DNA enrichment methods and kits

WO2026073084A3PCT designated stage Publication Date: 2026-05-15ILLUMINA INC
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
ILLUMINA INC
Filing Date
2025-09-29
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

The preparation of DNA libraries for sequencing, particularly for regions of interest, is laborious and time-consuming, and prone to human error due to the manual handling involved in isolating and amplifying specific DNA fragments.

Method used

The use of CRISPR components, specifically Cas nuclease/RNA guide complexes or Cas nickase/RNA guide complexes, to enrich DNA fragments containing a region of interest, either before or during library preparation, streamlining the process and reducing human intervention.

Benefits of technology

This method reduces the hands-on time required for sample preparation and minimizes errors by automating the DNA enrichment process, thereby speeding up library preparation and enhancing the efficiency of DNA sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025048400_15052026_PF_FP_ABST
    Figure US2025048400_15052026_PF_FP_ABST
Patent Text Reader

Abstract

In an example deoxyribonucleic acid (DNA) enrichment method, a DNA sample containing a region of interest is tagmented using bead-linked transposomes. This generates bead-linked DNA fragments. A Cas nuclease / RNA guide complex is introduced to the bead-linked DNA fragments, which cleaves DNA fragments containing the region of interest. The Cas nuclease / RNA guide complex is denatured, which releases the DNA fragments containing the region of interest from the bead- linked transposomes. The DNA fragments containing the region of interest are introduced into a flow cell containing surface-bound transposomes. Other enrichment methods are also disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

DNA ENRICHMENT METHODS AND KITSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of: U.S. Provisional Application S.N. 63 / 701 ,144, filed September 30, 2024; U.S. Provisional Application S.N. 63 / 715,970, filed November 4, 2024; and U.S. Provisional Application S.N. 63 / 716,132, filed November 4, 2024, the content of each of which is incorporated by reference herein in its entirety.REFERENCE TO SEQUENCE LISTING

[0002] The Sequence Listing submitted herewith is hereby incorporated by reference in its entirety. The name of the file ILI278BPCTJP-2755- PCT_Sequence_Listing.xml, the size of the file is 14,943 bytes, and the date of creation of the file is September 29, 2025.BACKGROUND

[0003] Double-stranded DNA (dsDNA) molecules can be fragmented and tagged to generate a library of smaller, double-stranded DNA molecules, which can undergo additional processing to generate single-stranded DNA molecules (ssDNA). These smaller, single-stranded DNA molecules may be used as templates in DNA sequencing reactions. The templates may enable short read lengths to be obtained; and then during data analysis, overlapping short sequence reads can be aligned to reconstruct the longer nucleic acid sequences. Preparation for sequencing, the sequencing process, and the data analysis can be laborious and time consuming, especially when the processes are performed in order to obtain information about a region of interest of the DNA sample.SUMMARY

[0004] Disclosed herein are methods for performing DNA enrichment. With these methods, DNA fragments containing a region of interest are isolated from other fragments of a DNA sample not containing the region of interest, and then are amplified for sequencing. The methods disclosed herein utilize CRISPR (i.e. , clustered regularly interspaced short palindromic repeats) components to isolate the DNA fragments containing the region of interest. These methods can be at least partially automated, which can reduce the amount of hands-on time needed to create an enriched sample. This, in turn, may speed up library preparation time and / or reduce the risk of human error in sample preparation.BRIEF DESCRIPTION OF THE DRAWINGS

[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.

[0006] Fig. 1A and Fig. 1 B depict hetero-dimers including different examples of the transposome complexes that can be used in different examples of the method disclosed herein;

[0007] Fig. 1 C and Fig. 1 D depict homo-dimers including one example of universal transposome complexes that can be used in the figure 8 series;

[0008] Fig. 1 E schematically depicts an example of unique dual indexed strands that can be used in the method described in the figure 8 series;

[0009] Fig. 1 F depicts another example of homo-dimers with another example of universal transposome complexes and corresponding unique dual indexed strands that can be used in the method described in the figure 8 series;

[0010] Fig. 1 G depicts still another example of homo-dimers with another example of universal transposome complexes and corresponding unique dual indexed strands that can be used in the method described in the figure 8 series;

[0011] Fig. 2A and Fig. 2B schematically depict one example method disclosed herein;

[0012] Fig. 3A through Fig. 3D schematically depict one example method disclosed herein;

[0013] Fig. 4A and Fig. 4B depict an example of a flow cell including a removable coating, and removal of a portion of the coating;

[0014] Fig. 5A through Fig. 5C schematically depict one example method disclosed herein;

[0015] Fig. 6A through Fig. 6F schematically depict another example method disclosed herein;

[0016] Fig. 7A through Fig. 7C schematically depict a portion of another example method disclosed herein;

[0017] Fig. 8A and Fig. 8B together schematically illustrate another example method using solution-based tagmentation;

[0018] Fig. 8C illustrates an additional process that may be performed in conjunction with the method of Fig. 8A and Fig. 8B;

[0019] Fig. 9 schematically depicts a portion of another example method disclosed herein;

[0020] Fig. 10 schematically depicts a portion of still another example method disclosed herein; and

[0021] Fig. 11 schematically depicts yet another example method disclosed herein.DETAILED DESCRIPTION

[0022] Examples of the methods and kits disclosed herein involve or enable DNA enrichment. The methods and kits respectively utilize and include a CRISPR component. The CRISPR component that is used is a Cas nuclease / RNA guide complex or a Cas nickase / RNA guide complex, which either binds to DNA fragments, or binds to and cleaves DNA fragments that contain a sequence of interest. As will be described in further detail herein, in some examples, the use of the Cas nuclease / RNAguide complex or the Cas nickase / RNA guide complex enables enrichment to take place prior to or during library preparation, and thus streamlines the library preparation process and eliminates post-library preparation enrichment. In other examples, the Cas nuclease / RNA guide complex or the Cas nickase / RNA guide complex enables post-library preparation enrichment.

[0023] Some of the methods and kits disclosed herein include two flow cells - one for enrichment and the other for cluster generation and sequencing. In these examples, one of the flow cells includes the transposome complexes used for enrichment, and the other of the flow cells includes primers for amplification. This enables a user to utilize commercially available flow cells (e.g., containing amplification primers and no transposome complexes) with the flow cells described herein.

[0024] Other examples of the flow cells utilized and included in some examples of the methods and kits disclosed herein include surface chemistry for immobilizing transposome complexes and primers to the surface of the flow cell. In other examples, the primers can be added to the flow cell surface during the workflow. By incorporating this surface chemistry, the flow cell can be repurposed for a particular application. On flow cell tagmentation and enrichment generates DNA sample fragments that contain a region of interest on the same surface where amplification and sequencing of the fragments take place. This eliminates the need for off flow cell DNA sample preparation to generate the enriched population of library fragments, and thus provides a more stream-lined and efficient process. Some of the methods using these example flow cells also enable library fragment indexing.

[0025] Definitions

[0026] Terms used herein will be understood to take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.

[0027] As used herein, the singular forms “a,” “an,” and “the” refer to both the singular as well as plural, unless the context clearly indicates otherwise. The term“comprising” as used herein is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0028] Reference throughout the specification to “one example,” “another example,” “an example,” and so forth, means that a particular element (e.g., feature, structure, composition, configuration, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0029] The terms “substantially” and “about” used throughout this disclosure, including the claims, are used to describe and account for small fluctuations, such as those due to variations in processing. For example, these terms can refer to less than or equal to ±5% from a stated value, such as less than or equal to ±2% from a stated value, such as less than or equal to ±1 % from a stated value, such as less than or equal to ±0.5% from a stated value, such as less than or equal to ±0.2% from a stated value, such as less than or equal to ±0.1 % from a stated value, such as less than or equal to ±0.05% from a stated value.

[0030] Adapter. An oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. Suitable adapter lengths may range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. The adapter may include any combination of nucleotides and / or nucleic acids. In some examples, the adapter can include an amplification domain, e.g., having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, the adapter can include a sequence that is complementary to at least a portion of a flow cell surface bound primer (which includes the universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to the complementary flow cell surface bound primer during amplification and clustergeneration. In some examples, the adapter can also include a sequencing primer sequence (i.e. , sequencing binding site) or a sequencing sample index (i.e., a barcode sequence). Combinations of different adapters may be incorporated into the nucleic acid molecule, such as the DNA fragments generated via tagmentation.

[0031] Amplification'. Some embodiments further comprise amplifying and / or replicating one or more nucleic acid templates, including fragments thereof. The amplifying and / or replicating comprises use of one or more of a bridge amplification reaction, an isothermal bridge amplification reaction, a rolling circle amplification (RCA) reaction, a modified rolling circle multiple displacement amplification, a helicase-dependent amplification reaction, a recombinase-dependent amplification reaction, a single-stranded DNA binding (SSB) protein mediated Isothermal amplification, a PCR reaction, a strand-displacement reaction, a ligase chain reaction, a transcription-mediated reaction, a loop-mediated amplification reaction, other suitable reactions, and combinations thereof.

[0032] Amplification Domain: A portion of an adapter having a universal nucleotide sequence, such as a P5 or P7 sequence or a complement thereof, that can serve as a starting point for template amplification and cluster generation.

[0033] Cas nickase / RNA guide complex: The structure formed between a Cas nickase and an RNA sequence. The RNA guide sequence is a short sequence including i) a scaffold portion that is able to bind to the Cas nickase and ii) a user- defined spacer portion (e.g., about 20 nucleotides in length) that defines which portion of a genomic sequence is to be enriched. The user-defined spacer portion includes a seed sequence, as it shares sufficient homology (at least at the 3’ end) with the region of interest of a DNA sample. The region of interest of a particular DNA sample that is to be enriched can be altered by changing the spacer portion present in the RNA guide. This complex is used to cut one strand of a double stranded sequence.

[0034] Cas nuclease / RNA guide complex: The structure formed between a Cas nuclease and an RNA sequence. The RNA guide sequence is a short sequence including i) a scaffold portion that is able to bind to the Cas nuclease and ii) a user- defined spacer portion (e.g., about 20 nucleotides in length) that defines which portionof a genomic sequence is to be enriched. The user-defined spacer portion includes a seed sequence, as it shares sufficient homology (at least at the 3’ end) with the region of interest of a DNA sample. The region of interest of a particular DNA sample that is to be enriched can be altered by changing the spacer portion present in the RNA guide. This complex is used to cut one strand of a double stranded sequence.

[0035] Clusters: Moreover, as used herein, the term “cluster of oligonucleotides” (or “cluster” or “oligonucleotide cluster” or “colony”) refers to a localized group or collection of DNA or RNA on a nucleotide-sample support, such as a flow cell, particle, polymer scaffold, or other solid surface. In particular, a cluster includes tens, hundreds, thousands, or more copies of a cloned or the same DNA or RNA segment. For example, in one or more embodiments, a cluster includes a grouping of oligonucleotides immobilized in a section of a flow cell or other nucleotide-sample slide. In some embodiments, the cluster can comprise one or more concatemers, such as, for example, a polony or a nanoball. In some embodiments, clusters are evenly spaced or organized in a systematic structure within a patterned flow cell. By contrast, in some cases, clusters are randomly organized within a non-patterned flow cell. In typical embodiments, a cluster is the product of an amplification reaction. A cluster of oligonucleotides can be imaged utilizing one or more light signals, changes in pH, changes in conductance, and other signals. For instance, an oligonucleotide-cluster image may be captured by a camera during a sequencing cycle of light emitted by irradiated fluorescent labeled nucleotides incorporated into oligonucleotides, fluorescent labeled nucleotides bound but not incorporated into oligonucleotides, and other fluorescent labeled complexes associated with incorporated or bound nucleotides from one or more clusters on a flow cell. Examples of other sequencing procedures are set forth herein. In some embodiments, a cluster can be monoclonal or polyclonal.

[0036] Corresponds with: When one primer “corresponds with” an amplification domain, the primer and amplification domain may have the same sequence, so that a copy of the amplification domain generates a sequence complementary to the primer.

[0037] Depositing-. Any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.

[0038] Depression-. A discrete concave feature in a substrate or a layer of a substrate (e.g., a patterned resin) having a surface opening that is at least partially surrounded by interstitial region(s) of the substrate or the layer. Depressions can have any of a variety of shapes at their opening in a surface including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The crosssection of a depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The depression may also have more complex architectures, such as ridges, step features, etc.

[0039] DNA Sample: Multiple copies of a polymeric form of nucleotides of any length that includes deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides derived from an RNA (ribonucleic acid) sample. The DNA sample is double stranded. The DNA sample may include naturally occurring DNA, which includes a nitrogen containing heterocyclic base (a nucleobase such as adenine, thymine, cytosine and / or guanine), a sugar (specifically deoxyribose, i.e. , a sugar lacking a hydroxyl group that is present at the 2’ position in ribose), and a backbone containing phosphodiester bonds. An analog structure can have an alternate backbone linkage including any of a variety known in the art.

[0040] The DNA sample may be genomic DNA (gDNA) that can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva) or tissues. gDNA can be prepared by lysing a cell that contains the DNA. The cell may be lysed under conditions that substantially preserve the integrity of the cell's gDNA. In one particular example, thermal lysis may be used to lyse a cell. In another particular example, exposure of a cell to alkaline pH can be used to lyse a cell while causingrelatively little damage to gDNA. Any of a variety of basic compounds can be used for lysis including, for example, potassium hydroxide, sodium hydroxide, and the like. Additionally, relatively undamaged gDNA can be obtained from a cell lysed by an enzyme that degrades the cell wall. Cells lacking a cell wall either naturally or due to enzymatic removal can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse a cell include exposure to detergents, mechanical disruption, sonication heat, pressure differential such as in a French press device, or Dounce homogenization. Agents that stabilize gDNA can be included in a cell lysate or isolated gDNA sample including, for example, nuclease inhibitors, chelating agents, salts, buffers and the like. A crude cell lysate containing gDNA may be used without further isolation of the gDNA. In one example, a whole blood sample may be lysed using an inorganic salt free lysis buffer (containing a chaotropic detergent), and the crude lysate may be exposed to specific processing steps to generate a complexed crude lysate (e.g., as described in International Pub. No. WO 2023 / 122755, incorporated herein by reference in its entirety). This complexed crude lysate can also be used as the DNA sample without further isolation or purification.

[0041] Each'. When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.

[0042] Enrichment: The process of isolating DNA fragments that contain a region of interest from a plurality of DNA fragments.

[0043] Flow Cell: A vessel having an enclosed flow channel where a reaction can be carried out, or a vessel having a channel that is open to a surrounding environment and in which a reaction can be carried out. The vessel with an open flow channel may be referred to herein as an open wafer flow cell. Any example of the flow cell may include an inlet for delivering reagent(s) to the channel, and an outlet for removing reagent(s) from the channel. In some examples, the flow cell enables the detection of the reaction that occurs therein. For example, the flow cell can includeone or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.

[0044] Flow channel'. An area that is defined between two bonded or otherwise attached components or that is defined within a lane so that it is open to the surrounding environment. The flow channel can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned sequencing surfaces or a patterned sequencing surface and a lid, and thus may be in fluid communication with one or more components of the sequencing surface(s).

[0045] Fragment. A portion or piece of the DNA sample. A “partially adapted DBA fragment” is a portion or piece of the DNA sample that has been tagmented, and thus includes an adapter ligated to the 5’ end of the DNA fragment. A “fully adapted fragment” is a portion or piece of the DNA sample that has adapters incorporated at both the 3’ and 5’ ends of the DNA fragment. Fragments containing the region of interest may be referred to herein as “interest fragments” or “interest DNA fragments.”

[0046] Fragmentation: The shearing or fragmenting of nucleic acid into shorter lengths. Fragmentation methods include enzymatic, physical (including sonication, nebulization, needle shearing, microwave, etc.), and chemical (including depurination, hydrolysis, oxidation, etc.). The terms “fragmenting enzymes” or “enzyme-based fragmentation” or “enzyme fragmentation” as used herein refers to enzymes that fragment nucleic acid. The enzymes can be a single enzyme or two or more enzymes that work together to fragment the nucleic acid. Some enzymes work on single stranded nucleic acid whereas others work on double stranded nucleic acid and yet others work on one strand of a double stranded nucleic acid. Fragmenting enzymes can cut randomly or specifically. Non-limiting examples of fragmenting enzymes include transposase, restriction enzymes, Argonaute, CRISPR -associated nuclease (Cas), endonucleases, exonuclease, topoisomerase, Fragmentase™ (New England Biolabs, Ipswich, MA). Preferred fragmentation embodiments include methods that fragment while retaining proximity information of the fragments.

[0047] Immobilization: The term “immobilized”, “affixed” and “attached” are used interchangeably herein and both terms are intended to encompass direct or indirect,covalent or non-covalent attachment unless indicated otherwise, either explicitly or by context.

[0048] Non-limiting exemplary covalent attachment includes, for example, those that result from the use of click chemistry techniques. Exemplary non-covalent attachment includes, but are not limited to, non-specific interactions (e g. hydrogen bonding, ionic bonding, van der Waals interactions etc.) or specific interactions (e.g. affinity interactions, receptor-ligand interactions, antibody-epitope interactions, avidinbiotin interactions, streptavidin-biotin interactions, lectin-carbohydrate interactions, etc.). Exemplary attachments are set forth in U.S. Pat. Nos. 6,737,236 B1 ; 7,259,258 B2; 7,375,234 B2and 7,427,678 B2; and U.S. Pat. Pub. 2011 / 0059865 A1 , each of which is incorporated herein by reference in its entirety.

[0049] In certain embodiments, the molecules (e.g. nucleic acids, enzymes) remain immobilized or attached to the solid support under the conditions in which it is intended to use the solid support, for example in applications requiring nucleic acid amplification and / or sequencing. In other embodiments, the molecules are reversibly immobilized and can be removed from the solid support through the use of cleavable sites, linkers, and the like.

[0050] Primer. A single stranded nucleic acid molecule that can hybridize to a complementary sequence, such as an adapter attached to a fragment. As one example, a flow cell surface bound primer can serve as a starting point for fragment amplification and cluster generation. As another example, a primer (e.g., a sequencing primer) may be introduced that can hybridize to fragments or fragment amplicons in order to prime synthesis of a new strand that is complementary to the fragments or fragment amplicons. Any primer can include any combination of nucleotides or analogs thereof. In some examples, the primer is a single-stranded oligonucleotide or polynucleotide. The primer length can be any number of bases long. In an example, each of the flow cell surface bound primer and the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.

[0051] Nanoballs: Some embodiments further comprise rolling circle amplification / replication used to form nucleic acid nanoballs. The term “nucleic acidnanoball” may be a concatemer comprising multiple copies of a target nucleic acid molecule. These nucleic acid copies may be arranged one after another in a continuous linear strand of nucleotides. These nucleic acid copies may result in a nanoball folding configuration. The multiple copies of a target nucleic acid molecule in a nucleic acid nanoball may each contain an adaptor sequence of known sequence to facilitate amplification or sequencing. The adaptor sequence of each target nucleic acid molecule may be the same or different. The nucleic acid nanoball can be loaded on the surface of solid support. The nanoball can be attached to the surface of solid support by any suitable method. Non-limiting examples of such methods include nucleic acid hybridization, biotin streptavidin binding, thiol binding, photoactive binding, covalent binding, antibody-antigen, physical constraints via hydrogels or other porous polymers, etc., or combinations thereof. In some cases, the nanoball can be digested with an enzyme (nuclease, etc.) to produce a smaller nanoball or a fragment from the nanoball.

[0052] Nucleic Acid Sample: A sample, typically derived from any organism, including but not limited to animals, plants, fungi, and microbes. For example, such samples may be derived from one or more biological fluids, cells, tissues, organs, or organisms, comprising a nucleic acid or a mixture of nucleic acids comprising at least one nucleic acid sequence. Such samples may include, but are not limited to sputum / oral fluid, amniotic fluid, blood, a blood fraction, or fine needle biopsy samples (such as surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (such as a patient), the sample may be from any mammal, including, but not limited to dogs, cats, horses, goats, sheep, cattle, pigs, etc. Alternatively, the sample may be microbial such as bacteria, viral, or fungal. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation ofinterfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (such as namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or “processed” samples are still considered to be biological “test” samples with respect to the methods described herein. A “nucleic acid sample” may also include nucleic acid sequence information stored in a memory, and which was originally obtained from a source such as one or more biological fluids, cells, tissues, organs, or organisms.

[0053] Patterned / Random: In some embodiments, the solid support comprises a patterned surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in an ordered pattern. A “patterned surface” refers to an arrangement of different regions in or on an exposed layer of a solid support. The features can be separated by interstitial regions that contribute to the pattern. In some embodiments, the interstitial regions can be a different height, creating wells or raised platform patterns. In other embodiments, the interstitial regions can have a different surface charge. In yet other embodiments, the interstitial regions can have a different attachment moiety. In some embodiments, the pattern can be any suitable pattern, such as a grid patterns, radial patterns, and combinations thereof. In some embodiments, a patterned surface can contain pre-determined locations of features but the features are not arrayed in a repetitive pattern. Examples of grid patterns include rectangular patterns, hexagonal patterns, triangular, and other suitable grid patterns. The regions for immobilization of molecules may be depressed regions, elevated regions, or planar regions relative to the interstitial regions. The regions may be fabricated as is generally known in the art using a variety of techniques, including, but not limited to, photolithography, stamping techniques, molding techniques, microetching techniques, and combinations thereof. As will be appreciated by those in the art, the technique used will depend on the composition and shape of the regions. For example, the regions for immobilization of molecules of a patterned surface may be wells, pits, channels, posts, pillars, ridges, stripes, swirls, lines, and other suitabletopographies. For example, the wells may have any opening in any shape, such as circular, oval, polygonal (e.g., hexagonal, octagonal, square, rectangular, elliptical, etc.). Exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Pat. No. 8,778,849 B2, which is incorporated herein by reference in its entirety.

[0054] In some embodiments, the solid support comprises a surface suitable for immobilization of molecules, such as enzymes, nucleic acids, and complexes thereof, in a random distribution over the solid support. Exemplary random distribution over a solid support is described in U.S. Pat. No. 8,241 ,573 B2, which is incorporated herein by reference in its entirety.

[0055] Polonies'. Some embodiments further comprise rolling circle amplification / replication used to form polonies. The term “polony” or “polonies” used herein refers to a nucleic acid library molecule clonally amplified in-solution or on- support to generate an amplicon that can serve as a template molecule for sequencing. In some aspects, a linear library molecule can be circularized to generate a circularized library molecule, and the circularized library molecule can be clonally amplified in-solution or on-support to generate a concatemer. In some aspects, the concatemer can serve as a nucleic acid template molecule which can be sequenced. The concatemer is sometimes referred to as a polony. In some aspects, a polony includes nucleotide strands.

[0056] Region of Interest: A sequence within a DNA sample that is targeted for a sequencing operation. The region of interest can include or can be adjacent to a protospacer sequence that is unique compared to the rest of the DNA sample. The target or protospacer sequence is present immediately adjacent to a protospacer adjacent motif (PAM). The PAM sequence serves as a binding signal for the Cas nuclease of the Cas nuclease / RNA guide complex.

[0057] Sequencing Procedures: The term “read” or “sequence read” (or sequencing reads) refers to a sequence obtained from a portion of a nucleic acid sample. A read may be represented by a string of nucleotides sequenced from any part or all of a nucleic acid molecule. Typically, though not necessarily, a readrepresents a short sequence of contiguous base pairs in the sample. The read may be represented symbolically by the base pair sequence (in A, T, C, or G) of the sample portion. It may be stored in a memory device and processed as appropriate to determine whether it matches a reference sequence or meets other criteria. A read may be obtained directly from a sequencing apparatus or indirectly from stored sequence information concerning the sample. In some cases, a read is a DNA sequence of sufficient length (such as at least about 25 bp) that can be used to identify a larger sequence or region, for example, that can be aligned and specifically assigned to a chromosome or genomic region or gene. For example, a sequence read may be a short string of nucleotides (such as 20-150 bases) sequenced from a nucleic acid fragment, a short string of nucleotides at one or both ends of a nucleic acid fragment, or the sequencing of the entire nucleic acid fragment that exists in the biological sample. Sequence reads may be obtained by any method known in the art. For example, a sequence read may be obtained in a variety of ways, such as using sequencing techniques or using probes, such as in hybridization arrays or capture probes, or amplification techniques.

[0058] Embodiments described herein can be used with any suitable sequencing chemistry, such as sequencing by synthesis (SBS), sequencing by binding, sequencing by ligation, or nanopore sequencing.

[0059] SBS can be with or without the use of reversible terminators. For example, SBS can be initiated by contacting the target nucleic acids with one or more nucleotides (e.g., labelled, synthetic, modified, or a combination thereof), DNA polymerase, etc. Those features where a primer is extended using the target nucleic acid as template will incorporate a labeled nucleotide that can be detected. The incorporation time used in a sequencing run can be significantly reduced using the altered polymerases described herein. Optionally, the labeled nucleotides can further include a reversible termination property that terminates further primer extension once a nucleotide has been added to a primer. For example, a nucleotide analog having a reversible terminator moiety can be added to a primer such that subsequent extension cannot occur until a deblocking agent is delivered to remove the moiety. Thus, forembodiments that use reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washes can be carried out between the various delivery steps. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with an array produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 04 / 018497; WO 91 / 06678; WO 07 / 123744; U.S. Pat. Nos. 7,057,026 B2, 7,329,492 B2, 7,211 ,414 B2, 7,315,019 B2, 7,405,281 B2, and 8,343,746 B2. Sequence reads can be generated using instruments such as MiniSeq™, MiSeq™, NextSeq™, HiSeq™, and NovaSeq™ sequencing instruments from Illumina, Inc. (San Diego, CA).

[0060] One example of SBS is termed sequencing by binding. One implementation of sequencing by binding includes cycles of initiating sequencing of a template with a reversible blocker on the 3’ end to prevent additional bases from incorporating, interrogating the template by flooding the flow cell with fluorescently tagged bases that do not include a blocker and measuring an emitted signal of bound bases, activating the 3’ end via removal of the reversible blocker, and incorporating the complementary base from unlabeled, blocked nucleotides. Reads using sequencing by binding can be generated from using instruments such as Onso™ sequencing instruments from Pacific Biosciences of California, Inc. (Menlo Park, CA). Another implementation of sequencing by binding could be sequencing by avidity. In sequencing by avidity, fluorescent dye labeled cores termed avidites are used. One potential cycle of sequencing by avidity includes providing a reagent of polymerase and reversibly terminated nucleotides to templates immobilized on a solid surface, deblocking the incorporated nucleotides, flowing a set of four types of avidites, washing away unbound avidites, detecting the incorporated bases / nucleotides, and removing the bound avidites. The steps in the cycle of sequencing by avidity may be performed in other orders. Sequencing by avidity is described in Arslan, S., Garcia, F.J., Guo, M. et al. Sequencing by avidity enables high accuracy with low reagent consumption. Nat Biotechnol 42, 132-138 (2024). https: / / doi.org / 10.1038 / s41587-023-01750-7, which isincorporated by reference in its entirety. Reads using sequencing by avidity can be generated using instruments such as Aviti™ sequencing instruments from Element Biosciences (San Diego).

[0061] One example of SBS using an open flow cell and without using reversible terminators is disclosed in Almogy, G.(2022) “Cost-efficient whole genomesequencing using novel mostly natural sequencing-by-synthesis chemistry and open fluidics platform” https: / / doi.org / 10.1101 / 2022.05.29.493900, which is incorporation by reference in its entirety. Sequence reads using an open flow cell can be generated using instruments such as UG 100TM Sequencer from Ultima Genomics, Inc. (Fremont, CA).

[0062] Some SBS embodiments include detection of a proton released upon incorporation of a nucleotide into an extension product. For example, sequencing based on detection of released protons can use an electrical detector and associated techniques that are described in U.S. Pat. Nos. 8,262,900 B2, 7,948,015 B2, 8,349,167 B2, and U.S. Pat. Pub. 2010 / 0137143 A1 , which are incorporated by reference in its entirety.

[0063] Sequence reads can be generated using instruments such as DNBSEQTM sequencing instruments from MGI Tech Co., Ltd. (Shenzhen, China) and as SURFSeq™, FASTASeq™, and GenoLab™ sequencing instruments from GeneMind Biosciences Co., Ltd. (Shenzhen, China).

[0064] Some embodiments can use methods involving the real-time monitoring of DNA polymerase activity. For example, nucleotide incorporations can be detected through fluorescence resonance energy transfer (FRET) interactions between a fluorophore-bearing polymerase and y-phosphate-labeled nucleotides, or with zeromode waveguides. Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al. Science 299, 682-686 (2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176- 1181 (2008), which are incorporated by reference in its entirety. Techniques sequencing using zeromode waveguides is described in U.S. Pat. No. 6,917,726 B2, which is incorporated by reference in its entirety.

[0065] Solid Support. The terms “solid support,” “solid surface,” and other grammatical equivalents herein refer to any substrate that is appropriate for or can be modified to be appropriate for the attachment of enzymes, nucleic acids, and complexes thereof. As will be appreciated by those in the art, the number of possible substrates is very large. Possible substrates include, but are not limited to, glass and modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon™, etc.), polysaccharides, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, optical fiber bundles, quartz, metal oxides, inorganic oxides, other suitable transparent materials, other suitable non-transparent materials, other suitable translucent materials, and combinations thereof. The composition and geometry of the solid support can vary with its use.

[0066] In some embodiments, the solid support or solid surface is a planar structure, such as a flowcell, slide, chip, microchip, array, microarray, wafer, panel, charge pad, and / or web. The planar structure can be a single surface structure having a single surface of sample / reaction sites. The planar structure can be a dual surface structure. One example of a dual surface structure includes a top substrate having a top surface of sample / reactions sites, a bottom substrate having a bottom surface of sample / reactions sites, and a spacer layer separating the top substrate and the bottom substrate. The solid support or solid surface can be open to direct application of a fluid. One example of an open solid support or open solid surface is an open flow cell having a single surface structure without an inlet port. In some embodiments, the solid support is not necessarily planar, such as, for example, the surface of a well, tube, or other vessel. Nonlimiting examples include the surface of a microcentrifuge tube, a well of a multiwell plate, and the like.

[0067] In some embodiments, the solid support comprises one or more surfaces of a flowcell or flow cell. The term “flowcell” or “flow cell” as used herein refers to a solid surface across which one or more fluid reagents can be flowed. Examples of flowcells and related fluidic systems and detection platforms that can be readily usedin the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497; U.S. 7,057,026 B2; WO 91 / 06678; WO 07 / 123744; U.S. 7,329,492 B2; U.S. 7,211 ,414 B2; U.S. 7,315,019 B2; U.S. 7,405,281 B2, and U.S. Pat. Pub. 2008 / 0108082 A1 , each of which is incorporated herein by reference in its entirety. In some embodiments, the flowcells can be one or more flow lanes. For flow cells having a plurality of flow lanes, each of the flow lanes can be independently accessed or two or more flow lanes can be accessed as a group.

[0068] In some embodiments, the solid support or solid surface is a non-planar structure, such beads, microspheres, and / or inner and / or outer surface of a tube or vessel. The terms “beads”, “microspheres,” or “particles” or grammatical equivalents herein is refer to small discrete particles. Suitable bead compositions include, but are not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon graphite, titanium dioxide, latex, polysaccharide (e.g. Dextran™, Sepharose™, cellulose, nylon, cross-linked micelles, Teflon™, as well as any other materials outlined herein for solid supports may all be used. “Microsphere Detection Guide” from Bangs Laboratories, Fishers Ind. is a helpful guide. In certain embodiments, the microspheres are magnetic microspheres or beads. The beads need not be spherical; irregular particles may be used. Alternatively or additionally, the beads may be porous. The bead sizes range from nanometers, i.e. 100 nm, to millimeters, i.e. 1 mm, with beads from about 0.2 micron to about 200 microns being preferred, and from about 0.5 microns to about 5 microns being particularly preferred, although in some embodiments smaller or larger beads may be used.

[0069] Tagmentatioir. A process in which the DNA sample is cleaved / fragmented and tagged (e.g., with the adapters) for analysis. Tagmentation is an in vitro transposition reaction.

[0070] Tagmented complexes: A DNA sample that has been exposed to tagmentation or tagmentation and ligation so that partially adapted fragments are formed, where the partially adapted fragments are held together by transposase enzymes.

[0071] Transferred and Non-Transferred Strands: The term “transferred strand” refers to a sequence that includes a transferred portion of a transposon end. Similarly, the term “non-transferred strand” refers to a sequence that includes the nontransferred portion of a transposon end. The 3’-end of a transferred strand is joined or transferred to a double stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to the double stranded fragment during tagmentation. In an example, the transferred and non-transferred strands include at least partially complementary portions that are covalently bound together.

[0072] Transposase or Transposase Enzyme: An enzyme that is capable of forming a functional complex with a transposon end-containing composition (e.g., transposons, transposon ends, transposon end compositions) and catalyzing insertion or transposition of the transposon end-containing composition into the double-stranded DNA sample with which it is incubated, for example, in the in vitro transposition reaction (i.e. , tagmentation). A transposase as presented herein can also include integrases from retrotransposons and retroviruses. Although many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposase that is capable of inserting a transposon end with sufficient efficiency to 5’-tag and fragment the DNA sample for its intended purpose can be used.

[0073] Transposome Complex: An entity formed between a transposase and a double stranded nucleic acid including a transposase integration recognition site. For example, the transposome complex can be a transposase enzyme pre-incubated with double-stranded transposon DNA under conditions that support non-covalent complex formation. Double-stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions or other double-stranded DNAs capable of interacting with a transposase, such as the hyperactive Tn5 transposase.

[0074] Transposome complexes can form dimers. In some instances, the 5’ end of each transferred strand of each complex in the dimer is attached to a surface (e.g., a bead or a flow cell surface). In other instances, the complexes in the dimersare configured for asymmetric attachment to a surface. By “asymmetric attachment” or “asymmetrically attached,” is it meant that one transposome complex in the dimer is attached to the surface through its transferred strand 5’ end and the other transposome complex in the dimer is attached to the surface through its nontransferred stand 3’ end.

[0075] Transposon End'. A double-stranded nucleic acid strand that exhibits only the nucleotide sequences (the “transposon end sequences”) that are necessary to form the complex with the transposase that is functional in tagmentation. The doublestranded nucleic acid strand of the transposon end can include any nucleic acid or nucleic acid analogue suitable for forming the functional complex with the transposase. For example, the transposon end can include natural DNA or DNA analogs (with modified bases and / or backbones), and can include nicks in one or both strands.

[0076] Transposases, transposomes and transposome complexes are generally known to those of skill in the art, as exemplified by the disclosure of U.S. Pat. App. Pub. 2010 / 0120098, which is incorporated herein by reference in its entirety. Although many embodiments described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it will be appreciated that any transposition system that is capable of inserting a transposon element with sufficient efficiency to tag a target nucleic acid can be used. In particular embodiments, a preferred transposition system is capable of inserting the transposon element in a random or in an almost random manner to tag the target nucleic acid. As used herein, the term "transposome" is intended to mean a transposase enzyme bound to a nucleic acid. Typically the nucleic acid is double stranded. For example, the complex can be the product of incubating a transposase enzyme with double-stranded transposon DNA under conditions that support non- covalent complex formation. Transposon DNA can include, without limitation, Tn5 DNA, a portion of Tn5 DNA, a transposon element composition, a mixture of transposon element compositions or other nucleic acids capable of interacting with a transposase such as the hyperactive Tn5 transposase.

[0077] Transposome Complexes

[0078] Fig. 1 A and Fig. 1 B illustrate dimers of different examples of the transposome complexes 10A, 10B and 10A, 10C that may be used in the methods and kits disclosed herein. It is to be understood that during transposome complexes 10A, 10B and 10A, 10C assembly, dimers are capable of forming. While hetero-dimers are shown, it is to be understood that homo-dimers may also form. It is to be understood that the type of dimer that is formed can be controlled by controlling the type of annealed transposons (with transposon ends 14A, 14B or 14A, 14C) added to the solution during transposon complex 10A, 10B, 10C assembly. For example, if the transposons that form complexes 10A alone are included in solution, homo-dimers of the complexes 10A will form. Alternatively, if both of the transposons that form complexes 10A and 10B are included in solution, homo-dimers of the respective complexes 10A and 10B will form and hetero-dimers, including one of each complex 10A, 10B, will form. The pre-formed dimers are then used in at least some of the methods disclosed herein. It is to be further understood that some transposome complexes 10A, 10B, 10C may not dimerize, and these individual transposome complexes 10A, 10B, 10C can attach to the bead or flow cell surface. The monomeric transposome complex(es) 10A, 10B, 10C will not participate in tagmentation.

[0079] Referring specifically to Fig. 1A, each of the transposome complexes 10A, 10B includes a transposase enzyme 12A, 12B non-covalently bound to a transposon end 14A, 14B. Each transposon end 14A, 14B is a double-stranded nucleic acid strand, one strand MEA or MEB of which is part of a transferred strand 16A, 16B and the other strand ME’A or ME’B of which is the non-transferred strand 18A, 18B. In other words, the transposon end 14A, 14B includes a portion of the respective transferred strand 16A, 16B that is hybridized to the non-transferred strand 18A, 18B.

[0080] The transferred strand 16A includes a 5’ end functional group 20A, a first amplification domain 26, and a sequencing primer sequence 28A that is attached to the strand MEA of the transposon end 14A. The strand MEA of the transposon end14A is positioned at the 3’ end of the transferred strand 16A. In some examples, the transferred strand 16A further includes an index sequence 30A positioned between the first amplification domain 26 and the sequencing primer sequence 28A. In other examples, the transferred strand 16A further includes the index sequence 30A positioned between the first amplification domain 26 and the sequencing primer sequence 28A, and an inosine 32A positioned between the 5’ end functional group 20A and the first amplification domain 26. The inosine 32A is desirable when fully adapted fragments formed using the transposome complex 10A are to be cleaved from the surface.

[0081] Similar to the transferred strand 16A, the transferred strand 16B includes a 5’ end functional group 20B, a second amplification domain 38, and a sequencing primer sequence 28B that is attached to the strand ME’B of the transposon end 14B. The strand ME’B of the transposon end 14B is positioned at the 3’ end of the transferred strand 16B. In some examples, the transferred strand 16B further includes an index sequence 30B positioned between the second amplification domain 38 and the sequencing primer sequence 28B. In other examples, the transferred strand 16B further includes the index sequence 30B positioned between the second amplification domain 38 and the sequencing primer sequence 28B, and an inosine 32B positioned between the 5’ end functional group 20B and the second amplification domain 38. The inosine 32B is desirable when fully adapted fragments formed using the transposome complex 10B are to be cleaved from the surface.

[0082] The 5’ end functional groups 20A, 20B may be any functional group that is capable of covalently or non-covalently attaching to surface functional groups of a bead 22 (see Fig. 2A) or a polymeric hydrogel 24 (see Fig. 2B), and thus will depend upon these surface functional groups. In one example, the surface functional groups of the bead 22 or polymeric hydrogel 24 include azide or tetrazine surface groups, and the 5’ end functional groups 20A, 20B respectively include a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1 .0]nonyne (BCN) or dibenzocyclooctyne (DBCO)). In another example, the surface functional groups of the bead 22 or polymeric hydrogel 24 are biotin surfacegroups, and the 5’ end functional groups 20A, 20B are each biotin. In these examples, additional streptavidin, or avidin or another avidin analog is added to indirectly attach the biotin groups to one another. In still another example, the bead 22 or polymeric hydrogel 24 is functionalized with one member of a binding pair, and the second member of the binding pair is used for each of the 5’ end functional group 20A, 20B.

[0083] The first and second amplification domains 26, 38 have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 attached to the polymeric hydrogel 24 (e.g., in a flow cell). The first amplification domain 26, its complement, and the primer 34, together with the second amplification domain 38, its complement, and the primer 36 enable the amplification of the DNA sample fragments generated during tagmentation.

[0084] Examples of suitable sequences for the first amplification domain 26 / primer 34 and for the second amplification domain 38 / primer 36 include P5 and P7 primer sequences; P15 and P7 primer sequences; or any combination of the PA primer sequences, the PB primer sequences, the PC primer sequences, and the PD primer sequences set forth herein. Examples of P5 and P7 primer sequences are used on the surface of commercial flow cells sold by Illumina Inc. for sequencing, for example, on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™, and other instrument platforms.

[0085] The P5 primer sequence is one of:P5 #1 : 5’ — > 3’AATGATACGGCGACCACCGAGAUCTACAC (SEQ. ID. NO. 1);P5 #2: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 2) where “n” is inosine in SEQ. ID. NO. 2; orP5 #3: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 3) where “n” is alkene-thymidine (i.e. , alkene-dT) in SEQ. ID. NO. 3. It is to be understood that SEQ. ID. NO. 2 is not used for the first amplification domain 26 when the additional inosine 32B is included.The P5’ sequence is the complement of any of the P5 examples.The P7 primer sequence may be any of the following:P7 #1 : 5’ — > 3’CAAGCAGAAGACGGCATACGAnAT (SEQ. ID. NO. 4)P7 #2: 5’ 3’CAAGCAGAAGACGGCATACnAGAT (SEQ. ID. NO. 5)P7 #3: 5’ 3’CAAGCAGAAGACGGCATACnAnAT (SEQ. ID. NO. 6) where “n” is 8-oxoguanine in each of SEQ. ID. NOS. 4-6. The P7’ sequence is the complement of any of the P7 examples.

[0086] In the examples of P5 and P7, the uracil, inosine, or “n” is a cleavage site 40A, 40B. The cleavage sites 40A, 40B are orthogonal (i.e., not susceptible to the same cleaving agent), so that after fully adapted fragments are generated and amplified, forward or reverse strands can be removed, for example, from a flow cell surface, while the other of the reverse or forward strands remain attached for exposure to sequencing.

[0087] It is to be understood that other sequences may be used for the amplification domains 26, 38 and for the primers 34, 36, as long as the combinationenables the desired amplification. As other examples, a P15, PA, PB, PC, or PD primer may be used.The P15 primer sequence is:P15: 5’ 3’AATGATACGGCGACCACCGAGAnCTACAC (SEQ. ID. NO. 7) where “n” is allyl-T (i.e. , a thymine nucleotide analog having an allyl functionality).The other primer sequences (PA-PD) mentioned above include:PA 5’ 3’GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ. ID. NO. 8)PB 5’ 3’CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ. ID. NO. 9)PC 5’ 3’ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ. ID. NO. 10)PD 5’ 3’GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ. ID. NO. 11 )

[0088] While not shown in the example sequences for PA-PD, it is to be understood that any of these sequences may include a cleavage site 40A, 40B such as uracil, 8-oxoguanine, allyl-T, diols, etc. at any point in the strand. As previously mentioned, the sequences for the first amplification domain 26 / primer 34 and for the second amplification domain 38 / primer 36 may be selected to have orthogonal cleavage sites 40A, 40B (i.e., one cleavage site is not susceptible to the cleavingagent used for the other cleavage site), so that after amplification, forward or reverse strands can be cleaved, leaving the other of the reverse or forward strands for sequencing.

[0089] Referring briefly to the primers 34, 36 used in the methods disclosed herein, each of the primers 34, 36 may also include a polyT sequence at the 5’ end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases. A linker may be attached to the polyT region that can covalently or non- covalently attach the primers 34, 36 to the polymeric hydrogel 24 and / or to the interstitial regions 54.

[0090] Referring back to Fig. 1 A, the sequencing primer sequences 28A, 28B have different sequences from each other that respectively bind to sequencing primers that are introduced, e.g., to a flow cell surface after amplification has been performed. As examples, the sequencing primer sequences 28A may bind a sequencing primer that primes synthesis of a new strand that is complementary, e.g., to forward strand fragments / fragment amplicons and the sequencing primer sequence 28B may bind a sequencing primer that primes synthesis of a new strand that is complementary, e.g., to reverse strand fragments / fragment amplicons.

[0091] The transposon ends 14A, 14B of each transposome complex 10A, 10B include the strands MEA, MEB respectively hybridized to the strands ME’ , ME’B. AS such, the strands MEA, ME’A are complementary and the strands MEB, ME’B are complementary. The double stranded transposon ends 14A, 14B are respectively capable of complexing with the transposases 12A, 12B. As examples, the strands MEA, ME’A and MEB, ME’B of the transposon ends 14A, 14B may be the related but non-identical 19-base pair (bp) outer end (e.g., strands MEA, ME’A) and inner end (e.g., strands MEB, ME’B) sequences that serve as the substrate for the activity of the Tn5 transposase, or the mosaic ends recognized by a wild-type or mutant Tn5 transposase, or the R1 end (e.g., strands MEA, ME’A) and the R2 end (strands MEB, ME’B) recognized by the MuA transposase.

[0092] When included, the index sequences 30A, 30B of the transposome complexes 10A, 10B are the same, and include a particular nucleic acid sequence that functions as a barcode for the DNA sample tagmented with the transposome complexes 10A, 10B. As will be described herein in reference to the Fig. 5 and Fig. 6 series, differently indexed transposomes complexes can be used to tagment and enrich different DNA samples that are ultimately sequenced at the same time on the flow cell. The unique indexes can be used for sample identification. Index sequences 30A, 30B may range from 7 bases to 15 bases long.

[0093] In the examples disclosed herein, the non-transferred strands 18A, 18B are made up of the strands ME’A, ME’B.

[0094] Referring now to Fig. 1 B, the dimer includes transposome complexes 10A, 10C that are capable of asymmetric attachment to a surface.

[0095] The transposome complex 10A may be any of the examples described in reference to Fig. 1 A, which include the transferred strand 16A having the 5’ end functional group 20A that is capable of attaching to the bead 22 or polymeric hydrogel surface 24. In contrast to the transposome complex 10A, the transferred strand 16C of the transposome complex 10C does not include the 5’ end functional group for surface attachment. Rather, the non-transferred strand 18C includes a 3’ end functional group 42 for surface attachment.

[0096] As shown in Fig. 1 B, the transposome complex 10C includes a transposase enzyme 12C non-covalently bound to the transposon end 140. The transposon end 14C is a double-stranded nucleic acid strand, one strand (e.g., MEc) of which is part of the transferred strand 16C and the other strand (e.g., ME’c) of which is a part of the non-transferred strand 18C. Any of the example strands for the transposon end 14A, 14B (e.g., MEA and ME’A) described herein may be used.

[0097] In the transposome complex 10C, the transferred strand 16C includes a second amplification domain 38’ and a sequencing primer sequence 28C that is attached to one strand MEc of the transposon end 14C. In some examples, the transferred strand 10C includes an index sequence 30C between the secondamplification domain 38’ and the sequencing primer sequence 28C. The strand MEc of the transposon end 14C is positioned at the 3’ end of the transferred strand 16C.

[0098] The first and second amplification domains 26, 38’ of the transposome complexes 10A, 10C have different sequences from each other, but have the same sequence, respectively, as first and second primers 34, 36 described herein.Examples of suitable sequences for the second amplification domain 38’ are the same as those set forth herein for the second amplification domain 38 / primer 36.

[0099] Similar to the sequencing primer sequences 28A, 28B, the sequencing primer sequences 28A, 28C have different sequences from each other that respectively bind to sequencing primers introduced during sequencing.

[0100] As mentioned, the transposome complexes 10A, 10C are configured for asymmetric attachment to the bead or flow cell surface. As such, one of the complexes, e.g., complex 10C, includes a 3’ end functional group 42 for attachment to the surface, and the other of the complexes, e.g., complex 10A, includes the 5’ end functional group 20Afor attachment to the surface. The 3’ end functional group 42 and the 5’ end functional group 20A may be any functional group that is capable of covalently or non-covalently attaching, directly or indirectly, to surface functional groups of the bead 22 or the polymeric hydrogel 24. In one example, the polymeric hydrogel 24 includes azide or tetrazine surface groups, and the 3’ end functional group 42 and the 5’ end functional group 20A each include a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1 .0]nonyne (BCN)). In another example, the polymeric hydrogel 24 includes biotin surface groups, and each of the 3’ end functional group 42 and the 5’ end functional group 20A is biotin. In these examples, additional streptavidin or avidin or another avidin analog is added to indirectly attach the biotin groups to one another as described herein. Still other reactive pairs (e.g., RAof the polymeric hydrogel 24 and the groups 42, 20A) include tetrazine / TCO, amine / carboxylic acid, amines / alkyl halydes, thiol / alkene, or thiol / carboxylic acid.

[0101] When the inosine 32C is included in the transposome complex 10C, it is incorporated into the non-transferred strand 10C so that it is positioned between the strand ME’c and the 3’ end functional group 42.

[0102] The transposome complexes 10A and 10B or the transposome complexes 10A and 10C may be used together in several of the methods described herein.

[0103] In other example, the transposome complexes are universal transposome complexes 10D, 10E (see Fig. 1 C and Fig. 1 D), 10D’, 10E’ (see Fig. 1 F), and 10D”, 10E” (see Fig. 1 G). In each of these figures, the universal transposome complexes 10D, 10E, 10D’, 10E’, 10D”, 10E” are respectively shown as homo-dimers. The universal transposome complexes 10D, 10E, 10D’, 10E’, 10D”, 10E” do not include the amplification domains 26, 38 or the index sequences 30, and thus can be used to tagment several DNA samples that can subsequently be pooled together.

[0104] Referring specifically to Fig. 1 C and Fig. 1 D, each of the transposome complexes 10D, 10E includes the transposase enzyme 12D, 12E non-covalently bound to a transposon end 14D, 14E. Each transposon end 14D, 14E is a doublestranded nucleic acid strand, one strand MED, MEE of which is the transferred strand 16D, 16E and the other strand ME’D, ME’E of which is part of the non-transferred strand 18D, 18E. In other words, the transposon ends 14D, 14E respectively include the transferred strand 16D, 16E hybridized to a portion of the non-transferred strand 18D, 18E.

[0105] In this example, each transferred strand 16D, 16E has a 5’ phosphate (5’P), which acts a substrate for a ligase, and thus enables respective ligation of the unique dual indexed strands 104A, 104B (each of which is shown in Fig. 1 E). Also in this example, each of the non-transferred strands 18D, 18E includes a complement 28’D, 28’E of the sequencing primer sequences 28D, 28E.

[0106] The unique dual indexed strands 104A, 104B are shown in Fig. 1 E. During methods that utilized these strands 104A, 104B, the strand 104A is ligated to the transferred strand 16D and the strand 104B is ligated to the transferred strand 16E. These strands 104A, 104B add two unrelated, non-redundant index sequences31 A, 31 B to each of the fully adapted DNA fragments that are generated from an individual DNA sample. Together, the index sequences 31 A, 31 B uniquely identify the particular DNA sample.

[0107] The strand 104A includes, from the 3’ end to the 5’ end, the sequencing primer sequence 28D, a first index sequence 31 A, and the first amplification domain 26D. Similarly, the strand 104B includes, from the 3’ end to the 5’ end, the sequencing primer sequence 28E, a second index sequence 31 B, and the second amplification domain 38E. Similar to other sequencing primer sequences, e.g., 28A, 28B, described herein, the sequences 28D, 28E in this example have different sequences from each other that respectively bind to sequencing primers that are introduced, e.g., to a flow cell surface after amplification has been performed. Also in this example, the first and second index sequences 31 A, 31 B form a unique dual index (UDI) for the DNA sample to which the strands 104A, 104B are ligated. Still further in this example, the first and second amplification domains 26D, 38E have the same sequences, respectively, as primers 34, 36 that are present on a surface of the flow cell that is to be used for amplification of the fully adapted DNA fragments generated in conjunction with the method shown in the figure 8 series.

[0108] One or both of the strands 104A, 104B also includes a 5’ end functional group that can attach the resulting bound complex to the flow cell surface. In the example shown, the strand 104A includes the 5’ end functional group 20D. Additionally or alternatively, the strand 104B could include the 5’ end functional group. The 5’ end functional group may be any of the examples set forth herein that can attach the transposome complexes 10A, 10B, 10C to the bead 22 or the polymeric hydrogel 24. In one example, the 5’ end group(s) is / are biotin.

[0109] Other examples of the transposome complexes 10D’, 10E’ and 10D”, 10E” and the corresponding strands 104A, 104B’ and 104A”, 104B” are respectively shown in Fig. 1 F and in Fig. 1 G.

[0110] In the example shown in Fig. 1 F, the sequencing primer sequences 28D, 28E of the strands 104A, 104B (shown in Fig. 1 E) are split between the transposome complexes 10D’, 10E’ and the corresponding strands 104A, 104B’.

[0111] Each of the transposome complexes 10D’, 10E’ includes the transposase enzyme 12D’, 12E’ non-covalently bound to a transposon end 14D’, 14E’. Each transposon end 14D’, 14E’ is a double-stranded nucleic acid strand, one strand MED’, MEF' of which is the transferred strand 16D’, 16E’ and the other strand ME’D1, ME’F’ of which is part of the non-transferred strand 18D’, 18E’. In other words, the transposon ends 14D’, 14E’ respectively include the transferred strand 16D’, 16E’ hybridized to a portion of the non-transferred strand 18D’, 18E’.

[0112] In this example, each transferred strand 16D’, 16E’ includes respective first portions 28D-1 , 28E-1 of the desired sequencing primer sequences (not shown). The second portions 28D-2, 28E-2 of the desired sequencing primer sequences are part of the dual indexed strands 104A’, 104B’, respectively. When the strands 104A’, 104B’ are ligated to the transferred strand 16D’, 16E’, the two portions 28D-1 plus 28D-2, 28E-1 plus 28E-2 form the sequencing primer sequences.

[0113] Each transferred strand 16D’, 16E’ also includes a 5’ phosphate (5’P), which acts a substrate for a ligase, and thus enables respective ligation of the unique dual indexed strands 104A, 104B’ (also shown in Fig. 1 F).

[0114] Similar to the non-transferred strands 18D, 18E, each of the nontransferred strands 18D’, 18E’ includes a complement 28’D, 28’E of the total sequencing primer sequence, which, as mentioned, is 28D-1 plus 28D-2, 28E-1 plus 28E-2.

[0115] The unique dual indexed strands 104A, 104B’ are also shown in Fig. 1 F. During some examples of the method, the strand 104A is ligated to the transferred strand 16D’ and the strand 104B’ is ligated to the transferred strand 16E’. These strands 104A, 104B’ add two unrelated, non-redundant index sequences 31 A, 31 B to each of the fully adapted DNA fragments of an individual DNA sample. Together, the index sequences 31 A, 31 B uniquely identify the particular DNA sample.

[0116] The strand 104A includes, from the 3’ end to the 5’ end, the second portion of the sequencing primer sequence 28D-2, the first index sequence 31 A, and the first amplification domain 26D. Similarly, the strand 104B’ includes, from the 3’ endto the 5’ end, the second portion of the sequencing primer sequence 28E-2, the second index sequence 31 B, and the second amplification domain 38E.

[0117] In the example shown in Fig. 1 G, alternative sequences 106, 108 are included in respective the transferred strands 16D”, 16E” and splint oligonucleotides 110, 112 are attached to the unique dual indexed strands 102A”, 102B”.

[0118] Each of the transposome complexes 38E”, 38F” includes the transposase enzyme 12D”, 12E” non-covalently bound to a transposon end 14D”, 14E”. Each transposon end 14D”, 14E” is a double-stranded nucleic acid strand, one strand MED-, MEF- of which is the transferred strand 16D”, 16E” and the other strand ME’D”, ME’F- of which is part of the non-transferred strand 18D”, 18E”. In other words, the transposon ends 14D”, 14E” respectively include the transferred strand 16D”, 16E” hybridized to a portion of the non-transferred strand 18D”, 18E”.

[0119] In this example, each transferred strand 16D”, 16E” includes respective additional sequences 106, 108. These sequences 106, 108 are different from each other so that their respectively complementary sequences 106’, 108’ (part of the respective splint oligonucleotides 110, 112) can bind to the sequences 106, 108, but not to the other of the sequences 108, 106.

[0120] Each transferred strand 16D”, 16E” also includes a 5’ phosphate (5’P), which acts a substrate for a ligase, and thus enables respective ligation of the unique dual indexed strands 104A”, 104B” (also shown in Fig. 1 G).

[0121] Unlike the non-transferred strands 18D’, 18E’, each of the nontransferred strands 18D”, 18E” is made up of the strand ME’D”, ME F and does not include a complement 28’D, 28’E of the sequencing primer sequence.

[0122] The unique dual indexed strands 104A”, 104B” are also shown in Fig. 1 G. During some examples of the method, the strand 104A” is hybridized to the sequence 106 via one portion 106’ of the splint oligonucleotide 110, and is ligated to the transferred strand 16D”. Similarly, the strand 104B” is hybridized to the sequence 108 via one portion 108’ of the splint oligonucleotide 112, and is ligated to the transferred strand 16E”. These strands 104A”, 104B” add two unrelated, non- redundant index sequences 31 A, 31 B to each of the fully adapted DNA fragments ofan individual DNA sample. Together, the index sequences 31 A, 31 B uniquely identify the particular DNA sample.

[0123] The strand 104A” includes, from the 3’ end to the 5’ end, the sequencing primer sequence 28D, the first index sequence 31 A, and the first amplification domain 26D, and also includes the splint oligonucleotide 110 hybridized thereto through the sequencing primer complement 28’D. Similarly, the strand 104B” includes, from the 3’ end to the 5’ end, the sequencing primer sequence 28E, the second index sequence 31 B, and the second amplification domain 38E, and also includes the splint oligonucleotide 112 hybridized thereto through the sequencing primer complement 28’E.

[0124] The examples shown in Fig. 1 F and Fig. 1 G extend the transferred strands 16D’, 16D”, 16D’, 16F” beyond the strands MED’, MEr and MED", MEr- in order to provide more access for the ligase.

[0125] Flow Cells

[0126] Each of the methods uses an example of a flow cell 44A (Fig. 2B), 44B (Fig. 3B and Fig. 4A), 44C (Fig. 5 series), 44D (Fig. 6 series), 44E (Fig. 7 series). The flow cells are collectively referred to with reference numeral “44” and the alphanumeric reference numerals (e.g., 44A, 44B, etc.) set forth in some of the figures identifies a specific one of the flow cells that is shown in a particular figure. The flow cells 44 will now be described.

[0127] Some examples of the flow cell 44 include a patterned substrate 46 (see Fig. 2B, Fig. 3B, Fig. 4A, Fig. 5A, and Fig. 7C) and a lid 56 (see Fig. 4A and Fig. 4B) or a second patterned substrate (not shown) attached to the patterned substrate 46. Other examples of the flow cell 44 include one patterned substrate 46, which is not bonded to another component, but rather, is open to the surrounding environment.

[0128] The patterned substrate 46 may be a single layered structure or a multilayered structure, the latter of which is shown in some of the figures.

[0129] Examples of suitable materials for the single layered structure version of the patterned substrate 46 include epoxy siloxane, glass, modified or functionalizedglass, polymeric materials (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cyclo-olefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamides), etc.), ceram ics / ceramic oxides, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2Os) or other tantalum oxide(s) (TaOx), hafnium oxide (HfO2), carbon, metals, or the like.

[0130] When the single layered structure is used, depressions 52 are defined at a surface of the structure and are separated by interstitial regions 54. The surface of the single layered structure defines the interstitial region 54.

[0131] Examples of the multi-layered structures include a base support 48 and a patterned material 50 positioned over the base support 48. The base support 48 may be any of the examples set forth herein for the single layered structure. The patterned material 50 may be any material that is capable of being patterned with the depressions 52.

[0132] In an example, the patterned material 50 may be an inorganic oxide that is selectively applied to the base support 48, e.g., via vapor deposition, aerosol printing, or inkjet printing, in the desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta2Ob), aluminum oxide (e.g., AI2O3), silicon oxide (e.g., SiO2), hafnium oxide (e.g., Hft ), etc. In another example, the patterned material 50 may be a resin matrix material that is applied to the base support 48 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, etc. Some examples of suitable resins include a polyhedral oligomeric silsesquioxane-based resin, a non-polyhedral oligomeric silsesquioxane epoxy resin, a polyethylene glycol) resin, a polyether resin (e.g., ringopened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP® from Bellex), and combinations thereof.

[0133] In an example, the patterned substrate 46 may be round and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular sheet or panel having its largest dimension up to about 10 feet (~ 3 meters). In an example, the patterned substrate 46 is a wafer having a diameter ranging from about 200 mm to about 300 mm. Wafers may subsequently be diced to form an individual flow cell substrate. In another example, the patterned substrate 46 is a die having a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that a patterned substrate 46 with any suitable dimensions may be used. For another example, a panel may be used that is a rectangular support, which has a greater surface area than a 300 mm round wafer.Panels may subsequently be diced to form individual flow cells.

[0134] Each flow cell 44 also includes a flow channel 58 (see, e.g., Fig. 4A and Fig. 4B). In the example shown in Fig. 4A and Fig. 4B, the flow channel 58 is an enclosed channel that is defined between the patterned substrate 46 and the lid 56. In an alternate example, the enclosed flow channel is defined between two patterned substrates 46 that are bonded together. In enclosed versions of the flow cell 44, a separate material 59 may attach portions of the patterned substrate 46 to the lid 56 or other patterned substrate so that the separate material 59 defines at least a portion of the walls of the flow channel 58.

[0135] When the patterned substrate 46 is open to the surrounding environment, the flow channel 58 may be a lane that is defined in the patterned substrate 46, and the depressions 52 may be defined within the lane.

[0136] While a single flow channel 58 is shown in Fig. 4A and Fig. 4B, it is to be understood that any example of the flow cell 44 may include any number of flow channels 58 (e.g., four channels, eight channels, etc.). With multiple channels, it is to be understood that each flow channel 58 may be isolated from each other flow channel 58 so that fluid introduced into any particular flow channel 58 does not flowinto any adjacent flow channel 58. Separation may be obtained through the material 59, which can be applied at the perimeter of each flow channel 58 and at the perimeter of the entire flow cell 44.

[0137] The length and width of the flow channel 58 may be smaller, respectively, than the length and width of the patterned substrate 46 so that a portion of the substrate surface surrounds the flow channel 58 and is available for attachment to another patterned substrate 46 or to the lid 56, or is available to define the perimeter of the open flow channel 58. In some instances, the width of each flow channel 58 can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some instances, the length of each flow channel 58 can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each flow channel 58 can be greater than, less than or between the values specified above. In another example, the flow channel 58 is square (e.g., 10 mm x 10 mm).

[0138] The depth / height of each flow channel 58 can be as small as a few monolayers thick, for example, when microcontact, aerosol, or inkjet printing is used to deposit the separate material 60 that partially defines the flow channel walls. In other examples, the depth / height of each flow channel 58 can be about 1 pm, about 10 pm, about 50 pm, about 100 pm, or more. In an example, the depth / height may range from about 10 pm to about 100 pm. In another example, the depth / height is about 5 pm or less. It is to be understood that the depth / height of each flow channel 58 can also be greater than, less than or between the values specified above. The depth / height of the flow channel 58 also varies along the length and width of the flow cell 44, e.g., because of the depressions 52.

[0139] Each of the flow cells 44 includes depressions 52 that are defined in the single layered structure or in the outermost layer of the multi-layered structure, and that are separated by interstitial regions 54. Many different layouts of the depressions 52 may be envisaged, including regular, repeating, and non-regular patterns. In an example, the depressions 52 are disposed in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts,triangular layouts, and so forth. In some examples, the layout or pattern can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the depressions 52 and the interstitial regions 54.

[0140] The layout or pattern may be characterized with respect to the density (number) of the depressions 52 in a defined area. For example, the depressions 52 may be present at a density of approximately 2 million per mm2. The density may be tuned to different densities including, for example, a density of about 100 per mm2, about 1 ,000 per mm2, about 0.1 million per mm2, about 1 million per mm2, about 2 million per mm2, about 5 million per mm2, about 10 million per mm2, about 50 million per mm2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used. As examples, a high density array may be characterized as having depressions 52 separated by less than about 100 nm, a medium density array may be characterized as having the depressions 52 separated by about 400 nm to about 1 pm, and a low density array may be characterized as having the depressions 52 separated by greater than about 1 pm.

[0141] The layout or pattern of the depressions 52 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one depression 52 to the center of an adjacent depression 52 (center-to-center spacing) or from the right edge of one depression 52 to the left edge of an adjacent depression 52 (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.1 pm, about 0.5 pm, about 1 pm, about 5 pm, about 10 pm, about 100 pm, or more or less. The average pitch for a particular pattern can be between one of the lower values and one of the upper values selected from the ranges above. In an example, the depressions 52 have a pitch (center-to-center spacing) of about 1 .5 pm. While example average pitch values have been provided, it is to be understood that other average pitch values may be used.

[0142] The size of each depression 52 may be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume can range from about 1 x10"3pm3to about 100 pm3, e.g., about 1 *10“2pm3, about 0.1 pm3, about 1 pm3, about 10 pm3, or more, or less. For another example, the opening area can range from about 1 xW3pm2to about 100 pm2, e.g., about 1 X10-2pm2, about 0.1 pm2, about 1 pm2, at least about 10 pm2, or more, or less. For still another example, the depth can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less. For yet another example, the diameter or each of the length and width can range from about 0.1 pm to about 100 pm, e.g., about 0.5 pm, about 1 pm, about 10 pm, or more, or less.

[0013] In each example of the flow cell 44, the depressions 52 house surface chemistry that enable designated reaction(s) (e.g., tagmentation, sample attachment, amplification, etc.) to take place. The individual surface chemistries will be discussed below in reference to the individual figures in which they are depicted. All of the flow cells 44 include the polymeric hydrogel 24 in the depressions 52, which will now be described.

[0144] As examples, the polymeric hydrogel 24 may be poly(N-(5- azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM) or another of the acrylamide copolymers disclosed herein, PEG-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, crosslinked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymers (PEO-PPO), poly(hydroxyethyl methacrylate) (PHEMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymers, polyethylene glycol)-poly(lactic-co-glycolic acid) block copolymers, poly(acrylic-co-vinylsulfonic acid), poly(acrylamide-co-vinylsulfonic acid), poly(L-aspartic acid), poly(aspartamide), adipic dihydrazide modified or aldehyde modified poly(L-glutamic acid), bisacrylamide, or hydrogels based on one or more of polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, and collagen, or combinations or mixtures thereof.

[0015] In some of the examples disclosed herein, the polymeric hydrogel 24 is a copolymer including at least one acrylamide monomer unit, and is a linear polymeric hydrogel or a branched polymeric hydrogel (e.g., a dendrimer).

[0146] The linear or branched polymeric hydrogel may include a first recurringR1is selected from the group consisting of -H, a halogen, an alkyl, an alkoxy, an alkenyl, an alkynyl, a cycloalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof;R2is selected from the group consisting of an azido, an optionally substituted amino, an optionally substituted alkenyl, an optionally substituted alkyne, a halogen, an optionally substituted hydrazone, an optionally substituted hydrazine, a carboxyl, a hydroxy, an optionally substituted tetrazole, an optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; each (CH2)Pcan be optionally substituted; and p is an integer from 1 to 50; and a second recurring unit of formula (II):, wherein: each of R3,R3’, R4, R4’ is independently selected from the group consisting of -H, R5, -OR5, - C(O)OR5, -C(O)R5, -OC(O)R5, -C(O)NR6R7, and -NR6R7; R5is selected from the group consisting of -H, -OH, an alkyl, a cycloalkyl, a hydroxyalkyl, an aryl, a heteroaryl, a heterocycle, and optionally substituted variants thereof; and each of R6and R7is independently selected from the group consisting of -H and an alkyl.

[0017] In an example of the polymeric hydrogel, R1is -H; R2is an azido; each of R3’, R4, and R4' is -H; R3is -C(O)NR6R7, where each of R6and R7is -H; and p is 5.This polymeric hydrogel is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, or PAZAM. In a variation of PAZAM, R1is -H; R2is an azido; each of R3, R4, and R4’ is -H; R3is -C(O)NR6R7, where each of R6and R7is a C1-C6 alkyl (e.g., -CH3); and p is 5.

[0148] In some examples, R2of some of the recurring units of formula (I) is replaced with tetramethylethylenediamine (TEMED). TEMED is a reaction promoter that may be introduced during copolymerization. As a result of a side reaction, TEMED replaces some of the azide (N3) or other R2groups. While this reaction reduces the azide (or other R2examples) content of the copolymer chains, it also introduces a branching site. The branching sites may provide a location where the copolymer chains can branch to one other.

[0149] In other examples, a third recurring unit of formula (II) may be included, with the caveat that the second and third recurring units are different. For example, in the second recurring unit each of R3, R4, and R4’ is -H; R3is -C(O)NR6R7, where each of R6and R7is -H, and in the third recurring unit, each of R3’, R4, and R4’ is -H; R3is - C(O)NR6R7, where each of R6and R7is a C1 -C6 alkyl.

[0150] The number of first recurring units (formula (I)) may be an integer ranging from 2 to 50,000, and the number of second recurring units (formula (II)) may be an integer ranging from 2 to 100,000. When the third recurring unit is included, the number of units may be an integer in the range of 1 to 100,000. It is to be understood that the incorporation of the individual units may be statistical, random, or in block, and may depend upon the method used to synthesize the polymeric hydrogel 24.

[0151] In other examples of the polymeric hydrogel 24, the first recurring unit of formula (I) may be replaced with a heterocyclic azido group of formula (III):wherein R8is H or a C1-C6 alkyl; R9is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0152] In one example of the polymeric hydrogel 24, formula (III) is the first recurring unit and formula (II) is the second recurring unit. In another example, formula (III) is the first recurring unit, one example of formula (II) is the second recurring unit, and a different example of formula (III) is the third recurring unit.

[0153] It is to be understood that other hydrogel materials may be used for the polymeric hydrogel 24.

[0154] Other examples of other suitable polymeric hydrogels include functionalized polysilanes, such as norbomene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other polysilane having functional groups that can attach the oligonucleotide primers 14, 16. Other examples of suitable polymeric hydrogels include those having a colloidal structure, such as agarose; or a polymer mesh structure, such as gelatin; or a crosslinked polymer structure, such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or an azidolyzed version of SFA. Examples of suitablepolyacrylamide polymers may be synthesized from acrylamide and an acrylic acid or an acrylic acid containing a vinyl group, or from monomers that form [2+2] photocycloaddition reactions. Still other examples of suitable polymeric hydrogel materials include mixed copolymers of acrylamides and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamides, acrylates etc.) may be utilized in the examples disclosed herein, such as highly branched polymers, including dendrimers. For example, the monomers (e.g., acrylamide, etc.) may be incorporated, either randomly or in block, into the branches (arms) of a dendrimer.

[0155] In the flow cell 44A shown in Fig. 2B, each depression 52 houses the polymeric hydrogel 24 and the following surface chemistry: the transposome complexes 10A and 10B or 10C and the primers 34, 36. Alternatively, the flow cell 44A may be used for tagmentation, and thus may include the polymeric hydrogel 24 and the transposome complexes 10A and 10B or 10C in each depression 52, and a second flow cell (not shown) may be used for amplification and sequencing. This second flow cell is similar to the example shown in Fig. 2B, except that it includes the polymeric hydrogel 24 and the primers 34, 36 in each depression 52 (without the transposome complexes 10A and 10B or 10C). While the example shown in Fig. 2B illustrates the transposome complexes 10A and 10B or 10C attached within the depressions 52, it is to be understood that the transposome complexes 10A and 10B or 10C may also or alternatively be attached to the interstitial regions 54. When attached to the interstitial regions 54, it is to be understood that the 5’ end functional groups 20A, 20B or the 5’ end functional group 20A and the 3’ end functional group 42 of the transposome complexes 10A and 10B or 10C are selected to attach to the patterned material 50 (or the single layered structure if used as the patterned structure 46) or to another layer that may be introduced to the interstitial regions 54 during flow cell manufacturing or the assay workflow.

[0156] In this example, the functional groups in one or more of the recurring units of the polymeric hydrogel 24 are capable of attaching the primers 34, 36, or both the primers 34, 36 and the transposome complexes 10A and 10B or 10C. These functional groups (e.g., R2in formula (I), NH2, N3, etc.) may be located in the sidechains of the linear or branched polymeric hydrogel material 24. In these instances, the inosine 32A may be included in the transposome complexes 10A and 10B or 10C to enable cleavage. For attachment of the transposome complexes 10A and 10B or 10C, the polymeric hydrogel 24 may alternatively be biotinylated. In this example, biotin 60 is attached to the surface of the polymeric hydrogel 24 through some of the R2groups (e.g., the azide, tetrazine, or other functional groups that can attach to an alkyne). The biotin 60 is attached to a linker, such as bicyclo[6.1 .0]nonyne (BCN), which can covalently attach to some of the R2groups. In other examples, streptavidin 62 and biotin 60 are attached to one another, and the biotin portion is attached to the surface of the polymeric hydrogel 24 through some of the R2groups or the linker. In this example, the 5’ end functional groups 20A, 20B or the 5’ end functional group 20A and the 3’ end functional group 42 of the transposome complexes 10A and 10B or 10C are each biotin. Other binding pairs may be used instead of biotin 60 and streptavidin 62, such as: those capable of peptide coupling (e.g., spytag and a spycatcher); a NiNTA (nickel- nitrilotriacetic acid) ligand and a histidine tag; or biotin and streptavidin. When biotin 60 is used for transposome complexes 10A and 10B or 10C attachment, the flow cell 44A may be reused by removing used transposome complexes 10A and 10B or 10C (e.g., using formamide) and introducing fresh transposome complexes 10A and 10B or 10C.

[0157] As will be described in reference to Fig. 2A through Fig. 2B, the flow cell 44A is used for a second tagmentation followed by amplification and sequencing of the enriched sample fragments.

[0158] In the flow cell 44B shown in Fig. 3B, each depression 52 houses the polymeric hydrogel 24 and the following surface chemistry: the primers 34, 36, transposome binding sites 66, and a plurality of dead Cas nuclease / RNA guide complexes 64.

[0159] In this example, the functional groups in one or more of the recurring units of the polymeric hydrogel 24 are capable of attaching the primers 34, 36, or both the primers 34, 36 and the transposome complexes 10A and 10B or 10C. When the functional groups of the polymeric hydrogel 24 are capable of attaching thetransposome complexes 10A and 10B or 10C, the functional groups are one example of the transposome binding sites 66. Other examples of the transposome binding site 66 include the biotin 60 or the biotin 60-streptavidin 62 attached to the surface of the polymeric hydrogel 24 through some of the R2groups (e.g., the azide, tetrazine, or other functional group that can attach to an alkyne). While the example shown in Fig. 3C illustrates the transposome complexes 10A and 10B or 10C attached within the depressions 52, it is to be understood that the transposome complexes 10A and 10B or 10C may also or alternatively be attached to the interstitial regions 54. When attached to the interstitial regions 54, it is to be understood that the 5’ end functional groups 20A, 20B or the 5’ end functional group 20A and the 3’ end functional group 42 of the transposome complexes 10A and 10B or 10C are selected to attach to the patterned material 50 (or the single layered structure if used as the patterned structure 46) or to another layer that may be introduced to the interstitial regions 54 during flow cell manufacturing or the assay workflow.

[0160] The dead Cas nuclease / RNA guide complex 64 includes a mutated version of the wild type Cas nuclease. In this Cas nuclease, one or more key amino acid residuals participating in DNA excision are mutated into other residuals. This renders the nuclease incapable of DNA excision. However, the DNA binding capability is retained. Also in this example, the RNA sequence includes a portion that can bind to a target sequence of at least some of the DNA fragments formed by the method described in reference to Fig. 3A (which are subsequently introduced into the flow cell 44B). To form the dead Cas nuclease / RNA guide complex 64, the mutated Cas nuclease and the RNA sequence (including the target sequence binding portion) are first mixed together in a buffer and allowed to incubate to form a complex. The mixture is incubated for about 10 minutes at room temperature, or for about 5 minutes at 37°C, or for at least 20 minutes on ice. The dead Cas nuclease / RNA guide complex 64 bind DNA fragments containing the target sequence without cutting the DNA fragments.

[0161] Once prepared, the dead Cas nuclease / RNA guide complex 64 may be introduced into each depression 52 using a high precision gantry tool, a printing method, or via some other selective deposition technique. The attachment of the deadCas nuclease / RNA guide complexes 64 in the depressions 52 may be through covalent bonding to the functional groups in one or more of the recurring units of the polymeric hydrogel 24. A chemical moiety that can covalently bond to the functional groups may be added to the Cas nuclease or the structurally exposed portions of the RNA guide. The dead Cas nuclease / RNA guide complex 64 may be introduced into the flow cell 44B during its manufacturing. Alternatively, the dead Cas nuclease / RNA guide complex 64 may be introduced into the flow cell 44B as part of the method, e.g., prior to the introduction of the enriched sample fragment.

[0162] As will be described in reference to Fig. 3A through Fig. 3D, the flow cell 44B is used for enriched sample fragment capture, followed by tagmentation, amplification, and sequencing of the enriched sample fragments.

[0163] The flow cell 44B can also include a removable coating 68 overlying the patterned substrate 64, including over the depressions 52 and the surface chemistry contained therein. The removable coating 68 enables selective exposure to the surface chemistry located in a predetermined area of the flow cell 44B. In turn, the selective exposure enables multiple DNA fragments (containing the same or different target sequences) to be sequentially introduced into the flow cell 44B, and then simultaneously sequenced on the flow cell 44B.

[0164] The removable coating 68 may be any material that melts, collapses, softens, solubilizes, or permeabilizes upon exposure to a predetermined stimulus, such as light, heat, or a pH change.

[0165] Removable coatings 68 that are responsive to light are made of photocleavable materials.

[0166] In some examples, the light removable coating is a hydrophilic polymer cross-linked with a photo-cleavable cross-linker, an acid-labile cross-linker, and / or a heat-labile crosslinker. In one specific example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer, and the photo-cleavable cross-linker is a coumarin or o-nitrobenzyl moiety. The coumarin or o-nitrobenzyl moieties may covalently conjugate with poly(ethylene glycol) of the polyvinyl alcohol / polyethylene glycol graft copolymer. The coumarin or o-nitrobenzyl is cleavable upon exposure toultraviolet (UV) (100 nm to 400 nm) or blue light (450 nm to 495 nm), which leads to decreased cross-linking density of the coating. Thus, upon light exposure, the cleaved polymer coating becomes hydrophilic and washable by an aqueous solution. In another example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer, and the photo-cleavable cross-linker is an acid-labile cross-linker. In this example, the acid-labile cross-linker is an acetal moiety. With the acid-labile cross-linker, an acid species can be generated in the presence of a photoacid generator (PAG) and upon exposure to UV light, which changes the pH and cleaves the cross-linker, thus rendering the polymeric coating more soluble (and easily removable via rinsing).

[0167] In other examples, the light removable coating is a hydrophilic polymer capped with a photo-cleavable hydrophobic group or an acid-labile group. The photo- cleavable hydrophobic groups or acid-labile groups are protective groups on the polymer side chains that render the polymer more hydrophobic. These examples undergo a phase transition from hydrophobic to hydrophilic upon exposure to light. In an example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer, which is functionalized with the photo-cleavable hydrophobic group, such as a coumarin or o- nitrobenzyl moiety. These photo-cleavable groups are generally hydrophobic, which prevents the coating 68 from being removed and washed away by an aqueous solution. Upon exposure to UV or visible light, these hydrophobic groups will be cleaved, returning the removable coating 68 back to its hydrophilic form. In another example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer, which is functionalized with an acid-labile group. An acid species can be generated in the presence of a photoacid generator (PAG) and upon exposure to UV light, which cleaves the acid-labile group. In one example, the cleavage of tert-butyl carbonate groups leads to the hydrophilic polyphenol coating, which is washable and removable by an aqueous solution.

[0168] In still other examples, the light removable coating is a thermo- responsive polymer and a photo-thermal additive (or photo-thermal filler). The thermo- responsive polymer may be selected from the group consisting of polylactic acid, poly(lactic-co-glycolic) acid, polycaprolactone, agarose, wax, poly(acrylamide-co- acrylonitrile), poly(A / -isopropylacrylamide), cyclodextrins, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and a combination thereof. The photo-thermal additive or photo-thermal filler included in the composite may be nano-sized or any micro-sized structures that absorb light (e.g., photonic) energy at a certain wavelength range and convert the absorbed energy to heat. The photo-thermal filler (or photo-thermal additive) may be selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole particles, graphene sheets, carbon nanotubes, carbon nanodots, black phosphorus particles, azobenzene particles, and combinations thereof. Upon exposure to UV or visible light, energy absorbed by the photo-thermal additive(s) is converted to heat, which induces a phase transition in the polymer matrix (due to the presence of the thermo-responsive polymer). This phase transition causes this light removable coating to soften or dissolve. The softened or dissolved coating can then be removed using an aqueous solvent.

[0169] Still other light removable coatings are light and pH responsive. With these coatings, exposure to light induces proton release. Examples of these light removable coatings include 2-Naphthol-6,8-disulfonic acid or 1 ,2-Naphthoquinone-2- diazide-5-sulfonic acid.

[0170] Heat removable coatings are made of thermo-responsive materials. As an example, the thermo-responsive material may be a polymer, a wax, or a myristic acid that melts upon reaching a certain temperature. As another example, the thermo- responsive material may be a polymer that transitions from a hydrophobic state to a hydrophilic state upon reaching a certain temperature, e.g., UCST (upper critical solution temperature) polymers, such as poly(acrylamide-co-acrylonitrile). As yet another example, the thermo-responsive material may be a polymer that transitions form a hydrophilic state to a hydrophobic state upon reaching a certain temperature,e.g., LCST (lower critical solution temperature) polymers, such as poly( / V- isopropylacrylamide) or PNIPAAm, which has a transition temperature of about 32°C- 44°C. In a specific example, the heat removable coating may include a polymer that is selected from the group consisting of polylactic acid, poly(lactic-co-glycolic) acid, polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly( / V- isopropylacrylamide), cyclodextrins, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and a combination thereof. Another suitable thermo-responsive material is made up of a hydrophilic polymer cross-linked with the heat-labile cross-linker. An example of the heat-labile crosslinker is disuccinimidyl adipate (DSA). DSA is a homobifunctional cross-linker with two NHS ester groups. The NHS esters react with primary amines to form stable amide bonds. DSA reacts with primary amines, creating a covalent linkage through amide bond formation. DSA contains a linker that is susceptible to hydrolysis under elevated temperatures. As still another example, the thermo-responsive material may be a gel, such as hydroxypropyl methylcellulose, which has a viscosity linked to temperature.

[0171] pH change removable coatings are made of, or include, pH responsive materials. Alternatively, the pH responsive material may be adjacent to the removable coating. Examples of polymers that are soluble in aqueous solutions having different pH levels include chitosan, which is soluble under acidic conditions, and copolymers of non-water-soluble monomers with amine functional monomers, which are tunable to dissolve at different pHs depending on the content of the amino functional monomer. One example of the copolymer is dimethylaminoethyl methacrylate, which is soluble under basic conditions. Other examples of pH responsive polymers are those that are commercially available under the tradename EUDRAGIT® from Evonik. As described herein, light and / or heat may be used to generate a local pH change.

[0172] In the flow cell 44C shown in Fig. 5A, each depression 52 houses the polymeric hydrogel 24 and the following surface chemistry: the transposome complexes 10A and 10B or 10C. In this particular example, the polymeric hydrogel 24 is biotinylated and the transposome complexes 10A and 10B or 10C are attached via biotin 60 and streptavidin 62. This enables the transposome complexes 10A and 10Bor 10C to be removed and replaced after tagmentation and enrichment have occurred within the flow cell 44C. Alternatively, the flow cell 44C may be used for tagmentation, amplification, and sequencing, and thus may include the polymeric hydrogel 24, the transposome complexes 10A and 10B or 10C, and the primers 34, 36 in each depression 52.

[0173] While the example shown in Fig. 5A illustrates the transposome complexes 10A and 10B or 10C attached within the depressions 52, it is to be understood that the transposome complexes 10A and 10B or 10C may also or alternatively be attached to the interstitial regions 54. When attached to the interstitial regions 54, it is to be understood that the 5’ end functional groups 20A, 20B or the 5’ end functional group 20A and the 3’ end functional group 42 of the transposome complexes 10A and 10B or 10C are selected to attach to the patterned material 50 (or the single layered structure if used as the patterned structure 46) or to another layer that may be introduced to the interstitial regions 54 during flow cell manufacturing or the assay workflow.

[0174] The figure 6 series involves still another example of the flow cell 44D, which includes spatially separated regions in which tagmentation and enrichment can take place (region 70A, Fig. 6A-6E), in which amplification of the enriched fragments can take place (region 70B, Fig. 6E), and in which additional amplification, clustering and sequencing can take place (region 70C, Fig. 6F). The regions 70A, 70B, 70C could be defined in different lanes of the flow cell 44D, or in spatially separated areas of the same lane, or in opposing patterned substrates 46 that are bound together.

[0175] The processes taking place in each of these regions 70A, 70B, 70C are depicted in Fig. 6A through Fig. 6F. Each of the regions 70A, 70B, 70C includes depressions 52, which include the polymeric hydrogel 24 and surface chemistry that is specific to the reaction(s) that is / are to take place in the respective regions 70A, 70B, 70C.

[0176] The depressions 52 in the region 70A house the polymeric hydrogel 24 and the transposome complexes 10A and 10B or 10C. In this particular example, the polymeric hydrogel 24 is biotinylated and the transposome complexes 10A and 10B or10C are attached via biotin 60 and streptavidin 62. This enables the transposome complexes 10A and 10B or 10C to be removed and replaced after tagmentation and enrichment have occurred in the region 70A.

[0177] The depressions 52 in the region 70B house the polymeric hydrogel 24 and the primers 34’, 36. The primers 34’, 36 may be any of the examples set forth herein, except that the primers 34’ include an additional cleavage site at the 5’ end. This additional cleavage site is orthogonal to the cleavage sites 40A and 40B or 40C, and may be any of the examples set forth herein, or may be a restriction site. The additional cleavage site at the 5’ end enables amplified fragments generated in the region 70B to be cleaved and transported to the region 70C for cluster generation and sequencing.

[0178] The depressions 52 in the region 70C house the polymeric hydrogel 24 and the primers 34, 36. These primers enable cluster generation and sequencing.

[0179] The flow cell 44E shown in Fig. 7C is similar to the flow cell 44B-44D in that it includes the substrate 46, the depressions 52 separated by interstitial regions 54, the polymeric hydrogel 24 in the depressions, biotin 66 or another functional group that can attach the transposome complexes 10A and 10B or 10C, and the primers 34, 36.

[0180] The methods involving the respective flow cells, 44A, 44B, 44C, 44D, 44E will be described in further detail in reference to the particular figures that depict the flow cells 44A, 44B, 44C, 44D, 44E.

[0181] The universal transposome complexes 10D, 10E or 10D’, 10E’, or 10D’, 10E” may also be used with any example of the flow cell 44C, 44D, 44E disclosed herein that includes the polymeric hydrogel 24 and the primers 34, 36. The universal transposome complexes 10D, 10E or 10D’, 10E’, or 10D’, 10E” are used in solutionbased tagmentation, and thus that are not attached within the flow cell 44C, 44D, 44E at the outset. The flow cell 44C, 44D, 44E includes the transposome binding sites 66, which can attach to the 5’ end group 20D of the universal transposome complexes 10D, 10D’, or 10D’.

[0182] Bead-linked transposomes

[0183] One of the methods uses bead-linked transposomes, the full structure of which is identified by reference numeral 76 in Fig. 2A. The bead-linked transposomes 76 include the transposomes 10A and 10B or 10C attached to a bead 22.

[0184] One example of the bead 22 is formed of any example of the polymeric hydrogel 24 disclosed herein. In one example, the functional groups in one or more of the recurring units of the polymeric hydrogel 24 that form the bead 22 are capable of attaching the transposome complexes 10A and 10B or 10C. In another example, the surface of the polymeric hydrogel bead is biotinylated, and streptavidin or avidin or another avidin analog is used to attach transposome complexes 10A and 10B or 10C to the bead 22.

[0185] In other examples, the bead 22 is a multi-layered particle including a core material coated with any example of the polymeric hydrogel 24 disclosed herein. In these examples, the core material is generally rigid and is insoluble in an aqueous liquid. Examples of suitable core materials include magnetic materials (e.g., magnetic FeOx, silica coated FeOx), polymeric materials (e.g., polytetrafluoroethylene (PTFE), some polyacrylics, polypropylene, polyethylene, polybutylene, polyurethanes, polystyrene and other styrene copolymers, nylon (i.e., polyamide), polycaprolactone (PCL), etc.), nitrocellulose, silica (SiCh), silica-based materials (e.g., functionalized SiC>2), carbon, or metals. As mentioned, in these examples, the polymeric hydrogel 24 forms the coating on the core material. The thickness of the polymeric hydrogel coating on the core material ranges from about 10 nm to about 200 nm.

[0186] In an example, the bead 22 is a spherical nanoparticle. In another example, the bead 22 is a non-spherical nanoparticle, such as a cube, a triangular prism, rod shaped, a platelet, cage-like (e.g., non-spherical, hollow particles having a porous shell), a tube, etc. In still another example, the bead 22 is an irregularly shaped nanoparticle.

[0187] The dimensions of the bead 22 may vary depending upon its shape. In the examples disclosed herein, the largest dimension (e.g., diameter, length, median, etc.) of the bead 22 is on the nanoscale, and thus ranges from about 1 nm to less than1000 nm. In some examples, the bead 22 is a nanoparticle having a diameter of greater than or equal to 1 nm, 2 nm, 3 nm, 4 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 20 nm, 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, or greater than or equal to 100 nm.

[0188] DNA Enrichment Method and Kit #1

[0189] One of the DNA enrichment methods is schematically depicted in Fig. 2A and Fig. 2B. This example method includes tagmenting a DNA sample 72 containing a region of interest, and thus including a target sequence 74, using bead-linked transposomes 76, thereby generating DNA fragments 78, 80A, 80B, 80C attached to the bead-linked transposomes 76 (shown in Fig. 2A); introducing a Cas nuclease / RNA guide complex 82 to the bead-linked transposomes 76 having the DNA fragments 78, 80A, 80B, 80C attached thereto, thereby cleaving DNA fragments 80A, 80B, 80C containing the region of interest (and the target sequence 74) and generating enriched fragments 84A, 84B, 84C; denaturing the Cas nuclease / RNA guide complex 82, thereby releasing the enriched fragments 84A, 84B, 84C from the bead-linked transposomes 76; and introducing the enriched fragments 84A, 84B, 84C into a flow cell 44A containing surface-bound transposomes 10A and 10B or 10C.

[0190] While the transposome complexes 10A and 10B are shown attached to the bead 22 in Fig. 2A, it is to be understood that the transposome complexes 10A and 10C may be used in the bead-linked transposomes 76 in place of the transposome complexes 10A and 10B.

[0191] At the upper portion of Fig. 2A, the DNA sample 72 is mixed with the bead-linked transposomes 76. In an example, the DNA sample 72 includes several copies of a longer piece of DNA or a piece of complementary DNA (cDNA) generated from RNA. The components may be mixed manually (e.g., using a pipette), or using an automated sample preparation instrument.

[0192] Tagmenting the DNA sample involves introducing a tagmentation buffer to the DNA sample 72 and the bead-linked transposomes 76, thereby forming a mixture; and bringing the mixture to a temperature of 30°C or higher

[0193] The tagmentation buffer may include water, an optional co-solvent (e.g., dimethylformamide), a metal co-factor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., Tris acetate salt, pH 7.6). In an example, the optional cosolvent may be present in an amount up to about 11 %, the metal co-factor may be present in a concentration ranging from about 3 mM to about 5.5 mM, and the buffer salt may be present in a concentration ranging from about 7 mM to about 12 mM.

[0194] At the bead 22 surface, the DNA sample 72 is tagmented by the transposome complexes 10A, 10B. At the outset of tagmentation, the DNA sample 72 is fragmented by the transposome complexes 10A and 10B (or 10C, if used). In particular, the copies of the longer DNA or cDNA in the DNA sample 72 are fragmented. As depicted at the bottom portion of Fig. 2A, the 5’ ends of both strands of the fragments of the duplex sample 72 are attached to respective 3’ ends of the transferred strands 16A and 16B or 16C of at least some of the transposome complexes 10A, 10B. This generates partially adapted DNA fragments, some of which include the region of interest, and thus the target sequence 74 (fragments 80A, 80B, 80C), and others of which do not include the target sequence 74 (fragments 78). The tagmentation may occur randomly across the different copies, and thus the target sequence (i.e. , protospacer) may occur in different locations. Therefore, the target sequence 74 may appear in multiple fragments and in relatively different locations among those fragments. On a single bead 22, the longer DNA or cDNA in the DNA sample 72 is fragmented multiple times. The number of tagmentation events that take place on a single piece of DNA or cDNA within the DNA sample 72 will depend upon the length of the piece, the size of the beads 22, the number of beads 22 in the mixture, the distance between neighboring dimers of the transposome complexes 10A, 10B on a particular bead 22, and the concentration of the beads 22 in the mixture. At a minimum, the transposome complexes 10A, 10B can tagment the copies within the DNA sample 72 at least every 50 base pairs.

[0195] As noted, tagmentation (including fragmentation and attachment) may take place at a temperature at or above 30°C. In one example, the temperature may range from 30°C to about 55°C. In another example, the temperature may range from35°C to about 45°C. The 3’ ends of the generated strands (i.e. , fragments 78, 80A, 80B, 80C) are not attached to the 5’ ends of the non-transferred strands 18A, 18B. As such, a gap exists between the 3’ end of each strand of the DNA fragment strands 78, 80A, 80B, 80C and the 5’ end of the corresponding non-transferred strand 18A, 18B. In one example, each gap is nine (9) base pairs long.

[0196] The method then involves washing untagmented DNA fragments (not shown) from the DNA fragments 78, 80A, 80B, 80C attached to the bead-linked transposomes prior to introducing the Cas nuclease / RNA guide complex 82. An example of the washing solution is an aqueous solution including a buffer agent (e.g., Ths), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbates), and / or a chelating agent (e.g., EDTA). In one example, the washing solution includes water, the salt at a concentration ranging from about 25 mM to about 50 mM, the surfactant in an amount ranging from about 0.01 wt% to about 0.1 wt%, and optionally the chelating agent. The washing solution may have a relatively high pH, e.g., ranging from about 7 to about 10. If the beads 22 are magnetic, the bead- linked transposomes 76 containing the DNA fragments 78, 80A, 80B, 80C may be consolidated via a magnet during the wash process.

[0197] The method then involves introducing a Cas nuclease / RNA guide complex 82 to the bead-linked DNA fragments 78, 80A, 80B, 80C. The Cas nuclease / RNA guide complex 82 may be formed in situ in the presence of the bead- linked transposomes 76 with the DNA fragments 78, 80A, 80B, 80C attached thereto, or may be formed and then added to the mixture containing the bead-linked transposomes 76 with the DNA fragments 78, 80A, 80B, 80C attached thereto.

[0198] When the Cas nuclease / RNA guide complex 82 is formed in situ, a suitable Cas nuclease and RNA sequence are added to the mixture containing the bead-linked transposomes 76 with the DNA fragments 78, 80A, 80B, 80C attached thereto. In one example, the Cas nuclease is a Cas9 nuclease, and thus the formed Cas nuclease / RNA guide complex 82 includes a Cas9 nuclease. As described herein, the RNA sequence includes a portion that shares sufficient homology (at least at the 3’ end) with the target sequence 74. A PAM sequence in at least some of the interestDNA fragments 80A, 80B, 80C serve as a binding signal for the Cas nuclease. The Cas nuclease and the RNA sequence form a ribonucleoprotein complex, i.e., the complex 82, through interactions between the RNA scaffold and surface-exposed positively-charged grooves on the Cas nuclease.

[0199] When the Cas nuclease / RNA guide complex 82 is formed before being introduced with the mixture (containing the bead-linked transposomes 76 with the DNA fragments 78, 80A, 80B, 80C attached thereto), the Cas nuclease and RNA sequence are added to a buffer and are allowed to incubate as described herein in reference to the dead Cas nuclease / RNA guide complex 64. Unlike the dead Cas nuclease / RNA guide complex 64, the complex 82 retains both DNA excision and binding capability. The Cas nuclease / RNA guide complex 82 is then introduced into the mixture containing the bead-linked transposomes 76 with the DNA fragments 78, 80A, 80B, 80C attached thereto.

[0200] In one example, the Cas nuclease is a Cas9 nuclease, and thus the formed Cas nuclease / RNA guide complex 82 includes a Cas9 nuclease.

[0201] Within the mixture, a PAM sequence in at least some of the interest DNA fragments 80A, 80B, 80C serves as a binding signal for the Cas nuclease. Within the mixture, the Cas nuclease of the complex 82 will only cleave a given locus if the portion of the RNA sequence shares sufficient homology with the target sequence 74 (present in the fragments 80A, 80B, 80C). Once the complex 82 binds to an interest fragment 80A, 80B, 80C, the seed sequence of the RNA sequence will begin to anneal to the target sequence 74 of the interest fragment 80A, 80B, 80C. If the seed and target sequences match, the RNA sequence will continue to anneal to the interest fragment 80A, 80B, 80C in a 3’ to 5’ direction. Mismatches between the target sequence and the 3’ end of the seed sequence completely abolish target cleavage, whereas mismatches toward the 5’ end distal to the PAM often still permit target cleavage. The Cas nuclease undergoes a conformational change upon target binding that positions the nuclease domains to cleave opposite strands of the interest fragments 80A, 80B, 80C. Thus, both strands of the interest fragments 80A, 80B, 80C are cleaved. Cleavage takes place about 3 to 4 nucleotides upstream of the PAMsequence. The cleavage is represented by the arrows adjacent interest fragments 80A, 80B, 80C, which forms enriched fragments 84A, 84B, 84C. The enriched fragments 84A, 84B, 84C remain bound to the bead-linked transposomes 76 until the complexes 82 are removed.

[0202] Because the fragments 78 do not include the target sequence 74, they are unaffected by the complex(es) 82.

[0203] This example method then involves denaturing the Cas nuclease / RNA guide complex 82. Denaturing the Cas nuclease / RNA guide complex 82 involves heating the mixture containing the Cas nuclease / RNA guide complex 82 and the DNA fragments 78, 80A, 80B, 80C attached to the bead-linked transposomes 76 to a temperature of about 72°C. Denaturation releases the complex(es) 82 and the enriched fragments 84A, 84B, 84C (containing the target sequence 74) from the bead- linked transposomes 76.

[0204] Because the fragments 78 do not include the target sequence 74, they remain intact (i.e. , not cleaved) and attached to the bead-linked transposomes 76 after the complex(es) 82 are removed.

[0205] The enriched fragments 84A, 84B, 84C are now free in the mixture. In one example of the method, this mixture may be introduced into the flow cell 44A containing surface-bound transposomes 10A and 10B or 10C, where an additional tagmentation process will take place (described below in reference to Fig. 2B).

[0206] In another example method, the enriched fragments 10A and 10B or 10C can be separated from the bead-linked transposomes 78 (which have fragments 78 and non-target regions of the interest fragments 80A, 80B, 80C still attached thereto) before they are introduced into the flow cell 44A. Separation may be performed using any suitable process that can purify the enriched fragments 84A, 84B, 84C from the supernatant. In one example, the separation may be performed using SPRI beads. The enriched fragments 84A, 84B, 84C are then introduced into the flow cell 44A containing surface-bound transposomes 10A and 10B or 10C. The enriched fragments 84A, 84B, 84C may be introduced into the flow cell 44A with the tagmentation buffer.

[0207] Within the flow cell 44A, the enriched fragments 84A, 84B, 84C undergo tagmentation with the surface-bound transposomes 10A, 10C. Fragmentation and attachment take place as described herein in reference to Fig. 2A. While the transposome complexes 10A and 10C are shown in Fig. 2B, it is to be understood that the transposome complexes 10A and 10B may be used in the processes described in reference to Fig. 2B.

[0208] The transposase enzymes 12A, 12C are then removed from the complexes 10A, 10C, which are now respectively attached to the tagmented enriched fragments 84A, 84B’, 84C’ via the transferred strands 16A, 16C. Transposase enzyme 12A, 12C removal may be accomplished, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell 44A to about 60°C. When heat is used, some example methods involve introducing a washing solution into the flow cell 44A; and heating the flow cell 44A, containing the washing solution, to about 60°C.

[0209] When SDS or another chaotropic detergent has been used for transposase enzyme removal, the washing solution may be flushed through the flow channel 58 prior to initiating an extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0210] To initiate the extension reaction, an extension mix or an extension amplification mix is introduced into the flow cell 44A. An example of the extension mix includes nucleotides, a polymerase, and accessory proteins. An example of the extension amplification mix includes nucleotides, a recombinase, a polymerase, and accessory proteins. The extension or extension amplification mix may also include a buffer agent (e.g., Tris), enzymes, stabilizers, a metal co-factor, a surfactant (e.g., TWEEN polysorbates), and / or a co-solvent (e.g., glycerol, dimethylformamide, etc.). The ExAMP reagents available from Illumina Inc. are examples of suitable extension amplification mixes.

[0211] The flow cell 44A may be up to 60°C (e.g., at about 38°C) when the extension amplification mix is introduced.

[0212] At the outset of the extension reaction, the non-transferred strands 18A, 18C are dehybridized. Additional sequences (adapters) are added to the 3’ ends ofthe newly tagmented strands by an extension reaction using the extension or extension amplification mix. The extension reaction involves the addition of nucleotides in a template dependent fashion from the 3’ ends of the tagmented enriched fragments 84A, 84B’, 84C’ using the respective transferred strands 16A, 16C as the template. This extension is represented by the arrows in Fig. 2B. The sequences resulting from the extension reaction render the partially adapted (tagmented) enriched fragments 84A, 84B’, 84C’ fully adapted. At least some of the fully adapted enriched fragments (not shown) that are generated along the transposome complex 10A include the first amplification domain 26 at one end and a complement of the second amplification domain 38 at the other end. At least some of the fully adapted fragments that are generated along the transposome complex 10C include the second amplification domain 38 at one end and a complement of the first amplification domain 26 at the other end.

[0213] In one example method within the flow cell 44A, the fully adapted enriched fragments are amplified using the primers 34, 36 and then sequenced. When the extension amplification mix is used, amplification takes place immediately when the fully adapted fragments are generated. When the extension mix is used, amplification does not occur immediately, but occurs after a polymerase and nucleotides are added to the flow cell 44A. In one example of cluster generation, the fully adapted enriched fragments are denatured from one another, and loop over to hybridize to an adjacent, complementary primer 34, 36, and a polymerase copies the copied templates to form double stranded bridges, which are denatured to form two single stranded strands. These two strands loop over and hybridize to adjacent, complementary primers 34, 36, and are extended again to form two new double stranded loops. The process is repeated on each template copy by cycles of isothermal denaturation and amplification to create dense clonal clusters. Each cluster of double stranded bridges is denatured. In an example, the reverse strands are removed by a cleaving agent suitable for the cleavage site of the primers 26 to which the reverse strands are attached (e.g., specific base cleavage), leaving forward template strands / amplicons. In another example, the forward strands are removed bya cleaving agent suitable for the cleavage site of the primers 34 to which the forward strands are attached (e.g., specific base cleavage), leaving reverse template strands / amplicons. Clustering results in the formation of several enriched fragments immobilized in the depressions 52. These clusters are then exposed to sequencing.

[0214] In another example of this method, the flow cell 44A includes the transposome complexes 10A and 10B, but does not include the primers 34, 36. In this example, the fully adapted enriched fragments are generated as described herein in reference to Fig. 2B, but are not amplified on the flow cell 44A. The fully adapted enriched fragments can be cleaved from the transposome complexes 10A, 10B, and introduced into another flow cell (which includes the primers 34, 36) for amplification and sequencing.

[0215] In one of the examples shown in Fig. 2B, biotin streptavidin bonds attach the transposome complexes 10A, 10B, and thus the fully adapted enriched fragments, to the polymeric hydrogel 24. In these examples, a biotin streptavidin cleavage composition may be introduced to break the biotin-streptavidin bonds and release the fully adapted enriched fragments. Examples of the biotin streptavidin cleavage composition include about 95% formamide and about 10mM ethylenediaminetetraacetic acid (EDTA), or from about 10% by volume to about 50% by volume of a formamide reagent and a balance of a salt buffer. At suitable reaction temperatures, these cleavage compositions disrupt the biotin-streptavidin interactions, thus releasing whatever is attached (e.g., streptavidin, the fully adapted enriched fragments) to the biotin 60. Alternatively, a hot wash with biotin and / or desthiobiotin causes the newly added biotin and / or desthiobiotin to compete with the already bound biotin. By disrupting the biotin-streptavidin interactions, the streptavidin 62 (and anything attached thereto) is removed, leaving the biotin 60 attached to the polymeric hydrogel 24. In another of the examples shown in Fig. 2B, the transposome complexes 10A and 10B or 10C include the inosine 32A and 32B or 32C. In these examples, the fully adapted enriched fragments can be cleaved by introducing any suitable inosine cleaving nuclease, such as Endonuclease V (Endo V), into the flow cell 44A.

[0216] The cleaved fully adapted enriched fragments are removed from the flow cell 44A and introduced into another flow cell that contains the primers 34, 36 in the depressions 52. In this additional flow cell, the cleaved fully adapted enriched fragments are exposed to amplification to generate clusters, which are then exposed to sequencing. This may be desirable when multiple indexed samples are introduced into the flow cell 44Afor simultaneous sequencing.

[0217] In another example of this method, the polymeric hydrogel 24 in the flow cell 44A is biotinylated and includes the transposome complexes 10A and 10B, but does not include the primers 34, 36. After the fully adapted enriched fragments are generated, they may be cleaved using the biotin streptavidin cleavage composition.

[0218] In this example, the cleaved fully adapted enriched fragments are transported into a holding receptacle (not shown). In one example, the holding receptacle is well or chamber that is patterned into the substrate 46. In this example, the holding receptacle is in fluid communication with the flow channel 58 (not shown in Fig. 2B), but is separate from the flow channel 58. The holding receptacle does not include the polymeric hydrogel 24. Alternatively, the holding receptacle may be off of the flow cell 44A, such as in a cartridge on the instrument that receives the flow cell 44A. Within the holding receptacle, the cleaved fully adapted enriched fragments are denatured to form single stranded, fully adapted enriched fragments (not shown in the Fig. 2 series). In an example, denaturing takes place in NaOH or Tris HCI and heat (e.g., at about 90°C).

[0219] After cleaving the fully adapted enriched fragments from this example of the flow cell 44A, the biotin 60 remains attached to the flow cell surface. Once the cleaved, fully adapted enriched fragments are transported into the holding cell, this example method involves attaching the primers 34, 36 to at least some of the biotin 60 within the depressions 52; and introducing the single stranded, fully adapted enriched fragments back into the flow cell 44A.

[0220] The primers 34, 36 that are introduced enable the desired amplification of the single stranded, fully adapted enriched fragments. In this example, the primers 34, 36 include a 5’ end biotin group so that they can attach to the biotin 60 throughadditional streptavidin 62. Any of the avidin / streptavidin techniques described herein for attaching the transposome complexes 10A and 10B or 10C to the biotinylated polymeric hydrogel 24 may be used to attach the primers 34, 36.

[0221] Once the primers 34, 36 are attached, the single stranded, fully adapted enriched fragments may be transported back to the flow channel 58, where each will seed in a depression 52 and undergo amplification. In one example, the amplification domain 26 of the single stranded, fully adapted enriched fragments hybridizes to the primer 34 in a depression 52. The enriched fragments are copied from the hybridized primers 34 by 3’ extension using a high-fidelity DNA polymerase. The original enriched fragments are denatured, leaving the copies immobilized all around the depression 52. Isothermal bridge amplification or some other form of amplification may be used to amplify the immobilized copies. Either the forward or reverse strands are removed by specific base cleavage, leaving the opposite template strands.

[0222] Sequencing may then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix including labeled nucleotides and a polymerase. Optical imaging may be used to detect each instance of nucleotide incorporation.

[0223] After sequencing, the biotin streptavidin cleavage composition may again be introduced to remove the primers 34, 36, and amplicons and nascent strands attached thereto. This leaves the biotin 60 within the depressions 52 ready for another cycle of the method described in the figure 2 series.

[0224] An example of a DNA enrichment kit for performing the examples of the method described in reference to the figure 2 series includes a transposome fluid including a first liquid carrier and the bead-linked transposomes 76; an enrichment fluid including a second liquid carrier and a Cas nuclease / RNA guide complex 82; a flow cell 44A including a substrate 46 having depressions 52 separated by interstitial regions 54; first and second primers 34, 36 immobilized within each of the depressions 52; first transposome complexes 10A immobilized within each of the depressions 52, on the interstitial regions 54, or both within each of the depressions 52 and on the interstitial regions 54, the first transposome complexes including a first amplificationdomain 26; and second transposome complexes 10B or 10C immobilized within each of the depressions 52 and / or on the interstitial regions 54, the second transposome complexes 10B, 10C including a second amplification domain 38, 38’. This example kit may also include a tagmentation buffer.

[0225] Other examples of the kit include the flow cell 44A without the primers 34, 36 attached in the depressions 52, and further include a primer fluid containing biotinylated primers.

[0226] DNA Enrichment Method #2

[0227] Another of the DNA enrichment methods is schematically depicted in Fig. 3A through Fig. 3D. This example method includes fragmenting a DNA sample 72, thereby generating a plurality of DNA fragments 78, 80A, 80B, wherein at least some of the plurality of DNA fragments 80A, 80B include a region of interest (and thus a target sequence 74); and introducing the plurality of DNA fragments 78, 80A, 80B to a flow cell 44B including: a substrate 46 having depressions 52 separated by interstitial regions 54; a plurality of dead Cas nuclease / RNA guide complexes 64 attached within each of the depressions 52, on the interstitial regions 54, or both within each of the depressions 52 and on the interstitial regions 54; and transposome binding sites 66 within each of the depressions 54, on the interstitial regions 54, or both within each of the depressions 52 and on the interstitial regions 54, whereby the plurality of dead Cas nuclease / RNA guide complexes 64 respectively bind the at least some of the plurality of DNA fragments 80A including the region of interest (and target sequence 74).

[0228] As described in reference to the figure 2 series, the DNA sample 72 includes several copies of a longer piece of DNA or a piece of complementary DNA (cDNA) generated from RNA. At the outset of the method shown in Fig. 3A, the DNA sample 72 is fragmented using any suitable technique. While a single double stranded piece of DNA is depicted, it is to be understood that several copies of the DNA or DNA that are included in the DNA sample 72 are fragmented. Fragmentation breaks the long double stranded pieces in the DNA sample 72 into smaller pieces (i.e. ,fragments), and can be performed using physical or enzymatic shearing methods or using CRISPR.

[0229] Examples of physical (or mechanical) shearing methods include acoustic shearing (e.g., sonication), hydrodynamic shearing, or nebulization.

[0230] Acoustic sonication uses ultrasound waves to break apart chemical bonds. Acoustic sonication is performed with an ultrasonicator, which shears the DNA sample 72 by applying bursts of ultrasound. The ultrasound waves cleave hydrogen bonds and cause single- and double-strand ruptures of the DNA helix. With hydrodynamic shearing, the DNA sample 72 is exposed to hydrodynamic shear forces when it is forced through a small orifice of a syringe. Nebulization involves forcing the DNA sample 72 through a small hole in a nebulizer unit using compressed air or nitrogen.

[0231] Examples of enzymatic shearing methods use transposons, restriction enzymes, or nicking enzymes to fragment the pieces in the DNA sample 72.

[0232] With CRISPR, fragmenting the pieces in the DNA sample 72 involves exposing the DNA sample 72 to a plurality of Cas nucleases 86, thereby forming the plurality of plurality of DNA fragments 78, 80A, 80B. The Cas nuclease 86 is introduced to a buffer containing the DNA sample 72. In the mixture, the Cas nuclease 86 randomly cuts the pieces in the DNA sample 72 into smaller fragments. Some of the fragments 80A include the target sequence 74, and other fragments 78, do not include the target sequence 74.

[0233] The fragments 80A, 80B, 78 are introduced into the flow cell 44B including the dead Cas nuclease / RNA guide complexes 64. The portion of the dead Cas nuclease / RNA guide complexes 64 that is designed against the target sequence 74 will serve as a guide for the incoming interest fragments 80A, 80B to bind, but not be cut. Thus, the dead Cas nuclease / RNA guide complexes 64 serves to pin the interest DNA fragments 80A, 80B in the depressions 52. Because the fragments 78 do not include the target sequence 74, they will not become bound to the flow cell surface. The bound interest DNA fragments 80A, 80B are shown in Fig. 3B.

[0234] The method then includes: removing unattached DNA fragments, e.g., fragments 78 from the flow cell 44B; introducing a plurality of first and second transposome complexes 10A, 10C to the flow cell 44B, whereby at least some of the plurality of first and second transposome complexes 10A, 10C attach to the transposome binding sites 66; removing unattached first and second transposome complexes 10A, 10C from the flow cell 44B; and initiating tagmentation of the bound at least some of the plurality of DNA fragments 80A, 80B including the region of interest (and thus the target sequence 74).

[0235] To wash unbound DNA fragments 78 (not shown in Fig. 3B) from the flow cell 44B, the washing solution may be flowed through the flow cell 44B, and the unbound DNA fragments 78 may be pulled out with the solution.

[0236] In Fig. 3C, the transposomes 10A and 10C (or 10B if used) are introduced into the flow cell 44B and bound at the transposome binding sites 66. The transposome-containing fluid may be introduced to the flow cell 44B through an inlet. In one example, a pump of the sequencing instrument may be used to transport the transposome-containing fluid into the flow channel 58 of the flow cell 44B.

[0237] When the transposome binding sites 66 are biotin, transposomes 10A and 10C (including biotin end groups 20A, 42) may be introduced with streptavidin or avidin, which will bind the transposome complexes 10A and 10C to the transposome binding sites 66. When the transposome binding sites 66 are biotin-streptavidin, the transposomes 10A and 10C (including biotin end groups 20A, 42) may be introduced and will bind to the streptavidin. The transposome-containing fluid may be incubated for a suitable time period to ensure binding of the transposome complexes 10A and 10C. Fig. 3C illustrates the bound transposomes 10A and 10C in the depressions 52.

[0238] The method then involves washing unbound transposome complexes 10A and 10C from the flow cell 44B. Any example of the washing solution may be used, and flowed through the flow cell 44B.

[0239] Tagmentation of the bound interest fragments 80A, 80B is then initiated, as shown in Fig. 3D. Initiating tagmentation involves introducing a tagmentation bufferto the flow cell 44B, and bringing the flow cell 44B to a temperature of 30°C or higher. Tagmentation takes place as described herein.

[0240] After tagmentation, the method further includes introducing a chaotropic detergent (e.g., SDS) to remove both the dead Cas nuclease / RNA guide complexes 64 and a transposase enzyme 12A, 12C from each of the attached first and second transposome complexes 10A, 10C. The washing solution may be flushed through the flow channel 58 prior to initiating an extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0241] The extension reaction is then performed as described in reference to Fig. 2A and Fig. 2B to form the fully adapted enriched fragments from the tagmented bound interest fragments 80A, 80B. The fully adapted enriched fragments are amplified and sequenced as described in reference to Fig. 2A and Fig. 2B, as long as the flow cell 44B includes the primers 34, 36. Alternatively, if fully adapted enriched fragments are generated separately from several DNA samples such that each set includes unique index sequences 28A, 28B, the fully adapted enriched fragments can cleaved from the flow cell 44B used for tagmentation, pooled together, and introduced into another flow cell for amplification and sequencing.

[0242] In another example of this method, the flow cell 44B includes the transposome complexes 10A and 10B, but does not include the primers 34, 36. In this example, the fully adapted enriched fragments are generated as described herein.The fully adapted enriched fragments can be cleaved and removed from the flow cell 44B, and introduced into another flow cell that contains the primers 34, 36 in the depressions 52. In this additional flow cell, the cleaved fully adapted enriched fragments are exposed to amplification to generate clusters, which are then exposed to sequencing.

[0243] In still other example methods, the dead Cas nuclease / RNA guide complexes 64 are introduced into solution with the plurality of DNA fragments 78, 80A, 80B, rather than being attached within the flow cell 44B.

[0244] One example method that utilizes the dead Cas nuclease / RNA guide complexes 64 in solution includes fragmenting a DNA sample 72, thereby generating aplurality of DNA fragments 78, 80A, 80B wherein at least some of the plurality of DNA fragments 80A, 80B include a region of interest (and thus a target sequence 74); combining the plurality of DNA fragments 78, 80A, 80B and the dead Cas nuclease / RNA guide complexes 64 in solution, whereby the plurality of dead Cas nuclease / RNA guide complexes 64 respectively bind the at least some of the plurality of DNA fragments 80A including the region of interest (and target sequence 74) to form bound complexes; and introducing the bound complexes to a flow cell including a substrate 46 having depressions 52 separated by interstitial regions 54 and transposome complexes 10A and 10B or 10C attached within the depressions 52, whereby the bound complexes attach to the substrate 46 (through end groups of the dead Cas nuclease / RNA guide complexes 64). The method can then proceed as described in Fig. 3C.

[0245] In still another example, the method described in reference to Fig. 3A through Fig. 3D may be performed sequentially to introduce different DNA samples 72 when the flow cell 44B includes the coating 68 shown in Fig. 4A and Fig. 4B.

[0246] When the flow cell 44B includes the removable coating 68 overlying the substrate 64; prior to introducing the plurality of DNA fragments 78, 80A, 80B to the flow cell 44B, the method further includes exposing a sub-set of the plurality of depressions 52 at a predetermined area, e.g., 88 in Fig. 4B) of the flow cell 44B by removing a portion of the removable coating 68 from the predetermined area 88. In this example, the plurality of dead Cas nuclease / RNA guide complexes 64 attached within the exposed sub-set of the plurality of depressions 52 respectively bind the at least some of the plurality of DNA fragments 80A, 80B including the target sequence 74.

[0247] In an example, fragments 78, 80A, 80B of a first DNA sample 72 are introduced into the flow channel 58. The first DNA sample 72 may be introduced in a suitable liquid (water, buffer etc.) that is introduced through an opening (inlet, outlet) so that it flows in a desirable direction. In one example, a pump of a sequencing instrument, in which the flow cell 44B is operatively positioned, may be used to transport the first DNA sample 72 into the flow channel 58. Because the removablecoating 68 overlies the depressions 52 and the dead Cas nuclease / RNA guide complexes 64, the interest DNA sample fragments 80A, 80B cannot bind anywhere.

[0248] While the fragments 78, 80A, 80B are present in the flow channel 58, the predetermined area 88 of the flow cell 44B is exposed to the stimulus that melts, solubilizes, or permeabilizes the removable coating 68. As described herein, the removable coating 68 may be susceptible to light, heat, or a pH change.

[0249] When light is the stimulus, any suitable visible light source may be used to illuminate the desired area / region 88 of the flow cell 44B.

[0250] When heat is the stimulus, any suitable heating mechanism may be used. The heating mechanism may be included in a complementary metal oxide semiconductor chip that coupled to the flow cell substrate 46, included as part of the lid 56, or included / embedded in the flow cell substrate 46, or deposited within the depressions 52. Examples of the heating mechanism may include one or more electrode materials that are capable of converting electricity to a suitable amount of thermal energy to heat up the desired portion of the removable coating 68. In other examples, an external heating mechanism may be used, such as a heater of a sequencing instrument in which the flow cell 44B is positioned.

[0251] In some instances when heat is the removal mechanism, the other area(s) of the flow channel 58 may be actively cooled while the area 88 is heated. Localized cooling may be performed with an active cooling system of an external heater (e.g., a Peltier). It is to be understood that while localized cooling may be used, it may not be used when the heating is localized to the desired area 88. In other words, the heating mechanism can be used to locally heat an area where the coating 68 is to be removed, and the other area(s) may remain unheated.

[0252] When a pH change is the stimulus, the pH change may be initiated by altering the temperature at the predetermined area 88. In some examples, pH levels decrease with an increase in temperature, and thus the heating mechanism may be used to induce a localized change in pH. In an example, a buffer that decreases pH with an increase in temperature, such as an acetate buffer, a citrate buffer, or a phosphate buffer, may be added to the flow cell 44B prior to localized heating. Inanother example, a buffer that increases pH with an increase in temperature, such as a borate buffer, may be added to the flow cell 44B prior to localized heating. In still another example, a buffer that can increase or decrease pH with an increase in temperature, such as a glycine buffer, may be added to the flow cell 44B prior to localized heating. In other examples, an acid (or another source of pH-lowering H+ ions) may be generated in the vicinity of an electrode that is adjacent to the predetermined area 8 (e.g., in the lid 56, substrate 46, etc.), and the acid or source of pH-lowering H+ ions lowers the pH. In still other examples, an acid (or another source of pH-lowering H+ ions) may be generated when the predetermined area 88 is exposed to light. The light exposure induces a photocatalytic reaction, and thus proton release in the desired area for coating removal. Thus, the pH change is coupled with a temperature change or light exposure, which enables the spatial control.

[0253] Exposure of a portion of the removable coating 68 to the stimulus melts, solubilizes, or permeabilizes the portion of the removable coating 68 located at the predetermined area 88. The removal of the portion of the removable coating 68 exposes the dead Cas nuclease / RNA guide complexes 64 at the area / region 88. This allows the interest DNA fragments 80A, 80B to bind at the dead Cas nuclease / RNA guide complexes 64. The remainder of the method described in Fig. 3C and Fig. 3D may then be performed to introduce transposome complexes 10A, 10C to the predetermined area 88, initiate tagmentation, and generate fully adapted fragments that are cleaved and seeded in the predetermined area 88.

[0254] The processes for removing another portion of the removable coating 68 at a second sub-set of the plurality of depressions 52 at a second predetermined area of the flow cell 44B can be performed to expose additional dead Cas nuclease / RNA guide complexes 64, and the method may be repeated with another DNA sample. This generates fully adapted fragments of the other DNA sample that are cleaved and seeded in the second predetermined area.

[0255] Once the desired number of predetermined areas are exposed, and respective fully adapted fragments that are generated, cleaved and seeded in the predetermined areas, the method may continue with amplification and sequencing.This configuration allows several different samples to be spatially separated and analyzed across the flow cell 44B. Because the different samples are seeded in respective predetermined areas, the amplified samples are spatially indexed. In other words, the predetermined area may be used to identify each of the samples.Additionally, the different sample fragments may also include an index sequence 30A and 30B or 30C.

[0256] The example method described in Fig. 4A and Fig. 4B could also be performed without the dead Cas nuclease / RNA guide complexes 64 immobilized in the depressions 52. Rather, the plurality of DNA fragments 78, 80A, 80B and the dead Cas nuclease / RNA guide complexes 64 in solution, whereby the plurality of dead Cas nuclease / RNA guide complexes 64 respectively bind the at least some of the plurality of DNA fragments 80A including the region of interest (and target sequence 74) to form bound complexes; the predetermined area of the flow cell is exposed; and the bound complexes are introduced into the flow cell and bind in the predetermined area.

[0257] An example of a DNA enrichment kit for performing this example of the method includes a transposome fluid including a first liquid carrier, first transposome complexes 10A including a first amplification domain 26; and second transposome complexes 10B or 10C including a second amplification domain 38, 38’; and a flow cell 44B including a plurality of inactivated Cas nuclease / RNA guide complexes 64 attached within each of the depressions 52, on the interstitial regions 54, or both within each of the depressions 52 and on the interstitial regions 54; transposome binding sites 66 within each of the depressions 52, on the interstitial regions 54, or both within each of the depressions 52 and on the interstitial regions 54; and first and second primers 34, 36 immobilized within each of the depressions 52. The kit may also include a tagmentation buffer.

[0258] Other examples of the kit include the flow cell 44B without the primers 34, 36 attached in the depressions 52. Some of these examples further include a second flow cell containing primers 34, 36 (but not the transposome complexes 10A and 10B or 10C) attached in the depressions 52.

[0259] DNA Enrichment Method #3

[0260] Another example method that utilizes the dead Cas nuclease / RNA guide complexes 64 in solution is partially shown in Fig. 7A through Fig. 7C. One example of this method includes combining a DNA sample 72 and a plurality of dead Cas nuclease / RNA guide complexes 64 in solution, wherein at least some strands of the DNA sample 72 include a region of interested (and target sequence 74), and whereby the plurality of dead Cas nuclease / RNA guide complexes 64 bind to the at least some strands of the DNA sample 72 including the region of interest to form bound complexes (see Fig. 7A). Another example of this method includes fragmenting a DNA sample 72, thereby generating a plurality of DNA fragments 78, 80A, 80B wherein at least some of the plurality of DNA fragments 80A, 80B include a region of interest (and thus a target sequence 74); and combining the plurality of DNA fragments 78, 80A, 80B and a plurality of dead Cas nuclease / RNA guide complexes 64 in solution, whereby the plurality of dead Cas nuclease / RNA guide complexes 64 respectively bind the at least some of the plurality of DNA fragments 80A, 80B including the region of interest (and target sequence 74) to form bound complexes (see Fig. 7A). Either example of the method further includes: separating the bound complexes from other DNA sample strands or DNA fragments 78 that are not respectively bound to one of the plurality of dead Cas nuclease / RNA guide complexes 64; removing the at least some of the strands of the DNA sample 72 or of the plurality of DNA fragments 80A, 80B from the dead Cas nuclease / RNA guide complexes 64; and tagmenting the at least some of the strands of the DNA sample 72 or of the plurality of DNA fragments 80A, 80B in solution, thereby generating tagmented complexes 100A, 100B (Fig. 7B). These tagmented complexes 100A, 100B can then be introduced into a flow cell 44E including depressions 52 separated by interstitial regions 54, and transposome binding sites 66 within each of the depressions 54 and / or on the interstitial regions 54 (Fig. 7C).

[0261] At the outset of one example of this method, the DNA sample 72 is fragmented using any suitable technique described herein. The fragments 80A, 80B, 78 are then mixed with the dead Cas nuclease / RNA guide complexes 64 in solution.The portion of the dead Cas nuclease / RNA guide complexes 64 that is designed against the target sequence 74 will serve as a guide for the incoming interest fragments 80A, 80B to bind, but not be cut. Because the fragments 78 do not include the target sequence 74, they will not become bound to the dead Cas nuclease / RNA guide complexes 64. This is shown in Fig. 7A.

[0262] In the other example, unfragmented strands of the DNA sample 72 are mixed with the dead Cas nuclease / RNA guide complexes 64 in solution. The portion of the dead Cas nuclease / RNA guide complexes 64 that is designed against the target sequence 74 will serve as a guide for some of the stands of the DNA sample 72 to bind to the complexes 64, but not be cut. Other strands that do not include the target sequence 74 will not become bound to the dead Cas nuclease / RNA guide complexes 64.

[0263] In either example, the end of the dead Cas nuclease / RNA guide complexes 64 that is opposed to the portion designed against the target sequence 74 includes a biotin moiety. This biotin moiety enables streptavidin coated beads 102 to be used to separate the fragments 80A, 80B that are bound to the complexes 64 or the strands (with the target sequence 74) that are bound to the complexes 64. While not shown in Fig. 7A, it is to be understood that when the streptavidin coated beads 102 are added to the solution, they will bind to the biotin moiety of the complexes 64. The fragments 78 or strands that do not include the target sequence 74, however, will not bind to the streptavidin coated beads 102 and thus will remain in solution. If the streptavidin coated beads 102 are magnetic, they can be pulled out of the solution with the attached fragments 80A, 80B or the strands containing the target sequence 74. Alternatively, another filtering or separation technique may be used to separate the unattached fragments 78 or the strands that do not include the target sequence 74 and the streptavidin coated beads 102.

[0264] After separation, the streptavidin coated beads 102 having the complexes 64 and the fragments 80A, 80B or the strands containing the target sequence 74 attached thereto are exposed to a chaotropic detergent (e.g., SDS) or heat and a buffer in order to remove the streptavidin coated beads 102 and thecomplexes 64. Cyclodextrin can be used to sequester the chaotropic detergent. The streptavidin coated beads 102 and the complexes 64 can be washed away, leaving the enriched fragments 80A, 80B or strands containing the target sequence 74 for further processing. The buffer in the solution with the enriched fragments 80A, 80B or strands containing the target sequence 74 can be exchanged before further processing.

[0265] Tagmentation may be performed with the transposome complexes 10A and 10B or 10C (Fig. 7B and Fig. 7C) or with the universal transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E” (Fig. 8A through Fig. 8C).

[0266] As shown in Fig. 7B, in one example, the transposome complexes 10A and 10B or 10C are added to the solution with the fragments 80A, 80B or strands containing the target sequence 74. In this example, the transposome complexes 10A and 10B or 10C are indexed, so that the resulting tagmented complexes 100A, 100B are also indexed. Thus, this method may be used to generate tagmented complexes 100A, 100B from different DNA samples in different solutions, which can then be pooled together for introduction onto a flow cell (Fig. 7C).

[0267] In this example, the solution-based tagmentations are respectively performed by mixing the fragments 80A, 80B or strands containing the target sequence 74 with a transposome complex solution including the respectively indexed transposome complexes 10A and 10B or 10C. The transposome complex solutions may be any of the examples set forth herein. To this mixture, the tagmentation buffer is added, and the temperature of the solution is brought to the tagmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tagmentation time may range from about 2 minutes to about 15 minutes.

[0268] Post tagmentation, the transposase enzymes 12A, 12B, 12C are not removed and so the DNA sample fragments 80A, 80B or strands containing the target sequence 74 remain connected together by the transposome complexes 10A and 10B or 10C that are still in place along the double stranded DNA fragments 80A, 80B or strands containing the target sequence 74. This is shown schematically in Fig. 7B.

[0269] Once all of the tagmented complexes 100A, 100B are formed, they may be introduced into the flow cell 44E, which contains transposome binding sites 66.The tagmented complexes 100A, 100B are allowed to incubate within the flow cell 44E so that the attachment between the 5’ and / or 3’ end functional groups of the transposome complexes 10A and 10B or 10C and the binding sites 66 takes place. When biotin is used for attachment, streptavidin may be introduced with the tagmented complexes 100A, 100B in order to create the biotin-streptavidin-biotin linkages.

[0270] Once the tagmented complexes 100A, 100B are attached within the flow cell 44E, a wash may be performed with an example of the washing solution described herein in order to remove any unbound material. Then, the transposase enzymes 12A, 12B, 12C may be removed using one of the methods disclosed herein. The tagmented (partially adapted) DNA sample fragments 80A, 80B or strands containing the target sequence 74 remain attached to the flow cell 44E through the binding sites 66.

[0271] The generation of the fully adapted DNA sample, amplification of these fragments (either on the same flow cell of a separate flow cell), and sequencing of the amplified fragments may be performed as described herein.

[0272] As mentioned, tagmentation of the enriched fragments 80A, 80B generated as described in Fig. 7A may be performed using the universal transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E”. This tagmentation process is described in reference to Fig. 8A through Fig. 8C with the universal transposome complexes 10D, 10E. It is to be understood that tagmentation can occur under the same conditions using the universal transposome complexes 10D’, 10E’ or 10D”, 10E”

[0273] The method that uses the universal transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E” and the associated unique dual indexed strands 104A, 104B or 104A, 104B’ or 104A”, 104B” includes tagmentating the at least some of the plurality of DNA fragments 80A, 80B with a plurality of first and second transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E”, thereby generating DNA sample fragments having the first transferred strand 16D, 16D’, 16D” or the second transferred strand 16E, 16E’, 16E” attached thereto and respectively ligating the associated unique dual indexed strands 104A, 104B or 104A, 104B’ or 104A”, 104B’ to the first and second transferred strands 16D, 16E or 16D’, 16E’, or 16D”, 16E”. The ligationprocess forms the tagmented complex 100A (Fig. 8C), because the tagmented strands are partially adapted with the adapter sequences.

[0274] The example shown in Fig. 8A through Fig. 8C depicts the use of the first and second transposome complexes 10D, 10E and the associated unique dual indexed strands 104A, 104B.

[0275] Fig. 8A and Fig. 8B together depict tagmentation and ligation of the fragments 80A, 80B (specifically fragments 80A) to form tagmented complexes 100A, 100B (specifically complex 100A). It is to be understood that these processes can also be performed with the strands containing the target sequence 74 (formed from the unfragmented DNA sample 72 as described herein). As illustrated in Fig. 8A, the solution-based tagmentation of the fragments 80A, 80B is performed by mixing the DNA sample fragments 80A, 80B (extracted using the processes described in reference to Fig. 7A) with a transposome complex solution including any the universal transposome complexes 10D, 10E. This transposome complex solution may include any of the liquid carriers set forth herein. To this mixture, the tagmentation buffer is added, and the temperature of the solution is brought to the tagmentation temperature (e.g., from about 37°C to about 55°C). In this example, the tagmentation time may range from about 2 minutes to about 15 minutes. As described, tagmentation results in the fragmenting of the DNA fragments 80A, 80B into duplex fragments 114A, 114B and 114C, 114D and 114E, 114F, and the 5’ ends of both fragments 114A, 114B and 114C, 114D and 114E, 114F are attached to respective 3’ ends of the transferred strands 16D, 16F. The 3’ ends of the duplex fragments 114A, 114B and 114C, 114D and 114E, 114F are not attached to the 5’ ends of the non-transferred strands 18D, 18E.

[0276] In the example shown in Fig. 8A and Fig. 8B, the plurality of unique dual indexed strands 104A, 104B are added to the tagmented duplex fragments 114A, 114B and 114C, 114D and 114E, 114F (in the tagmentation buffer) with a ligase and nicotinamide adenine dinucleotide (NAD+). A suitable ligase is E.coli DNA ligase. In one example, the ligase is present in an amount ranging from about 10 units to about25 units and the NAD+ is present in an amount ranging from about 0.25 mM to about 1 mM.

[0277] The conditions at which the solution is maintained or to which the solution is brought when the unique dual indexed strands 104A, 104B, the ligase, and the NAD+ are added will initiate hybridization of the sequences 28D and 28’ D, 28E and 28’E. The 5’ phosphorylated ends 5’P of the transferred strands 16D, 16E serve as a substrate for the ligase, thus enabling the respective ligation of the unique dual indexed strands 104A, 104B to the 5’ ends of the transferred strands 16D, 16E. This is shown in Fig. 8B. When the universal transposome complexes 10D’, 10E’ are used, ligation is performed with the unique dual indexed strands 104A, 104B’. Similarly, when the universal transposome complexes 10D”, 10E” are used, ligation is performed with the unique dual indexed strands 104A”, 104B”.

[0278] Post tagmentation and ligation, the transposase enzymes 12D, 12E are not removed and so the (now partially adapted) DNA sample fragments 114A, 114B and 114C, 114D and 114E, 114F remain connected together by the transposome complexes 10D, 10E. This tagmented complex 100A is shown schematically in Fig. 8B.

[0279] While sequential tagmentation and ligation are shown and described in reference to Fig. 8A and Fig. 8B, it is to be understood that these processes could be formed simultaneously by mixing the DNA sample fragments 80A, 80B, the complexes 10D, 10E, the tagmentation buffer, the strands 104A, 104B, the ligase, and the NAD+ all together, and bringing the solution to a suitable tagmentation / ligation temperature.

[0280] The processes shown in Fig. 8A and Fig. 8B can be repeated, in separate batches, for any number of DNA sample fragments 80A, 80B from different DNA samples 72 that are to be processed in the flow cell 44E. Once all of the bound complexes, i.e., 100A and similar complexes for other DNA samples, are formed, they may be pooled together and introduced into a flow cell 44E simultaneously. The flow cell 44E may be used. Because all of the transposome complexes 10D, 10E are used for solution-based tagmentation, the flow cell 44E does not include the transposome complexes 38E, 38F attached thereto.

[0281] The tagmented complexes 100A, 10OB are allowed to incubate within the flow cell 44E so that the attachment takes place between the 5’ end functional groups 20D and the transposome binding sites 66. Because the tagmented complexes 100A, 100B are attached to the flow cell surface, the spatial link between the fragments 100A, 100B, etc. from the same DNA sample 72 can maintained on the flow cell surface.

[0282] Once the tagmented complexes 100A, etc. are attached, a wash may be performed with an example of the washing solution described herein in order to remove any unbound material. Then, the transposase enzymes 12D, 12E may be removed using one of the methods disclosed herein. At least some of the tagmented (partially adapted) DNA sample fragments (from the different samples) remain attached to the flow cell 44E through the 5’ end functional groups 20D. Any non-bound partially adapted DNA sample fragments can be washed away.

[0283] The fully adapted fragments may then be generated and amplified using the flow cell bound primers 34, 36 and the extension amplification mix. Sequencing of the amplified fragments may then be performed as described herein. The dual index sequence data (from sequences 31 A, 31 B) can be used to identify the particular DNA sample 72.

[0284] The method shown in Fig. 8A and 8B may further include additional processing prior to introducing the tagmented complexes 100A, 100B into the flow cell 44E. After tagmentation and ligation, some of the unique dual indexed strands 104A, 104B may remain unattached. It may be desirable to remove these unattached unique dual indexed strands, shown at 104A-1 , 104A-2, before introducing the tagmented complexes 100A, 100B to the flow cell 44E. This process is shown in Fig. 8C.

[0285] Removal of the unattached unique dual indexed strands 104A-1 , 104A-2 involves exposing the solution to a 3’ - 5’ exonuclease 116. The 3’5’ exonuclease116 acts on single stranded DNA to digest the strands 104A-1 , 104A-2 following completion of the ligation reaction. One example of the 3’ -> 5’ exonuclease 116 is Pyro Exo.

[0286] Other 3’ ends of the strands 104A, 104B are protected by the transposase enzyme 12D, 12E, and thus should not be chewed back. The 3’ ends of the sequencing primer sequence complements 28’D, 28’E are exposed. Thus, a blocking group (not shown) could be incorporated at the 3’ end of these strands when synthesizing the transposome complexes 10D, 10E. Examples of such blocking groups (not shown) may be dideoxycytidine (ddC) or deoxythymidine (dT). These groups can be removed prior to extension and amplification.

[0287] Once the unattached unique dual indexed strands 104A-1 , 104A-2 are removed, the solution including the tagmented complexes 100A, 100B can be introduced into the flow cell 44E. The method may proceed as described herein.

[0288] In another example, the ligation of the unique dual indexed strands 104A, 104B (Fig. 8B) and the removal of the unattached unique dual indexed strands 104A-1 , 104A-2 (Fig. 8C) take place sequentially within a single mixture and the respective reactions are controlled by temperature. In this example method, the ligation involves adding a ligation mix to the initially tagmented DNA fragments (shown in Fig. 8A), thereby forming a mixture, wherein the ligation mix includes a DNA ligase and a 3’ 4 5’ exonuclease; and exposing the mixture to a ligation temperature for a first predetermined time. After the predetermined time, the method further includes removing unattached unique dual indexed strands 104A-1 , 104A-2 from the mixture by exposing the mixture to an exonuclease activation temperature, thereby activating the 3’ 5’ exonuclease; and adding ethylenediaminetetraacetic acid to cease 3’5’ exonuclease activity.

[0289] In this example method, the ligation mix includes the ligase, the 3’ -> 5’ exonuclease, and the NAD+.

[0290] The ligation temperature may range from about 12°C to about 37°C depending upon the DNA ligase that is used. The predetermined time is sufficient for ligation to occur. In an example, the time ranges from about 10 minutes to about 30 minutes.

[0291] After the predetermined time, the temperature is increased to activate the 3’ -> 5’ exonuclease. Upon activation, the 3’ -> 5’ exonuclease 120 acts on thesingle stranded DNA to digest the strands 104A-1 , 104A-2 following completion of the ligation reaction. EDTA is added to stop the 3’5’ exonuclease activity.

[0292] Once the unattached unique dual indexed strands 104A-1 , 104A-2 are removed, the solution can be introduced into the flow cell 44E, and the method may proceed as described herein so that the partially adapted fragments are fully adapted, and the fully adapted fragments are amplified and sequenced.

[0293] DNA Enrichment Method #4

[0294] Still another of the DNA enrichment methods is schematically depicted in Fig. 5A through Fig. 5C. This example method includes attaching first and second indexed transposome complexes 10A and 10B or 10C in depressions 52 of a flow cell 44C containing biotin linkers, the first and second indexed transposome complexes 10A and 10B or 10C each including a biotin end group 20A and 20B or 42 and an inosine 32A and 32B or 32C adjacent to the biotin end group 20A and 20B or 42; tagmenting a DNA sample 72 containing a target sequence 74 using the first and second indexed transposome complexes 10A and 10B or 10C, thereby generating flow cell-linked DNA fragments 90, 92; removing a transposase enzyme 12A and 12B or 12C from each of the first and second indexed transposome complexes 10A and 10B or 10C; introducing a Cas nickase / RNA guide complex 98 that binds to flow cell-linked DNA fragments 92 containing the target sequence 74; while the Cas nickase / RNA guide complex 98 is bound, removing DNA fragments 90 not containing the target sequence 74; and removing the Cas nickase / RNA guide complex 98.

[0295] At the outset of the method, the transposomes 10A and 10C (or 10B if used) are introduced into the flow cell 44C and bound within the depressions 52. The transposome-containing fluid may be introduced to the flow cell 44C through an inlet. In one example, a pump of the sequencing instrument may be used to transport the transposome-containing fluid into the flow channel 58 of the flow cell 44C.

[0296] As described herein, the flow cell 44C includes biotin 60 or biotin 60- streptavidin 62 attached to the polymeric hydrogel 24 in each of the depressions 52. When biotin 60 is present within the depressions 52, the transposome complexes 10A and 10B or 10C (including biotin end groups 20A and 20B or 42) may be introducedwith streptavidin or avidin, which will bind the transposome complexes 10A and 10B or 10C to the surface. When biotin 60-streptavidin 62 is present within the depressions 52, the transposomes 10A and 10B or 10C (including biotin end groups 20A and 20B or 42) may be introduced and will bind to the streptavidin 62. The transposome- containing fluid may be incubated for a suitable time period to ensure binding of the transposome complexes 10A and 10B or 10C. Fig. 5A illustrates the bound transposome complexes 10A and 10B or 10C in the depressions 52.

[0297] The method then involves washing unbound transposome complexes 10A and 10B or 10C from the flow cell 44C. Any example of the washing solution may be used, and flowed through the flow cell 44C.

[0298] The DNA sample 72 (the long pieces of which are shown fragmented at reference numerals 90, 92 in Fig. 5A) is introduced into the flow cell 44C for tagmentation. The pieces of the DNA sample 72 may be introduced with a tagmentation buffer and the flow cell 44C may be heated to at least 30°C to initiate tagmentation. Tagmentation involves fragmentation and attachment as described herein, which generates flow cell-linked DNA fragments 90, 92, some of which 92 include the target sequence 74 and others 90 of which do not include the target sequence 74.

[0299] As shown in Fig. 5B, the transposase enzymes 12A and 12B or 12C are then removed from the complexes 10A and 10B or 10C, which are now respectively attached to the fragments 90, 92 via the transferred strands 16A and 16B or 16C. Transposase enzyme removal may be accomplished, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell 44C to about 60°C.

[0300] In this example method, a Cas nickase / RNA guide complex 98 that binds to flow cell-linked DNA fragments 92 containing the target sequence 74 is introduced. Similar to the Cas nuclease / RNA guide complex 82 described in reference to Fig. 2A, the Cas nickase / RNA guide complex 98 may be formed in situ, or may be formed and then introduced into the flow cell 44C. The Cas nickase / RNA guide complex(es) 98 binds to the DNAfragment(s) 92 containing the target sequence 74, and cuts onestrand of the DNAfragment(s) 92. Because the fragments 90 do not include the target sequence 74, they are unaffected by the complex(es) 98.

[0301] While the Cas nickase / RNA guide complex 98 is bound to the fragment 92, DNA fragments 90 that do not contain the target sequence 74 are removed. This is shown in Fig. 5C. This may be accomplished by introducing exonuclease III to the flow cell 44C. Exonuclease III (Exo III) will digest the DNA fragments 90 not protected by the bound Cas nickase / RNA guide complex 98. The washing solution may be flowed through the flow cell 44C to remove the Exonuclease III and the released DNA fragments 90.

[0302] The Cas nickase / RNA guide complex 98 is then removed. This is also shown in Fig. 5C. The Cas nickase / RNA guide complex 98 may be removed by introducing a chaotropic detergent (e.g., SDS) into the flow cell 44C. The washing solution may be flushed through the flow channel 58 prior to initiating an extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0303] The method then includes: performing an extension reaction to generate fully adapted DNA fragments 94 containing the target sequence 74 and linked to the flow cell 44C (see Fig. 5C); and cleaving the fully adapted DNA fragments 94 from the flow cell 44C.

[0304] The extension reaction is performed as described in reference to Fig. 2A and Fig. 2B to form the fully adapted enriched fragments 94 from the partially adapted interest fragments 92 (shown in Fig. 5C).

[0305] The fully adapted enriched fragments 94 can be cleaved by introducing Endonuclease V (Endo V) into the flow cell 44C. Endonuclease V cleaves the fully adapted enriched fragments 94 at the inosine 32A and 32B or 32C.

[0306] The cleaved fully adapted enriched fragments 94 are transported into a holding receptacle (not shown). In one example, the holding receptacle is a well or chamber that is patterned into the substrate 46. In this example, the holding receptacle is in fluid communication with the flow channel 58, but is separate from the flow channel 58. The holding receptacle does not include the polymeric hydrogel.Alternatively, the holding receptacle may be off of the flow cell 44C, such as in a cartridge on the instrument that receives the flow cell 44C. Within the holding receptacle, the cleaved adapted enriched fragments 94 are denatured to form single stranded, fully adapted enriched fragments. In an example, denaturing takes place in NaOH or Tris HCI and heat (e.g., at about 90°C). These fragments may be held while the flow cell 44C is used in additional round(s) of sample preparation.

[0307] After cleaving the fully adapted enriched fragments 94, biotin- streptavidin-biotin remains in the depressions 52 of the flow cell 44C. To remove the streptavidin 60, a biotin streptavidin cleavage composition may be introduced into the flow cell 44C. Examples of the biotin streptavidin cleavage composition include about 95% formamide and about 10mM ethylenediaminetetraacetic acid (EDTA), or from about 10% by volume to about 50% by volume of a formamide reagent and a balance of a salt buffer. At suitable reaction temperatures, these cleavage compositions disrupt the biotin-streptavidin interactions, thus releasing whatever is attached (e.g., streptavidin, the 5' end functional group 48 (biotin)) to the biotin 60 attached to the polymeric hydrogel 24. Alternatively, a hot wash with biotin and / or desthiobiotin causes the newly added biotin and / or desthiobiotin to compete with the already bound biotin. By disrupting the biotin-streptavidin interactions, the streptavidin 60 and the 5’ end functional groups 20A and 20B or 48 (biotin) are removed, leaving the biotin - BCN attached to the polymeric hydrogel 24.

[0308] The flow cell 44C may then be used for a subsequent cycle of generating new fully adapted enriched fragments with another DNA sample. When the flow cell 44C is used for the subsequent cycle of generating new fully adapted enriched fragments, the subsequent cycle includes: while the cleaved fully adapted DNA fragments are in the holding depression: attaching third and fourth indexed transposome complexes (similar to complexes 10A and 10B or 10C) in the depressions 52 of the flow cell 44C; tagmenting a second DNA sample containing a second region of interest using the third and fourth indexed transposome complexes, thereby generating second flow cell-linked DNA fragments; removing a transposase enzyme from each of the third and fourth indexed transposome complexes; introducinga second Cas nickase / RNA guide complex that binds to second flow cell-linked DNA fragments containing the second region of interest; while the second Cas nickase / RNA guide complex is bound, removing second DNA fragments not containing the region of interest; and removing the second Cas nickase / RNA guide complex. These processes are as described herein in reference to Fig. 5A through Fig. 5C for the DNA sample 72. The subsequent cycle may further include: performing an extension reaction to generate fully adapted second DNA fragments containing the second region of interest and linked to the flow cell; cleaving the fully adapted second DNA fragments from the flow cell; and pooling the fully adapted second DNA fragments with the cleaved fully adapted DNA fragments in the holding depression. Because the fragments are indexed, they can be identified during subsequent sequencing. These processes can be repeated for any desirable number of DNA samples.

[0309] Once all of the fully adapted enriched fragments are formed and pooled in the holding depression, one example of the method includes transporting the pooled fragments into a flow cell including primers 34, 36; and initiating amplification and a sequencing reaction.

[0310] In one example, the depressions 52 of the flow cell 44C used for tagmentation also include the primers 34, 36. The reintroduced fully adapted enriched fragments seed to the primers 34, 36 in the depressions 52. Amplification and sequencing can be performed as described herein.

[0311] In another example, the fully adapted enriched fragments are introduced into a different flow cell that includes the primers 34, 36 in the depressions 52. Amplification and sequencing can be performed as described herein.

[0312] In still another example, biotinylated primers 34, 36 may be introduced into the flow cell 44C with streptavidin so that they attach to the polymeric hydrogel 24. After the primers 34, 36 are attached, the pooled fragments may be transported from the holding depression back into the flow cell 44C for amplification and sequencing. After sequencing, this example of the flow cell 44C can be reused by breaking the biotin-streptavidin bonds and introducing new transposomes 10A and 10B or 10C or transposomes 10A and 10B or 10C and primers 34, 36.

[0313] An example DNA enrichment kit for performing this example method includes a transposome fluid including: a first liquid carrier, first indexed transposome complexes 10A including a first biotin end group 20A and a first inosine 32A adjacent to the biotin end group 20A, and second indexed transposome complexes 10B or 10C including a second biotin end group 20B or 42 and a second inosine 32B or 32C adjacent to the second biotin end group 20B or 42; an enrichment fluid including: a second liquid carrier and a Cas nuclease / RNA guide complex 82; a first cleavage fluid including an exonuclease; a second cleavage fluid including an inosine cleaving nuclease; and a flow cell 44C including: a substrate 46 having depressions 52 defined therein and separated by interstitial regions 54; a biotinylated polymeric hydrogel 24 positioned in each of the depressions 52; and first and second primers 34, 36 immobilized within each of the depressions 52.

[0314] DNA Enrichment Method #5

[0315] Yet another of the DNA enrichment methods is schematically depicted in Fig. 6A and Fig. 6F. This example is similar to the example described in reference to Fig. 5A through Fig. 5C, except that the flow cell 44D includes different regions 70A, 70B, 70C for the various processes. This example method includes introducing a DNA sample 72 containing at least one target sequence 74, 74’ into a first area 70A of a flow cell 44D, the first area 70A including: first depressions 52 defined in a substrate 46 and first and second indexed transposome complexes 10A and 10B or 10C attached in each the first depressions 52, the first and second indexed transposome complexes 10A and 10B or 10C each including a biotin end group 20A and 20B or 42 and an inosine 32A and 32B or 32C adjacent to the biotin end group 20A and 20B or 42; initiating tagmentation of the DNA sample 72 in the first area 70A, thereby generating flow cell-linked DNA fragments 90, 92, 92’; removing a transposase enzyme 12A and 12B or 12C from each of the first and second indexed transposome complexes 10A and 10B or 10C; introducing a Cas nickase / RNA guide complex 98 that binds to flow cell-linked DNA fragments 92, 92’ containing the at least one target sequence 74, 74’; while the Cas nickase / RNA guide complex 82 is bound, removingflow cell-linked DNA fragments 90 not containing the at least one target sequence 74, 74’; and removing the Cas nickase / RNA guide complex 98.

[0316] The processes shown in Fig. 6A through Fig. 6D take place in the region 70A of the flow cell 44D. In this example, the indexed transposome complexes 10A and 10B or 10C are bound to the polymeric hydrogel 24 via includes biotin- streptavidin-biotin.

[0317] The DNA sample 72 (including the long pieces of which are shown fragmented at reference numerals 90, 92, 92’ in Fig. 6A) is introduced into the flow cell 44D for tagmentation in the region 70A. The pieces of the DNA sample 72 may be introduced with a tagmentation buffer and the flow cell 44C may be heated to at least 30°C to initiate tagmentation. Tagmentation involves fragmentation and attachment as described herein, which generates flow cell-linked DNA fragments 90, 92, 92’, some of which 92, 92’ include the target sequences 74, 74’ and others 90 of which do not include the target sequence 74, 74’.

[0318] As shown in Fig. 6B, the transposase enzymes 12A and 12B or 12C are then removed from the complexes 10A and 10B or 10C, which are now respectively attached to the fragments 90, 92, 92’ via the transferred strands 16A and 16B or 16C. Transposase enzyme removal may be accomplished, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell 44C to about 60°C.

[0319] In this example method, one or more Cas nickase / RNA guide complexes 98, 98’ may be added that are designed to respectively bind to the target sequences 74, 74’ of the flow cell-linked DNA fragments 92, 92’. As mentioned herein, the Cas nickase / RNA guide complexes 98, 98’ may be formed in situ, or may be formed and then introduced into the flow cell 44D. The Cas nickase / RNA guide complex(es) 98, 98’ bind to the respective DNAfragment(s) 92, 92’ containing the target sequence 74, 74’, and cut one strand of the respective DNAfragment(s) 92, 92’. Because the fragments 90 do not include the target sequence 74, 74’, they are unaffected by the complex(es) 98, 98’.

[0320] While the Cas nickase / RNA guide complexes 98, 98’ are bound to the fragments 92, 92’, DNA fragments 90 that do not contain the target sequences 74, 74’are removed. This is shown in Fig. 6C. This may be accomplished by introducing exonuclease III to the flow cell 44D. Exonuclease III (Exo III) will digest the DNA fragments 90 not protected by the bound Cas nickase / RNA guide complexes 98, 98’. The washing solution may be flowed through the flow cell 44D to remove the Exonuclease III and the released DNA fragments 90.

[0321] The Cas nickase / RNA guide complexes 98, 98’ are then removed. This is shown in Fig. 6D. The Cas nickase / RNA guide complexes 98, 98’ may be removed by introducing a chaotropic detergent (e.g., SDS) into the flow cell 44D. The washing solution may be flushed through the flow channel 58 prior to initiating an extension reaction. This removes the chaotropic detergent, which may interfere with downstream enzyme activity.

[0322] The method then includes: performing an extension reaction to generate fully adapted DNA fragments 94, 94’ containing the target sequences 74, 74’ and linked to the flow cell 44D (see Fig. 6D); and cleaving the fully adapted DNA fragments from the first area 70A. The extension reaction is performed as described in reference to Fig. 2A and Fig. 2B to form the fully adapted enriched fragments 94, 94’ from the partially adapted interest fragments 92, 92’ (shown in Fig. 6B). The fully adapted enriched fragments 94, 94’ can be cleaved by introducing any suitable inosine cleaving nuclease, such as Endonuclease V (Endo V), into the flow cell 44D. Endonuclease V cleaves the fully adapted enriched fragments 94, 94’ at the inosine 32A and 32B or 32C.

[0323] The cleaved fully adapted enriched fragments 94, 94’ are transported into the second area 70B, as shown in Fig. 6E. The method then includes: transporting the cleaved fully adapted DNA fragments 94, 94’ to the second area 70B of the flow cell 44D, the second area 70B including first and second primers 34’, 36 attached to the substrate 46, the first primers 34’ including a cleavable group 96 at its 5’ end. The second area 70B will be discussed below.

[0324] If the first area 70A is to be used for additional enrichment, biotin- streptavid in-biotin remaining in the depressions 52 in the first area 70A of the flow cell44D should be removed. Removal of the streptavidin 60 may be performed as described in reference to the figure 5 series.

[0325] Then, while the cleaved fully adapted DNA fragments 94, 94’ are in the second area 70B: the method can include attaching third and fourth indexed transposome complexes (similar to complexes 10A and 10B or 10C) in the first depressions 52 of the first area 70A; tagmenting a second DNA sample containing at least one second region of interest using the third and fourth indexed transposome complexes, thereby generating second flow cell-linked DNA fragments; removing a transposase enzyme from each of the third and fourth indexed transposome complexes; introducing a second Cas nickase / RNA guide complex that binds to second flow cell-linked DNA fragments containing the at least one second region of interest; while the second Cas nickase / RNA guide complex is bound, removing second DNA fragments not containing the region of interest; and removing the second Cas nickase / RNA guide complex. This method may further include performing an extension reaction to generate fully adapted second DNA fragments containing the at least one second region of interest and linked to the flow cell 44D; cleaving the fully adapted second DNA fragments from the first area 70A; and transporting the cleaved fully adapted second DNA fragments to the second area 70B of the flow cell 44D, thereby pooling the cleaved fully adapted DNA fragments 94, 94’ and the cleaved fully adapted second DNA fragments. Because the fragments are indexed, they can be identified during subsequent sequencing. These processes can be repeated for any desirable number of DNA samples.

[0326] Once the desired fragments are transported to the second area 70B, polymerase chain reaction is performed in the second area 70B to increase the concentration of the fully adapted enriched fragments 94, 94’. In the second area 70B, amplification of the cleaved fully adapted DNA fragments 94, 94’ (and any other that have been transported thereto) is initiated. Initiating amplification of the cleaved fully adapted DNA fragments 94, 94’ and the cleaved fully adapted second DNA fragments in the second area 70B generates fragment amplicons attached to the first and second primers 34’, 36.

[0327] These amplicons can be cleaved by targeting the cleavable group 96 at the 5’ end of the primer 34’. This cleavable group 96 is orthogonal to the cleavage sites 40A and 40B or 40C, and thus releases the generated amplicons for further amplification and sequencing. The cleaving agent used will depend upon the cleavable group 96.

[0328] The method then includes cleaving the first primers 34’ and the fragment amplicons (not shown) attached thereto; transporting the first primers 34’ and the fragment amplicons attached thereto to a third area 70C of the flow cell 44D, the third area including: second depressions 52 defined in the substrate 46 and third and fourth primers 34, 36 attached within each of the depressions 52; and initiating amplification of the fragment amplicons in the third area 70C. In the third area 70C, amplification is performed to generate clusters of the various enriched fragments, and then sequencing can be performed. The indexes enable the various fragments to be identified.

[0329] A DNA enrichment kit for performing this example of the method includes a flow cell 44D including: a first area 70A including first depressions 52 defined in a substrate 46 and first and second indexed transposome complexes 10A and 10B or 10C attached in each the first depressions 52, the first and second indexed transposome complexes 10A and 10B or 10C each including a biotin end group 20A and 20B or 42 and an inosine 32A and 32B or 32C adjacent to the biotin end group 20A and 20B or 42; a second area 70B in selective fluid communication with the first area 70B, the second area 70B including first and second primers 34’, 36 attached to the substrate 46, the first primers 34’ including a cleavable group 96 at its 5’ end; and a third area 70C in selective fluid communication with the second area 70B, the third area 70C including: second depressions 52 defined in the substrate 46 and third and fourth primers 34, 36 attached within each of the depressions 52; an enrichment fluid including: a second liquid carrier and a Cas nickase / RNA guide complex 98, 98’; a first cleavage fluid including an exonuclease; and a second cleavage fluid including an inosine cleaving nuclease.

[0330] DNA Enrichment Method #6

[0331] Still another example method is partially shown in Fig. 9. This method includes fragmenting a DNA sample 72, thereby generating a plurality of DNA fragments 78, 80A, 80B, wherein at least some of the plurality of DNA fragments 80A, 80B include a region of interest (e.g., target region 74); combining the plurality of DNA fragments 78, 80A, 80B and a plurality of Cas nuclease / RNA guide complexes 82 in solution, whereby the Cas nickase / RNA guide complexes 82 bind and cut the at least some of the plurality of DNA fragments 80A, 80B including the region of interest; and while the Cas nickase / RNA guide complexes 82 are bound to the at least some of the plurality of DNA fragments, removing at least some other of the plurality of DNA fragments 78 that do not contain the target sequence.

[0332] The DNA sample 72 includes several copies of a longer piece of DNA or a piece of complementary DNA (cDNA) generated from RNA. At the outset of the method shown in Fig. 9, the DNA sample 72 is fragmented using any suitable technique. While a single double stranded piece of DNA is depicted, it is to be understood that several copies of the DNA or DNA that are included in the DNA sample 72 are fragmented. Fragmentation breaks the long double stranded pieces in the DNA sample 72 into smaller pieces (i.e., fragments 78, 80A, 80B), and can be performed as described herein, e.g., using physical or enzymatic shearing methods or using CRISPR.

[0333] The method then involves introducing a Cas nuclease / RNA guide complex 82 to the DNA fragments 78, 80A, 80B. The Cas nuclease / RNA guide complex 82 may be formed in situ in the presence of the DNA fragments 78, 80A, 80B, , or may be formed and then added to the mixture containing the DNA fragments 78, 80A, 80B. The mixture is shown at the left side of the arrow in Fig. 9.

[0334] When the Cas nuclease / RNA guide complex 82 is formed in situ, a suitable Cas nuclease and RNA sequence are added to the mixture containing the DNA fragments 78, 80A, 80B. In one example, the Cas nuclease is a Cas9 nuclease, and thus the formed Cas nuclease / RNA guide complex 82 includes a Cas9 nuclease. As described herein, the RNA sequence includes a portion that shares sufficienthomology (at least at the 3’ end) with the target sequence 74. A PAM sequence in at least some of the interest DNA fragments 80A, 80B serve as a binding signal for the Cas nuclease. The Cas nuclease and the RNA sequence form a ribonucleoprotein complex, i.e., the complex 82, through interactions between the RNA scaffold and surface-exposed positively-charged grooves on the Cas nuclease.

[0335] When the Cas nuclease / RNA guide complex 82 is formed before being introduced with the mixture (containing the DNA fragments 78, 80A, 80B), the Cas nuclease and RNA sequence are added to a buffer and are allowed to incubate as described herein in reference to the dead Cas nuclease / RNA guide complex 64. Unlike the dead Cas nuclease / RNA guide complex 64, the complex 82 retains both DNA excision and binding capability. The Cas nuclease / RNA guide complex 82 is then introduced into the mixture containing the DNA fragments 78, 80A, 80B.

[0336] In one example, the Cas nuclease is a Cas9 nuclease, and thus the formed Cas nuclease / RNA guide complex 82 includes a Cas9 nuclease.

[0337] Within the mixture, a PAM sequence in at least some of the interest DNA fragments 80A, 80B serves as a binding signal for the Cas nuclease. Within the mixture, the Cas nuclease of the complex 82 will only cleave a given locus if the portion of the RNA sequence shares sufficient homology with the target sequence 74 (present in the fragments 80A, 80B). Once the complex 82 binds to an interest fragment 80A, 80B, the seed sequence of the RNA sequence will begin to anneal to the target sequence 74 of the interest fragment 80A, 80B. If the seed and target sequences match, the RNA sequence will continue to anneal to the interest fragment 80A, 80B in a 3’ to 5’ direction. Mismatches between the target sequence and the 3’ end of the seed sequence completely abolish target cleavage, whereas mismatches toward the 5’ end distal to the PAM often still permit target cleavage. The Cas nuclease undergoes a conformational change upon target binding that positions the nuclease domains to cleave opposite strands of the interest fragments 80A, 80B.Thus, both strands of the interest fragments 80A, 80B are cleaved. Cleavage takes place about 3 to 4 nucleotides upstream of the PAM sequence. The cleavage is represented by the arrows adjacent interest fragments 80A, 80B.

[0338] Because the fragments 78 do not include the target sequence 74, they are unaffected by the complex(es) 82.

[0339] The unaffected fragments 78 are then removed. As shown in on the right side of the arrow in Fig. 9, the unaffected fragments 78 are digested using an exonuclease 116’. The exonuclease 116’ will digest the DNA fragments 78 not protected by the bound Cas nuclease / RNA guide complex 82. An example of the exonuclease 116’ is Exonuclease III (Exo III).

[0340] The Cas nuclease / RNA guide complex 82 is then removed. The Cas nuclease / RNA guide complex 82 may be removed by introducing a chaotropic detergent (e.g., SDS) into the mixture, followed by the addition of cyclodextrin, and performing a bead or column based purification process. Alternatively, RNase and heat may be used to remove the RNA guides, and thus the Cas nuclease / RNA guide complex 82.

[0341] One example of the method then includes: performing tagmentation in solution using the transposome complexes 10A and 10B or 10C (as described in reference to Fig. 7B and Fig. 7C), or any of 10D, 10E or 10D’, 10E’, or 10D”, 10E” (as described in reference to Fig. 8A and Fig. 8B).

[0342] The tagmented complexes 100A, 100B (from Fig. 7B or Fig. 8B) are then introduced and allowed to incubate within the flow cell 44E so that the attachment takes place between the 5’ end functional groups 20A and 20B or 42, or 20D and the transposome binding sites 66. In one example, the 5’ end functional groups 20A and 20B or 42, or 20D are biotin and the transposome binding sites 66 are streptavidin. In another example, the 5’ end functional groups 20A and 20B or 42, or 20D and the transposome binding sites 66 are biotin, and additional streptavidin is introduced to enable the non-covalent attachment.

[0343] The transposase enzymes 12A, 12C or 12D, 12E or 12D’, 12E’, or 12D”, 12E” are then removed using any of the methods disclosed herein. An extension and amplification reaction is initiated by introducing the extension amplification mix into the flow cell 44E. Forward or reverse strands are removed, and sequencing can be performed as described herein.

[0344] DNA Enrichment Method #7

[0345] In still another example method, enrichment takes place after tagmentation using the transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E” and before ligation using the associated unique dual indexed strands 104A, 104B or 104A’, 104B’ or 104A”, 104B”.

[0346] This method combines the tagmentation and ligation of Fig. 8A and Fig. 8B with the separation process of Fig. 7A, and is partially shown in Fig. 10.

[0347] This example method includes tagmentating a DNA sample 72 with a plurality of first and second transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E”, thereby generating tagmented DNA sample fragments 114A, 114B, 119A, 119B etc. having the first transferred strand 16D, 16D’, 16D” or the second transferred strand 16E, 16E’, 16E” attached thereto (similar to Fig. 8A); combining the DNA sample fragments 114A, 114B etc. and a plurality of dead Cas nuclease / RNA guide complexes 64 in solution, thereby forming bound complexes 118 between the plurality of dead Cas nuclease / RNA guide complexes 64 and some of the tagmented DNA sample fragments 114A, 114B including a region of interest (e.g., target region 74), and whereby other of the tagmented DNA sample fragments 119A, 119B not including the region of interest remain unbound (shown in Fig. 10); separating the bound complexes 118 from the other of the tagmented DNA sample fragments 119A, 119B; and respectively ligating the unique dual indexed strands to the first and second transferred strands attached to the some of the tagmented DNA sample fragments 114A, 114B, thereby generating partially adapted DNA sample fragments (similar to Fig. 8B).

[0348] In this example method, tagmentation is as described in reference to Fig. 8A.

[0349] After tagmentation, but before ligation, the tagmented fragments (e.g., fragments 114A, 114B, 119A 119B with transposome complexes 10D, 10E bound thereto) are mixed in a solution with the dead Cas nuclease / RNA guide complexes 64. The portion of the dead Cas nuclease / RNA guide complexes 64 that is designed against the target sequence 74 will serve as a guide for the tagmented fragments114A, 114B to bind, but not be cut. The interaction between the dead Cas nuclease / RNA guide complexes 64 and the tagmented fragments 114A, 114B (including the region of interest) forms the bound complexes 118. Thus, the dead Cas nuclease / RNA guide complexes 64 serves to tag the of-interest tagmented fragments 114A, 114B. Because the fragments 119A 119B do not include the target sequence 74, they will not bind to the dead Cas nuclease / RNA guide complexes 64.

[0350] In this example, the end of the dead Cas nuclease / RNA guide complexes 64 that is opposed to the portion designed against the target sequence 74 includes a biotin moiety. This biotin moiety enables streptavidin coated beads 102 to be used to separate the bound complexes 118 (and thus the tagmented fragments 114A, 114B) that are bound to the complexes 64. As depicted in Fig. 10, when the streptavidin coated beads 102 are added to the solution, the bound complexes 118 will bind to the biotin moiety of the complexes 64. The tagmented fragments 119A, 119B, however, will not bind to the streptavidin coated beads 102 and thus will remain in solution. If the streptavidin coated beads 102 are magnetic, they can be pulled out of the solution with the attached bound complexes 118. Alternatively, another filtering or separation technique may be used to separate the unattached tagmented fragments 119A, 119B and the streptavidin coated beads 102 with the attached bound complexes 118.

[0351] After separation from the unattached tagmented fragments 119A, 119B, the bound complexes 118 can be removed from the streptavidin coated beads 102. In one example, the bound complexes 118 are removed from the streptavidin coated beads 102 by introducing Endo V to the streptavidin coated beads 102 having the bound complexes 118 attached thereto. Endo V cleaves an inosine or other cleavage site that is positioned between the biotin and the dead Cas nuclease / RNA guide complex 64. In this example, the bound complexes 118 remain intact, and the dead Cas nuclease / RNA guide complex 64 can subsequently be removed during transposase enzyme 12D, 12E removal (e.g., with the chaotropic agent or using another suitable technique). In another example, the bound complexes 118 are removed from the streptavidin coated beads 102 by simultaneously introducing an RNase to the streptavidin coated beads 102 having the bound complexes 118attached thereto and heating the streptavidin coated beads 102 having the bound complexes 118 attached thereto. This process removes the RNA guides, and thus the dead Cas nuclease / RNA guide complex 64. In this example, the bound complexes 118 are disassembled to leave the tagmented fragments 114A, 114B attached to the universal transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E”.

[0352] Ligation is then performed, as described in reference to Fig. 8B, with the associated universal transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E”. This forms partially adapted fragments.

[0353] Removal of any unattached universal transposome complexes, e.g., 104A-2, 104B-2, may also performed as described in reference to Fig. 8C.

[0354] In light of the previous description, in one example of the method partially shown in Fig. 10, each of the Cas nuclease / RNA guide complexes 64 has a biotin group attached thereto; and separating the bound complexes involves: introducing streptavidin coated beads 102 to the solution, whereby the bound complexes 118 attach to the streptavidin coated beads 102 and the other of the DNA sample fragments remain 119A, 119B unattached; removing the streptavidin coated beads having the bound complexes attached thereto; and prior to respectively ligating the unique dual indexed strands, the method further comprises: releasing the bound complexes from the streptavidin coated beads; removing the streptavidin coated beads; and introducing the unique dual indexed strands to the bound complexes.

[0355] After ligation, and in some instances, removal of the unattached universal transposome complexes, e.g., 104A-2, 104B-2, the further includes introducing the partially adapted DNA sample fragments (as part of the tagmented complexes 100A, 100B), independently or as part of the bound complexes 118, to a flow cell 44 containing an attachment mechanism (similar to the transposome binding sites 66) for the unique dual indexed strands 104A, 104B, and surface bound primers 34, 36. It is to be understood that the tagmented complexes 100A, 100B are introduced independently (i.e. , not part of the bound complex 118) when the dead Cas nuclease / RNA guide complex 64 are removed during bead 102 detachment. It is to be further understood that the tagmented complexes 100A, 100B are introduced as partof the bound complex 118 when the dead Cas nuclease / RNA guide complex 64 is not removed during bead 102 detachment.

[0356] The tagmented complexes 100A, 100B, alone or as part of the bound complexes 118 are introduced and allowed to incubate within the flow cell 44 so that the attachment takes place between the 5’ end functional groups 20D and the attachment mechanism. The attachment mechanism may be any example set forth herein for the transposome binding sites 66.

[0357] Once the tagmented complexes 100A, etc. are attached, a wash may be performed with an example of the washing solution described herein in order to remove any unbound material. Then, the transposase enzymes 12D, 12E may be removed using one of the methods disclosed herein. If the dead Cas nuclease / RNA guide complex 64 is still present, it can be removed during transposase enzymes 12D, 12E removal. At least some of the tagmented (partially adapted) DNA sample fragments remain attached to the flow cell 44E through the 5’ end functional groups 20D. Any non-bound partially adapted DNA sample fragments can be washed away.

[0358] The fully adapted fragments may then be generated and amplified using the flow cell bound primers 34, 36 and the extension amplification mix. Sequencing of the amplified fragments may then be performed as described herein.

[0359] DNA Enrichment Method #8

[0360] In yet a further example method, enrichment takes place after tagmentation using the transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E” and ligation using the unique dual indexed strands 104A, 104B or 104A, 104B’ or 104A”, 104B”.

[0361] This method also combines the tagmentation and ligation of Fig. 8A and Fig. 8B with the separation process of Fig. 7A, and is partially shown in Fig. 11 .

[0362] This example method includes tagmentating a DNA sample 72 with a plurality of first and second transposome complexes 10D, 10E or 10D’, 10E’ or 10D”, 10E”, thereby generating tagmented DNA sample fragments 114A, 114B, 119A, 119B etc. having the first transferred strand 16D, 16D’, 16D” or the second transferredstrand 16E, 16E’, 16E” attached thereto (similar to Fig. 8A); respectively ligating unique dual indexed strands 104A, 104B or 104A, 104B’ or 104A”, 104B” to the first and second transferred strands 16D and 16E, or 16D’ and 16E’, or 16E” and 16D” attached to the tagmented DNA sample fragments 114A, 114B, 119A, 119B, thereby generating partially adapted DNA sample fragments 120A, 120B, 122A, 122B; combining the partially adapted DNA sample fragments 120A, 120B, 122A, 122B and a plurality of dead Cas nuclease / RNA guide complexes 64 in solution, thereby forming bound complexes 118’ between the plurality of dead Cas nuclease / RNA guide complexes and some of the partially adapted DNA sample fragments 120A, 120B including a region of interest (i.e. , target sequence 74), and whereby other of the partially adapted DNA sample fragments 122A, 122B not including the region of interest remain unbound; and separating the bound complexes 118’ from the other of the DNA sample fragments 122A, 122B.

[0363] In this example method, tagmentation is performed as described in reference to Fig. 8A, and ligation is performed as described in reference to Fig. 8B. These processes together form the partially adapted fragments 120A, 120B, 122A, 122B as shown in Fig. 11 .

[0364] It is to be understood that removal of any unattached universal transposome complexes, e.g., 104A-2, 104B-2, may also performed as described in reference to Fig. 8C.

[0365] The partially adapted fragments 120A, 120B, 122A, 122B are mixed in a solution with the dead Cas nuclease / RNA guide complexes 64. The portion of the dead Cas nuclease / RNA guide complexes 64 that is designed against the target sequence 74 will serve as a guide for the partially adapted fragments 120A, 120B to bind, but not be cut. The interaction between the dead Cas nuclease / RNA guide complexes 64 and the partially adapted fragments 120A, 120B (including the region of interest) forms the bound complexes 118’. Thus, the dead Cas nuclease / RNA guide complexes 64 serves to tag the of-interest partially adapted fragments 120A, 120B. Because the partially adapted fragments 122A, 122B do not include the target sequence 74, they will not bind to the dead Cas nuclease / RNA guide complexes 64.

[0366] In this example, the end of the dead Cas nuclease / RNA guide complexes 64 that is opposed to the portion designed against the target sequence 74 includes a non-biotin group or another group that exhibits orthogonal binding capabilities to those of the 5’ end functional group 20D of the unique dual indexed strands 104A, 104B or 104A, 104B’ or 104A”, 104B”. The orthogonal binding capability ensures that the removal beads 102’ can bind to the binding group of the dead Cas nuclease / RNA guide complexes 64, and not to the 5’ end functional group 20D that is present on all of the partially adapted fragments 120A, 120B, 122A, 122B. An example of the nonbiotin group is a polyA tail, which includes from 6 to 15 A nucleotides.

[0367] A polyA tail non-biotin group enables removal beads 102’ functionalized with polyT tails to be used. A poly T tail includes from 6 to 15 T nucleotides. These removal beads 102’ are used to separate the bound complexes 118’ (and thus the partially adapted fragments 120A, 120B) that are bound to the complexes 64. As depicted in Fig. 11 , when the removal beads 102’ are added to the solution, the bound complexes 118’ will bind to the non-biotin moiety of the complexes 64. The partially adapted fragments 122A, 122B, however, will not bind to the removal beads 102’, and thus will remain in solution. If the removal beads 102’ are magnetic, they can be pulled out of the solution with the attached bound complexes 118’. Alternatively, another filtering or separation technique may be used to separate the unattached partially adapted fragments 122A, 122B and the removal beads 102’ with the attached bound complexes 118’.

[0368] After separation from the unattached partially adapted fragments 122A, 122B, the bound complexes 118’ can be removed from the removal beads 102’. In one example, the bound complexes 118’ are removed from the removal beads 102’ by introducing Endo V to the removal beads 102’ having the bound complexes 118’ attached thereto. Endo V cleaves an inosine or other cleavage site that is positioned between the biotin and the dead Cas nuclease / RNA guide complex 64. In this example, the bound complexes 118’ remain intact, and the dead Cas nuclease / RNA guide complex 64 can subsequently be removed during transposase enzyme 12D, 12E removal (e.g., with the chaotropic agent or using another suitable technique). Inanother example, the bound complexes 118’ are removed from the removal beads 102’ by simultaneously introducing an RNase to the removal beads 102’ having the bound complexes 118’ attached thereto and heating the removal beads 102’ having the bound complexes 118’ attached thereto. This process removes the RNA guides, and thus the dead Cas nuclease / RNA guide complex 64. In this example, the bound complexes 118’ are disassembled to leave the tagmented complexes 100A, 100B.

[0369] In light of the previous description, in one example of the method partially shown in Fig. 11 , each of the Cas nuclease / RNA guide complexes 64 has a non-biotin group attached thereto; and separating the bound complexes 118’ involves introducing removal beads 102’ to the solution, whereby the bound complexes 118’ attach to the removal beads 102’ through the non-biotin groups, and the other of the DNA sample fragments 122A, 122B remain unattached; and removing the removal beads 102’ having the bound complexes 118’ attached thereto.

[0370] The method may further include releasing the bound complexes 118’ from the removal beads 102’; and introducing the partially adapted DNA sample fragments 120A, 120B (as part of the tagmented complexes 100A 100B), independently or as part of the bound complexes 118’ to a flow cell 44 containing an attachment mechanism for the unique dual indexed strands 104A, 104B, and surface bound primers 34, 36. The flow cell 44E may be used. It is to be understood that the tagmented complexes 100A, 100B are introduced independently (i.e., not part of the bound complex 118’) when the dead Cas nuclease / RNA guide complex 64 are removed during bead 102’ detachment. It is to be further understood that the tagmented complexes 100A, 100B are introduced as part of the bound complex 118’ when the dead Cas nuclease / RNA guide complex 64 is not removed during bead 102’ detachment.

[0371] The tagmented complexes 100A, 100B, alone or as part of the bound complexes 118’, are introduced and allowed to incubate within the flow cell 44E so that the attachment takes place between the 5’ end functional groups 20D and the attachment mechanism. The attachment mechanism may be any example set forth herein for the transposome binding sites 66.

[0372] Once the tagmented complexes 100A, 100B are attached, a wash may be performed with an example of the washing solution described herein in order to remove any unbound material. Then, the transposase enzymes 12D, 12E may be removed using one of the methods disclosed herein. If the dead Cas nuclease / RNA guide complex 64 is still present, it can be removed during transposase enzymes 12D, 12E removal. At least some of the partially adapted DNA sample fragments 120A, 120B remain attached to the flow cell 44E through the 5’ end functional groups 20D. Any non-bound partially adapted DNA sample fragments can be washed away.

[0373] The fully adapted fragments may then be generated and amplified using the flow cell bound primers 34, 36 and the extension amplification mix. Sequencing of the amplified fragments may then be performed as described herein.

[0374] Additional Notes

[0375] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.

[0376] Reference throughout the specification to “one example”, “another example”, “an example”, and so forth, means that a particular element (e.g., feature, structure, and / or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.

[0377] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.

Claims

1. What is claimed is:1 . A deoxyribonucleic acid (DNA) enrichment method, comprising: tagmenting a DNA sample containing a region of interest using bead-linked transposomes, thereby generating DNA fragments attached to the bead-linked transposomes; introducing a Cas nuclease / RNA guide complex to the bead-linked transposomes having the DNA fragments attached thereto, thereby cleaving DNA fragments containing the region of interest and generating enriched fragments; denaturing the Cas nuclease / RNA guide complex, thereby releasing the enriched fragments from the bead-linked transposomes; and introducing the enriched fragments into a flow cell containing surface-bound transposomes.

2. The DNA enrichment method as defined in claim 1 , wherein the Cas nuclease / RNA guide complex includes a Cas9 nuclease.

3. The DNA enrichment method as defined in claim 1 or claim 2, further comprising washing untagmented DNA fragments from the DNA fragments attached to the bead-linked transposomes prior to introducing the Cas nuclease / RNA guide complex.

4. The DNA enrichment method as defined in one of claims 1 through 3, wherein the denaturing of the Cas nuclease / RNA guide complex involves heating a mixture containing the Cas nuclease / RNA guide complex and the DNA fragments attached to the bead-linked transposomes to a temperature of about 72°C.

5. The DNA enrichment method as defined in one of claims 1 through 4, wherein each DNA fragment not containing the region of interest remains attached to a respective bead of the bead-linked transposomes after denaturation.

6. The DNA enrichment method as defined in one of claims 1 through 5, wherein tagmenting the DNA sample involves: introducing a tagmentation buffer to the DNA sample and the bead-linked transposomes, thereby forming a mixture; and bringing the mixture to a temperature of 30°C or higher.

7. The DNA enrichment method as defined in one of claims 1 through 6, further comprising: introducing a tagmentation buffer to the flow cell with the enriched fragments; and bringing the flow cell to a temperature of 30°C or higher.

8. A deoxyribonucleic acid (DNA) enrichment kit, comprising: a transposome fluid including: a first liquid carrier; and bead-linked transposomes; an enrichment fluid including: a second liquid carrier; and a Cas nuclease / RNA guide complex; a flow cell including: a substrate having depressions separated by interstitial regions; first and second primers immobilized within each of the depressions; first transposome complexes immobilized within each of the depressions, on the interstitial regions, or both within each of the depressions and on the interstitial regions, the first transposome complexes including a first amplification domain; and second transposome complexes immobilized within each of the depressions, on the interstitial regions, or both within each of the depressions and on the interstitial regions, the second transposome complexes including a second amplification domain.

9. The DNA enrichment kit as defined in claim 8, further comprising a tagmentation buffer.

10. A deoxyribonucleic acid (DNA) enrichment method, comprising: fragmenting a DNA sample, thereby generating a plurality of DNA fragments, wherein at least some of the plurality of DNA fragments include a region of interest; and introducing the plurality of DNA fragments to a flow cell including: a substrate having depressions separated by interstitial regions; a plurality of dead Cas nuclease / RNA guide complexes attached within each of the depressions, on the interstitial regions, or both within each of the depressions and on the interstitial regions; and transposome binding sites within each of the depressions on the interstitial regions, or both within each of the depressions, and on the interstitial regions, whereby the plurality of dead Cas nuclease / RNA guide complexes respectively bind the at least some of the plurality of DNA fragments including the region of interest.

11. The DNA enrichment method as defined in claim 10, further comprising: removing unattached DNA fragments from the flow cell; introducing a plurality of first and second transposome complexes to the flow cell, whereby at least some of the plurality of first and second transposome complexes attach to the transposome binding sites; removing unattached first and second transposome complexes from the flow cell; and initiating tagmentation of the bound at least some of the plurality of DNA fragments including the region of interest.

12. The DNA enrichment method as defined in claim 11 , wherein initiating tagmentation involves: introducing a tagmentation buffer to the flow cell; and bringing the flow cell to a temperature of 30°C or higher.

13. The DNA enrichment method as defined in claim 11 or claim 12, wherein after tagmentation, the method further comprises introducing a chaotropic detergent to remove the dead Cas nuclease / RNA guide complexes and a transposase enzyme from each of the attached first and second transposome complexes.

14. The DNA enrichment method as defined in one of claims 10 through 13, wherein fragmenting the DNA sample involves exposing the DNA sample to a plurality of Cas nucleases, thereby forming the plurality of DNA fragments.

15. The DNA enrichment method as defined in claim 10, wherein: the flow cell further includes a removable coating overlying the substrate; prior to introducing the plurality of DNA fragments to the flow cell, the method further comprises exposing a sub-set of the plurality of depressions at a predetermined area of the flow cell by removing a portion of the removable coating from the predetermined area; and the plurality of dead Cas nuclease / RNA guide complexes attached within the exposed sub-set of the plurality of depressions respectively bind the at least some of the plurality of DNA fragments including the region of interest.

16. The DNA enrichment method as defined in claim 15, further comprising: removing unattached DNA fragments from the flow cell; introducing a plurality of first and second transposome complexes to the flow cell, whereby at least some of the plurality of first and second transposome complexes attach to the transposome binding sites within the exposed sub-set of the plurality of depressions;removing unattached first and second transposome complexes from the flow cell; initiating tagmentation of the bound at least some of the plurality of DNA fragments including the region of interest; and after tagmentation, introducing a chaotropic detergent to remove the dead Cas nucleases and a transposase from each of the attached first and second transposome complexes.

17. The DNA enrichment method as defined in claim 16, further comprising: exposing a second sub-set of the plurality of depressions at a second predetermined area of the flow cell by removing a second portion of the removable coating from the second predetermined area; introducing a plurality of second DNA fragments to the flow cell, whereby the plurality of dead Cas nuclease / RNA guide complexes attached within the exposed second sub-set of the plurality of depressions respectively bind at least some of the plurality of second DNA fragments; removing unattached second DNA fragments from the flow cell; introducing a second plurality of first and second transposome complexes to the flow cell, whereby at least some of the second plurality of first and second transposome complexes attach to the transposome binding sites within the exposed second sub-set of the plurality of depressions; removing unattached first and second transposome complexes from the flow cell; initiating tagmentation of the bound at least some of the plurality of second DNA fragments; and after tagmentation, introducing a chaotropic detergent to remove the dead Cas nuclease / RNA guide complexes and a transposase from each of the attached first and second transposome complexes within the exposed second sub-set of the plurality of depressions.

18. A deoxyribonucleic acid (DNA) enrichment method, comprising: fragmenting a DNA sample, thereby generating a plurality of DNA fragments, wherein at least some of the plurality of DNA fragments include a region of interest; and combining the plurality of DNA fragments and a plurality of dead Cas nuclease / RNA guide complexes in solution, whereby the plurality of dead Cas nuclease / RNA guide complexes respectively bind the at least some of the plurality of DNA fragments including the region of interest to form bound complexes.

19. The enrichment method as defined in claim 18, further comprising introducing the bound complexes to a flow cell including a substrate having depressions separated by interstitial regions, whereby the bound complexes attach to the substrate.

20. The enrichment method as defined in claim 18, further comprising: separating the bound complexes from other DNA fragments that are not respectively bound to one of the plurality of dead Cas nuclease / RNA guide complexes; removing the at least some of the plurality of DNA fragments from the dead Cas nuclease / RNA guide complexes; and tagmenting the at least some of the plurality of DNA fragments in solution, thereby generating tagmented complexes.

21. The enrichment method as defined in claim 20, further comprising introducing the tagmented complexes into a flow cell including depressions separated by interstitial regions, and transposome binding sites within each of the depressions, on the interstitial regions, or both within the depression and on the interstitial regions.

22. The enrichment method as defined in claim 20, wherein tagmenting the at least some of the plurality of DNA fragments in solution involves:tagmentating the at least some of the plurality of DNA fragments with a plurality of first and second transposome complexes, each of the first transposome complexes including: a first transposon end including a portion of a first non-transferred strand hybridized to a first transferred strand having a 5’ phosphate; and a first sequencing primer sequence complement attached to the portion of the first non-transferred strand; and each of the second transposome complexes including: a second transposon end including a portion of a second non-transferred strand hybridized to a second transferred strand having a 5’ phosphate; and a second sequencing primer sequence complement attached to the portion of the second non-transferred strand, thereby generating DNA sample fragments having the first transferred strand or the second transferred strand attached thereto; and respectively ligating unique dual indexed strands to the first and second transferred strands attached to the DNA sample fragments.

23. A deoxyribonucleic acid (DNA) enrichment kit, comprising: a transposome fluid including: a first liquid carrier; first transposome complexes including a first amplification domain; and second transposome complexes including a second amplification domain; and a flow cell including: a plurality of dead Cas nuclease / RNA guide complexes attached within each of the depressions, on the interstitial regions, or both within each of the depressions and on the interstitial regions; transposome binding sites within each of the depressions, on the interstitial regions, or both within each of the depressions and on the interstitial regions; andfirst and second primers immobilized within each of the depressions.

24. The DNA enrichment kit as defined in claim 23, further comprising a tagmentation buffer.

25. A deoxyribonucleic acid (DNA) enrichment method, comprising: attaching first and second indexed transposome complexes in depressions of a flow cell containing biotin linkers, the first and second indexed transposome complexes each including a biotin end group and an inosine adjacent to the biotin end group; tagmenting a DNA sample containing a region of interest using the first and second indexed transposome complexes, thereby generating flow cell-linked DNA fragments; removing a transposase enzyme from each of the first and second indexed transposome complexes; introducing a Cas nickase / RNA guide complex that binds to flow cell-linked DNA fragments containing the region of interest; while the Cas nickase / RNA guide complex is bound, removing DNA fragments not containing the region of interest; and removing the Cas nickase / RNA guide complex.

26. The DNA enrichment method as defined in claim 25, further comprising: performing an extension reaction to generate fully adapted DNA fragments containing the region of interest and linked to the flow cell; and cleaving the fully adapted DNA fragments from the flow cell.

27. The DNA enrichment method as defined in claim 26, wherein cleaving the fully adapted DNA fragments involves introducing Endo V to the flow cell.

28. The DNA enrichment method as defined in claim 26, further comprising: transporting the cleaved fully adapted DNA fragments to a holding depression; while the cleaved fully adapted DNA fragments are in the holding depression: attaching third and fourth indexed transposome complexes in depressions of the flow cell; tagmenting a second DNA sample containing a second region of interest using the third and fourth indexed transposome complexes, thereby generating second flow cell-linked DNA fragments; removing a transposase from each of the third and fourth indexed transposome complexes; introducing a second Cas nickase / RNA guide complex that binds to second flow cell-linked DNA fragments containing the second region of interest; while the second Cas nickase / RNA guide complex is bound, removing second DNA fragments not containing the region interest; and removing the second Cas nickase / RNA guide complex.

29. The DNA enrichment method as defined in claim 28, further comprising: performing an extension reaction to generate fully adapted second DNA fragments containing the region of interest and linked to the flow cell; cleaving the fully adapted second DNA fragments from the flow cell; and pooling the fully adapted second DNA fragments with the cleaved fully adapted DNA fragments in the holding depression.

30. The DNA enrichment method as defined in claim 29, further comprising; transporting the pooled fully adapted second DNA fragments and the fully adapted DNA fragments to the flow cell; and initiating amplification and a sequencing reaction.

31. The DNA enrichment method as defined in claim 25, wherein: the Cas nickase / RNA guide complex includes a Cas9 nickase;removing DNA fragments not containing the region of interest involves introducing Exo III to the flow cell; and removing the Cas nickase / RNA guide complex involves introducing a chaotropic detergent.

32. A deoxyribonucleic acid (DNA) enrichment kit, comprising: a transposome fluid including: a first liquid carrier; first indexed transposome complexes including a first biotin end group and a first inosine adjacent to the biotin end group; and second indexed transposome complexes including a second biotin end group and a second inosine adjacent to the second biotin end group; an enrichment fluid including: a second liquid carrier; and a Cas nickase / RNA guide complex; a first cleavage fluid including an exonuclease; a second cleavage fluid including an inosine cleaving nuclease; and a flow cell including: a substrate having depressions defined therein and separated by interstitial regions; a biotinylated polymeric hydrogel positioned in each of the depressions; and first and second primers immobilized within each of the depressions.

33. A deoxyribonucleic acid (DNA) enrichment method, comprising: introducing a DNA sample containing at least one region of interest into a first area of a flow cell, the first area including: first depressions defined in a substrate and separated by interstitial regions; andfirst and second indexed transposome complexes attached in each the first depressions, on the interstitial regions, or both within each of the depressions and on the interstitial regions, the first and second indexed transposome complexes each including a biotin end group and an inosine adjacent to the biotin end group; initiating tagmentation of the DNA sample in the first area, thereby generating flow cell-linked DNA fragments; removing a transposase from each of the first and second indexed transposome complexes; introducing a Cas nickase / RNA guide complex that binds to flow cell-linked DNA fragments containing the at least one region of interest; while the Cas nickase / RNA guide complex is bound, removing flow cell-linked DNA fragments not containing the at least one region of interest; and removing the Cas nickase / RNA guide complex.

34. The DNA enrichment method as defined in claim 33, further comprising: performing an extension reaction to generate fully adapted DNA fragments containing the at least one region of interest and linked to the flow cell; and cleaving the fully adapted DNA fragments from the first area.

35. The DNA enrichment method as defined in claim 34, wherein cleaving the fully adapted DNA fragments involves introducing Endo V to the first area.

36. The DNA enrichment method as defined in claim 34 or claim 35, further comprising transporting the cleaved fully adapted DNA fragments to a second area of the flow cell, the second area including first and second primers attached to the substrate, the first primers including a cleavable group at its 5’ end.

37. The DNA enrichment method as defined in claim 36, further comprising: while the cleaved fully adapted DNA fragments are in the second area:attaching third and fourth indexed transposome complexes in the first depressions of the first area; tagmenting a second DNA sample containing at least one second region of interest using the third and fourth indexed transposome complexes, thereby generating second flow cell-linked DNA fragments; removing a transposase from each of the third and fourth indexed transposome complexes; introducing a second Cas nickase / RNA guide complex that binds to second flow cell-linked DNA fragments containing the at least one second region of interest; while the second Cas nickase / RNA guide complex is bound, removing second DNA fragments not containing the region of interest; and removing the second Cas nickase / RNA guide complex.

38. The DNA enrichment method as defined in claim 37, further comprising: performing an extension reaction to generate fully adapted second DNA fragments containing the at least one second region of interest and linked to the flow cell; cleaving the fully adapted second DNA fragments from the first area; and transporting the cleaved fully adapted second DNA fragments to the second area of the flow cell, thereby pooling the cleaved fully adapted DNA fragments and the cleaved fully adapted second DNA fragments.

39. The DNA enrichment method as defined in claim 38, further comprising initiating amplification of the cleaved fully adapted DNA fragments and the cleaved fully adapted second DNA fragments in the second area, thereby generating fragment amplicons attached to the first and second primers.

40. The DNA enrichment method as defined in claim 39, further comprising: cleaving the first primers and the fragment amplicons attached thereto;transporting the first primers and the fragment amplicons attached thereto to a third area of the flow cell, the third area including: second depressions defined in the substrate; and third and fourth primers attached within each of the depressions; and initiating amplification of the fragment amplicons in the third area.

41. The DNA enrichment method as defined in claim 36, further comprising: initiating amplification of the cleaved fully adapted DNA fragments in the second area, thereby generating fragment amplicons attached to the first and second primers; cleaving the first primers and the fragment amplicons attached thereto; transporting the first primers and the fragment amplicons attached thereto to a third area of the flow cell, the third area including: second depressions defined in the substrate; and third and fourth primers attached within each of the depressions; and initiating amplification of the fragment amplicons in the third area.

42. The DNA enrichment method as defined in claim 33, wherein: the Cas nickase / RNA guide complex includes a Cas9 nickase; removing DNA fragments not containing the at least one region of interest involves introducing Exo III to the flow cell; and removing the Cas nickase / RNA guide complex involves introducing a chaotropic detergent.

43. A deoxyribonucleic acid (DNA) enrichment kit, comprising: a flow cell including: a first area including: first depressions defined in a substrate; and first and second indexed transposome complexes attached in each the first depressions, the first and second indexed transposomecomplexes each including a biotin end group and an inosine adjacent to the biotin end group; a second area in selective fluid communication with the first area, the second area including first and second primers attached to the substrate, the first primers including a cleavable group at its 5’ end; and a third area in selective fluid communication with the second area, the third area including: second depressions defined in the substrate; and third and fourth primers attached within each of the depressions; an enrichment fluid including: a second liquid carrier; and a Cas nickase / RNA guide complex; a first cleavage fluid including an exonuclease; and a second cleavage fluid including an inosine cleaving nuclease.

44. A deoxyribonucleic acid (DNA) enrichment method, comprising: fragmenting a DNA sample, thereby generating a plurality of DNA fragments, wherein at least some of the plurality of DNA fragments include a region of interest; combining the plurality of DNA fragments and a plurality of Cas nuclease / RNA guide complexes in solution, whereby the Cas nickase / RNA guide complexes bind and cut the at least some of the plurality of DNA fragments including the region of interest; and while the Cas nickase / RNA guide complexes are bound to the at least some of the plurality of DNA fragments, removing at least some other of the plurality of DNA fragments that do not contain the target sequence.

45. The DNA enrichment method as defined in claim 44, wherein removing the at least some other of the plurality of DNA fragments involves exposing the at least some other of the plurality of DNA fragments to Exonuclease III.

46. The DNA enrichment method as defined in claim 44 or claim 45, further comprising removing the Cas nickase / RNA guide complex by introducing a chaotropic detergent.

47. A deoxyribonucleic acid (DNA) enrichment method, comprising: tagmentating a DNA sample with a plurality of first and second transposome complexes, each of the first transposome complexes including: a first transposon end including a portion of a first non-transferred strand hybridized to a first transferred strand having a 5’ phosphate; and a first sequencing primer sequence complement attached to the portion of the first non-transferred strand; and each of the second transposome complexes including: a second transposon end including a portion of a second non-transferred strand hybridized to a second transferred strand having a 5’ phosphate; and a second sequencing primer sequence complement attached to the portion of the second non-transferred strand, thereby generating tagmented DNA sample fragments having the first transferred strand or the second transferred strand attached thereto; combining the tagmented DNA sample fragments and a plurality of dead Cas nuclease / RNA guide complexes in solution, thereby forming bound complexes between the plurality of dead Cas nuclease / RNA guide complexes and some of the tagmented DNA sample fragments including a region of interest, and whereby other of the tagmented DNA sample fragments not including the region of interest remain unbound; separating the bound complexes from the other of the tagmented DNA sample fragments; and respectively ligating the unique dual indexed strands to the first and second transferred strands attached to the some of the tagmented DNA sample fragments, thereby generating partially adapted DNA sample fragments.

48. The method as defined in claim 47, wherein: each of the Cas nuclease / RNA guide complexes has a biotin group attached thereto; separating the bound complexes involves: introducing streptavidin coated beads to the solution, whereby the bound complexes attach to the streptavidin coated beads and the other of the tagmented DNA sample fragments remain unattached; removing the streptavidin coated beads having the bound complexes attached thereto; and prior to respectively ligating the unique dual indexed strands, the method further comprises: releasing the bound complexes from the streptavidin coated beads; removing the streptavidin coated beads; and introducing the unique dual indexed strands to the bound complexes.

49. The method as defined in claim 48, wherein releasing the bound complexes from the streptavidin coated beads involves introducing Endo V to the streptavidin coated beads having the bound complexes attached thereto.

50. The method as defined in claim 48, wherein releasing the bound complexes from the streptavidin coated beads involves simultaneously introducing an RNase to the streptavidin coated beads having the bound complexes attached thereto and heating the streptavidin coated beads having the bound complexes attached thereto.

51. The method as defined in one of claim 48 through claim 50, further comprising introducing the partially adapted DNA sample fragments, independently or as part of the bound complexes, to a flow cell containing an attachment mechanism for the unique dual indexed strands and surface bound primers.

52. A deoxyribonucleic acid (DNA) enrichment method, comprising: tagmentating a DNA sample with a plurality of first and second transposome complexes, each of the first transposome complexes including: a first transposon end including a portion of a first non-transferred strand hybridized to a first transferred strand having a 5’ phosphate; and a first sequencing primer sequence complement attached to the portion of the first non-transferred strand; and each of the second transposome complexes including: a second transposon end including a portion of a second non-transferred strand hybridized to a second transferred strand having a 5’ phosphate; and a second sequencing primer sequence complement attached to the portion of the second non-transferred strand, thereby generating tagmented DNA sample fragments having the first transferred strand or the second transferred strand attached thereto; respectively ligating unique dual indexed strands to the first and second transferred strands attached to the tagmented DNA sample fragments, thereby generating partially adapted DNA sample fragments; combining the partially adapted DNA sample fragments and a plurality of dead Cas nuclease / RNA guide complexes in solution, thereby forming bound complexes between the plurality of dead Cas nuclease / RNA guide complexes and some of the partially adapted DNA sample fragments including a region of interest, and whereby other of the partially adapted DNA sample fragments not including the region of interest remain unbound; and separating the bound complexes from the other of the partially adapted DNA sample fragments.

53. The method as defined in claim 52, wherein: each of the Cas nuclease / RNA guide complexes has a non-biotin group attached thereto; and separating the bound complexes involves:introducing removal beads to the solution, whereby the bound complexes attach to the removal beads through the non-biotin groups, and the other of the partially adapted DNA sample fragments remain unattached; and removing the removal beads having the bound complexes attached thereto.

54. The method as defined in claim 53, further comprising releasing the bound complexes from the removal beads; and introducing the some of the partially adapted DNA sample fragments, independently or as part of the bound complexes, to a flow cell containing an attachment mechanism for the unique dual indexed strands, and surface bound primers.