Compound for regulating activity or expression of BRAF and uses therof
Compounds targeting BRAF gene activity and expression, particularly through antisense oligonucleotides and siRNA, address the challenges of BRAF-related diseases by inhibiting its activity and expression, offering therapeutic benefits for conditions like cancer and neurodevelopmental disorders.
Patent Information
- Application Number
- PCT/KR2025/015477
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-08
- Filing Date
- 2025-09-30
- Publication Date
- 2026-04-16
AI Technical Summary
Current methods are inadequate for effectively preventing, improving, or treating diseases and disorders associated with BRAF variants, including Class I to III mutations and gene fusions, which cause overactivation or overexpression of the BRAF gene, leading to conditions such as cancer and neurodevelopmental disorders.
Development of compounds, specifically oligomer compounds and RNAi agonists like antisense oligonucleotides and siRNA, to regulate the activity and expression level of the BRAF gene, targeting its mRNA to inhibit its activity and reduce its expression levels.
The compounds effectively inhibit BRAF activity and expression, providing therapeutic benefits for conditions caused by BRAF overactivation or overexpression, including various cancers and neurodevelopmental disorders, and overcome resistance to small molecule inhibitors.
Abstract
Description
Compounds for regulating BRAF activity or expression and uses thereof
[0001] The present invention relates to a compound for regulating the expression level and / or activity of a BRAF gene and a composition containing the same, said compound and composition being useful for preventing, treating, or alleviating diseases, disorders, and conditions associated with BRAF.
[0002] BRAF is a member of the AS / RAF / MEK / ERK (MAPK) signaling pathway and is a gene located on chromosome 7 that encodes the serine / threonine kinase B (BRAF) protein. The BRAF protein plays a crucial role in the MAPK cell signaling pathway, which promotes cell growth and survival. Braf variants that induce BRAF activation include point mutations at the V600 site, corresponding to Class I mutations, and non-V600 mutations occurring at sites other than the V600 site. Non-V600 mutations are categorized into three groups based on the activation mechanism: class II, class III, and fusion mutations resulting from fusion with other genes.
[0003] The aforementioned Class II mutations are mutations that form a dimer with high kinase activity alone and become activated even without signaling from the upstream signaling protein, the RAS gene. These mutations are primarily found in the activation site of BRAF or in P-loop segments (e.g., K601 and L597 or G464 and G469). Class III mutations refer to mutations that become activated under the signaling of the upstream signaling protein, RAS. These abnormalities often coexist with other MAPK pathways or other pathway-activating mutations and cause RAS overactivation, leading to the upregulation of cell growth and cell signaling. They are primarily found in the P-loop, catalytic loop, or DFG motif (e.g., G466, N581, and D594). Thirdly, activating BRAF fusions involve retaining the kinase domain while deleting the N-terminal CR1 autoinhibitory domain, and this change leads to the formation of an active dimer. An example of this is the fusion between the KIAA1549 and BRAF genes, which results in the duplication of the 2-MBP region that fuses the 5' end of the KIAA1549 gene with the 3' end of BRAF.
[0004] There is a need for methods and drug compositions to prevent, improve, and / or treat diseases, disorders, and conditions associated with BRAF variants that can occur in various ways, such as Class I to III and gene fusion mutations.
[0005] One example of the present invention relates to a compound for regulating the activity and / or expression level of BRAF, and a pharmaceutical composition or method for preventing, improving, and / or treating a BRAF-mediated disease, disorder, and condition comprising said compound as an active ingredient.
[0006] A further example of the present invention relates to a composition or method for controlling the activity and / or expression level of BRAF using a compound for controlling the activity and / or expression level of BRAF.
[0007] The compound for regulating the activity and / or expression level of the above BRAF may be an oligomer compound and / or an RNAi agonist, the oligomer compound may be an antisense oligonucleotide, and the RNAi agonist may include, but is not limited to, ssRNAi, siRNA, shRNA, and miRNA.
[0008] One example of the present invention relates to a compound for controlling the activity and / or expression level (amount) of BRAF, and a pharmaceutical composition or method for preventing, improving, and / or treating a disease, disorder, and condition associated with BRAF, comprising said compound as an active ingredient. Additionally, one example of the present invention relates to a compound for controlling the activity and / or expression level (amount) of BRAF, and a pharmaceutical composition or method for preventing, improving, and / or treating a disease, disorder, and condition mediated by BRAF, comprising said compound as an active ingredient.
[0009] A specific embodiment of the present invention relates to a method for preventing, improving, and / or treating a disease, disorder, and condition associated with BRAF, comprising the step of administering a compound for regulating the activity and / or expression level of BRAF to an individual or patient in need thereof. As used herein, the term “expression” refers to a process in which a polynucleotide produces a gene product, e.g., RNA or polypeptide (or protein, etc.).
[0010] More specifically, the present invention relates to a pharmaceutical composition or method for preventing, improving, and / or treating diseases, diseases, disorders, and conditions caused by the overactivation or overexpression of BRAF.
[0011] In this specification, “individual,” “patient,” or “subject” means a human or non-human animal selected for treatment or therapy, and non-human animals may include, but are not limited to, mammals such as monkeys, rats, mice, rabbits, guinea pigs, and others.
[0012] Embodiments of the present invention relate to compounds for regulating the activity and / or expression level (amount) of BRAF, which are oligomeric compounds and / or RNAi agents. One embodiment provides a method, a compound, and a composition for inhibiting BRAF mRNA and protein expression, inhibiting the activity of BRAF protein, or reducing mRNA and protein levels. In certain embodiments, the compound for regulating the activity and / or expression level (amount) of BRAF may be an inhibitor that reduces or inhibits the activity and / or expression level (amount) of BRAF.
[0013] The compound according to the present invention may be a disease, disorder, and condition related to BRAF, specifically a disease, disease, disorder, and condition caused by the overactivation or overexpression of BRAF, and includes various diseases such as, for example, tumors (Cancer or Tumor or Neoplasm), neurodevelopmental disorders (Rasopathy) associated with the Ras-MAPK signaling pathway, etc.
[0014] The above-mentioned disease, disorder, or pathological condition is caused by the overactivation of the BRAF signaling pathway, which may occur due to mutations in the BRAF gene itself or genes upstream thereof, or due to the disruption of homeostasis in other signaling pathways. Specifically, the above-mentioned disease, disorder, or pathological condition covers all diseases that cause overactivation of BRAF itself or induce overactivation of the MAPK signaling pathway through genetic modifications such as point mutations, insertions, duplications, or fusions of BRAF according to the present invention. The above-mentioned BRAF mutation includes both somatic mutations and germline mutations, but preferably may be a somatic mutation. Specifically, the above-mentioned disease, disorder, or pathological condition may be cancer or neurodevelopmental disorder.
[0015] Specific Braf mutations include all cases such as Braf p.E451Q, Braf p.G464E / V / A, Braf p.G466E / V / R / A, Braf p.G469A / V / S / E / R, Braf p.K483M / E, Braf p.N581S / I, Braf p.D594A / H / V / G / N / E / Y, Braf p.F595L, Braf p.G596R / C, Braf p.L597Q / R / S / V, Braf p.G596R / C, Braf p.V600E / K / D / R / L, Braf p.K601E / N / T, Braf p.A712T, T599_W605ins, T599 dup, KIAA_1549-BRAF fusion, BCAS1-BRAF fusion, etc. Includes.
[0016] Additionally, an example of a Braf mutation may be a Braf V600 mutation, specifically one or more mutations selected from the group consisting of V600E, V600K, V600D, V600A, V600G, V600M, and V600R. An example of a Braf mutation may be a BRAF fusion mutation, and a BRAF fusion mutation-mediated disease or condition refers to a disease or condition in which the biological function of the BRAF kinase having the fusion mutation affects the development, course, and / or symptoms of the disease or condition, or the regulation of BRAF alters the development, course, and / or symptoms of the disease or condition.Specific examples of BRAF fusion mutations are KIAA1549-BRAF, MKRN1-BRAF, TRIM24-BRAF, AGAP3-BRAF, ZC3HAV1-BRAF, CCDC6-BRAF, AGK-BRAF, EPS15-BRAF, NUP214-BRAF, ARMC10-BRAF, BTF3L4-BRAF, GHR-BRAF, ZNF767-BRAF, CCDC91-BRAF, DYNC112-BRAF, ZKSCAN1-BRAF, GTF2I-BRAF, RAD18-BRAF, MZT1-BRAF, CUX1-BRAF, SLC12A7-BRAF, MYRIP-BRAF, SND1-BRAF, NUB1-BRAF, KLHL7-BRAF, TANK-BRAF, RBMS3-BRAF, STRN3-BRAF, STK35-BRAF, ETFA-BRAF, SVOPL-BRAF, JHDMID-BRAF, ADCK2-BRAF, EPB41L2-BRAF, MCC-BRAF, OSBP-BRAF, DAAM1-BRAF, TEX41-BRAF, NRF1-BRAF, TRIP11-BRAF, GNAI1-BRAF, PTPRZ1-BRAF, TOP2B-BRAF, PAPSS1-BRAF, TAX1BP1-BRAF, CDC27-BRAF, AGTRAP-BRAF, FAM131B-BRAF, AKAP9-BRAF, SLC45A3, FCHSD1-BRAF, TTYH3-BRAF, LIMD1-BRAF, GIT2-BRAF, JHDM1D-BRAF, TMEM9-BRAF, LUC7L2-BRAF, MBNL2-BRAF, GLI2-BRAF, GIPC2-BRAF, It includes all genes that have fused with Braf, such as EPS15L1-BRAF.
[0017] Diseases involving Braf overactivation mutations, for example, neurodevelopmental disorders associated with the Ras-MAPK signaling pathway may include Noonan syndrome, Cardiofacialcutaneous (CFC) syndrome, and Leopard syndrome.
[0018] In addition, the above-mentioned tumor (Cancer or Tumor or Neoplasm) includes all carcinomas that may be induced by BRAF overactivation or overexpression. Specifically, an example of a disease, disorder, or condition mediated by BRAF may be a “BRAF variant cancer,” a “BRAF-positive cancer,” or a “BRAF mutation-positive cancer,” in which BRAF-positive cancer induces carcinoma by enhancing BRAF activity in cells, particularly leading to the activation of the MAPK pathway. Brain tumors induced by BRAF mutations can be classified into pediatric brain tumors and adult brain tumors. The above-mentioned cancer includes brain cancer and carcinomas of areas outside the brain, such as non-brain cancer or extracranial cancers, and the above-mentioned non-brain cancer includes solid cancer and non-solid cancer (hematological tumors). Specific examples of the above cancer include, but are not limited to, glioblastoma, glioblastoma, and neuroblastoma.
[0019] For example, on the skin: Melanoma, Cutaneous Melanoma, Melanoma of Unknown Primary, Mucosal Melanoma, Skin Squamous Cell Carcinoma, Merkel Cell Carcinoma; on the lungs: Non-Small Cell Lung Carcinoma, Squamous Cell Lung Carcinoma, Lung Carcinoma, Small Cell Lung Carcinoma, Bronchogenic Carcinoma; on the thyroid: Thyroid Gland Undifferentiated (Anaplastic) Carcinoma, Thyroid Gland Follicular Carcinoma, Thyroid Gland Carcinoma, Thymic Carcinoma; In the liver, there is cholangiocarcinoma and hepatocellular carcinoma;In the circulatory system, hairy cell leukemia, Erdheim-Chester disease, mature B-cell lymphoma / leukemia, multiple myeloma, non-Hodgkin lymphoma, lymphoma, Langerhans cell histiocytosis, acute myeloid leukemia, myelodysplastic syndromes, chronic myelomonocytic leukemia, chronic lymphocytic leukemia, histiocytosis, Hodgkin lymphoma, juvenile xanthogranuloma, splenic diffuse red pulp, and small B-cell Lymphoma;In the digestive system, pancreatic carcinoma (Adenocarcinoma), colorectal carcinoma (Adenocarcinoma), gastric carcinoma (Adenocarcinoma), pancreatic ductal adenocarcinoma, adenocarcinoma of the gastroesophageal junction, esophageal squamous cell carcinoma, esophageal carcinoma, gastrointestinal stromal tumor, malignant salivary gland neoplasm, small intestinal adenocarcinoma, dysdermal neuroepithelialoma, bile duct carcinoma (Biliary Tract Carcinoma), rectal carcinoma, gallbroid carcinoma, and colorectal carcinoma (Adenocarcinoma); The reproductive organs include ovarian carcinoma, cervical carcinoma, germ cell tumor, endometrial carcinoma, prostate carcinoma, and cervical squamous cell carcinoma;In the head and neck region: Head and Neck Squamous Cell Carcinoma, Papillary Craniopharyngioma, Nasal Cavity and Paranasal Sinus Carcinoma, Lip and Oral Cavity Carcinoma, Nasopharyngeal Carcinoma, Oropharyngeal Carcinoma, Ameloblastoma, Laryngeal Neoplasm; in the urinary system: Urothelial Carcinoma, Bladder Carcinoma, Kidney Cancer (e.g., Renal Cell Carcinoma); in soft tissues: Soft Tissue Sarcoma, Histiocytic Sarcoma, Small Intestinal Adenocarcinoma, Embryonal Rhabdomyosarcoma; The breast refers to all applicable cancers, including breast carcinoma.
[0020] It includes low-grade gliomas (LGG) primarily corresponding to Grade 1-2 in the WHO 2021 classification of CNS tumors caused by BRAF mutations, particularly BRAF-altered low-grade gliomas, and BRAF-mutated pLGG can be accompanied by refractory epilepsy. Low-grade gliomas (LGG) include astrocytoma (specifically, astrocytoma, IDH-mutant) and oligodendroglioma (oligodendroglioma, IDH-mutant, 1p / 19q-codeleted), which belong to grade II of the WHO 2021 classification of CNS tumors, and are characterized by slow growth rates and a relatively good prognosis. High-grade glioma (HGG) includes anaplastic astrocytoma (Astrocytoma, IDH-mutant) and anaplastic oligodendroglioma (Oligodendroglioma, IDH-mutant, 1p / 19q-codeleted), which belong to WHO CNS grade III, and glioblastoma (Glioblastoma, IDH-wildtype), which belongs to WHO CNS grade IV, and is characterized by rapid progression and a poor prognosis.
[0021] Examples include PA (Pilocytic Astrocytoma), GG (Ganglioglioma), DIA / DIG (Desmoplastic Infantile Astrocytoma / Ganglioglioma), DLGT (Diffuse Leptomeningeal Glioneuronal Tumor), and DNT (Dysembryoplastic Neuroepithelial Tumor). Adult brain tumors caused by BRAF mutations include high-grade gliomas, which are mainly Grade 3-4 in the WHO 2021 classification of CNS tumors, and may specifically be BRAF-altered high-grade gliomas, including, for example, GBM (Glioblastoma), Astrocytoma, Astroblastoma, PXA (Pleomorphic Xanthoatrocyoma), Papillary Craniopharyngioma, and Melanoma Metastasis.
[0022] In addition, Glioma, Anaplastic Pleomorphic Xanthoastrocytoma, Low-Grade Neuroepithelial Tumor, Anaplastic Ganglioglioma, Neuronal and Mixed Neuronal-Glial Tumors, Pilomyxoid Astrocytoma, Dysembryoplastic Neuroepithelial Tumor, Malignant Central Nervous System Neoplasm, Astrocytic Tumor, Diffuse Glioma, Neuroblastoma, Malignant Peripheral Nerve Sheath Tumor, Gangliocytoma, Metastatic Malignant Neoplasm in the Brain, Neurofibroma, Neurofibromatosis Type 1, and Optic Glioma It includes all brain tumors in which Braf mutations are found, such as Optic Nerve Glioma and Schwannoma.
[0023] In particular, brain tumors caused by BRAF mutations may be gliomas, which can be classified into pediatric brain tumors and adult brain tumors, or they may be divided into low-grade gliomas (primarily Grade 1-2 in the WHO 2021 classification of CNS tumors) and high-grade gliomas (primarily Grade 3-4 in the WHO 2021 classification of CNS tumors). Typically, low-grade gliomas are mostly pediatric brain tumors, while high-grade gliomas tend to appear more frequently in adult brain tumors. Accordingly, the BRAF-mediated disease, disorder, and condition according to the present invention may be a brain tumor mediated by a BRAF variant, for example, a BRAF mutation, specifically a glioma and the accompanying symptoms. The above symptoms may include epilepsy, headache, dizziness, hemiplegia, facial paralysis, increased intracranial pressure, hydrocephalus, decreased sensation, decreased vision, visual field constriction, hemianopia, tinnitus, hearing loss, loss of smell, slurred speech, speech disorder, aphasia, dysarthria, dysphagia, vomiting, gait disorder, tremors of hands and feet, convulsions, decreased cognitive function, memory impairment, intellectual disability, personality disorder, cerebral hemorrhage, stroke, abnormal pulse and respiratory rates, decreased attention, ataxia, spatial sensory impairment, etc.
[0024] The above BRAF variant, for example, a BRAF variant mediated glioma, may be a BRAF mutation positive glioma, specifically including a BRAF altered low-grade glioma and a BRAF altered high-grade glioma, and the BRAF altered high-grade glioma may be a BRAF variant gliobrastoma.
[0025] In the present specification regarding gliomas caused by BRAF mutations, the term glioma used has a general meaning in the art and refers to a tumor occurring in the brain or spine, which is generally derived from or associated with glial cells. In certain embodiments, gliomas referred to in the present specification include, without limitation, oligodendrogliomas (derived from oligodendrocytes), ependymomas (derived from ependymal cells), astrocytomas (derived from astrocytes and including glioblastoma (glioblastoma multiforme or grade IVV astrocytoma)), brainstem glioma (occurring in the brainstem), optic nerve glioma (occurring within or around the optic nerve), or mixed gliomas (e.g., oligoastrocytomas containing cells derived from various types of glial cells).
[0026] In certain embodiments, the glioma is a low-grade glioma (LGG) or a high-grade glioma (HGG). In certain embodiments, the glioma may be a grade I glioma, a grade II glioma, a grade III glioma, or a grade IV glioma. General classifications or grades of cancer, and in particular the classification of gliomas, are well known in the art. For example, gliomas may be graded according to the World Health Organization (WHO) grading system. In certain embodiments, the glioma may be a primary glioma, a metastatic (or secondary) glioma, or a recurrent glioma.
[0027] In the present invention, the compound for regulating the activity and / or expression level of BRAF is, specifically, a compound useful for regulating BRAF activity or expression. In particular, the compound according to the present invention targets the gene encoding the BRAF protein and regulates the activity and / or expression of the BRAF protein. The BRAF-targeted antisense oligonucleotide (ASO) of the present invention reduces the amount of BRAF expression by degrading the mRNA of the BRAF gene and can induce inhibition of BRAF activity, so it can be used as a therapeutic drug for cancers and other genetic diseases in which the BRAF gene is overexpressed or overactivated. Furthermore, it can act not only on point mutations on the BRAF gene but also in cases where gene fusion occurs between the BRAF gene and other genes, so it can be used as a therapeutic drug for various types of mutations and genetic abnormalities. In particular, BRAF proteins modified by mutations may respond differently to BRAF inhibitors of the small molecule class and acquire resistance upon repeated administration, but the BRAF antisense oligonucleotide of the present invention can prevent and overcome resistance by reducing the amount of Braf mRNA expression itself.
[0028] As used herein, "target nucleic acid" and "target RNA" refer to nucleic acids designed to be affected by an antisense compound. "Target RNA" refers to an RNA transcript and includes pre-mRNA and mRNA unless otherwise specified. In this specification, "RNA" refers to an RNA transcript and includes both pre-mRNA and mature mRNA unless otherwise specified.
[0029] As used herein, "target region" refers to a portion of a target nucleic acid designed to hybridize an oligomer compound. Herein, the "target nucleic acid" and "target RNA" are BRAF. In this specification, the BRAF gene may be a human BRAF gene sequence, a known reference transcript or a variant thereof, and may be identified in various gene databases. Specifically, the nucleic acid sequence of the BRAF gene, e.g., the human BRAF nucleic acid sequence, may be identified by NCBI (National Center for Biotechnology Information) Nucleotide ID NC_000007.14, genomic location 140713328 to 140924929 on chromosome 7, appearing in nucleotides 142027505 to 142239131, or may be NCBI Nucleotide ID NC_060931.1 or Ensembl Nucleotide ID ENST00000646891.2. The coordinates used in this institution refer to the coordinates of the genome reference assembly GRCh38 (Genome Research Consortium Human Build 38), also known as Hg38 (Human Genome Build 38).
[0030] The compounds according to the present invention include, but are not limited to, antisense oligonucleotides for BRAF nucleic acids and RNA interference agents (RNAi agents).
[0031] The above RNAi agent refers to an antisense agent that acts at least partially via RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNAs including microRNA mimics. RNAi agents are not intended to include antisense oligonucleotides.
[0032] One example of the above RNAi agent may be siRNA as a double-stranded RNAi agent, and may include an antisense strand complementary to a target gene and a sense strand complementary to the antisense strand, and may optionally include one or more lipophilic moiety conjugated to one or more internal positions of at least one strand, optionally via a linker or carrier. The sense and antisense strands may each be 19 to 25 nucleotides long, but are not limited thereto. The lipophilic moiety may be an aliphatic, alicyclic, or polyalicyclic compound, specifically lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexianol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)ritocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine, or may contain a saturated or unsaturated C4-C30 hydrocarbon chain and a selective functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. More specifically, the above lipophilic moiety may contain saturated or unsaturated C6-C18 hydrocarbon chains, and for a detailed description thereof, refer to WO2019217459A1, etc.
[0033] The BRAF inhibitor according to the present invention may comprise a conjugate group and / or a terminal group. In certain embodiments, the BRAF inhibitor modulates the amount and / or activity of the target nucleic acid. The conjugate moiety modifies one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cell distribution, cell uptake, charge, and removal. In certain embodiments, the conjugate moiety imparts new properties to the attached oligonucleotide. As used herein, "conjugate group" refers to a group of atoms directly attached to the oligonucleotide. The conjugate group comprises a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
[0034] In this specification, the term “inhibiting expression or activity” indicates a reduction or inhibition of expression or activity compared to expression or activity in untreated or control samples, and does not necessarily indicate the complete elimination of expression or activity. Specifically, the antisense oligomer or RNAi agonist according to the present invention may be capable of reducing BRAF expression levels to 70% or less, 65% or less, 60% or less, or 50% or less.
[0035] In certain embodiments, the oligomer compound and the oligomer duplex can hybridize to a target nucleic acid to produce at least one antisense activity; and such oligomer compound and the oligomer duplex are antisense compounds. In certain embodiments, the antisense compound has antisense activity when it reduces or inhibits the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, the antisense compound selectively affects one or more target nucleic acids.
[0036] In a specific embodiment, the BRAF inhibitor may reduce the level of activity or expression of BRAF mRNA or BRAF protein by about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, or about 95% or more based on 100% before treatment. Alternatively, based on 100% prior to treatment, the activity or expression level of the BRAF protein after treatment with the BRAF inhibitor may be about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less.
[0037] The BRAF inhibitor according to the present invention may be an antisense oligonucleotide, and an antisense oligonucleotide means an oligonucleotide having a nucleic acid sequence complementary to a target nucleic acid or a region or segment thereof. In certain embodiments, the antisense oligonucleotide can specifically hybridize to a target nucleic acid or a region or segment thereof. As used herein, "antisense oligonucleotide" means an oligonucleotide comprising an oligonucleotide portion of an antisense compound capable of hybridizing to a target nucleic acid and having at least one antisense activity. The terms "antisense oligomer," "antisense compound," "antisense oligonucleotide," or "antisense RNase H oligonucleotide" are used interchangeably and each has a base-pair forming portion connected by a nucleobase bond that causes the base-pair portion to hybridize. In these embodiments, the region of the oligonucleotide has a nucleobase sequence complementary to the target nucleobase sequence. In a specific example, one region or the entire length of the nucleobase sequence of the oligonucleotide is complementary to a target gene or target region with at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% nucleobase homology. The term "antisense RNase H oligonucleotide" means an oligonucleotide comprising a region that is complementary to the target sequence and includes at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.
[0038] In this specification, compounds for controlling the activity and / or expression level (amount) of BRAF, e.g., oligonucleotides, also include pharmaceutically acceptable salts thereof, and the “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound, e.g., an oligomer compound or oligonucleotide, i.e., a salt that retains the desired biological activity of the parent compound and does not cause unwanted toxicological effects.
[0039] More specifically, the oligomer compound according to the present invention is more preferably i) having a low expression rate of the human BRAF gene, i.e., a high BRAF inhibition rate, ii) having a rapid recovery time after administration of the oligomer compound in a tolerability evaluation using mice, and iii) the IC of the oligomer compound under test. 50 A lower (uM) value is preferable. Specifically, the oligomer compound according to the invention, i.e., the antisense oligonucleotide, may satisfy one or more of the characteristics i) to iii) above, and most preferably may satisfy all of the characteristics i) to iii).
[0040] For example, regarding i) the expression rate of the human BRAF gene above, the lower the average relative expression rate of human BRAF mRNA by 5-10-5 2'-MOE Gapmer modified oligonucleotide in an experiment using a cell line according to the method of Example 1 of the present invention, the higher the potency of the oligonucleotide. Specifically, the expression rate of the human BRAF gene above may be a value evaluated in one cell line, or an average value evaluated among two or more cell lines. For example, the relative expression rate of the 5-10-5 2'-MOE Gapmer modified oligonucleotide in the cell line experiment may be 0.9 or less, 0.8 or less, 0.7 or less, 0.6 or less, 0.5 or less, 0.45 or less, 0.4 or less, or 0.3 or less.
[0041] When the above ii) drug tolerance evaluation using a mouse is performed according to the method of Example 3 of the present invention, the recovery time (minutes) in the drug tolerance evaluation results in the mouse in the experiment using a cell line according to the method of Example 1 of the present invention may be 660 minutes or less, 600 minutes or less, 540 minutes or less, 500 minutes or less, 480 minutes or less, 420 minutes or less, 300 minutes or less, 240 minutes or less, or 180 minutes or less.
[0042] IC of the oligomer compound subject to test in iii) above 50 With respect to the (uM) value, the degree of inhibition of BRAF mRNA expression levels by 5-10-5 2'-MOE capmer-modified oligonucleotide using a cell line according to the method of Example 2 of the present invention (IC 50 It is more preferable that the value (in the unit uM) is, for example, 0.9 or less, 0.8 or less, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, or 0.15 or less.
[0043]
[0044] One embodiment relates to an oligomer compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of the BRAF nucleic acid sequence, and the modified oligonucleotide comprises one or more modifications selected from the group consisting of a modified sugar moiety, a modified nucleoside inter-bond, and a modified base.
[0045] Another embodiment relates to an oligomer compound comprising a modified oligonucleotide composed of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases among the nucleic acid sequences of SEQ ID NOs 1 to 763, and the modified oligonucleotide comprises one or more modifications selected from the group consisting of a modified sugar moiety, a modified nucleoside inter-bond, and a modified base.
[0046] "Oligomer compound" means a compound comprising a single oligonucleotide and optionally one or more additional feature groups, e.g., a conjugate group or a terminal group. "Oligonucleotide" means a polymer of linked nucleosides, each independently modified or unmodified. Unless otherwise specified, the oligonucleotide comprises 8 to 80 subunits, 8 to 70, 8 to 60, 8 to 50, 8 to 40, 8 to 30, 8 to 25, 8 to 22, 8 to 20, 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 10 to 25, 10 to 22, 10 to 20, 12 to 80, 12 to 70, 12 to 60, 12 to 50, 12 to 40, 12 to 30, It may include one or more subunits selected from the group consisting of 12 to 25, 12 to 22, 12 to 20, 14 to 80, 14 to 70, 14 to 60, 14 to 50, 14 to 40, 14 to 30, 14 to 25, 14 to 22, 14 to 20, 16 to 80, 16 to 70, 16 to 60, 16 to 50, 16 to 40, 16 to 30, 16 to 25, 16 to 22, or 16 to 20.
[0047] The length of an oligonucleotide can be increased or decreased without removing activity. For example, in the literature by Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of oligonucleotides with nucleotide lengths of 13 to 25 were tested for their ability to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides with a nucleotide length of 25 containing 8 or 11 mismatched nucleotides near the ends of the oligonucleotides can direct specific cleavage of target RNA, albeit to a lesser extent than oligonucleotides without mismatches.
[0048] As used herein, in the context of oligonucleotides, “adjacent” refers to a nucleoside, a nucleobase, a sugar moiety, or a linkage between nucleosides that are immediately adjacent to each other. For example, “adjacent nucleobase” means nucleosides that are immediately adjacent to each other in a sequence.
[0049] As exemplary oligomer compounds of the present invention, nucleobase sequences that bind complementarily to the nucleic acid sequence of human BRAF are shown in Tables 1 to 8 below, and the start point and end point in Tables 1 to 8 below represent the base positions of the BRAF nucleic acid sequence provided by Ensemble (Ensembl database transcript ID: ENST00000646891.2).
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058] In a specific example, the oligonucleotide is an oligomer compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide may be an oligomer compound comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases in a region selected from the group consisting of SEQ ID NOs 1 to 763. The oligomer compound may be a modified oligonucleotide comprising one or more modifications selected from the group consisting of a modified sugar moiety, modified nucleoside inter-bonding, and modified bases.
[0059] The specific oligonucleotide above may be one or more regions selected from the TR1 to TR15 regions of the BRAF nucleic acid sequence (specifically, Ensembl database transcript ID: ENST00000646891.2). Detailed information regarding each of the above regions is provided in Table 9 below. The respective inverse complementary nucleic acid sequences for the TR1 to TR15 regions of the above BRAF nucleic acid sequence are provided in Table 10. An example of an antisense oligonucleotide according to the present invention may be an oligomer compound comprising an oligonucleotide composed of a nucleoside with 8 to 80, for example, 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases linked together, selected from the group consisting of SEQ ID NOs 764 to 778.
[0060] The above region may appear to be a region possessing a highly effective inhibitor of BRAF expression in antisense oligonucleotide screening, and the above region on BRAF mRNA can be considered a good target region for targeting with RNAi agonists. The start point and end point in Table 9 below represent the base positions of the BRAF nucleic acid sequence provided by Ensemble (Ensembl database transcript ID: ENST00000646891.2).
[0061] Target Region ID Sequence Number Start Site of Human BRAF Nucleic Acid Sequence Stop Site of Human BRAF Nucleic Acid Sequence TR Region of Human BRAF Nucleic Acid Sequence Nucleotide sequence (5' to 3')TR1764143238143274AAACACTTGGTAGACGGGACTCGAGTGATGATTGGGATR2765146866146908GTGAAAATGTTGAATGTGACAGCACCTACACCTCAGCAGTTACTR3766147975148010ATCAAACTTATAGATATTGCACGACAGACTGCACAGTR47671481301481 70ACATAAGGATGCTAACTAATGGCTGGTAAATAATATGATACTR5768148225148248GATAATAAATACATGACTGCAAACTR6769149593149623TGTGAAGAGTAAACCATGGCAAAGATTGTGATR7770171571171617AGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGG AGTGGGTCCCTR8771190294190320CATCCAGGCAGGGGGATATGGTGCGTTTR9772190685190714GACTCCAGAAGAAGACCCTAC CTATGCCTGTR10773190971190993AGTAAAATGTCTTAACTTCGGATTR11774191497191524TGGTCCTATCAAAGATTTGGCCATC TCTTR12775191873191894ATGAAAAGGAACATTTCACGTATR13776191903191940AATGATACTAAGGAATAAAGAAGTACAACTAT TGGAAATR14777191959191985TTTAAATCCTCCAGTGGCATTAAATATTR15778192029192052ATAGAAGACTAGCAAGCATGTAAC
[0062] Target Region ID Sequence Number Part of the inverse complementary nucleotide sequence (5' to 3') to the TR region of the human BRAF nucleic acid sequence 794CATATTATTTACCAGCCATTAGTTAGCATCCTTAPart of TR6 795TTGCCATGGTTTA
[0063] For example, the above oligonucleotide may be an oligomer compound comprising an oligonucleotide composed of a nucleoside linked with 8 to 80, for example, 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases, which are reverse complements to the BRAF gene region (sense strand) selected from the group consisting of SEQ ID NOs 764 to 778.
[0064] Specifically, the nucleic acid sequence of an oligonucleotide inversely complementary to the BRAF gene region (sense strand) selected from the group consisting of SEQ ID NOs 764 to 778 is, for example, an oligonucleotide inversely complementary to a portion of the nucleic acid sequence of TR1 (SEQ ID NO. 764) in the BRAF gene, such as the nucleic acid sequences of SEQ ID NOs 393 to 397 or the nucleic acid sequences of SEQ ID NOs 705 to 716;
[0065] As an oligonucleotide inversely complementary to a portion of the nucleic acid sequence of TR2 (SEQ No. 765), for example, the nucleic acid sequences of SEQ Nos. 285 to 296;
[0066] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR3 (SEQ No. 766), for example, the nucleic acid sequences of SEQ No. 262 to SEQ No. 270;
[0067] As an oligonucleotide that is inversely complementary to a portion of the nucleic acid sequence of TR4 (SEQ NO. 767), for example, the nucleic acid sequence of SEQ NOs 742 to 758; more specifically, as an oligonucleotide that is inversely complementary to a portion of the nucleic acid sequence of SEQ NO. 767, for example, the nucleic acid sequence of SEQ NOs 742 to 745 or 752 to 755;
[0068] As an inverse complementary oligonucleotide to a portion of the nucleic acid sequence of TR5 (SEQ No. 768), for example, the nucleic acid sequence of SEQ No. 601 or 739,
[0069] An oligonucleotide that is inversely complementary to a portion of the nucleic acid sequence of TR6 (SEQ NO. 769), for example, the nucleic acid sequence of SEQ NOs. 590 to 591 or the nucleic acid sequence of SEQ NOs. 729 to 737, more specifically, an oligonucleotide that is inversely complementary to a portion of the nucleic acid sequence of SEQ NO. 769, for example, the nucleic acid sequence of SEQ NOs. 729 to 735;
[0070] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR7 (SEQ No. 770), for example, the nucleic acid sequences of SEQ Nos. 248 to 255;
[0071] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR8 (SEQ No. 771), for example, the nucleic acid sequences of SEQ Nos. 202 to 207;
[0072] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR9 (SEQ No. 772), for example, the nucleic acid sequences of SEQ Nos. 179 to 185;
[0073] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR10 (SEQ No. 773), for example, the nucleic acid sequences of SEQ Nos. 149 to 152;
[0074] An oligonucleotide that is inversely complementary to a portion of the nucleic acid sequence of TR11 (SEQ No. 774), for example, the nucleic acid sequence of SEQ No. 126 to SEQ No. 130, the nucleic acid sequence of SEQ No. 346, or the nucleic acid sequence of SEQ No. 763;
[0075] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR12 (SEQ No. 775), for example, the nucleic acid sequence of SEQ No. 102, SEQ No. 339, SEQ No. 341, or SEQ No. 342;
[0076] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR13 (SEQ No. 776), for example, the nucleic acid sequences of SEQ Nos. 696 to 699;
[0077] As an oligonucleotide inverse complement to a portion of the nucleic acid sequence of TR14 (SEQ No. 777), for example, the nucleic acid sequences of SEQ Nos. 689 to 694; or
[0078] As an oligonucleotide that is inversely complementary to a portion of the nucleic acid sequence of TR15 (SEQ No. 778), for example, among the nucleic acid sequences of SEQ Nos. 97 to 1027, or SEQ No. 340,
[0079] It may be an oligonucleotide comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases. Additionally, the oligonucleotide may be an oligomer compound comprising one or more modifications selected from the group consisting of a modified sugar moiety, a modified nucleoside inter-bond, and a modified base.
[0080] A specific example of the above oligonucleotide is, in the specific example, the oligonucleotide that binds complementarily to the TR4 region may be an oligomer compound comprising an oligonucleotide composed of a nucleoside with 14 to 80, for example, 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases linked together, which is included in the nucleic acid sequence of SEQ ID NO. 782, more specifically in the nucleic acid sequence of SEQ ID NO. 794, and may be, for example, an oligomer compound having the nucleic acid sequence of SEQ ID NO. 742 to 745 or 752 to 755.
[0081] The oligonucleotide that binds complementarily to the TR5 region may be an oligomer compound comprising an oligonucleotide composed of a nucleoside with 14 to 80, for example, 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases linked in the nucleic acid sequence of SEQ ID NO. 783, and may be an oligomer compound having, for example, the nucleic acid sequence of SEQ ID NO. 601 or 739.
[0082] The oligonucleotide that binds complementarily to the TR6 region may be an oligomer compound comprising an oligonucleotide composed of a nucleoside in which 14 to 80, for example, 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases are linked in the nucleic acid sequence of SEQ ID NO. 784, more specifically the nucleic acid sequence of SEQ ID NO. 795, and may be an oligomer compound having, for example, the nucleic acid sequence of SEQ ID NO. 729 to 735.
[0083] The oligonucleotide that binds complementarily to the TR13 region may be an oligomer compound comprising an oligonucleotide composed of a nucleoside with 14 to 80, for example, 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases linked in the nucleic acid sequence of SEQ ID NO. 791, and may be an oligomer compound having, for example, the nucleic acid sequence of SEQ ID NO. 696 to 699.
[0084]
[0085] In this specification, "modified oligonucleotide" means an oligonucleotide in which at least one sugar, nucleobase, or nucleoside-link is modified, and said modified oligonucleotide may include one or more modifications selected from the group consisting of a modified sugar moiety, a modified nucleoside-link, and a modified base. The term "unmodified oligonucleotide" means an oligonucleotide that does not include any modification of any sugar, nucleobase, or nucleoside-link.
[0086] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.
[0087] As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety.
[0088] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. A nucleobase is a complex-ring moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is a group of atoms other than unmodified A, T, C, U, or G that can be paired with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase.
[0089] There may be at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 modified nucleobases among any sequence of nucleobases included in the oligonucleotide.
[0090] The above-mentioned modified oligonucleotide has a sugar motif, wherein the sugar motif is
[0091] It may include a 5'-region composed of 1 to 6 linked 5'-region nucleosides; a central region composed of 6 to 10 linked central region nucleosides; and a 3'-region composed of 1 to 6 linked 3'-region nucleosides.
[0092] In an embodiment, the modified sugar moiety may include one or more selected from the group consisting of non-cyclic modified sugar moiety and cyclic or tricyclic sugar moiety. In a specific embodiment, the modified sugar moiety is a sugar substitute. Such a sugar substitute may include one or more substitutions corresponding to other types of the modified sugar moiety.
[0093] In certain embodiments, the modified sugar moiety is a non-cyclic modified sugar moiety comprising a furanosyl ring having one or more substituents, none of which bridges two atoms of the furanosyl ring to form a cyclic structure. Such non-bridging substituents may be at any position on the furanosyl, including substituents at the 2', 3', 4' and / or 5' positions (but not limited thereto). Examples of 2'-substituents suitable for the non-cyclic modified sugar moiety include, but are not limited to, the following: 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is a halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C10 alkoxy, O-C1-C10 substituted alkoxy, O-C1-C10 alkyl, O-C1-C10 substituted alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn) (wherein each Rm and Rn are independently H, an amino protecting group or a substituted or unsubstituted C1-C10 alkyl), -O(CH2)2ON(CH3)2("DMAOE"), 2'-OCH2OCH2N(CH2)2("DMAEOE"), etc.
[0094] In certain embodiments, the non-cyclic modified sugar moiety comprises a substituent at the 3'-position. Examples of substituents suitable for the 3'-position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy) and alkyl (e.g., methyl, ethyl). In certain embodiments, the non-cyclic modified sugar moiety comprises a substituent at the 4'-position. Examples of 4'-substituents suitable for the non-cyclic modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in WO 2015 / 106128 (Manoharan et al.).
[0095] Examples of 5'-substituents suitable for non-cyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl and 5'-methoxy, 5'-aminopropyl, or 5'-CP. One example of a 5'-substituent suitable for the non-cyclic modified sugar moiety includes 5'-CP, specifically, “5'-CP” is a sugar moiety compound in which two methyl groups are substituted at the 5-position of the included 2-deoxyribose, and these methyl groups are connected to each other to form cyclopropane, and is also referred to as “5'-CP nucleoside,” and a detailed description thereof is provided in WO2022 / 211095A1. In addition, in certain embodiments, the non-cyclic modified sugar moiety comprises, but is not limited to, one or more non-bridging sugar substituents, e.g., 2'-F-5'-methyl sugar moiety.
[0096] In certain embodiments, the 2'-substituted non-cyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0097] Certain modified sugar moietyes include substituents that bridge two atoms of the furanosyl ring to form a second ring, thereby generating a bicyclic sugar moiety. Nucleosides containing such bicyclic sugar moietys have been referred to as bicyclic nucleosides (BNA), locking nucleosides, or stereolocatedly bound nucleotides (CRN). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383; and PCT Publication No. WO 2013 / 036868. In these specific embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose is a ribose ring. Examples of such 4' to 2' bridging substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "bound ethyl" or "cEt" when present in S coordination), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("bound MOE" or "cMOE") and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof, 4'-CH2-ON(CH3)-2', 4'-CH2-C-(H)(CH3)-2', 4'-CH2-C-(=CH2)-2' and analogs thereof, 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2'(where, R, R a and R b Each independently is H, protector, or C1-C 12 It includes, but is not limited to, alkyl groups.
[0098] The modified sugar moiety described above comprises a substituent that bridges two atoms of the furanosyl ring to form a second ring, thereby generating a bicyclic sugar moiety. Nucleosides containing such a bicyclic sugar moiety have been referred to as bicyclic nucleosides (BNA) or constrained nucleosides. The bicyclic sugar moiety comprises a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose is a ribose ring. Examples of such 4' to 2' bridging substituents include, but are not limited to: 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "bound ethyl" or "cEt" when present in S coordination), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("bound MOE" or "cMOE") and analogs thereof, 4'-C(CH3)(CH3)-O-2' and analogs thereof, 4'-CH2-N(OCH3)-2' and analogs thereof, 4'-CH2-ON(CH3)-2', 4'-CH2-C-(H)(CH3)-2', 4'-CH2-C-(=CH2)-2' and analogs thereof, 4'-C(R a R b )-N(R)-O-2', 4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2'(where, R, R a and R b Each independently is H, protector, or C1-C 12 It includes, but is not limited to, alkyl (e.g., US 7,427,672 (Imanishi et al.)).
[0099] In this specification, the general description of a cyclic nucleoside includes both isomer coordinations. When the position of a specific cyclic nucleoside (e.g., LNA or cEt) is identified in the embodiments illustrated herein, they exist in the β-D coordination, unless otherwise specified.
[0100] In certain embodiments, the modified sugar moiety is a sugar substitute. In these specific embodiments, the oxygen atom of the sugar moiety is replaced, for example, by a sulfur, carbon, or nitrogen atom.
[0101] Many other bicyclic and tricyclic sugars and sugar substitutes that can be used in modified nucleosides are known in the art.
[0102] In one embodiment, the oligonucleotide compound may comprise an unmodified internucleotide linkage (phosphodiester internucleotide linkage) and / or one or more modified internucleotide linkages. In certain embodiments, each internucleotide linkage may comprise one or more internucleotide linkages selected from the group consisting of phosphodiester internucleotide linkages (PO), phosphorothioate internucleotide linkages (PS), and methanesulfonyl phosphoramidate internucleotide linkages (MsPA). The term methanesulfonyl phosphoramidate internucleotide linkage (MsPA) is also used interchangeably with mesyl-phosphoramidate internucleotide linkage.
[0103] In a specific embodiment, each nucleoside linker of the modified oligonucleotide may be independently selected from a phosphorothioate (PS) nucleoside linker and a phosphodiester (PO) nucleoside linker. In one embodiment, each phosphorothioate nucleoside linker is independently selected from stereorandom phosphorothioate, phosphorothioate, and phosphorothioate.
[0104] In a specific example, the modified oligonucleotide according to the present invention may include one or more nucleoside linkers selected from the group consisting of phosphodiester nucleoside linkers (PO), phosphorothioate nucleoside linkers (PS), and methanesulfonyl phosphoramidate nucleoside linkers (MsPA), and may include, for example, phosphodiester (PO) and / or phosphorothioate (PS), nucleoside linkers of PS, PO, or a mixture of PS and PO. In this case, the modified oligonucleotide may have an unmodified or modified sugar moiety and a nucleobase that may be unmodified or modified, as described above regarding the sugar moiety and nucleobase. For example, when the nucleoside linkers of the modified oligonucleotide include both PS and PO, the PO bonds may be located in both the wing and gap regions of the gapmer structure, and preferably may be present in each wing. Specifically, the oligonucleotide compound has a gapmer structure including a 5'-wing region, a gap region, and a 3'-wing region, and may have 1 to 6 links in each wing region. For example, an example of a modified oligonucleotide containing mixed nucleoside linkers of PO and PS may be selected from the group consisting of SOSSS, SOOSS, SOSOS, SOOOSS, SOOOOS, SSSOSS, SSOOSSS, SSOSOS, SSOOSS, SSOOOS, and SSOOSS. In this case, 'O' represents a phosphodiester nucleoside linker (PO), and 'S' represents a phosphorothioate nucleoside linker (PS).More specifically, it may be a combination of a 5'-wing region including one or more selected from the group consisting of SOSSS, SOOSS, SOSOS, SOOOSS, and SOOOOS, and a 3'-wing region including one or more selected from the group consisting of SSSOSS, SSOOSSS, SSOSOS, SSOOSS, SSOOOS, and SSOOSS. Specifically, it may be SOSSSSSSSSSSSSSSSSOSS, SOSSSSSSSSSSSSSSSOOSS, SOOSSSSSSSSSSSSSSSSOOSS, SOSOSSSSSSSSSSSSSSSOSOS, SOOOSSSSSSSSSSSSSSS, SOOOSSSSSSSSSSSSSOOOS, or SOOOOSSSSSSSSSSSSOOSS. More specifically, it may be SOSSSSSSSSSSSSSSSSOSS SOSSSSSSSSSSSSSSSSSOOSS, SOOSSSSSSSSSSSSSSSSOOSS, or SOOOOSSSSSSSSSSSSOOSS.
[0105] An example of an oligomer compound containing the above PO bond may be a sequence comprising 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 adjacent nucleobases among the nucleic acid sequences of SEQ ID NOs. 1 to 763, more specifically SEQ ID NOs. 183, 290, 291, 340, 341, 397, 493, 601, 697, 729, 730, 737, 742, 744, 752, 753, 754, or 755, and more specifically, among the nucleic acid sequences of SEQ ID NOs. 601, 697, 742, 754, or 755, 12, 13, In a nucleic acid sequence containing 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases, it may contain a mixed nucleoside linker of PO and PS. When the oligomer compound has a gapmer structure including a 5'-wing region, a gap region, and a 3'-wing region, examples of modified oligonucleotides containing a mixed nucleoside linker of PO and PS are described in Tables 21 to 23 below.
[0106] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a completely modified sugar motif, and each nucleoside within the completely modified region may comprise the same single modified sugar moiety referred herein as a uniformly modified sugar motif, or may comprise two or more different types of modified sugar moietys, specifically, the modified oligonucleotide may comprise a bicyclic sugar moiety, for example, one 4' to 2' bridging sugar substituent, or a non-bicyclic modified sugar moiety, specifically one 2'-MOE, or may comprise one or more bicyclic sugar moietys and one or more non-bicyclic modified sugar moietys.
[0107] In certain embodiments, the modified oligonucleotide may comprise a region having a gapmer motif defined by two outer regions or "wings" and a central or inner region or "gap," wherein the central gap region is a region capable of recruiting RNaseH by binding complementarily to the target nucleic acid. The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form adjacent sequences of nucleosides, wherein at least a portion of the sugar moiety of the nucleoside of each wing may differ from at least a portion of the sugar moiety of the nucleoside of the gap.
[0108] "GAPMER" refers to an oligonucleotide comprising an inner region containing multiple nucleosides that support RNase H cleavage, situated between outer regions containing one or more nucleosides, wherein the nucleosides comprising the inner region are chemically distinct from the nucleosides comprising the outer region or nucleosides. The inner region may be referred to as a "gap," and the outer region may be referred to as a "wing." Here, the length of the three regions of the GAPMER (number of nucleosides) may be provided using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. For example, a 5-10-5 GAPMER consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. Where chemical modifications are included in the above nomenclature, for example, a 5-10-5 MOE capmer consists of 1 to 6 MOE modified nucleosides linked to the 5'-wing, 10 deoxynucleosides linked to the gap, and 1 to 5 MOE nucleosides linked to the 3'-wing. In certain embodiments, the modified oligonucleotides may include a 5-10-5 MOE capmer, a 3-10-3 BNA capmer, a 3-10-3 cEt capmer, or a 3-10-3 LNA capmer, etc.
[0109] In certain embodiments, the modified oligonucleotide may include one or more modified portions selected from the group consisting of modified sugar moiety, modified nucleoside inter-bonds, and modified nucleobases in the three regions (5'-wing, gap, and 3'-wing) of the gapmer motif. Specifically, one or more modified nucleobases, e.g., 5-mC, may be included in the modified oligonucleotide, mainly in the gap region, but may also be included in the wing region.
[0110] The above-mentioned nucleoside bonds, for example, PS and PO bonds, may each be included in one or more of the total bonds of the modified oligonucleotide, for example, the total bonds may be included as PS bonds, or PS and PO bonds may be included in a mixture. PO bonds may be included in one or more of the total bonds of the modified oligonucleotide, and may be included mainly in the wing region, but may also be included in the gap region.
[0111]
[0112] Modified sugar moiety may be included in one or more of the total nucleotides mainly contained in the oligonucleotide, and specifically, non-cyclic sugar moiety may be included in the wing region, and cyclic sugar moiety may be mainly included in the wing region but may also be included in the gap region.
[0113] As a specific example, (i) the modified oligonucleotide may have C (cytosine) included in the gap region, wing region, or both the gap and wing regions (i.e., the entire oligonucleotide region), specifically in the entire oligonucleotide region, modified to 5-mC (methylcytosine), at least one internucleotide linkage included in the oligonucleotide may be modified to a PS bond, and the sugar moiety may be a structure in which a non-cyclic sugar moiety is included in the wing region; and (ii) the modified oligonucleotide may have C (cytosine) included in the gap region, wing region, or both the gap and wing regions (i.e., the entire oligonucleotide region), specifically in the entire oligonucleotide region, modified to 5-mC (methylcytosine), and each include at least one PS bond and one PO bond, specifically in the internucleotide linkage included in the wing region, including at least one PO bond, and the gap region entirely contains PS (iii) The modified oligonucleotide may be a structure in which a non-cyclic sugar moiety is included in the wing region, or (iii) the modified oligonucleotide may be a structure in which C (cytosine) included in the gap region, the wing region, or both the gap and the wing region (i.e., the entire oligonucleotide region) is modified to 5-mC (methylcytosine), in detail, in which PS bonds are included in the entire gap region and PS bonds, PO bonds, or mixed bonds of PS and PO are included in the wing region, and a cyclic sugar moiety is mainly included in the wing region but may also be included in the gap region. However, including a modified portion selected from the group consisting of modified sugar moiety, unmodified or modified nucleoside inter-bonds, and modified nucleobases included in such a modified oligonucleotide is an exemplary example and is not limited thereto.
[0114] For example, the modified sugar moiety may comprise one or more selected from the group consisting of a non-cyclic modified sugar moiety comprising a 2'-MOE sugar moiety and a 2'-OMe sugar moiety; and a cyclic modified sugar moiety comprising a 2',4'-bridge selected from O-CH2- and -O-CH(CH3)-. The modified oligomer compound may comprise a non-cyclic modified sugar moiety and a cyclic modified sugar moiety, and specifically may comprise at least one modified nucleoside comprising a cyclic modified sugar moiety having a 2'-4' bridge and at least one modified nucleoside comprising a non-cyclic modified sugar moiety. In a specific example, the 5'-wing and / or 3'-wing may comprise at least one cyclic modified sugar moiety and a non-cyclic modified sugar moiety, and the modified oligonucleotide comprises a 5'-wing region consisting of 1 to 6 linked 5'-region nucleosides; a central gap region consisting of 6 to 10 linked central region nucleosides; and a 3'-wing region consisting of 1 to 6 linked 3'-region nucleosides, wherein the 5'-wing region and / or 3'-wing region may comprise at least one cyclic modified sugar moiety. For example, the 5'-wing region and / or 3'-wing region may comprise at least one cyclic modified sugar moiety, and the remaining nucleosides may comprise a non-cyclic modified sugar moiety, and a detailed description thereof is provided in WO2016-127002A1.
[0115]
[0116] In certain embodiments, the modified oligonucleotide comprises one or more conjugate moietyes or conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the molecule, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cell distribution, cell uptake, charge, and removal. In certain embodiments, the conjugate moiety imparts new properties to the molecule, for example, a fluorophore or reporter group that enables the detection of the molecule.
[0117] Conjugate moiety includes, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moiety, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholinenic acid moiety, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorescent dyes, and dyes.
[0118] In certain embodiments, the conjugate group comprises a conjugate linker that attaches the conjugate moiety to the remainder of the modified oligonucleotide. In certain embodiments, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached to the remainder of the modified oligonucleotide via the conjugate linker through a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, a nucleoside, or an amino acid unit. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In these specific embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, conjugate linkers comprising the conjugate linker described above are those known in the art as being useful for attaching a difunctional linking moiety, e.g., a conjugate group, to an oligomer compound, e.g., an oligonucleotide provided herein.
[0119] In certain embodiments, it is desirable for a conjugate group or a conjugate moiety to be cleaved from the remainder of the oligonucleotide. For example, under certain circumstances, an oligomeric compound (including an antisense agent or an oligomeric compound that is part thereof) or a modified oligonucleotide containing a specific conjugate moiety is better absorbed by certain cell types, but once the compound is absorbed, it is desirable for the conjugate group to be cleaved to release the unconjugated oligonucleotide. Accordingly, a specific conjugate moiety may typically contain one or more cleavable moietys within a conjugate linker. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms containing at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved within a cell or an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.
[0120] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, each ligand of the cell-targeting moiety has an affinity for at least one type of receptor on the target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian lung cell. Each ligand of the cell-targeting moiety is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative.
[0121]
[0122] One example of the present invention relates to a pharmaceutical composition for the prevention, alleviation, or treatment of a disease associated with increased activity and / or expression of BRAF comprising a preparation capable of mediating RNA interference (RNA interference, RNAi) for BRAF, or a method for the prevention, alleviation, or treatment of a disease associated with increased activity and / or expression of BRAF comprising the step of administering the preparation capable of mediating RNA interference (RNA interference, RNAi) for BRAF to a subject or individual in need thereof.
[0123] Another example of the present invention provides a composition for reducing human BRAF protein synthesis or human BRAF mRNA levels in a human subject having an increased expression level of the human BRAF gene. Or the present invention provides a method for reducing BRAF protein synthesis or human BRAF mRNA levels in a human subject having an increased expression level of the BRAF gene.
[0124] In a specific embodiment, the method according to the present invention comprises administering an RNAi agent to a subject and detecting or quantifying an amount of BRAF RNA or BRAF protein in the subject's cells or biological fluid. In a specific embodiment, the method comprises detecting / quantifying a first amount of BRAF RNA or BRAF protein in a first biological sample obtained before administration and detecting / quantifying a second amount of BRAF RNA or BRAF protein in a second biological sample obtained after administration, and detecting or quantifying a decrease in BRAF RNA or BRAF protein by comparing the first amount with the second amount.
[0125] The level or inhibition of expression of BRAF nucleic acid can be assessed in various ways known in the art. For example, target nucleic acid levels can be quantified by, for instance, Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. Antisense inhibition of BRAF nucleic acid can be evaluated by measuring BRAF protein levels. BRAF protein levels can be assessed or quantified in various ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assay, protein activity assay (e.g., caspase activity assay), immunohistochemistry, immunocytochemistry, or fluorescence-activated cell sorting (FACS).
[0126] In some embodiments, the subject or patient may have received one or more treatments selected from the group consisting of drug therapy, radiation therapy, and surgical therapy prior to treatment.
[0127]
[0128] In certain embodiments, the present specification describes a pharmaceutical composition comprising one of its oligomer compounds. In certain embodiments, one or more oligomer compounds each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition comprises one or more oligomer compounds and one or more excipients. In certain embodiments, the excipient is selected from water, salt solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0129] In certain embodiments, a pharmaceutical composition comprising an oligomer compound comprises any pharmaceutically acceptable salt of the oligomer compound, an ester of the oligomer compound, or a salt of such ester.
[0130] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions.
[0131] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intravertebral (IT), intraventricular (ICV), etc.). In these specific embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, e.g., water, or a physiologically compatible buffer, e.g., Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components (e.g., components that aid solubility or act as preservatives) are included. In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. Certain injectable pharmaceutical compositions are present in unit dosage forms, e.g., ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulation agents, such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.
[0132] The formulation composition and method of pharmaceutical compositions depend, without limitation, on various criteria including the route of administration, the severity of the disease, or the dose to be administered.
[0133] In certain embodiments, the oligomer compound may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of a pharmaceutical composition or formulation. Compositions and methods for the formulation of pharmaceutical compositions rely on a number of criteria, including but not limited to the route of administration, disease severity, or dosage.
[0134] RNAi preparations according to the present invention may be administered orally or parenterally, and parenteral administration means administration via injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intra-arterial administration, intraperitoneal administration, or intracranial administration, e.g., intravertebral or intraventricular administration.
[0135] The present invention relates to compounds for regulating the expression level and / or activity of the BRAF gene and compositions containing the same, which are useful for preventing, treating, or alleviating diseases, disorders, and conditions associated with BRAF.
[0136] The present invention will be explained in more detail with reference to the following examples, but the scope of the present invention is not intended to be limited to the following examples.
[0137]
[0138] Example 1: Inhibition of intracellular BRAF by 5-10-5 2'-MOE capmer (single dose)
[0139] 5-10-5 2'-MOE gapmer modified oligonucleotides were designed to target human BRAF RNA, and their effects on BRAF mRNA were tested in vitro. The modified oligonucleotides in the table below are 5-10-5 2'-MOE gapmers with phosphorothioate (PS) nucleoside linkages (PS links), and the cytosine in the wing region is methylcytosine. The gap segment consists of 10 2'-deoxyribosyl nucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. The motif for the gapmer (in the 5' to 3' direction) is eeeeeddddddddddeeeee; in the formula, 'd' represents the 2'-deoxyribosyl sugar moiety, and 'e' represents the 2'-MOE sugar moiety.
[0140] Two cell lines were treated by free absorption with 5 μM of modified oligonucleotides from SK-N-AS, Kelly, and SNB-19 cultured at a density of 20,000 cells / well, or A431 cell lines cultured at a density of 10,000 cells / well. Total RNA was extracted from the cells after 24 hours of treatment. The mRNA expression level of the BRAF gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. mRNA levels were measured using the human RPL-13 primer probe set (forward sequence: ATTTCTGTGGATCCGAGGAGG (SEQ No. 796), reverse sequence: GCCAGTTTCAGTTCTTCAGCAGA (SEQ No. 797), probe sequence: AGTACCGCTCCAAACTCATCCTCTTCC (SEQ No. 798) and the human BRAF primer probe set 1 (forward sequence: ACCCGCCTCGGACTCTATT (SEQ No. 799), reverse sequence: ACATTGGGAGCTGATGAGGAT (SEQ No. 800), probe sequence: CACAGCCCTTCCGACCAGCAGATG (SEQ No. 801).
[0141] The analysis results represent the relative expression rate of BRAF mRNA compared to untreated control cells. Each capmer listed in the table below targets the human BRAF transcriptome sequence disclosed herein (Ensembl database transcriptome ID: ENST00000646891.2). Table 11 below shows the expression level of human BRAF mRNA by oligonucleotides modified with 5-10-5 2'-MOE capmers. Relative expression rate is the value calculated by comparing the BRAF mRNA expression level of the experimental group treated only with DPBS, the solvent for the oligonucleotide, to the BRAF mRNA expression level when 5 μM of the oligonucleotide is treated. The mean value of the relative expression rate refers to the average value of the relative expression rates in two different cell lines. Specifically, in Table 11 below, the modified oligonucleotides of SEQ ID NOs 1 to 318 and SEQ ID NOs 760 to 763 are the average values of relative expression rates evaluated in SK-N-AS and Kelly cell lines, the modified oligonucleotides of SEQ ID NOs 319 to 686 are the average values of relative expression rates evaluated in Kelly and SNB-19 cell lines, and the modified oligonucleotides of SEQ ID NOs 687 to 759 are the average values of relative expression rates evaluated in SNB-19 and A431 cell lines.
[0142] The lower the average relative expression rate of human BRAF mRNA by the 5-10-5 2'-MOE Gapmer modified oligonucleotide in Table 11 below, the higher the potency of the oligonucleotide compound. For example, in the cell line experiment above, it may be preferable that the relative expression rate of the 5-10-5 2'-MOE Gapmer modified oligonucleotide is 0.9 or less, 0.8 or less, 0.75 or less, 0.7 or less, 0.6 or less, 0.5 or less, 0.45 or less, 0.4 or less, or 0.3 or less.
[0143] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)1340011TAGACACCTCAAATATCATG0.771340022GACACCTCAAATATCATGGT0.571340033TATCATGGTTTATGTGAAAG0.801340044TTATGTGAAAGCTAAAGACT0.801340055ATTACTCTTACCCTTTACTC0.741340066TACCCTTTACTCCAGAATGG0.671340077ACCCTTTACTCCAGAATGGA0.671340088TCACTACTTGACATTTAAGG0.511340099ACTACTTGACATTTAAGGAG0.5313401010TTAAGGAGAAAGTCAACTGC0.8613401111GGAGAAAGTCAACTGCAGCC0.5813401212CATTCTTCGTCATGACTTTC0.9013401313ATTCTTCGTCATGACTTTCA0.8413401414TCTTCGTCATGACTTTCAAG0.7013401515CTTCGTCATGACTTTCAAGC0.7113401616TTCGTCATGACTTTCAAGCA0.5613401717TCGTCATGACTTTCAAGCAG0.5113401818CATCGAGTCTTTTAAATTCT0.5813401919ATCGAGTCTTTTAAATTCTT0.5613402020AACTAAGAGTGACTCACTTG0.5413402121ACTAAGAGTGACTCACTTGA0.5613402222CTAAGAGTGACTCACTTGAG0.6713402323TAAGAGTGACTCACTTGAGA0.5613402424AAGAGTGACTCACTTGAGAG0.6913402525GGTATATTAAATAGCCAATG0.7713402626ATAGCCAATGTTTTAGAGAG0.8713402727TAGCCAATGTTTTAGAGAGG0.7213402828AGCCAATGTTTTAGAGAGGA0.4713402929GCCAATGTTTTAGAGAGGAC0.4013403030CCAATGTTTTAGAGAGGACA0.5113403131CAATGTTTTAGAGAGGACAA0.5513403232GAGGACAATTTTAACTATTG0.6613403333AGGACAATTTTAACTATTGG0.6313403434GGACAATTTTAACTATTGGT0.3413403535TGGTATATGCCATCCGAGGG0.4713403636GGTATATGCCATCCGAGGGG0.7513403737TGCCATCCGAGGGGCAGGAA0.7513403838CCATCCGAGGGGCAGGAAGA0.9713403939GATTAAATGGCTAGTGTAAT0.7713404040ATTAAATGGCTAGTGTAATA0.9813404141TAAATGGCTAGTGTAATACC0.7913404242AAATGGCTAGTGTAATACCT0.6213404343CTCATCATTGATTAGTAAAA0.7313404444TCATCATTGATTAGTAAAAC0.6813404545CATCATTGATTAGTAAAACT0.6413404646GGTTTCCTTACTGAAGAAGG0.8813404747GAGATTAACTCTACATATGG0.6513404848GATTAACTCTACATATGGTT0.5913404949ATTAACTCTACATATGGTTA0.7113405050TTAACTCTACATATGGTTAG0.9613405151TCTCCAGATCCATGTTAGCT0.7813405252GATCCATGTTAGCTAAACAT0.8013405353ATCCATGTTAGCTAAACATG0.7613405454TCCATGTTAGCTAAACATGT0.8213405555CCATGTTAGCTAAACATGTC0.8213405656CATGTTAGCTAAACATGTCA0.6413405757GCTAAACATGTCACCTGTCA0.7113405858CTAAACATGTCACCTGTCAC0.9013405959CCTTTCACTAACATTTCCGG0.6413406060TTTCACTAACATTTCCGGTG0.7413406161TCACTAACATTTCCGGTGGA0.7913406262ACTAACATTTCCGGTGGACC0.7213406363TAACATTTCCGGTGGACCTA0.8213406464GTGACACTTTGGAGGCATGT0.5913406565GAGGCATGTTTTACTGGCTA0.5913406666AGGCATGTTTTACTGGCTAC0.6413406767GGCATGTTTTACTGGCTACA0.4413406868GCATGTTTTACTGGCTACAG0.6513406969AATGGAACAATGAGTTTCTG0.7713407070ATGGAACAATGAGTTTCTGA0.9313407171TGGAACAATGAGTTTCTGAG0.8213407272GGAACAATGAGTTTCTGAGT0.9013407373GAACAATGAGTTTCTGAGTG0.7913407474GAAAGGTGTCAGATGCAGAT0.9813407575AAAGGTGTCAGATGCAGATG0.9413407676AGATGCAGATGATGGGAGCC0.7613407777ATGCAGATGATGGGAGCCTA0.7413407878TAGGCAGGATGGCATTGAGA0.7913407979AGATAACTGTGAGGCAGGTA0.6813408080GATAACTGTGAGGCAGGTAT0.6513408181ATAACTGTGAGGCAGGTATG0.7813408282TAACTGTGAGGCAGGTATGC0.8713408383AATTATAGAAGGAGCTCTAT0.7013408484ATTATAGAAGGAGCTCTATC0.9413408585TTATAGAAGGAGCTCTATCA1.0013408686AAGGAGCTCTATCAATAAAG0.8813408787GGAGCTCTATCAATAAAGAG0.6913408888GAGACCCCTGACCTTGTGCC0.6113408989CCTGACCTTGTGCCTCAAAA0.5813409090CTGACCTTGTGCCTCAAAAT0.5813409191GACCTTGTGCCTCAAAATGG0.6413409292CTTGTGCCTCAAAATGGCCA0.6113409393TGTGCCTCAAAATGGCCAAA0.6013409494AATGGCCAAACATTTGGAGC0.6313409595ATGGCCAAACATTTGGAGCA0.6213409696TGGCCAAACATTTGGAGCAT0.6313409797TTACATGCTTGCTAGTCTTC0.5713409898TACATGCTTGCTAGTCTTCT0.4313409999ACATGCTTGCTAGTCTTCTA0.41134100100CATGCTTGCTAGTCTTCTAT0.34.
[0144] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)134101101AACCCTATCTAACAATTACT0.59134102102TACGTGAAATGTTCCTTTTC0.34134103103AGTCATGAATCAATTCTGAT0.77134104104GTCATGAATCAATTCTGATT0.66134105105GCATTACTTATCTTAAGCTA0.69134106106CATTACTTATCTTAAGCTAC0.89134107107ATTACTTATCTTAAGCTACC0.72134108108TTACTTATCTTAAGCTACCC0.77134109109TACTTATCTTAAGCTACCCA0.58134110110CTTATCTTAAGCTACCCAAA0.53134111111TATCTTAAGCTACCCAAATG0.58134112112GGTTAAAGATTTGCCGTAAT0.31134113113GTTAAAGATTTGCCGTAATT0.39134114114TTAAAGATTTGCCGTAATTA0.55134115115TAAAGATTTGCCGTAATTAT0.66134116116CGTAATTATTATTGAGTGAT0.57134117117GTGATTTTCCTGGATGACAT0.57134118118TGATTTTCCTGGATGACATC0.68134119119GTTTACTGGAAGAACCTTGA0.55134120120TTTACTGGAAGAACCTTGAT0.71134121121TACTGGAAGAACCTTGATCT0.55134122122ACTGGAAGAACCTTGATCTA0.61134123123CTGGAAGAACCTTGATCTAT0.53134124124GAAGATATAGTTAAGAGGCT0.55134125125GATATAGTTAAGAGGCTGAC0.54134126126AGAGATGGCCAAATCTTTGA0.48134127127ATGGCCAAATCTTTGATAGG0.74134128128TGGCCAAATCTTTGATAGGA0.63134129129GGCCAAATCTTTGATAGGAC0.55134130130GCCAAATCTTTGATAGGACC0.39134131131AGACACAATGATAAGGTGAT0.58134132132CACAATGATAAGGTGATTGC0.62134133133CAATGATAAGGTGATTGCTA0.60134134134TTGGCAACCAGAGGTATCTC0.47134135135TGGCAACCAGAGGTATCTCA0.46134136136GGCAACCAGAGGTATCTCAA0.37134137137GCAACCAGAGGTATCTCAAA0.59134138138ACCAGAGGTATCTCAAAGAA0.47134139139ACACACCTAAAAGTTCTCAC0.73134140140ACACCTAAAAGTTCTCACAG0.61134141141GAGCGAGACATCCTTAATGT0.37134142142AGCGAGACATCCTTAATGTA0.46134143143GCGAGACATCCTTAATGTAT0.38134144144CGAGACATCCTTAATGTATT0.43134145145CCGCTAAAAATCCGAAGTTA0.51134146146CGCTAAAAATCCGAAGTTAA0.58134147147GCTAAAAATCCGAAGTTAAG0.58134148148AATCCGAAGTTAAGACATTT0.63134149149ATCCGAAGTTAAGACATTTT0.51134150150TCCGAAGTTAAGACATTTTA0.38134151151CCGAAGTTAAGACATTTTAC0.46134152152CGAAGTTAAGACATTTTACT0.51134153153TTTGGTCACCTGCACTCAAA0.57134154154TTGGTCACCTGCACTCAAAA0.52134155155GGTCACCTGCACTCAAAATT0.47134156156GTCACCTGCACTCAAAATTT0.54134157157TCACCTGCACTCAAAATTTA0.68134158158ACTTAGTTTATTGCTTCAAG0.43134159159CTTAGTTTATTGCTTCAAGG0.39134160160TTAGTTTATTGCTTCAAGGA0.40134161161TAGTTTATTGCTTCAAGGAA0.49134162162GACTTCCTAAATTAGATCTG0.45134163163TTAGATCTGTTCAGTTTGCC0.46134164164TAGATCTGTTCAGTTTGCCT0.36134165165AGATCTGTTCAGTTTGCCTT0.65134166166GATCTGTTCAGTTTGCCTTA0.53134167167CAGGCTAACCGACTGCCAAC0.70134168168AGGCTAACCGACTGCCAACT0.59134169169GGCTAACCGACTGCCAACTT0.48134170170GCTAACCGACTGCCAACTTC0.47134171171CTAACCGACTGCCAACTTCT0.54134172172TAACCGACTGCCAACTTCTC0.51134173173AACCGACTGCCAACTTCTCA0.50134174174ACCGACTGCCAACTTCTCAC0.54134175175AACACAGGCATAGGTAGGGT0.70134176176ACACAGGCATAGGTAGGGTC0.58134177177CACAGGCATAGGTAGGGTCT0.61134178178ACAGGCATAGGTAGGGTCTT0.70134179179CAGGCATAGGTAGGGTCTTC0.49134180180AGGCATAGGTAGGGTCTTCT0.45134181181GGCATAGGTAGGGTCTTCTT0.36134182182GCATAGGTAGGGTCTTCTTC0.38134183183CATAGGTAGGGTCTTCTTCT0.25134184184GGTAGGGTCTTCTTCTGGAG0.45134185185TAGGGTCTTCTTCTGGAGTC0.52134186186GTCCCTAGTGGACATGTGAT0.52134187187GGACATGTGATAGCTGGCAA0.62134188188GACATGTGATAGCTGGCAAC0.64134189189AAGTGAATGATACAAACCCG0.53134190190AGTGAATGATACAAACCCGG0.50134191191ACCCGGAACAGAAAGTAAAG0.54134192192CCCGGAACAGAAGTAAAGC0.55134193193CCGGAACAGAAAGTAAAGCC0.49134194194CGGAACAGAAGTAAGCCT0.5 2134195195GTAAAGCCTCTAGAAGAGGC0.42134196196TGTATTTTAACCCTTGGATG0.57134197197GTATTTTAACCCTTGGATGT0.46 134198198ACCACACAAGTGTTCTTTGG0.57134199199GTTCTTTGGTTCACCTTAAA0.49134200200GAAACGCACCATATCCCCCT0.62.
[0145] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)134201201AAACGCACCATATCCCCCTG0.59134202202AACGCACCATATCCCCCTGC0.46134203203ACGCACCATATCCCCCTGCC0.47134204204CGCACCATATCCCCCTGCCT0.48134205205GCACCATATCCCCCTGCCTG0.32134206206ACCATATCCCCCTGCCTGGA0.47134207207CATATCCCCCTGCCTGGATG0.46134208208ATATCCCCCTGCCTGGATGG0.66134209209ATCCCCCTGCCTGGATGGGT0.73134210210CCTCTGTTTGGAAACCAGCC0.70134211211TCTGTTTGGAAACCAGCCCG0.66134212212CTGTTTGGAAACCAGCCCGA0.72134213213TGTTTGGAAACCAGCCCGAT0.77134214214GTTTGGAAACCAGCCCGATT0.59134215215TTTGGAAACCAGCCCGATTC0.60134216216GAATTTTTGGCAATGAGCGG0.50134217217AATGAGCGGGCCAGCAGCTC0.67134218218ATGAGCGGGCCAGCAGCTCA0.61134219219TGAGCGGGCCAGCAGCTCAA0.63134220220GCGGGCCAGCAGCTCAATAG0.76134221221CGGGCCAGCAGCTCAATAGA0.76134222222GGGCCAGCAGCTCAATAGAG0.63134223223AGCTCAATAGAGGCGAGAAT0.61134224224GGGAAAGAGTGGTCTCTCAT0.64134225225GGAAAGAGTGGTCTCTCATC0.68134226226GAAAGAGTGGTCTCTCATCT0.72134227227AAAGAGTGGTCTCTCATCTC0.57134228228AGAGTGGTCTCTCATCTCTT0.61134229229GAGTGGTCTCTCATCTCTTT0.54134230230GAGGCACTCTGCCATTAATC0.49134231231AGGCACTCTGCCATTAATCT0.46134232232GGCACTCTGCCATTAATCTC0.65134233233GCCATTAATCTCTTCATGGC0.72134234234CTCGTCCCACCATAAAAATT0.69134235235TCGTCCCACCATAAAAATTA0.79134236236CGTCCCACCATAAAAATTAT0.56134237237CTGGTCCCTGTTGTTGATGT0.59134238238GGTCCCTGTTGTTGATGTTT0.55134239239GTCCCTGTTGTTGATGTTTG0.52134240240TCCCTGTTGTTGATGTTTGA0.52134241241GTAACTGTCCAGTCATCAAT0.51134242242AACTGTCCAGTCATCAATTC0.50134243243ACTGTCCAGTCATCAATTCA0.49134244244AAATGGATCCAGACAACTGT0.82134245245AATGGATCCAGACAACTGTT0.69134246246ATGGATCCAGACAACTGTTC0.75134247247GGATCCAGACAACTGTTCAA0.85134248248GGGACCCACTCCATCGAGAT0.43134249249GGACCCACTCCATCGAGATT0.36134250250ACCCACTCCATCGAGATTTC0.43134251251CCCACTCCATCGAGATTTCA0.42134252252CTGTAGCTAGACCAAAATCA0.50134253253TGTAGCTAGACCAAAATCAC0.52134254254GTAGCTAGACCAAAATCACC0.50134255255TAGCTAGACCAAAATCACCT0.44134256256AGCTAGACCAAAATCACCTA0.75134257257CCTATTTTTACTGTGAGGTC0.49134258258TATTACTCTTGAGGTCTCTG0.59134259259GAGGTCTCTGTGGATGATTG0.57134260260AGGTCTCTGTGGATGATTGA0.48134261261GGTCTCTGTGGATGATTGAC0.47134262262CTGTGCAGTCTGTCGTGCAA0.50134263263TGTGCAGTCTGTCGTGCAAT0.54134264264GTGCAGTCTGTCGTGCAATA0.50134265265TGCAGTCTGTCGTGCAATAT0.40134266266GCAGTCTGTCGTGCAATATC0.37134267267GTCGTGCAATATCTATAAGT0.36134268268TCGTGCAATATCTATAAGTT0.68134269269CGTGCAATATCTATAAGTTT0.63134270270GTGCAATATCTATAAGTTTG0.54134271271ATTTGGTCTCAATGATATGG0.64134272272TTTGGTCTCAATGATATGGA0.45134273273TTGGTCTCAATGATATGGAG0.30134274274AGATGGTGATACAAGCTGGA0.44134275275TGGTGATACAAGCTGGAGCC0.46134276276ACACCACTGGGTAACAATAG0.59134277277CACCACTGGGTAACAATAGC0.49134278278ACCACTGGGTAACAATAGCC0.42134279279ACTGGGTAACAATAGCCAGT0.54134280280CTTTGTGGAATAGCCCATGA0.62134281281TTTGTGGAATAGCCCATGAA0.57134282282TTGTGGAATAGCCCATGAAG0.49134283283TAGCCCATGAAGAGTAGGAT0.45134284284GAGTAGGATATTCACATGTC0.49134285285GTAACTGCTGAGGTGTAGGT0.23134286286AACTGCTGAGGTGTAGGTGC0.35134287287ACTGCTGAGGTGTAGGTGCT0.34134288288AGGTGTAGGTGCTGTCACAT0.37134289289GGTGTAGGTGCTGTCACATT0.43134290290TGTAGGTGCTGTCACATTCA0.31134291291GTAGGTGCTGTCACATTCAA0.40134292292TAGGTGCTGTCACATTCAAC0.45134293293AGGTGCTGTCACATTCAACA0.36134294294GGTGCTGTCACATTCAACAT0.42134295295GTGCTGTCACATTCAACATT0.33134296296GTCACATTCAACATTTTCAC0.35134297297ATGCTTGCTAGTCTTCTATT0.81134298298CTTGCTAGTCTTCTATTTGT0.71134299299GCTAGTCTTCTATTTGTGAA0.86134300300CTAGTCTTCTATTTGTGAAT0.83.
[0146] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)134301301AGTCTTCTATTTGTGAATGA0.87134302302GTCTTCTATTTGTGAATGAA0.68134303303TCTTCTATTTGTGAATGAAT0.85134304304TTGTGAATGAATAAAACCCT0.85134305305TGTGAATGAATAAAACCCTA0.82134306306GTGAATGAATAAAACCCTAT0.79134307307TGAATGAATAAAACCCTATC0.91134308308GAATGAATAAAACCCTATCT0.94134309309TGAATAAAACCCTATCTAAC0.97134310310GAATAAAACCCTATCTAACA0.92134311311ATAAAACCCTATCTAACAAT1.05134312312TAAAACCCTATCTAACAATT1.13134313313AAAACCCTATCTAACAATTA1.13134314314AAACCCTATCTAACAATTAC1.07134315315ATCTTAAGCTACCCAAATGA0.84134316316TACCCAAATGAGGGGTTAAA0.90134317317GGGTTAAAGATTTGCCGTAA0.62134318318GGTTAAAGATTTGCCGTAAT0.54134319319ACACCTCAAATATCATGGTT0.76134320320CAAATATCATGGTTTATGTG0.75134321321ACTCTTACCCTTTACTCCAG0.76134322322CCCTTTACTCCAGAATGGAG0.95134323323ATCACTACTTGACATTTAAG0.99134324324CTACTTGACATTTAAGGAGA0.91134325325AATGGCTAGTGTAATACCTG0.84134326326TGATTACATCCTGTGATCCT0.87134327327GATTACATCCTGTGATCCTG0.77134328328ATTACATCCTGTGATCCTGA0.84134329329TTACATCCTGTGATCCTGAA0.66134330330TACATCCTGTGATCCTGAAA0.83134331331CCTCATCATTGATTAGTAAA0.72134332332GTTTCCTTACTGAAGAAGGA0.90134333333AGATTAACTCTACATATGGT0.86134334334TAACTCTACATATGGTTAGA0.96134335335TCCTTTCACTAACATTTCCG0.98134336336ACACTTTGGAGGCATGTTTT0.77134337337TCGCAAAGGAGACTAGTAAA0.97134338338CGCAAAGGAGACTAGTAAAG0.86134339339TTGTGCCTCAAAATGGCCAA1.01134340340GTTACATGCTTGCTAGTCTT0.42134341341ACGTGAAATGTTCCTTTTCA0.37134342342CGTGAAATGTTCCTTTTCAT0.47134343343ACTTATCTTAAGCTACCCAA1.01134344344GGGTACTTAAAAACTAAATT1.04134345345ATAGTTAAGAGGCTGACAGT1.00134346346GATGGCCAAATCTTTGATAG0.64134347347ATTACAGTCATTTTCTACAC0.86134348348TCTACACAACAAAGTGTAAG0.93134349349AGTAGAATCTTGCTGGGCAA0.74134350350GTAGAATCTTGCTGGGCAAA0.80134351351ATGATAAGGTGATTGCTAAA1.08134352352CACACCTAAAAGTTCTCACA1.20134353353GCGTTTGCAACAAAATTTGA0.77134354354TGAGCGAGACATCCTTAATG0.69134355355GGTCTTCTTCTGGAGTCCCT0.79134356356GTCTTCTTCTGGAGTCCCTA0.71134357357CATGTGATAGCTGGCAACAA0.84134358358TAGCTGGCAACAAAAGTTGC1.06134359359GCTGGCAACAAAAGTTGCAT1.03134360360CTGGCAACAAAAGTTGCATG0.93134361361ACCAAGTGAATGATACAAAC0.68134362362TCCTTTTGTTGCTACTCTCC0.61134363363CTTTTGTTGCTACTCTCCTG0.74134364364TTTTGTTGCTACTCTCCTGA0.99134365365TTTGTTGCTACTCTCCTGAA0.67134366366TTGTTGCTACTCTCCTGAAC0.68134367367CTCTGTTTGGAAACCAGCCC0.84134368368AGCGGGCCAGCAGCTCAATA1.16134369369CAGCTCAATAGAGGCGAGAA0.98134370370CAGTTACTCCGTACCTTACT0.77134371371AGTTACTCCGTACCTTACTG0.89134372372GTTACTCCGTACCTTACTGA0.77134373373ATCCTCGTCCCACCATAAAA0.66134374374CCTCGTCCCACCATAAAAAT0.89134375375ACTGAAAGCTGTATGGATTT0.83134376376CTGTATGGATTTTTATCTTG0.81134377377TGCAATATCTATAAGTTTGA0.81134378378GCAATATCTATAAGTTTGAT0.74134379379CACTGGGTAACAATAGCCAG0.90134380380CTGGGTAACAATAGCCAGTT1.03134381381GCCCATGAAGAGTAGGATAT0.65134382382CTGAGTACTCCTACTTCATT0.69134383383CATTTTTGAAGGCTTGTAAC0.77134384384TTTTTGAAGGCTTGTAACTG1.17134385385TTTTGAAGGCTTGTAACTGC0.91134386386TTTGAAGGCTTGTAACTGCT0.75134387387GTGTAGGTGCTGTCACATTC0.76134388388CATGCCACTTTCCCTTGTAG0.55134389389GCCACTTTCCCTTGTAGACT0.73134390390TTCCCTTGTAGACTGTTCCA0.94134391391TCCCTTGTAGACTGTTCCAA0.96134392392GTAGACTGTTCCAAATGATC0.82134393393ATCACTCGAGTCCCGTCTAC0.86134394394TCACTCGAGTCCCGTCTACC0.62134395395CACTCGAGTCCCGTCTACCA0.58134396396ACTCGAGTCCCGTCTACCAA0.58134397397GTCCCGTCTACCAAGTGTTT0.42134398398TACATACACCTAATTGAAAG0.61134399399CACCTAATTGAAAGCAGAAC0.94134400400ACCTAATTGAAAGCAGAACC1.03.
[0147] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)134401401CCTAATTGAAAGCAGAACCT1.05134402402TTATGATGATTAGTATAAGA1.30134403403TATGATGATTAGTATAAGAC0.84134404404ATAACCACTGTTAGAGTCTA0.90134405405AATGAGGTATCATACTACAT0.83134406406GGTATCATACTACATTTTGT0.68134407407ACTAACTTAATCTTAATGTC1.10134408408TATCTACTACAGCTAAACTC0.99134409409CTACAGCTAAACTCTGTAAG1.10134410410TACAGCTAAACTCTGTAAGC1.01134411411AGGACCCAAAATTTCTAGGT0.61134412412AAAATTTCTAGGTGTGCCAC0.80134413413GTGCCACTGCTCAACCCTCA0.73134414414TAGCATGAAGCTTTTACTTA1.01134415415AGCATGAAGCTTTTACTTAC1.05134416416ACGTTGTGTTAAGTCCTCTA0.82134417417CTTTTATTGTGGAAACGCTA0.90134418418TTTTATTGTGGAAACGCTAA1.06134419419TTTATTGTGGAAACGCTAAT0.96134420420AGCCATTAGGAGCTAAAATC1.04134421421ATACAGTTAAGTAAGTAACA1.13134422422TACAGTTAAGTAAGTAACAG1.12134423423AGTTAAGTAAGTAACAGGAT1.31134424424GTTAAGTAAGTAACAGGATT1.02134425425TTAAGTAAGTAACAGGATTT1.00134426426AAGGTAACCATGCTTATCAT0.90134427427AGGTAACCATGCTTATCATA0.96134428428GGTAACCATGCTTATCATAC0.77134429429GTAACCATGCTTATCATACC0.77134430430TAACCATGCTTATCATACCT1.02134431431TGATGATCATTTACTGCCTT0.88134432432ACCTCCAGTATTTAACATAA0.87134433433CCTCCAGTATTTAACATAAC0.97134434434CTCCAGTATTTAACATAACC1.02134435435CCAGTATTTAACATAACCTT0.92134436436CAGTATTTAACATAACCTTG0.80134437437CATTTCTAAATACTGGTGTC0.99134438438TCAGCAAGTCCTTTTAACAA0.73134439439CAGCAAGTCCTTTTAACAAA0.70134440440GACTACTAAACTCTGCATGT0.80134441441TACTAAGTCTTAGTATCTAG0.90134442442ACTAAGTCTTAGTATCTAGT0.97134443443TCTTAGTATCTAGTGTCCTA1.02134444444CTTAGTATCTAGTGTCCTAA0.99134445445TTAGTATCTAGTGTCCTAAC0.93134446446AATCAAAGACAACTCTCATG0.86134447447GATTCATGTGGCACATACAC0.82134448448AAAGACCAATGAAGAGGTCC0.92134449449AAGACCAATGAAGAGGTCCT0.91134450450AGACCAATGAAGAGGTCCTT0.90134451451ACCTGCGAAGAGGTCCACAA0.84134452452TTTAACACCCCGTAAATCTA1.09134453453CCCCGTAAATCTACTCTAGT1.02134454454CCCGTAAATCTACTCTAGTC0.87134455455CCGTAAATCTACTCTAGTCA0.84134456456CGTAAATCTACTCTAGTCAA0.86134457457GATCCAAGTATTATAGATAG0.98134458458TCCAAGTATTATAGATAGCA0.80134459459CCAAGTATTATAGATAGCAA1.02134460460GGAGTTTCATAGAAAGTACT0.87134461461TCTGTTGGTCACACATTCCT0.84134462462CTGTTGGTCACACATTCCTC0.91134463463TGTTGGTCACACATTCCTCT0.94134464464GTTGGTCACACATTCCTCTC0.83134465465TTGGTCACACATTCCTCTCA0.89134466466TTAGAAAGGCCAACACCAAC1.01134467467GAAAGGCCAACACCAACTAA0.85134468468AAGGCCAACACCAACTAAAA0.78134469469GGCCAACACCAACTAAAATT0.85134470470GCCAACACCAACTAAAATTT0.85134471471AGCTACTCAGAGCTAGCACC0.99134472472GCTACTCAGAGCTAGCACCA0.88134473473CTACTCAGAGCTAGCACCAA0.90134474474TACTCAGAGCTAGCACCAAA0.97134475475AGCTAGCACCAAAAAGATAG0.94134476476TGGACCCTCCCCATTTAATT0.83134477477ATTAACAGTGTAACTGTTGT1.06134478478ATCATTGCCAGATGAATTCT0.91134479479TTAGAATCAGTTCCCACTTC0.95134480480TAGAATCAGTTCCCACTTCC0.90134481481GAATCAGTTCCCACTTCCCA0.89134482482CCCATTCCTGATTCAGCAAA0.92134483483CCATTCCTGATTCAGCAAAG0.87134484484CAAATCCCCTTTCAAACTAT0.90134485485AATCCCCTTTCAAACTATGG0.94134486486ATCCCCTTTCAAACTATGGA0.83134487487TCATTGTATTGCACAATTAG0.93134488488TGCACAATTAGGTTTCTTAT0.60134489489ATGACCCGCGGAGCCTTAAA0.91134490490TCAACGTCCAGACTACACTC0.90134491491AACGTCCAGACTACACTCCA0.81134492492ACGTCCAGACTACACTCCAG0.75134493493GTCATACATTTTGTTCATAG0.43134494494CTTGATTGAGCCTAACTCTC1.04134495495TGATTGAGCCTAACTCTCCC0.78134496496GATTGAGCCTAACTCTCCCA0.89134497497ACTTTAAAAGCACGTGACAA0.95134498498CTTTAAAAGCACGTGACAAT0.87134499499TAAAAGCACGTGACAATTGT0.95134500500AAGGTGTGTATGCCTTAATA0.75.
[0148] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)134501501AGGTGTGTATGCCTTAATAA0.78134502502AACTCCAGTCACCGAATCTT0.98134503503ACTCCAGTCACCGAATCTTA0.78134504504CTCCAGTCACCGAATCTTAG0.63134505505TCTACTAGTCCAACTCAACA1.02134506506CTACTAGTCCAACTCAACAT0.96134507507TACTAGTCCAACTCAACATT1.01134508508ACTAGTCCAACTCAACATTT1.02134509509ACTCAACATTTCAGATGTAG0.74134510510AGATCTTGTGGACCCTCTAA1.03134511511ATCTTGTGGACCCTCTAAAA0.91134512512TCTTGTGGACCCTCTAAAAC0.87134513513CCAATTTAGGCTTAAATAAG0.89134514514GCTTAAATAAGATTGCGAAA0.84134515515CTTAAATAAGATTGCGAAAC0.94134516516TAAATAAGATTGCGAAACAG0.85134517517TAAGATTGCGAAACAGCTTC0.79134518518CAAAATATTCGTTTTAAGGG0.82134519519AAAATATTCGTTTTAAGGGT0.83134520520AAATATTCGTTTTAAGGGTA0.82134521521TGCAGATAGTATCTTAGTCT0.54134522522CTCCTACTATTGTAAAGACT0.87134523523TCCTACTATTGTAAAGACTT0.74134524524CCTACTATTGTAAAGACTTC1.09134525525CAAGTTAGCTTTCGTTCTAT0.84134526526AGTTAGCTTTCGTTCTATTT0.75134527527TTAGCTTTCGTTCTATTTTC0.86134528528TAGCTTTCGTTCTATTTTCC0.82134529529GCTTTCGTTCTATTTTCCAC0.80134530530TCATTAGACAGTTTTACCTT0.81134531531TAGCATAAATTTGTTATAGG0.93134532532AGCATAAATTTGTTATAGGC0.69134533533GCATAAATTTGTTATAGGCC0.78134534534TATAGGCCGAGTTGCATAAA0.94134535535TAGGCCGAGTTGCATAAAAA0.83134536536CCACCCAGTTACAATGGAAA1.05134537537CACCCAGTTACAATGGAAAA0.95134538538CCCAGTTACAATGGAAAATG0.80134539539ATGCTATCAACCAAAGGAAC0.87134540540GTTTCTCTTAACAGTCTCAT0.74134541541ATACTTTGATGCCCTCTGCT0.87134542542TTGATGCCCTCTGCTCCCTT0.84134543543TGATGCCCTCTGCTCCCTTA0.68134544544GATGCCCTCTGCTCCCTTAT0.65134545545TGCCCTCTGCTCCCTTATTA0.74134546546GCCCTCTGCTCCCTTATTAC0.72134547547CTCTGCTCCCTTATTACAAC0.78134548548TCTGCTCCCTTATTACAACC0.77134549549TTTAAAGTTATGCTCCATAG0.77134550550TTAAAGTTATGCTCCATAGT0.80134551551AAACTGCCAACCTGATCCCT1.00134552552ACTGCCAACCTGATCCCTAA0.87134553553TCACACTTTAATATGGACAC0.83134554554CACACTTTAATATGGACACG0.92134555555ACACTTTAATATGGACACGA0.86134556556AAGCAACATGCTTTAATGGT0.88134557557GCAACATGCTTTAATGGTTA0.55134558558AGTAAGTGCATATCATTGCT0.68134559559ACAGCAAGAAACCATTGTGT0.77134560560CAGCAAGAAACCATTGTGTA0.89134561561CAAGAAACCATTGTGTATAG0.84134562562TTACATATTTCCTCGTAACA0.75134563563TACATATTTCCTCGTAACAT0.69134564564ACATATTTCCTCGTAACATG0.79134565565ATCACTATGTTACTTGATCT0.74134566566GAAGCAATTCCTCTAATCCT0.69134567567GCAATTCCTCTAATCCTATG0.69134568568CAATTCCTCTAATCCTATGA0.89134569569ATTCCTCTAATCCTATGAAC0.92134570570TCCTCTAATCCTATGAACAT1.00134571571TCACTAATACATGTTCACCA0.69134572572CACTAATACATGTTCACCAT0.74134573573CATGTTCACCATTTTTTCAG0.68134574574ATGTTCACCATTTTTTCAGC0.57134575575TTTTCAGCTTTAATTAGTCC0.72134576576GTTTTTCACTGAGGTACAAA0.76134577577CAACCTTAGCACTTTATAAA0.88134578578GCACTTTATAAAATGAATCC0.92134579579AAGATCACTTTCAACATAGG0.80134580580ACTGGTACTAAAAAGTATAC0.97134581581CTGGTACTAAAAAGTATACT1.00134582582TGGTACTAAAAAGTATACTC0.97134583583GATAAACTGAATGGAATGAT0.99134584584ATAAACTGAATGGAATGATC0.91134585585TAAACTGAATGGAATGATCT0.85134586586GGAATGATCTATGTTCATAC0.49134587587GAATGATCTATGTTCATACT0.80134588588TAAAAGGGGACATATGAACC0.98134589589ATGTGTATCCTAAAGAGAAT0.92134590590TTTGCCATGGTTTACTCTTC0.43134591591GCCATGGTTTACTCTTCACA0.52134592592CCATGGTTTACTCTTCACAA0.62134593593AATACGGGCACTCAGAGAAA0.67134594594AGTAACTAACAACCATTCTG0.80134595595GTAACTAACAACCATTCTGT0.74134596596ACTAACAACCATTCTGTTTA0.97134597597ACCTCTCTTGCTTAGCTCAA0.82134598598TCTTGCTTAGCTCAATCACT0.81134599599TTGCTTAGCTCAATCACTGA0.94134600600AGTTTGCAGTCATGTATTTA0.73.
[0149] Compound IDSEQ ID NOSequence(5’ to 3’)상대적 발현율(평균)134601601GCAGTCATGTATTTATTATC0.36134602602TAGTTAGCATCCTTATGTTC0.68134603603AGTTAGCATCCTTATGTTCC0.60134604604GTTAGCATCCTTATGTTCCT0.69134605605AAGTTCATCACTCAGTTGTA0.75134606606TTCATCACTCAGTTGTAGCT0.87134607607TCAGTTGTAGCTGACTCTCA0.85134608608CAGTTGTAGCTGACTCTCAT0.86134609609AGTTGTAGCTGACTCTCATA0.88134610610ATTTTCCCCCGTTACACCTC0.93134611611TTTTCCCCCGTTACACCTCT0.94134612612TTTCCCCCGTTACACCTCTA0.77134613613GTCCTCACTAGGCATATCCT0.85134614614TCCTCACTAGGCATATCCTA0.92134615615CTCACTAGGCATATCCTAGT0.99134616616AATTGTTACTCCAAGTGTCA0.97134617617ATTGTTACTCCAAGTGTCAT0.94134618618TTGTTACTCCAAGTGTCATT0.97134619619CAATCCAAAAAATAGCCAAC0.98134620620ATCCAAAAAATAGCCAACCT0.90134621621TCCAAAAAATAGCCAACCTT0.95134622622GCCCTATGGAATTTTGCTTA0.91134623623CCTATGGAATTTTGCTTAAA1.02134624624ATGCATACCCTGTGGTCTCA0.68134625625TGCATACCCTGTGGTCTCAC0.66134626626GCATACCCTGTGGTCTCACA0.58134627627CACTTTTATACACAGGCTGA0.82134628628GCTTATTCTACTGTTTGTAT0.35134629629TTCCCTTAATTATGTCACTC0.91134630630TCCCTTAATTATGTCACTCA0.85134631631CCTTAATTATGTCACTCAAA0.92134632632CAATTCTCTATTAGTTGGAT0.72134633633AATTCTCTATTAGTTGGATA0.87134634634ATTCTCTATTAGTTGGATAC0.92134635635ACATCCACTACTCTTAATAT0.84134636636CATCCACTACTCTTAATATA0.86134637637ATCCACTACTCTTAATATAA0.74134638638CCACTACTCTTAATATAATC0.83134639639CACTACTCTTAATATAATCC0.82134640640ATATCCTATTATGACTTGTC0.72134641641TATCCTATTATGACTTGTCA0.85134642642ATCCTATTATGACTTGTCAC0.78134643643TCCTATTATGACTTGTCACA0.81134644644TTGTCACAATGTCACCACAT0.91134645645ACTTCTTATCCAAATCAATC0.65134646646TTATCCAAATCAATCACTAC0.99134647647ACCCTATCTAACAATTACTA0.91134648648CCCTATCTAACAATTACTAA1.01134649649CCCTAACAAATACTTCATAC0.97134650650TTTCTCTCACCAATATCCAT0.88134651651CAATACAACTCCTCACTAAT1.05134652652AATACAACTCCTCACTAATT0.88134653653CTACACCATCATAACATCAT0.88134654654TACACCATCATAACATCATC0.90134655655ATATCTATAACACCACTACC0.92134656656ATCTATAACACCACTACCTC0.85134657657TTCTACAACTATCAACTTAC1.01134658658TCTACAACTATCAACTTACT0.99134659659CATACTTTCAATACACACTC1.04134660660ATACTTTCAATACACACTCA0.84134661661CACATCATTTATTATACTCC0.85134662662ACATCATTTATTATACTCCC0.87134663663ACCCTCCCCATTTAATTACA1.03134664664CCTCCCCATTTAATTACAAT0.86134665665ACAACCTACTATAATTCCTA0.98134666666CAATCAAAAACTCCTACTAT1.01134667667TTACCAATACAAACCTTTCA0.90134668668CCAATACAAACCTTTCACTC0.78134669669CACCTATTCATATCCATCCT0.87134670670ACCTATTCATATCCATCCTT0.73134671671CTCCAATTACTATTCATATC0.77134672672CCAATTACTATTCATATCAC0.89134673673TACTATACTTCCATTAATTC0.91134674674CTCCATACCATTATTAAATC0.85134675675CCATACCATTATTAAATCAC0.88134676676CACCACATTACATACTTACC0.94134677677CCACATTACATACTTACCAT0.94134678678GAAATACACTGAAACTGGTT0.68134679679AAATATTCGTTTTAAGGGTT0.79134680680AATATTCGTTTTAAGGGTTC0.70134681681ATATTCGTTTTAAGGGTTCA0.64134682682TATTCGTTTTAAGGGTTCAT0.63134683683AATACACTGAAACTGGTTTC0.76134684684AATATTCGTTTTAAGGGTAA0.90134685685ATATTCGTTTTAAGGGTAAA0.78134686686TATTCGTTTTAAGGGTAAAG0.86134687687CCTATCTAACAATTACTAAT0.99134688688CTATCTAACAATTACTAATA0.99134689689ATATTTAATGCCACTGGAGG0.29134690690TATTTAATGCCACTGGAGGA0.40134691691TTTAATGCCACTGGAGGATT0.41134692692TTAATGCCACTGGAGGATTT0.43134693693TAATGCCACTGGAGGATTTA0.60134694694ATGCCACTGGAGGATTTAAA0.48134695695CTTAGATATTTTCCAATAGT0.68134696696TTTCCAATAGTTGTACTTCT0.34134697697CCAATAGTTGTACTTCTTTA0.27134698698CTTCTTTATTCCTTAGTATC0.38134699699CTTTATTCCTTAGTATCATT0.56134700700TAAAAATACGTGAAATGTTC0.90.
[0150] Compound IDSEQ ID NOSequence (5’ to 3’)상대적 발현율 (평균)134701701AATCTCCCAATCATCACTCG0.93134702702ATCTCCCAATCATCACTCGA0.85134703703TCTCCCAATCATCACTCGAG0.77134704704CTCCCAATCATCACTCGAGT0.66134705705TCCCAATCATCACTCGAGTC0.57134706706CCCAATCATCACTCGAGTCC0.55134707707CCAATCATCACTCGAGTCCC0.59134708708CAATCATCACTCGAGTCCCG0.63134709709AATCATCACTCGAGTCCCGT0.51134710710ATCATCACTCGAGTCCCGTC0.37134711711TCATCACTCGAGTCCCGTCT0.26134712712CATCACTCGAGTCCCGTCTA0.33134713713CTCGAGTCCCGTCTACCAAG0.44134714714TCGAGTCCCGTCTACCAAGT0.44134715715CGAGTCCCGTCTACCAAGTG0.29134716716GAGTCCCGTCTACCAAGTGT0.26134717717GTGTATCCTAAAGAGAATAT0.89134718718TATAACAAACATAAAGGTCC0.91134719719ATAACAAACATAAAGGTCCT0.9134720720CAAACATAAAGGTCCTAAAG0.96134721721ACATAAAGGTCCTAAAGAAG0.79134722722ATAAAGGTCCTAAAGAAGGA0.96134723723TAAAGGTCCTAAAGAAGGAA0.9134724724AAAGGTCCTAAAGAAGGAAC0.99134725725AGGTCCTAAAGAAGGAACAC0.97134726726TCCTAAAGAAGGAACACGCT0.82134727727CCTAAAGAAGGAACACGCTT0.69134728728AATAAGCCTTTGTTTCTCAC0.56134729729TCACAATCTTTGCCATGGTT0.16134730730CACAATCTTTGCCATGGTTT0.19134731731ACAATCTTTGCCATGGTTTA0.23134732732CAATCTTTGCCATGGTTTAC0.31134733733AATCTTTGCCATGGTTTACT0.35134734734ATCTTTGCCATGGTTTACTC0.4134735735TCTTTGCCATGGTTTACTCT0.36134736736CTTTGCCATGGTTTACTCTT0.36134737737TTGCCATGGTTTACTCTTCA0.23134738738TGCCATGGTTTACTCTTCAC0.3134739739GTTTGCAGTCATGTATTTAT0.28134740740GCACTAGACAGAGACATTTA0.63134741741CACTAGACAGAGACATTTAT0.68134742742GTATCATATTATTTACCAGC0.24134743743TATCATATTATTTACCAGCC0.17134744744ATCATATTATTTACCAGCCA0.16134745745TCATATTATTTACCAGCCAT0.24134746746TTATTTACCAGCCATTAGTT0.53134747747TATTTACCAGCCATTAGTTA0.49134748748ATTTACCAGCCATTAGTTAG0.59134749749TTTACCAGCCATTAGTTAGC0.43134750750TTACCAGCCATTAGTTAGCA0.41134751751ACCAGCCATTAGTTAGCATC0.31134752752CCAGCCATTAGTTAGCATCC0.24134753753CAGCCATTAGTTAGCATCCT0.18134754754AGCCATTAGTTAGCATCCTT0.11134755755GCCATTAGTTAGCATCCTTA0.13134756756CCATTAGTTAGCATCCTTAT0.32134757757CATTAGTTAGCATCCTTATG0.42134758758ATTAGTTAGCATCCTTATGT0.57134759759TTAGTTAGCATCCTTATGTT0.65134760760CACTAACATTTCCGGTGGAC0.32134761761CTAACATTTCCGGTGGACCT0.44134762762AACATTTCCGGTGGACCTAA0.54134763763CCAAATCTTTGATAGGACCA0.45.
[0151] Example 2: Inhibition of intracellular BRAF by 5-10-5 2'-MOE capmer (multiple doses)
[0152] The 5-10-5 2'-MOE capmer-modified oligonucleotide prepared in Example 1 was tested at various doses in cell lines.
[0153] Specifically, A431 cell lines cultured at a density of 10,000 cells / well were treated with modified oligonucleotides at concentrations of 0.004, 0.015, 0.059, 0.234, 0.938, 3.75, and 15 μM by free absorption.
[0154] Total RNA was extracted from the cells after a treatment period of 24 hours. The mRNA expression level of the BTAF gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. mRNA levels were measured using the human RPL-13 primer probe set and human BRAF primer probe set 1 used in Example 1. The results represent the relative BRAF mRNA levels compared to untreated control cells.
[0155] As exemplified in the table below, BRAF mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC 50 Using Prism10 software, the “Absolute IC 50It was calculated using the formula. The table below shows the expression levels of human BRAF mRNA by 5-10-5 2'-MOE capmer-modified oligonucleotides. The IC50 of the modified oligonucleotides is shown in Table 19 below. 50 It represents.
[0156] Compound IDSEQ ID NOIC 50 (uM)134034340.9031341831830.2011342902900.3291342912910.3391343403400.4301343413410.3211343973970.4271344 934930.1631345215212.0471345575570.5061345745741.9751345905900.9701345915910.7941346016010.1221346036031.3 601346286283.4001346976970.0651347117110.4221347297290.2301347307300.2301347317310.2251347377370.1201347427420.1251347437430.1291347447440.1251347457450.4241347527520.0821347537530.0141347547540.0271347557550.065
[0157] In the above experiment, it is preferable for the IC50 (uM) value of the oligomer compound under test to be as low as possible, for example, 0.9 or less, 0.8 or less, 0.7 or less, 0.6 or less, 0.5 or less, 0.4 or less, 0.3 or less, 0.2 or less, or 0.15 or less.
[0158]
[0159] Example 3: Tolerability of a modified oligonucleotide complementary to human BRAF in mice
[0160] The modified oligonucleotide used in this study is the modified oligonucleotide prepared in Examples 1 and 2, which is a 5-10-5 2'-MOE gapmer, where all nucleoside bonds are PS bonds, and all cytosine residues included in the entire oligonucleotide region are modified to 5-methylcytosine (mC). The gap segment consists of 10 2'-deoxynucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. The tolerability of the oligonucleotide was evaluated by testing the modified oligonucleotide described above in mice.
[0161] Specifically, wild-type C57 / Bl6 mice were each administered a single dose of 300 µg of the oligonucleotides listed in the table below via intraventricular administration. Each treatment group consisted of three mice. A group of mice administered DPBS was used as a negative control. After administration, the recovery time until the mice exhibited normal behavioral responses was measured. Specifically, (1) whether the mice were bright, alert, and responsive; (2) whether the mice stood or crouched without stimulation; (3) whether the mice showed any movement without stimulation; and (4) the elapsed time to exhibit regular breathing. The results are presented in the table below.
[0162] Body weight was measured prior to administration within the study and evaluated for percentage change after 8 weeks of administration compared to baseline. Long-term tolerability was assessed by measuring mRNA levels of Iba1, microglial markers, and Gfap, astral markers in the brain. Since both Iba1 and Gfap are CNS inflammation markers, higher levels of either marker are considered to indicate lower tolerability of the oligonucleotide in mice. The mRNA expression levels of the Iba1 and Gfap genes relative to Hprt, one of the cell maintenance genes, were measured using quantitative real-time PCR. mRNA levels were measured using the mouse Hprt primer set (forward sequence: TCAGTCAACGGGGGACATAAA (sequence number 802), reverse sequence: GGGGCTGTACTGCTTAACCAG (sequence number 803), Gfap primer set (forward sequence: AACCTGGCTGCGTATAGA (sequence number 804), reverse sequence: CGAACTTCCTCCTCATAGAT (sequence number 805), and Iba1 primer set (forward sequence: ATCAACAAGCAATTCCTC (sequence number 806), reverse sequence: ATATCTCCATTTCCATTCAG (sequence number 807).
[0163] Compound IDSEQ ID NO Recovery Time (min) Gfap Relative Expression Rate Iba1 Relative Expression Rate 1347731832101.160.991347752906521.521.471347762913651.801.371347823403051.341.471347833411971.221.241347843972621.070.871347854933371.361.46134790601131.141.02134792697141.2 61.15134793729221.131.4713479473761.011.381347957531091.031.14134796754231.251.23134797755970.931.36134798730720.861.24134799742131.411.18134801744160.950.901348027521051.131.41
[0164] In the results of the tolerability evaluation in the above mice, the recovery time (minutes) may be 660 minutes or less, 600 minutes or less, 540 minutes or less, 500 minutes or less, 480 minutes or less, 420 minutes or less, 300 minutes or less, 240 minutes or less, or 180 minutes or less. Among the modified oligonucleotides that did not exhibit acute toxicity death or inflammatory response based on the above experimental results, IC in Example 2 50 Eighteen types were selected in order of lowest severity, and the PS / PO modification of Example 4 was subsequently carried out. At this time, oligonucleotides that had been measured to have long recovery times were also included, provided there was no acute toxicity death, as there is a possibility that toxicity can be reduced and recovery time shortened through PS / PO modification.
[0165]
[0166] Example 4: Inhibition of intracellular BRAF by an oligonucleotide having mixed backbone chemistry (single dose)
[0167] The modified oligonucleotide used in this test is identical to the modified oligonucleotide prepared in Example 3, having a central gap region consisting of 10 2'-deoxynucleotides and 3' and 5' wings each consisting of 5 2'-MOE nucleotides (5-10-5 2'-MOE gapmer), except that the internucleoside linkage in the gap region is a PS linkage, and the internucleoside linkage in the wing region has a phosphodiester or phosphorothioate linkage. Specific information on the modified oligonucleotide is shown in Table 21 below. The internucleoside linkage of each oligonucleotide is indicated in the backbone chemical properties column, where 'o' indicates a PO linkage and 's' indicates a PS linkage. Each gapmer listed in the table below is targeted to the human BRAF transcript sequence disclosed herein (Ensembl database transcript ID: ENST00000646891.2).
[0168] The SEQ ID NO of the compounds listed in Table 21 below is the number corresponding to the nucleic acid sequence listed in Tables 1 to 8.
[0169] SNB-19 cells cultured at a density of 20,000 cells / well or A431 cells cultured at a density of 10,000 cells / well were each treated with 5 μM of modified oligonucleotides by free absorption. Total RNA was extracted from the cells after 24 hours of treatment. The mRNA expression level of the BRAF gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR. The human RPL-13 primer probe set and the human BRAF primer probe set were used substantially identically to those in Example 1 to measure mRNA levels. The results represent the relative expression level of human BRAF mRNA compared to untreated control cells. The mean value of the relative expression rate refers to the average value of the relative expression rates in the two cell lines, SNB-19 and A431.
[0170] Compound IDSEQ ID NO서열(5’to 3’)뉴클레오시드간 결합상대적 발현율(평균)134773183CATAGGTAGGGTCTTCTTCTsssssssssssssssssss0.42174001183CATAGGTAGGGTCTTCTTCTsossssssssssssssoss0.34174002183CATAGGTAGGGTCTTCTTCTsosssssssssssssooss0.36174003183CATAGGTAGGGTCTTCTTCTsoossssssssssssooss0.36174004183CATAGGTAGGGTCTTCTTCTsososssssssssssosos0.37174005183CATAGGTAGGGTCTTCTTCTsooosssssssssssooss0.36174006183CATAGGTAGGGTCTTCTTCTsooosssssssssssooos0.40174007183CATAGGTAGGGTCTTCTTCTsoooossssssssssooss0.40134775290TGTAGGTGCTGTCACATTCAsssssssssssssssssss0.38174008290TGTAGGTGCTGTCACATTCAsossssssssssssssoss0.31174009290TGTAGGTGCTGTCACATTCAsosssssssssssssooss0.31174010290TGTAGGTGCTGTCACATTCAsoossssssssssssooss0.37174011290TGTAGGTGCTGTCACATTCAsososssssssssssosos0.34174012290TGTAGGTGCTGTCACATTCAsooosssssssssssooss0.42174013290TGTAGGTGCTGTCACATTCAsooosssssssssssooos0.47174014290TGTAGGTGCTGTCACATTCAsoooossssssssssooss0.56134776291GTAGGTGCTGTCACATTCAAsssssssssssssssssss0.44174015291GTAGGTGCTGTCACATTCAAsossssssssssssssoss0.35174016291GTAGGTGCTGTCACATTCAAsosssssssssssssooss0.36174017291GTAGGTGCTGTCACATTCAAsoossssssssssssooss0.38174018291GTAGGTGCTGTCACATTCAAsososssssssssssosos0.39174019291GTAGGTGCTGTCACATTCAAsooosssssssssssooss0.38174020291GTAGGTGCTGTCACATTCAAsooosssssssssssooos0.50174021291GTAGGTGCTGTCACATTCAAsoooossssssssssooss0.57134782340GTTACATGCTTGCTAGTCTTsssssssssssssssssss0.45174022340GTTACATGCTTGCTAGTCTTsossssssssssssssoss0.43174023340GTTACATGCTTGCTAGTCTTsosssssssssssssooss0.45174024340GTTACATGCTTGCTAGTCTTsoossssssssssssooss0.41174025340GTTACATGCTTGCTAGTCTTsososssssssssssosos0.43174026340GTTACATGCTTGCTAGTCTTsooosssssssssssooss0.45174027340GTTACATGCTTGCTAGTCTTsooosssssssssssooos0.61174028340GTTACATGCTTGCTAGTCTTsoooossssssssssooss0.52.
[0171] Compound IDSEQ ID NO서열(5’to 3’)뉴클레오시드간 결합상대적 발현율(평균)134783341ACGTGAAATGTTCCTTTTCAsssssssssssssssssss0.43174029341ACGTGAAATGTTCCTTTTCAsossssssssssssssoss0.34174030341ACGTGAAATGTTCCTTTTCAsosssssssssssssooss0.37174031341ACGTGAAATGTTCCTTTTCAsoossssssssssssooss0.36174032341ACGTGAAATGTTCCTTTTCAsososssssssssssosos0.41174033341ACGTGAAATGTTCCTTTTCAsooosssssssssssooss0.43174034341ACGTGAAATGTTCCTTTTCAsooosssssssssssooos0.48174035341ACGTGAAATGTTCCTTTTCAsoooossssssssssooss0.50134784397GTCCCGTCTACCAAGTGTTTsssssssssssssssssss0.58174036397GTCCCGTCTACCAAGTGTTTsossssssssssssssoss0.56174037397GTCCCGTCTACCAAGTGTTTsosssssssssssssooss0.60174038397GTCCCGTCTACCAAGTGTTTsoossssssssssssooss0.73174039397GTCCCGTCTACCAAGTGTTTsososssssssssssosos0.70174040397GTCCCGTCTACCAAGTGTTTsooosssssssssssooss0.81174041397GTCCCGTCTACCAAGTGTTTsooosssssssssssooos0.81174042397GTCCCGTCTACCAAGTGTTTsoooossssssssssooss0.94134785493GTCATACATTTTGTTCATAGsssssssssssssssssss0.43174043493GTCATACATTTTGTTCATAGsossssssssssssssoss0.37174044493GTCATACATTTTGTTCATAGsosssssssssssssooss0.37174045493GTCATACATTTTGTTCATAGsoossssssssssssooss0.34174046493GTCATACATTTTGTTCATAGsososssssssssssosos0.34174047493GTCATACATTTTGTTCATAGsooosssssssssssooss0.34174048493GTCATACATTTTGTTCATAGsooosssssssssssooos0.38174049493GTCATACATTTTGTTCATAGsoooossssssssssooss0.39134790601GCAGTCATGTATTTATTATCsssssssssssssssssss0.25174050601GCAGTCATGTATTTATTATCsossssssssssssssoss0.19174051601GCAGTCATGTATTTATTATCsosssssssssssssooss0.21174052601GCAGTCATGTATTTATTATCsoossssssssssssooss0.23174053601GCAGTCATGTATTTATTATCsososssssssssssosos0.22174054601GCAGTCATGTATTTATTATCsooosssssssssssooss0.22174055601GCAGTCATGTATTTATTATCsooosssssssssssooos0.31174056601GCAGTCATGTATTTATTATCsoooossssssssssooss0.36134792697CCAATAGTTGTACTTCTTTAsssssssssssssssssss0.38174057697CCAATAGTTGTACTTCTTTAsossssssssssssssoss0.25174058697CCAATAGTTGTACTTCTTTAsosssssssssssssooss0.36174059697CCAATAGTTGTACTTCTTTAsoossssssssssssooss0.37174060697CCAATAGTTGTACTTCTTTAsososssssssssssosos0.36174061697CCAATAGTTGTACTTCTTTAsooosssssssssssooss0.39174062697CCAATAGTTGTACTTCTTTAsooosssssssssssooos0.46174063697CCAATAGTTGTACTTCTTTAsoooossssssssssooss0.48134793729TCACAATCTTTGCCATGGTTsssssssssssssssssss0.35174064729TCACAATCTTTGCCATGGTTsossssssssssssssoss0.33174065729TCACAATCTTTGCCATGGTTsosssssssssssssooss0.41174066729TCACAATCTTTGCCATGGTTsoossssssssssssooss0.45174067729TCACAATCTTTGCCATGGTTsososssssssssssosos0.41174068729TCACAATCTTTGCCATGGTTsooosssssssssssooss0.45174069729TCACAATCTTTGCCATGGTTsooosssssssssssooos0.57174070729TCACAATCTTTGCCATGGTTsoooossssssssssooss0.51134794737TTGCCATGGTTTACTCTTCAsssssssssssssssssss0.35174071737TTGCCATGGTTTACTCTTCAsossssssssssssssoss0.30174072737TTGCCATGGTTTACTCTTCAsosssssssssssssooss0.31174073737TTGCCATGGTTTACTCTTCAsoossssssssssssooss0.34174074737TTGCCATGGTTTACTCTTCAsososssssssssssosos0.35174075737TTGCCATGGTTTACTCTTCAsooosssssssssssooss0.35174076737TTGCCATGGTTTACTCTTCAsooosssssssssssooos0.39174077737TTGCCATGGTTTACTCTTCAsoooossssssssssooss0.55134795753CAGCCATTAGTTAGCATCCTsssssssssssssssssss0.28174078753CAGCCATTAGTTAGCATCCTsossssssssssssssoss0.25174079753CAGCCATTAGTTAGCATCCTsosssssssssssssooss0.26174080753CAGCCATTAGTTAGCATCCTsoossssssssssssooss0.24174081753CAGCCATTAGTTAGCATCCTsososssssssssssosos0.24174082753CAGCCATTAGTTAGCATCCTsooosssssssssssooss0.26174083753CAGCCATTAGTTAGCATCCTsooosssssssssssooos0.38174084753CAGCCATTAGTTAGCATCCTsoooossssssssssooss0.38134796754AGCCATTAGTTAGCATCCTTsssssssssssssssssss0.21174085754AGCCATTAGTTAGCATCCTTsossssssssssssssoss0.16174086754AGCCATTAGTTAGCATCCTTsosssssssssssssooss0.17174087754AGCCATTAGTTAGCATCCTTsoossssssssssssooss0.20.
[0172] Compound IDSEQ ID NO서열(5’to 3’)뉴클레오시드간 결합상대적 발현율(평균)174088754AGCCATTAGTTAGCATCCTTsososssssssssssosos0.18174089754AGCCATTAGTTAGCATCCTTsooosssssssssssooss0.19174090754AGCCATTAGTTAGCATCCTTsooosssssssssssooos0.27174091754AGCCATTAGTTAGCATCCTTsoooossssssssssooss0.27134797755GCCATTAGTTAGCATCCTTAsssssssssssssssssss0.19174092755GCCATTAGTTAGCATCCTTAsossssssssssssssoss0.18174093755GCCATTAGTTAGCATCCTTAsosssssssssssssooss0.17174094755GCCATTAGTTAGCATCCTTAsoossssssssssssooss0.19174095755GCCATTAGTTAGCATCCTTAsososssssssssssosos0.21174096755GCCATTAGTTAGCATCCTTAsooosssssssssssooss0.20174097755GCCATTAGTTAGCATCCTTAsooosssssssssssooos0.26174098755GCCATTAGTTAGCATCCTTAsoooossssssssssooss0.24134798730CACAATCTTTGCCATGGTTTsssssssssssssssssss0.34174099730CACAATCTTTGCCATGGTTTsossssssssssssssoss0.30174100730CACAATCTTTGCCATGGTTTsosssssssssssssooss0.44174101730CACAATCTTTGCCATGGTTTsoossssssssssssooss0.46174102730CACAATCTTTGCCATGGTTTsososssssssssssosos0.44174103730CACAATCTTTGCCATGGTTTsooosssssssssssooss0.51174104730CACAATCTTTGCCATGGTTTsooosssssssssssooos0.59174105730CACAATCTTTGCCATGGTTTsoooossssssssssooss0.59134799742GTATCATATTATTTACCAGCsssssssssssssssssss0.22174106742GTATCATATTATTTACCAGCsossssssssssssssoss0.17174107742GTATCATATTATTTACCAGCsosssssssssssssooss0.19174108742GTATCATATTATTTACCAGCsoossssssssssssooss0.27174109742GTATCATATTATTTACCAGCsososssssssssssosos0.27174110742GTATCATATTATTTACCAGCsooosssssssssssooss0.16174111742GTATCATATTATTTACCAGCsooosssssssssssooos0.30174112742GTATCATATTATTTACCAGCsoooossssssssssooss0.33134801744ATCATATTATTTACCAGCCAsssssssssssssssssss0.35174113744ATCATATTATTTACCAGCCAsossssssssssssssoss0.27174114744ATCATATTATTTACCAGCCAsosssssssssssssooss0.30174115744ATCATATTATTTACCAGCCAsoossssssssssssooss0.38174116744ATCATATTATTTACCAGCCAsososssssssssssosos0.28174117744ATCATATTATTTACCAGCCAsooosssssssssssooss0.27174118744ATCATATTATTTACCAGCCAsooosssssssssssooos0.35174119744ATCATATTATTTACCAGCCAsoooossssssssssooss0.49134802752CCAGCCATTAGTTAGCATCCsssssssssssssssssss0.38174120752CCAGCCATTAGTTAGCATCCssssssssssssssssoss0.28174121752CCAGCCATTAGTTAGCATCCsssssss sssssssooss0.29174122752CCAGCCATTAGTTAGCATCCsoosssssssssssooss0.41174123752CCAGCCATTAGTTAGC ATCCsosossssssssssssosos0.35174124752CCAGCCATTAGTTAGCATCCsooosssssssssssooss0.42174125752CCAG CCATTAGTTAGCATCCsooosssssssssssoos0.55174126752CCAGCCATTAGTTAGCATCCsoooossssssssssooss0.51.
[0173]
[0174] Example 5: Inhibition of intracellular BRAF by 5-10-5 MOE cappers having mixed backbone chemistry (multiple doses)
[0175] The 5-10-5 2'-MOE capper modified oligonucleotide having mixed backbone chemical properties obtained in Example 4 above was tested on A431 cells at various doses. A431 cells cultured at a density of 10,000 cells / well were treated by free absorption with the modified oligonucleotides at concentrations of 0.004, 0.015, 0.059, 0.234, 0.938, 3.75, and 15 μM, respectively. Total RNA was extracted from the cells after 24 hours of treatment.
[0176] The mRNA expression level of the BRAF gene relative to RPL-13, one of the cell maintenance genes, was measured by quantitative real-time PCR, and the mRNA levels were measured using the human RPL-13 primer probe set and the human BRAF primer probe set, which were substantially the same as those in Example 1.
[0177] The results show the relative BRAF mRNA levels compared to untreated control cells. As exemplified in the table below, BRAF mRNA levels were reduced in a dose-dependent manner in modified oligonucleotide-treated cells. IC 50 Using Prism10 software, the “Absolute IC 50 It was calculated using the formula. The IC50 of the modified oligonucleotides is shown in Table 7 below. 50 It represents.
[0178] Compound IDSEQ ID NOIC50(uM)1740011830.4231740021830.1511740031830.5331740041830.8311740051830.3281740082901.2481740092901.3731740102902.1771740112901.9911740152911.2561740162912.0561740172911.8371740182911.5181740192912.3851740243400.8961740293410.861740303411.1181740313410.8211740434932.5061740444933.2491740454931.21740464931.141740474931.891740484937.61740494932.761347906010.2511740506010.2441740516010.2951740526010.3441740536010.3331740546010.5151740556011.1431740576970.3121740586970.5291740596970.7661740606970.6131740647291.5081740717370.7781740727370.681740737371.0681740747371.7811347957530.2311740787530.21740797530.2171740807530.2791740817530.4041740827530.5271347967540.1011740857540.1311740867540.1621740877540.1471740887540.1661740897540.131740907540.2091740917540.2291347977550.1351740927550.0961740937550.11740947550.0981740957550.1791740967550.0761740977550.0941740987550.1441740997300.4691347997420.2041741067420.1481741077420.161741087420.1611741097420.2621741107420.2251348017440.1351741137440.1361741147440.2031741157440.2651741167440.2441741177440.191741187440.3621741207520.1721741217520.1971741237520.228.
[0179] Experimental results showed that the measured IC50 values in the Absolute A431 cell line varied by approximately 100-fold, ranging from a minimum of 0.076 uM to a maximum of 7.6 uM. Among these, oligonucleotides corresponding to sequence numbers 601, 697, 753, 754, 755, 742, and 752 exhibited low IC50s. 50 It was selected as a sequence with particularly good efficacy, showing a tendency of expression reduction of more than 70% at the measured value and maximum concentration (Data not shown). Among the sequences with good efficacy described above, 30 types of oligonucleotides with a concentration of 0.527 uM or less were selected, and mouse tolerability tests corresponding to Example 6 were conducted.
[0180]
[0181] Example 6: Tolerability of a modified oligonucleotide complementary to human BRAF in mice
[0182] The modified oligonucleotide used in this test has the mixed backbone chemical properties prepared in Example 4, all cytosine bases are modified to mC, and it is a 5-10-5 2'-MOE gapmer. In addition, the internucleoside linkages in the gap region are PS bonds, and the internucleoside linkages in the wing region have phosphodiester or phosphothioate linkages. Specific information on the modified oligonucleotide is shown in Tables 21 to 23 below.
[0183] The tolerability of the oligonucleotides was evaluated by testing the modified oligonucleotides described above in mice.
[0184] Specifically, wild-type C57 / Bl6 mice were each administered a single dose of 600 µg of the oligonucleotides listed in the table below via intraventricular administration. Each treatment group consisted of three mice. A group of mice administered DPBS was used as a negative control. Three hours after administration, mice were evaluated according to seven different criteria. The criteria were: (1) whether the mouse was bright, alert, and responsive; (2) whether the mouse stood or crouched without stimulation; (3) whether the mouse exhibited any movement without stimulation; (4) whether the mouse moved forward after being lifted; (5) whether the mouse exhibited any movement after being lifted; (6) whether the mouse responded to a tail pinch; and (7) regular breathing. For each of the seven criteria, a sub-score of 0 was given if the mouse met the criterion, and 1 (Functional Observation Sum Score or FOB) otherwise. After evaluating all seven criteria, the scores were summed for each mouse and averaged within each treatment group. The results are presented in the table below.
[0185] Body weight was measured prior to administration within the study and evaluated for percentage change after 8 weeks of administration compared to baseline. Long-term tolerability was assessed by measuring mRNA levels of Iba1, microglial markers, and Gfap, astral markers in the brain. Since both Iba1 and Gfap are CNS inflammatory markers, higher levels of either marker are considered to indicate lower tolerability of the oligonucleotide in mice. The mRNA expression levels of the Iba1 and Gfap genes relative to Hprt, one of the cell maintenance genes, were measured by quantitative real-time PCR. mRNA levels were measured using the mouse Hprt primer set, Gfap primer set, and Iba1 primer set, which had the same sequences as those used in Example 3.
[0186] Compound IDScoreBody weight 8w (% of Day0)DPBS0.0127.91347904.5121.71740504.0115.71740512.01031740521.8101.91740570.8124.41347953.5119.71740782 .81211740794.0128.11740802.8125.31740822.5124.91347963.8129.71740853.6121.91740863.3116.41740873.0122.71740 883.8123.51740893.0129.71347973.8116.41740923.3124.21740933.0124.91740943.31131740962.31141740973.8122.31740982.5118.31347993.3131.91741062.3138.11741072.8131.71741082.01321348012.5134.71741202.3125.41741213.0131.2
[0187] Example 7: Evaluation of efficacy in Colo205 cells
[0188] The modified oligonucleotide used in this test is a 5-10-5 2'-MOE gapmer containing a modified base with a cytosine base of mC and a PS bond prepared in Example 3. This gapmer is 20 nucleosides long, wherein the central gap segment consists of 10 2'-deoxynucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. Additionally, the internucleoside linkage in the gap region is a PS bond, and the internucleoside linkage in the wing region has a phosphodiester or phosphorothioate linkage. Specific information on the modified oligonucleotide is shown in Tables 21 to 23 below.
[0189] Specifically, Colo205 cell lines cultured at a density of 20,000 cells / well were treated with modified oligonucleotides at concentrations of 0.25, 0.5, 1, and 5 μM by free absorption. Total RNA was extracted from the cells after 24 hours of treatment. The mRNA expression levels of the BRAF gene relative to RPL-13, one of the cell maintenance genes, were measured by quantitative real-time PCR. The human RPL-13 primer probe set and the human BRAF primer probe set were the same as those used in Example 1.
[0190] The above experimental results represent the relative BRAF mRNA levels compared to untreated control cells. As exemplified in the table below, BRAF mRNA levels were reduced in a dose-dependent manner in cells treated with modified oligonucleotides. IC50 was calculated using the “absolute IC50” formula with Prism10 software.
[0191] In addition, cell viability was measured using the CellTiter-Glo 2.0 Cell Viability Assay (Promega, G9241) after 168 hours of treatment. The results are shown as relative values compared to the number of untreated control cells.
[0192] As shown in the experimental results in Table 26 below, considering the purpose and significance of the Colo205 cell experiment, it was confirmed that the 11 types of antisense oligonucleotides obtained from the above examples, which showed a good effect in reducing Braf gene expression, effectively inhibited the growth and division ability of Colo205, a colon cancer cell with the Braf p.V600E mutation. Table 26 below shows the IC50 for reducing Braf gene expression. 50 and Colo205 cell viability IC50 50 Displays the result value.
[0193] Test compound Colo205 Braf mRNA cell viability IC 50 [μM]IC 50[μM]1740500.741.011740512.91.621740570.950.991347961.250.961740850.680.931347 971.390.8617409310.931740941.020.921740960.970.931741060.970.971741082.040.96
[0194] From the experimental results above, it was confirmed that when 11 representative antisense oligonucleotides with excellent Braf gene expression reduction effects were treated at different concentrations, the growth and division capabilities of Colo205 cells were effectively inhibited as Braf gene expression decreased. When the existing phosphothioate linkage is changed to a phosphodiester, there is a tendency for in vivo tolerability to increase while efficacy decreases; the selected phosphoester-modified oligonucleotides showed a tendency to maintain efficacy compared to the existing phosphothioate nucleotides.
[0195]
[0196] Example 8: Evaluation of Tolerance in Rats
[0197] The modified oligonucleotides used in this test are 5-10-5 2'-MOE gapmers containing modified bases with a cytosine base of mC and PS bonds prepared in Example 3, the central gap segment consists of 10 2'-deoxynucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. In each oligonucleotide, the nucleoside linkage is a phosphodiester or phosphorothioate linkage, and the specific sequences and nucleoside linkages of each compound are identical to those of the compounds listed in Tables 21 to 23.
[0198] The tolerability of the modified oligonucleotides described above was evaluated by testing them in rats. Sprague-Dawley rats each received a single intrathecal injection of 3 mg of the oligonucleotides listed in the table below. Each treatment group consisted of three rats, and a group receiving PBS was used as a negative control. At 3 hours and 8 weeks after administration, gait and wakefulness status were assessed in each rat.
[0199] For the gait evaluation, scores were assigned to each individual based on the following criteria. -2 points were assigned for gait ataxia or excessive swaying; -1 point for dragging or spreading limbs; 0 points for normal gait with body support on limbs; 1 point for walking on toes; and 2 points for walking with a bent back. For the state of arousal, scores were assigned to each individual based on the following criteria. 1 point was assigned for anesthesia or coma; 2 points for significantly low arousal (only slight head or body movement); 3 points for low arousal (observable periods of inactivity and slight walking); 4 points for normal state (observable alertness and walking behavior); 5 points for high arousal (observable excitement, tension, sudden rushing, and rigidity); and 6 points for significantly high arousal (observable high alertness, excitement, and running around). The scores assigned in the above gait and arousal evaluations were summed for each mouse, and the average was calculated within each treatment group.
[0200] Tolerability was evaluated by measuring mRNA levels of Gfap astrocyte markers in the cerebral cortex and cerebellar regions using brain tissues autopsied 8 weeks after administration. Gfap is a CNS inflammatory marker; therefore, higher levels of the marker are considered to indicate lower tolerability of the oligonucleotide in rats. The mRNA expression levels of the Gfap gene for Gapdh, one of the cell maintenance genes, were measured by quantitative real-time PCR. mRNA levels were measured using the rat Gapdh primer probe set (forward sequence: TGCTCCTCCCTGTTCTAGAGACA (SEQ No. 808), reverse sequence: CACCGACCTTCACCATCTTGT (SEQ No. 809), probe sequence: CCGCATCTTCTTGTGCAGTGCCAG (SEQ No. 810) and the Gfap primer probe set (Thermo Fisher, Assay ID Rn01253033_m1).
[0201] Compound ID 3 hours 8 weeks gait arousal state gait arousal state DPBS0404174050-0.72.3-0.74174051-1.32.704174093-1.31.704
[0202] Compound IDCerebellumGfapGfapDPBS1.021.001740501.641.071740512.501.141740931.120.89
[0203] As shown in Tables 27 and 28 above, abnormalities in gait and wakefulness were observed in the behavioral assessment 3 hours after oligonucleotide administration, but they soon recovered, and in the behavioral assessment at week 8, both gait and wakefulness recovered to normal levels compared to the control group. In the neuroinflammation assessment at week 8, Gfap expression was measured to be within the normal range.
[0204]
[0205] Example 9: Evaluation of efficacy in primates
[0206] The modified oligonucleotides used in this test are 5-10-5 2'-MOE gapmers containing modified bases with a cytosine base of mC and PS bonds prepared in Example 3, the central gap segment consists of 10 2'-deoxynucleotides, and the 3' and 5' wings each consist of 5 2'-MOE nucleotides. In each oligonucleotide, the nucleoside linkage is a phosphodiester or phosphorothioate linkage, and the specific sequences and nucleoside linkages of each compound are identical to those of the compounds listed in Tables 21 to 23.
[0207] The modified oligonucleotides described above were further evaluated for efficacy in non-human primates (NHP). Two cynomolgus monkeys for each compound received 20 mg of each compound via intrathecal bolus injection on Day 1 and Day 29 of the study. Two weeks after administration on Day 29, the relative BRAF mRNA expression levels in the cerebral cortex and spinal cord regions were analyzed.
[0208] The mRNA expression level of the BRAF gene relative to UBC, one of the cell maintenance genes, was measured by quantitative real-time PCR. mRNA levels were measured using a non-human primate UBC primer probe set (Thermo Fisher, Assay ID Mf02798368_m1) and a non-human primate BRAF primer probe set (forward sequence: CCCAAGTCACCACAAAAACC (Sequence No. 811), reverse sequence: GACCTCTCATCATCAGTGCT (Sequence No. 812), probe sequence: CCTGCCCAACAAACAGAGGACAGTG (Sequence No. 813). Monkey brain tissue that received no treatment was used as a control, and the relative BRAF mRNA expression levels are listed in the table below. As shown in the table below, the modified oligonucleotide reduced BRAF mRNA in the cerebral cortex and spinal cord regions compared to the control.
[0209] Compound ID Frontal lobe Cortical motor cortical temporal lobe Cortical lumbar spinal cord DPBS1.051.011.021.011740500.410.540.330.32
[0210] As shown in the experimental results of Table 29 above, the modified oligonucleotide reduced BRAF mRNA in the cerebral cortex and spinal cord regions compared to the control group.
Claims
An oligomer compound comprising a modified oligonucleotide composed of 1.8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide is complementary to an equal length portion of a BRAF nucleic acid sequence by at least 80% nucleic acid sequence homology (identity), and the modified oligonucleotide comprises one or more modifications selected from the group consisting of a modified sugar moiety, a modified nucleoside inter-bond, and a modified base.
2. The oligomer compound of claim 1, having a sequence complementary to the target region of a BRAF gene selected from the group consisting of SEQ ID NOs 764 to 778, and comprising 8 to 80 nucleotides.
3. The oligomer compound of claim 1, having a sequence complementary to the target region of a BRAF gene selected from the group consisting of SEQ ID NOs 767, 768, 769, and 776, and comprising 8 to 80 nucleotides.
4. In claim 1, the compound is an oligomer compound comprising a modified oligonucleotide composed of 8 to 80 linked nucleosides, The nucleic acid sequence of the above modified oligonucleotide is Nucleic acid sequences of SEQ ID NOs 393 to 397 or SEQ ID NOs 705 to 716; Nucleic acid sequences of SEQ ID NOs 285 to 296; Nucleic acid sequences of SEQ ID NOs 262 to 270; Nucleic acid sequences of SEQ ID NOs 742 to 758; Nucleic acid sequence of SEQ ID NO. 601 or 739; Nucleic acid sequences of SEQ ID NOs 590 to 591 or nucleic acid sequences of SEQ ID NOs 729 to 737; Nucleic acid sequences of SEQ ID NOs 248 to 255; Nucleic acid sequences of SEQ ID NOs 202 to 207; Nucleic acid sequences of SEQ ID NOs 179 to 185; Nucleic acid sequences of SEQ ID NOs 149 to 152; The nucleic acid sequences of SEQ ID NOs 126 to 130, the nucleic acid sequence of SEQ ID NO. 346, or the nucleic acid sequence of SEQ ID NO. 763; The nucleic acid sequence of SEQ ID NO. 102, SEQ ID NO. 339, SEQ ID NO. 341, or SEQ ID NO. 342; Nucleic acid sequences of SEQ ID NOs 696 to 699; Nucleic acid sequences of SEQ ID NOs 689 to 694; and The nucleic acid sequence of SEQ ID NOs 979 to 1027, or SEQ ID NO. 340; comprising 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases, The above-mentioned modified oligonucleotide is an oligomer compound comprising one or more modifications selected from the group consisting of a modified sugar moiety, modified nucleoside inter-bonds, and modified bases.
5. The oligomer compound according to claim 1, comprising a modified oligonucleotide composed of 8 to 80 linked nucleosides, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases among the nucleic acid sequences of SEQ ID NOs 779 to 793, The above-mentioned modified oligonucleotide is an oligomer compound comprising one or more modifications selected from the group consisting of a modified sugar moiety, modified nucleoside inter-bonds, and modified bases.
6. In claim 1, the nucleic acid sequence of the modified oligonucleotide comprises an oligonucleotide composed of a nucleoside in which 14 to 80, for example, 14 to 30, or 14 to 22, specifically 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases are linked in the nucleic acid sequence of SEQ ID NO. 783, 791, or 794. The above-mentioned modified oligonucleotide is an oligomer compound comprising one or more modifications selected from the group consisting of a modified sugar moiety, modified nucleoside inter-bonds, and modified bases.
7. In claim 1, the nucleic acid sequence of the modified oligonucleotide comprises an oligonucleotide composed of a nucleoside having 9 to 80 consecutive nucleoside sequences, for example, 12 to 30, or 12 to 22, specifically 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases linked together, comprising the nucleic acid sequence of SEQ ID NO.
795. The above-mentioned modified oligonucleotide is an oligomer compound comprising one or more modifications selected from the group consisting of a modified sugar moiety, modified nucleoside inter-bonds, and modified bases.
8. An oligomer compound according to claim 7, wherein the nucleic acid sequence of the modified oligonucleotide comprises 12, 13, 14, 15, 16, 17, 18, 19, or 20 adjacent nucleobases selected from one nucleic acid sequence selected from the group consisting of SEQ ID NOs 183, 290, 291, 340, 341, 493, 601, 697, 729, 737, 753, 754, 755, 742, 744, and 752.
9. In any one of claims 1 to 8, the modified oligonucleotide is, 5'-wing region composed of 1 to 6 linked 5'-region nucleosides; A central region composed of 6 to 10 connected central region nucleosides; and 3'-wing region consisting of 1 to 6 linked 3'-domain nucleosides An oligomer compound containing 10. An oligomer compound according to any one of claims 1 to 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.
11. In any one of claims 1 to 10, the modified sugar moiety comprises a non-cyclic modified sugar moiety consisting of a 2'-MOE sugar moiety and a 2'-OMe sugar moiety; and An oligomer compound comprising one or more selected from the group consisting of cyclic modified sugar moiety comprising a 2',4'-bridge selected from O-CH2- and -O-CH(CH3)-.
12. An oligomer compound according to any one of claims 1 to 11, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety having a 2'-4' bridge and at least one modified nucleoside comprising a modified sugar moiety having a non-modified sugar moiety.
13. The modified oligomer compound according to claim 12, wherein the modified oligonucleotide comprises a 5'-wing region; a central gap region; and a 3'-wing region, wherein one or more regions selected from the group consisting of the 5'-wing and the 3'-wing may comprise one or more cyclic modified sugar moiety and a non-cyclic modified sugar moiety, wherein the cyclic modified sugar moiety is a cyclic modified sugar moiety having a 2'-4' bridge.
14. In any one of claims 1 to 13, the modified oligonucleotide is an oligomer compound comprising at least one modified nucleoside inter-linkage.
15. An oligomer compound according to claim 14, wherein the internucleoside bond comprises one or more internucleoside bonds selected from the group consisting of phosphorothioate internucleoside bonds, mesylphosphoramidate internucleoside bonds, and phosphodiester internucleoside bonds.
16. An oligomer compound according to claim 16, wherein the modified oligonucleotide comprises phosphothioate nucleoside inter-bondings and phosphodiester nucleoside inter-bondings, wherein the phosphodiester nucleoside inter-bondings are included in at least one wing region of the gapmer structure.
17. An oligomer compound according to any one of claims 1 to 16, wherein the modified oligonucleotide comprises a modified nucleobase.
18. An oligomer compound according to claim 9, wherein each of the central region nucleosides is a 2'-β-D-deoxynucleoside.
19. An oligomer compound comprising a conjugate in any one of claims 1 to 18.
20. A composition for reducing or inhibiting the activity or expression level of BRAF, comprising an oligomer compound according to any one of claims 1 to 19.
21. A pharmaceutical composition for the prevention, improvement, or treatment of a disease or disorder associated with BRAF, comprising an oligomer compound according to any one of claims 1 to 19.
22. A pharmaceutical composition according to claim 21, wherein the composition further comprises a pharmaceutically acceptable carrier or diluent.
23. A pharmaceutical composition in which the pharmaceutically acceptable diluent in paragraph 22 is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).
24. A pharmaceutical composition according to any one of claims 21 to 23, wherein the disease or disorder associated with BRAF is cancer or a neurodevelopmental disorder.
25. A pharmaceutical composition wherein, in paragraph 24, the disease or disorder is a seizure or epilepsy associated with a BRAF mutation-positive brain tumor.