tissue- restricted antigens and the induction of regulatory T cells, as determined by immunohistochemistry or gene expression analysis.

[0186] 88. Engineered thymic tissue or thymic epithelial cells obtainable by the method of any of embodiments 85-87.

[0187] 89. Engineered thymic tissue or thymic epithelial cells according to any of embodiments 78-81 or 88, for use in a medical treatment for the prevention or treatment of autoimmune disease, allergy, or for the induction of immune tolerance to a therapeutic protein or gene therapy product.

[0188] 90. Engineered thymic tissue or thymic epithelial cells according to any of embodiments 78-81 or 88, for use in a medical treatment, wherein the tissue or cells are derived from fetal thymic tissue, adult thymic tissue, or from pluripotent stem cells differentiated into thymic epithelial cells.

[0189] 91 . Engineered thymic tissue or thymic epithelial cells according to any of embodiments 78-81 or 88, for use in a medical treatment, wherein the tissue or cells are autologous to the subject to be treated.

[0190] 92. A non-human animal comprising engineered thymic tissue or thymic epithelial cells according to any of embodiments 78-81 or 88.

[0191] Examples

[0192] Example 1

[0193] In this example, 3rd generation self-inactivating (SIN) lentiviral vectors were produced to provide for AIRE and antigen (Ag) expressing vector(s). 3rdgeneration LV are a class of LV that are characterized by an RCL-deficient (replication competent lentivirus-deficient) backbone and are self-inactivating (SIN). The helper plasmids of 3rd generation lentiviral vectors are gag - pol, rev and env, and are widely commercially available. Gag-pol and rev are packaging plasmids, while env is the envelope plasmid. The vector containing the gene(s) of interest, in this example either AIRE and antigen, or AIRE and lineage defining transcription factor, and reporter genes, contained long terminal repeats (LTR) sequences that are self-inactivating on the 5’and 3’ends, i.e. resulting in LTR’s which after reverse transcription and integration, do not have promoter activity. The genes of interest, were separated by regulatory sequences, for instance T2A or P2A (Kim et al., PLOS ONE, 2011 , Vol. 6 Iss. 4, e18556) to allow for separate expression of separate proteins from a single transcript. These lentiviral vectors are exemplary gene constructs, comprised in lentiviral vectors, in accordance with the invention.

[0194] Materials

[0195] Lentivirus production Plasmids were designed as shown in Figure 2 and obtained from VectorBuilder. The nucleic acid construct, i.e. expression cassette, as depicted in Fig 2A was inserted in the lentiviral vector backbone, the transfer plasmid (as provided by Vector Builder, such is commonly (commercially) available, i.a. from Addgene) after the cPPT and before WPRE. For further plasmid production Stabl3 E.coli cells were used for transformation and QIAprep Spin Miniprep Kit (#27104), NucleoBond® Xtra Midi EF kit (#740420), EndoFree Plasmid Mega Kit (#12381) for plasmid isolation. Only plasmids isolated with Endotoxin free kits were used for virus production. Helper plasmids pMDLg / pRRE, pRSV-Rev, and pMD2.VSV-G were used for lentiviral production (Available from Addgene, plasmids #12251 , #12259, and #12253). HEK293T cells were transiently transfected with the transfer and helper plasmids using X-tremeGENE HP DNA transfection reagent (Sigma-Aldrich #6366236001). Supernatants with lentivirus particles were harvested 40h, and 64 h after transfection, filtered through 0,45 pm pore filters (Corning, Cat#431220). Pooled lentiviral supernatants were concentrated by centrifugation using Vivaspin 20 centrifugal concentrator columns (Sigma -Aldrich, #Z614653-48EA) according to the manufacturer’s instructions. 40-fold concentrated viral supernatant was aliquoted and frozen, to avoid multiple freeze / thaw cycles.

[0196] For the lentiviral vector constructs expression mouse AIRE, a codon optimized sequence was used, as listed below.

[0197] TTAATTAAATGGCAGGGGGAGATGGAATGCTTCGTAGACTGCTGCGCCTGCATAG AACAGAAATTGCAGTGGCCATCGACAGCGCCTTTCCCCTGCTGCACGCCTTGGC TGACCACGATGTTGTGCCCGAGGATAAATTCCAGGAGACTCTGAGGCTGAAGGA GAAGGAGGGCTGTCCACAGGCTTTCCACGCCCTGCTGAGCTGGCTCCTGACAAG AGATTCCGGGGCTATCCTGGACTTTTGGAGGATCCTGTTTAAAGACTACAACCTG GAGAGGTATAGCAGACTGCACAGTATCCTGGATGGATTCCCTAAAGACGTGGATC TGAACCAGAGCAGGAAAGGGCGAAAGCCCCTGGCCGGACCAAAGGCTGCCGTG CTGCCCCCTAGGCCTCCAACCAAGAGAAAAGCCCTGGAGGAACCCCGGGCAACA CCACCCGCTACTCTCGCCAGCAAGAGCGTGTCCAGCCCCGGCTCCCACCTGAAG ACCAAGCCTCCAAAGAAGCCCGATGGCAATCTGGAGTCTCAGCACCTGCCTCTC GGCAACGGAATTCAGACAATGGCCGCCTCAGTGCAAAGAGCTGTGACCGTGGCA TCCGGCGATGTCCCCGGCACAAGAGGAGCTGTGGAGGGTATCCTGATCCAGCAG GTGTTTGAATCTGGAAGATCCAAAAAGTGCATTCAGGTGGGTGGCGAATTCTACA CACCTAATAAGTTCGAGGACCCAAGCGGCAACCTGAAGAATAAGGCTAGAAGCG GCTCCAGCCTGAAGCCCGTGGTGCGGGCCAAGGGAGCCCAGGTGACCATCCCA GGCAGGGATGAGCAGAAGGTGGGCCAGCAGTGCGGCGTGCCACCCCTGCCTTC CCTGCCATCTGAGCCTCAGGTTAACCAGAAGAACGAGGACGAGTGCGCTGTATG TCATGATGGCGGCGAGCTGATTTGTTGCGACGGGTGTCCTAGAGCATTCCACCT GGCCTGTCTGTCTCCTCCCCTGCAGGAAATCCCTTCCGGACTGTGGCGGTGCAG CTGCTGTCTGCAGGGCAGAGTGCAGCAGAATCTGAGCCAGCCCGAGGTGAGCA GACCTCCCGAGCTGCCAGCCGAGACACCAATCCTGGTGGGCCTGAGGAGTGCTT CCGAGAAGACTAGAGGACCATCTCGGGAGCTGAAGGCTAGCAGTGACGCCGCA GTGACCTACGTGAATCTGCTGGCCCCTCACCCTGCTGCTCCACTCCTCGAGCCC TCAGCCCTGTGTCCTCTTCTGAGCGCCGGAAACGAGGGCCGCCCCGGGCCCGC TCCAAGCGCCCGGTGTAGCGTGTGCGGCGATGGAACTGAGGTGCTGAGATGTG CCCACTGTGCTGCTGCATTTCACTGGAGATGTCATTTTCCCACCGCTGCCGCCAG ACCTGGCACCAACCTGAGGTGCAAAAGTTGTTCCGCAGACAGTACCCCAACTCCT GGCACACCTGGCGAGGCAGTGCCTACATCTGGTCCTAGACCCGCCCCTGGGCT GGCTAAGGTGGGTGACGACTCCGCTTCTCACGACCCCGTCCTGCATCGCGACGA CCTGGAGAGTCTGCTCAACGAGCACAGCTTTGATGGCATTCTCCAGTGGGCCATT CAGAGCATGTCACGGCCACTGGCGGAGACTCCACCCTTCTCTTCTACCGGT (SEQ ID NO.1)

[0198] HEK-293T cells culture

[0199] HEK293T cells (ATCC, #CRL-3216) were cultured in IMDM (Gibco, #12440-053) supplemented with 10% Fetal Calf-Serum (Bodinco, #S00FD10003) and 1 % Penicillinstreptomycin (10,000 U / rnL) (Gibco, ##15140122).

[0200] Physical titer

[0201] Total RNA was isolated from 40-fold concentrated viral supernatant using an RNeasy Mini kit (QIAGEN, cat. 74104), with lysate homogenization performed using QIAshredder spin-columns (QIAGEN, #79656) and reverse transcribed into cDNA using a SuperScript III kit (Invitrogen). The physical titer, representing lentiviral vector genomes packaged in particles, was determined by quantitative PCR (Invitrogen QuantStudio 3) targeting the HIV^P gene located on the transfer plasmid using the primers and probe, Forward primer (FW), 5’-CAG GAC TCG GCT TGC TGA AG-‘3 (SEQ ID NO. 2) and reverse primer (REV) 5’- TCC CCC GCT TAA TAC TGA CG -3’ (SEQ ID NO. 3), and probe 5’- FAM-CGC ACG GCA AGA GGC GAG G-TAMRA -3’ (SEQ ID NO. 4), using TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444557).

[0202] Functional titer on HEK-293T cells

[0203] HEK-293T cells were seeded at 200 000 cells / well using a 6-well plate. 24 hours later, concentrated lentivirus supernatant, supplemented with DMEM / F12 and LentiBOOST (Revvity Health Sciences, #SB-A-LF-901-01) (1 mg / ml) was added to the culture. To aid the transduction efficiency, the cells were spin-oculated for 30 minutes at 300xg and 32°C. Cells were incubated for 5 days at 37°C and 5% CO2 before being harvested and analysis with flow cytometry. The functional titer was calculated as followed: [a*(b / 100)] / c, where a is the number of target cells, b is the percentage of transduced cells and c the volume (mL) of supernatant added, to provide for Tll / mL.

[0204] The principle of the engineering is illustrated in Figure 1. In type I diabetes (T1 D) patients, failure of (proper) insulin presentation in the thymus is understood to be responsible for the escape of autoreactive T-cells to insulin. In addition, there is believed to be a lack of insulin-specific T regulatory cells produced by their thymus. Central tolerance is therefore compromised which may trigger an autoimmune response towards insulin (including against pancreatic beta-cells) initiated. The engineered thymic cells or thymus tissue generated in accordance with the invention aims to educate the immune system to thereby e.g. restore central tolerance to insulin using gene therapy.

[0205] The gene therapy approach may use a lentivirus (3rdgeneration) that provides the AIRE and insulin gene to the thymic cells. AIRE is a key transcription factor of the medullary thymic epithelial cells (mTEC) that allowed expression of tissue-restricted genes in the thymus and contribute to AIRE+mTECs functionality. By overexpressing AIRE together with the insulin gene, the (insulin) peptide presentation in mTECs (and other antigen presenting cells (APC)) is restored, resulting in the apoptosis of autoreactive T-cells to insulin via negative selection and the production of insulin-specific T regulatory cells. Constructs, or lentiviral vectors, such as depicted in Figure 2, expressing both AIRE and Pro-insulin, either in a single construct or in two separate constructs (e.g. with one or two lentiviral vectors (NB, a lentiviral vector genome may comprise one construct or two constructs). The constructs depicted in Figure 2 comprise a reporter gene. In a therapy setting, reporter genes are preferably omitted.

[0206] Production and quality assessment results of gene therapy vectors and controls is shown in Figure 3. The constructs could stably integrate within the genome by lentiviral vector delivery, lentiviral vector design is depicted in Figure 2. EFS-comAIRE-T2A- Prolnsulin2-P2A-zsGreen is a lentiviral vector construct, delivering both AIRE and Insulin, while EFS-comAire-T2A-zsGreen and EFS-Prolnsulin2-T2A-zsGreen are control constructs for the delivery of the combination of AIRE and Insulin (which may be optionally, and alternatively, be combined to deliver both AIRE and Insulin). The use of a lentiviral vector for solely delivering Insulin expression can have effect in these experiments. The physical titer of each of the constructs was reaching 10(9) virus particle (VP) per mL, which is suitable for pre-clinical and clinical applications (Figure 3A). The functional titer was assessed by flow cytometry using zsGreen expression as readout (Figure 3B). Using 20 uL of concentrated virus suspension 80% of transduction efficiency was achieved (Figure 30). From the transduction percentage, the functional titer can be evaluated as transducing unit (TU) per mL (Figure 3D). From the transduction percentage, the functional titer can be evaluated as transducing unit (TU) per mL (Figure 3E).

[0207] The principle of Mimetic technology is illustrated in Figure 5. In type I diabetes (T 1 D) patients, failure of (proper) insulin presentation in the thymus is understood to be responsible for the escape of autoreactive T-cells to insulin. In addition, there is believed to be a lack of insulinspecific T regulatory cells produced by their thymus. Central tolerance is therefore compromised which may trigger an autoimmune response towards insulin (including against pancreatic beta-cells) initiated. The engineered thymic cells or thymus tissue generated in accordance with the invention aims to educate the immune system to thereby e.g. restore central tolerance to pancreatic cells using gene therapy.

[0208] The Mimetic technology aims to restore central tolerance by generating engineered thymic mimetic cells, i.e. specialized cells that express tissue-restricted antigen(s) majorly from one specific tissue, e.g. a particular lineage. The Mimetic technology includes a gene therapy that may use e.g. a lentivirus (3rdgeneration) to provides AIRE and a lineage-defining transcription factor to the thymic cells. In the second part of these examples 1 and 2, the aim is to generate engineered pancreatic mimetic cells and use Pdx1 (pancreatic duodenal homeobox-1) as lineage transcription factor therefor. AIRE is a key transcription factor of a subset of medullary thymic epithelial cells (mTEC) that allows expression of tissue-restricted genes in the thymus. By overexpressing AIRE together with the Pdx1 gene, peptide presentation of genes downstream of Pdx1 (including insulin) is induced, therefore restoring / inducing central tolerance for all targets of Pdx1 , which are representative of the pancreatic cells in the periphery, against which tolerance is to be induced. Solely expressing Pdx1 may be advantageous as well. Production and quality assessment results of lentiviral vectors is shown in Figure 7. The constructs could stably integrate within the genome by lentiviral vector delivery. Lentiviral vector design is shown in Figure 6. EFS-comAIRE-T2A-PDX1-P2A-zsGreen represents a construct of the lentiviral vector which delivers both Aire and Pdx1 , while EFS-comAIRE-T2A-zsGreen and EFS-PDX1-T2A-zsGreen are control constructs for the Aire and Pdx1 combination (which may optionally be combined to deliver both Aire and Pdx1 , or alternatively used to deliver solely Pdx1). The physical titer of each of the constructs reached 10(9) virus particle (VP) per mL, which is suitable for pre- clinical and clinical applications. The functional titer was assessed by flow cytometry using zsGreen expression as readout (Figure 70). Using 20 uL of concentrated virus suspension 80% of transduction efficiency was achieved (Figure 7D). From the transduction percentage, the functional titer can be evaluated as transducing unit (TU) per mL (Figure 7E).

[0209] Example 2

[0210] Mouse experiments are conducted to confirm proof of principle for the means and methods outlined herein, as depicted in Figure 4, to restore central tolerance in a mouse model. In these experiments, thymus of the NOD mouse is used, as these mice have shown to have defective central tolerance. After transduction with the lentiviral vector encoding AIRE and / or Insulin and / or lineage defining transcription factor PDX1 , we place the thymus in Balb / C nude mice, which lack a thymus but otherwise do not have an intrinsic hematopoietic defects. This allows for monitoring T cell development, without the interference / competition of an already present T cell compartment. Briefly, thymi from NOD / ShiLtJ mice, which have impaired tolerogenic function leading to insulitis development (Mendes-da-Cruz et al., Front. Endocrinol., 12 July 2018, Sec. Neuroendocrine Science, Volume 9 - 2018, doi: 10.3389 / fendo.2018.00381), are harvested, sectioned into smaller pieces, and treated with 2-deoxyguanosine (dGUO) prior to transduction with one of the lentiviral constructs shown in e.g Figure 2 or Figure 6. After transduction, the NOD / ShiLtJ thymic pieces are transplanted under the kidney capsule of Balb / c nude mice, which lack a thymus and thus exhibit impaired T cell development but which retain normal hematopoietic function. This setup allows for monitoring changes in the T cell compartment influenced by the transplanted thymic tissues. Untransduced NOD / ShiLtJ thymic pieces are used i.a. as controls. The recovery of central tolerance is next assessed in the blood of the transplanted mice by monitoring the presence of insulin-specific Tregs and autoreactive insulin-specific conventional T cells using tetramer staining. Alternatively, the recovery of central tolerance is next assessed in the blood of the transplanted mice by monitoring e.g. the presence of “pancreas”-specific Tregs and autoreactive "pancreas”-specific conventional T cells using tetramer staining. Finally, the pancreata and blood of the Balb / c nude mice are harvested and examined for insulitis and T1 D development respectively to evaluate the therapeutic effect.

[0211] Mice

[0212] 6-8 week-old Balb / C-nude (BALB / cAnN-Foxn1 nu / nu / Rj) mice are obtained from Janvier Laboratories (Le Genest Saint Isle, France). NOD / ShiLtJ mice are purchased from the Jackson Laboratory (Bar Harbor, Maine, USA) and breed at the animal facility of the Leiden University Medical Center. All mice are maintained under sterile and specific pathogen-free conditions. All mouse experiments are performed in accordance with institutional and national guidelines of the Central Committee Animal Experiments (Centrale Commissie Dierproeven) and are approved by the Animal Welfare Body (“Instantie voor Dierenwelzijn” of the Leiden University Medical Center.

[0213] Lentiviral transduction of thymus tissue

[0214] Thymic lobes of NOD / ShiLtJ mice are harvested, within one week of age. Alternatively, thymic lobes are harvested from embryos at E10 - the timepoint before hematopoietic stem cell colonization, or at E17. Thymi are placed in petri dishes containing cold PBS, supplemented with 8% FBS and cut into small pieces. Cut pieces are next placed into individual wells on nitrocellulose or nucleopore filters containing a suitable medium, such as DMEM / F12 supplemented with 10% FCS, 15 mM HEPES, 2 mM Glutamax, 0.1 mM non-essential amino acids, 0.05 mM b-mercaptoethanol and penicillin / streptomycin in the presence of 2-deoxyguanosine (2dGuo) for about 3-7 days, with daily medium changes to remove thymocytes. Next, thymic pieces are transduced. One of the three techniques listed here may be selected: 1) In vitro injection of 5-10 pL containing 0.5-1*109transducing units / ml of concentrated lentiviral vector into thymic pieces, 2) placement of thymic pieces in a transwell plate containing adherent HEK293 T cells which are producing lentiviral vectors or 3) by transduction of single cell suspensions, followed by reaggregation of the thymic epithelial cells into thymic organ cultures (RTOCs). The latter may alternatively be thymic epithelial cells derived from iPSCs, or thymus tissue derived from iPSCs generated in vitro (Chatta et al., J Allergy Clin Immunol 2019 Nov;144(5):1416-19) Subcapsular kidney capsule transplantations

[0215] 6-8 week old female Balb / C nude mice are anesthetized with isofluorane and receive a subcutaneous (s.c.) injection (0.3 mg / ml) of buprenorphine (Temgesic, Schering- Plough, Belgium) for pain relief. The right kidney is exteriorized via flank incisions and a small incision is made in the renal capsule. Lentiviral vector-transduced NOD / ShitLtJ-derived thymic pieces are transplanted under the kidney capsule by using a siliconized polyethylene tube. After transplantation, the peritoneum and skin is sutured. Next, mice are immediately treated with buprenorphine s.c. and placed in a cage on a heating pad to recover.

[0216] Histology

[0217] The pancreases of Balb / C nude mice are obtained post transplantation and are fixed in 4% paraformaldehyde before being embedded in paraffin and sectioned. Pancreatic sections are stained with hematoxylin and eosin or used for immunohistochemistry (IHC). Immunohistochemistry includes CD3 and FOXP3. Islets are scored for lymphocytic infiltrates, utilizing a scoring system with four grades: 1 , no infiltration; 2, peri-insulitis; 3, < 50% of islet infiltrated; and 4, > 50% of islets infiltrated.

[0218] Preparation of mouse blood and flow cytometry

[0219] To monitor T cell development in live Balb / C-nude mice over time, peripheral blood is collected at specified intervals via tail vein puncture in Microvette CB300 LH tubes (Sarstedt). Red blood cells are lysed by incubation with NH4CI 8,4 g / l; KHCO3 1g / l, (pH 7.4) twice for 1 min at room temperature. The lysis activity is neutralized by adding FACS buffer (pH 7.4 / 0,2% BSA I 0,1 % NaN3) and cells are stained as described below. For flow cytometry, surface marker staining is performed by incubation with an antibody mix for 30 min in FACS buffer. Subsequently, cells are fixed by using the FOXP3 Transcription Factor Staining Buffer Set according to the manufacturer’s protocol (Thermo Fischer Scientific) and intracellular staining is performed. Dead cells are excluded by using e.g. Fixable Viability Near-infra Red Dye (1 :1000, Life Technologies). Fluorescence minus one (FMO) is used as a negative control for T cell development markers. Single stained controls of immunocompetent Balb / C splenocytes or single-stained beads (UltraComp Beads, BD Biosciences) are used for the single stains. Samples are analyzed on the Attune™ NxT 4L flow cytometer (ThermoFisher). All generated data is analyzed using the OMIQ software (Dotmatics, Boston, MA). Example 3

[0220] To confirm the proof-of-principle of immune-education (as outlined in Figure 5), fetal thymic tissue was transduced with lentivirus encoding lineage-defining transcription factor with or without Aire. The presence of T-regulatory cells before and after transduction was evaluated by means of flow- cytometry and immunohistochemistry, respectively. At embryonic day 16.5 (E16.5), in ex vivo culture prior to transduction (also called dO), fetal thymic tissue was phenotypically characterized for the presence of different mTEC populations (Figure 10), comprising both mature (mTEChi) and immature (mTECIo) populations (https: / / doi.Org / 10.1038 / s41467-020-17544-3), as determined by the differential expression of CD80 and MHC-II. Mature mTECs arevalidated by the expression of Aire, which are absent in mTECIo populations, At dO, no Foxp3+ CD3+ cells were detected (Figure 11), indicating that regulatory T cells have not developed. Transduction of fetal thymic tissues with lentiviral vector containing Pdx1 could be monitored overtime using the reporter gene zsGreen (Figure

[0221] 12) and by staining either with immunofluorescence or using histochemistry (Figure

[0222] 13). Five days post-transduction with a lentiviral vector encoding Pdx1 and Aire sequences, Foxp3+cells were detected by immunohistochemistry, whereas untransduced controls remained negative (Figure 14). These findings indicated that stable vector integration containing Pdx1 and Aire sequences promoted Foxp3 expression, consistent with the emergence of Foxp3+ T regulatory cells.

[0223] Methods

[0224] Mouse Fetal thymus culture and transduction

[0225] Fetal thymi (E16.5, JC Discovery) were cut into two lobes using a needle and forceps under the microscope. Each lobe was transduced in a hanging drop system on terasaki plates. Each hanging drop had a total volume of 25 pl which consists of 1 % poloxamer transduction enhancer (Lentiboost, Revvity), 75% concentrated lentivirus, and 24% transduction medium. The transduction medium was DMEM / F12 (StemCell Technologies) supplemented with 1 % non-essential amino acids (Gibco, Thermo Fisher Scientific), 1 % Glutamax (Gibco, Thermo Fisher Scientific), 1 % penicillin / streptomycin (Gibco, Thermo Fisher Scientific), and 0.1 % betamercaptoethanol (Fisher Scientific). The hanging drop culture was incubated at 37°C 5%CO2 overnight, after which the thymic lobes were transferred to an air-liquid interface culture system. In this system, the thymic lobes were placed on an air-liquid insert that floats on culture medium DMEM / F12 (StemCell Technologies) supplemented with 10% fetal calf serum (Gibco, Thermo Fisher Scientific), 1 % non- essential amino acids (Gibco, Thermo Fisher Scientific), 1 % Glutamax (Gibco, Thermo Fisher Scientific), 1 % penicillin / streptomycin (Gibco, Thermo Fisher Scientific), and 0.1 % beta-mercaptoethanol (Fisher Scientific). Six days post-transduction the thymic lobes were fixed for embedding.

[0226] Fixation and embedding

[0227] The thymic lobes were washed with PBS and then fixed in 4% PFA (Thermo Fisher Scientific) for 3 hours at 4°C. Histogel (Thermo Fisher Scientific) that was prewarmed to 65°C and the fixed thymic lobes were embedded on liquid histogel with slide chambers (Ibidi) as a mold. These were cooled at 4°C to harden the histogel and stored in EtOH prior to paraffin embedding.

[0228] Treg evaluation pre-transduction with flow cytometry

[0229] To generate single cell suspension, the thymic lobes were incubated in a digestion solution at 37°C for 20 min. The digestion solution was DMEM / F12 (StemCell Technologies) supplemented with 0.002% Liberase TM (Merck) and 500 ng / ml DNasel (Thermo Fisher Scientific). The generated cell suspension was transferred into a tube containing albumin-rich buffer (PBS with 0.5% BSA and 2 mM EDTA). If there was tissue remaining, the digestion process was repeated until everything only single cells remained. The incubation time in the digestion solution was decreased by 5 min per digestion round. The generated cell suspensions were pooled and spun down at 400 g for 8 min at 4°C. The pellet was incubated in erilysis (eBioscience, Invitrogen) for 2- 3 min at room temperature (RT) to remove red blood cells and the reaction is stopped by adding albumin-rich buffer. The single cells suspension was then filtered through 70 pm filter and counted prior to CD45 depletion procedure.

[0230] Remaining cell clumps were removed by loading the cell suspension onto preseparation filter (Miltenyi Biotec), after which the cells were labelled with CD45 mouse microbeads (Miltenyi Biotec) for 15 min on ice using the following ratio, 10 pl microbeads per 10 million cells. The labeled cell suspension was washed and subsequently loaded onto the MACS column (Miltenyi Biotec). The flow-through containing CD45- cells were collected. The CD45- cells were stained with extracellular and intracellular markers to evaluate the properties of these cells using 2 panels below.

[0231] Mouse T-cell and stomal cell FC panel

[0232] Treg evaluation post-transduction by immunohistochemistry

[0233] Paraffin blocks were cut into 4 pM sections using a rotary microtome (Leica Biosystems). Sections were deparaffinized and dehydrated, and endogenous peroxidase activity wasblocked. For IHC, antigen retrieval was performed in a steamer cooker for 20 minutes at pH6.0 using Citrate Buffer (Thermo Fisher Scientific). Tissues were stained with primary antibodies overnight (see table below). Detection was achieved using diaminobenzidine (DAB) chromogen (Agilent) and counterstaining with hematoxylin. Imaging was done using EVOS™ M7000 Imaging System (Thermo Fisher Scientific). For the immunofluorescence staining of PDX1 , the detection was done using the secondary antibody anti-rabbit Alexa Fluor 594 (Invitrogen).

[0234] Example 4

[0235] In vitro experiments were conducted as a proof-of-principle that mimetic cells can be generated by transduction of thymus epithelial cells (TECs) with lentiviral vector encoding lineage-defining transcription factors. Pdx1 , a master regulator of pancreatic organogenesis (Ebrahim et al., 2022, Frontiers in Molecular Biosciences DOI: 10.3389 / fmolb.2022.1091757) is chosen as a lineage-defining transcription factor to engineer pancreas-mimetic cells. As a benchmark, Hnf4g, a transcription factor that has been described as one of the drivers of liver / intestine mimetic cell accumulation (Michelson et al., 2023, J Exp Med 220 (10): e20230461), was included in the in vitro experiments. The schematic, production and quality assessment of the gene therapy lentiviral vectors carrying HNF4 transcription factor are shown in Figure 9. Briefly, primary mouse TECs were transduced with a lentiviral vector encoding a lineagedefining transcription factor (i.e. Pdx1 or Hnf4g) with or without Aire. Four days posttransduction, the cells were subjected to gene expression analysis.

[0236] Lentivirus transduction with both EFS-PDX1-T2A-zsGreen and EFS-comAIRE-T2A- PDX1-P2A-zsGreen induced the expression of Neurog3, a PDX1 transcriptional target (Wang et al., 2018, Molecular Metabolism 9 (2018) 57e6) that plays a key role in pancreas development, as well as Trpm3, an ion channel that is involved in insulin secretion (Philippaert K, Vennekens R. The Role of TRP Channels in the Pancreatic Beta-Cell. In: Emir TLR, editor. Neurobiology of TRP Channels. Boca Raton (FL): CRC Press / Taylor & Francis; 2017. Chapter 12; Thiel et al., 2013, Molecular Endocrinology 50(3): R75-R83). AIRE involvement was needed to induce the expression of Adgrgl, a receptor whose expression correlates with functioning of pancreatic beta cells (Duner et al., 2016, J Clin Endocrinol Metab 101 (12):4637-4645; Olaniru et al., 2025, Cell. Mol. Life Sci. 82, 129) (Figure 15A). These suggests the variable necessity of Aire in driving the expression of Pdx1 -regulated pancreas-relevant genes. Aire seemed to be required in inducing the expression of Hnf4g-regulated liverrelevant genes, such as Muc13, Apob, and Tkfc (Figure 15B). The expression of mucins (Muc13) and other apolipoproteins other than Apob (i.e. Apoa4 and Apoc3) has been described in entero-hepato mimetic mTEC population (Michelson et al., 2023, J Exp Med 220 (10): e20230461). Altogether, these findings showed that lentivirus-mediated overexpression of lineage-defining transcription factor induced the expression of relevant target genes. Aire is variably involved in the process, which is also in line with previous findings (Michelson et al., 2022, Cell 185, 2542-2558).

[0237] Methods

[0238] Culture of primary mouse TECs

[0239] Primary C57BL / 6 mouse TECs (Cell Biologies) were cultured on culture dishes coated with 0.1 % Gelatin-based coating (Cell Biologies). These cells were grown in epithelial medium (Cell Biologies) containing 0.1 % epithelial growth factor, 0.1 % hydrocortisone, 2% fetal bovine serum and 1% antibiotic-antimycotic at 37°C and 5% CO2. The medium was refreshed daily, and cells were passaged when reaching confluency.

[0240] Lentivirus transduction

[0241] Twenty-four hours prior to transduction, 25,000 primary mouse TECs were seeded in each well of a 24-well plate. The transduction was performed in a total volume of 200 pl mixture containing 1 % transduction enhancer (Lentiboost, Revvity), lentivirus supernatant for desired MOI, and epithelial medium. Transduced cells were harvested 96 hours post-transduction. Flow cytometry on Attune™ NxT 4L flow cytometer (ThermoFisher) was performed to assess viability and transduction efficiency based on Zombie NIR (Biolegends) viability staining and zsGreen reporter, respectively.

[0242] Molecular analysis

[0243] RNA was isolated from transduced cells and the non-transduced controls with RNeasy micro kit (Qiagen). For transcriptome profiling, RNA was subjected to bulk RNA- sequencing with rRNA depletion (Genomescan BV). Sequencing reads were aligned to mouse genome (build: GRCm38 / mm10) using STAR (Dobin et al., 2013, Bioinformatics Jan 1 ;29(1 ): 15-21 ) and feature counts were generated with HTseq (Putri et al., 2022, Bioinformatics 38(10):2943-2945). Differential expression was performed using DEseq2 (Love et al., 2014, Genome Biology, 15:550). For targeted analysis, cDNA was synthesized using Superscript III (Thermo Fisher Scientific) and relevant targets were queried by dPCR on AbsoluteQ (Thermo Fisher Scientific) using AbsoluteQ MAP16 Plate kit and master mix (Thermo Fisher Scientific) and Neurog3 primers / probe mix (Mm00437606_s1 (VIC), Thermo Fisher Scientific).

Claims

1. CLAIMS1. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment of a subject, wherein in the medical treatment, thymus tissue is provided, and thymic cells of the thymus tissue are engineered by providing thymic cells with the nucleic acid encoding the AIRE sequence and the nucleic acid encoding a lineage defining transcription factor sequence.

2. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment of a subject, wherein the engineered thymus tissue or engineered thymic cells in the medical treatment is capable of educating the immune system of the subject receiving the medical treatment, such that immune tolerance is induced in the subject.

3. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with claim 1 or claim 2, wherein the medical treatment is for the treatment of diabetes type 1 , or the prevention thereof, and the lineage defining transcription factor is PDX1.

4. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding encoding a lineage defining transcription factor sequence, comprised in a lentiviral vector, for use in a medical treatment in accordance with any of claims 1-3.

5. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in medical treatment of a subject in accordance with any of claims 1-4, wherein the lineage defining transcription factor induces expression of proteins corresponding with a peripheral phenotype, which induced expressed proteins are processed by the thymic cell to provide for MHC molecules presenting one or more peptide fragments derived therefrom, therewith providing engineered mimetic thymic cells, which induce immune tolerance against the peripheral phenotype.

6. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of claims 1-5, wherein the thymus tissue is autologous thymus tissue of the subject, and, wherein the medical treatment comprises implanting the engineered thymus tissue or engineered thymic cells provided with the nucleic acid encoding the AIRE sequence and the lineage defining transcription factor.

7. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of claims 1-6, wherein the thymus tissue is derived from a thymus biopsy or from pluripotent stem cells, such as induced pluripotent stem cells (iPSCs).

8. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, for use in a medical treatment in accordance with any of claims 1-7, wherein the lineage defining transcription factor is expressed in a thymic cell, which preferably is a medullary thymic epithelial cell.

9. A nucleic acid encoding an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence in accordance with any of claims 1-7, wherein the nucleic acids encoding an AIRE sequence and / or lineage defining transcription factor sequence is codon optimized, and, wherein preferably, the subject is a human.

10. Method for engineering thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, as defined by any of claims 1-9, comprising the steps of: providing thymus tissue, by providing a biopsy of a thymus obtained from a subject; or, providing pluripotent stem cells of a subject and inducing the pluripotent stem cells to develop into thymus tissue to therewith provide thymus tissue; provide a nucleic acid encoding an AIRE sequence and a nucleic acid encoding an lineage defining transcription factor sequence.

11. The method for preparing thymus tissue comprising an AIRE sequence and a nucleic acid encoding a lineage defining transcription factor sequence, in accordance with claim 10, comprising the further steps of:- preparing a single cell suspension of the provided thymus tissue, prior to the transfer of the provided nucleic acid(s); and- reaggregating the cells of the thymus tissue, after the transfer of the provided nucleic acid(s) to the cells of the thymus tissue.

12. A gene therapy vector encoding AIRE and a lineage defining transcription factor, as defined in any of claims 1-9.

13. Engineered thymic cells or engineered thymus tissue as defined in any of claims 1-9, or as obtained by the method of claim 10 or claim 11.

14. Engineered thymic cells or engineered thymus tissue as defined in any of claims 1-9, or as obtained by the method of claim 10 or claim 11 , for use in a medical treatment, preferably such as defined in any of claims 1-9.

15. A non-human animal comprising engineered thymic cells or engineered thymus tissue as defined by claim 13.