mRNA therapy for neurological disorders

RNA-based therapies using GRIN2A and GRIA3-encoding polynucleotides delivered by BBB-crossing lipid nanoparticles address the limitations of current treatments for schizophrenia, achieving effective mRNA delivery and therapeutic outcomes in neurological disorders.

WO2026080440A1PCT designated stage Publication Date: 2026-04-16MT SINAI SCHOOL OF MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-10-07
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

Current pharmacological interventions for neurological disorders such as schizophrenia are limited by side effects, poor tolerability, and uncertain long-term efficacy, particularly in ultra-high risk individuals, and fail to treat negative and cognitive symptoms effectively.

Method used

Development of RNA-based therapies using polynucleotides that encode GRIN2A and GRIA3 genes, with modified 5' and 3' untranslated regions, delivered via BBB-crossing lipid nanoparticles (BLNPs) to target neuronal cells.

Benefits of technology

Efficient delivery of mRNA to brain cells, including neurons and astrocytes, with potential therapeutic benefits in treating neurological disorders like schizophrenia, demonstrated in animal models and human brain samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000053_0000
    Figure 00000053_0000
  • Figure 00000056_0000
    Figure 00000056_0000
  • Figure 00000057_0000
    Figure 00000057_0000
Patent Text Reader

Abstract

The present invention relates to a polynucleotide sequence comprising a 5' untranslated region (5' UTR), a messenger RNA (mRNA) coding region, and a 3' untranslated region (3' UTR), wherein the 5' UTR and / or 3' UTR are modified. The invention further encompasses compositions and methods for delivering the modified polynucleotide to a subject in need thereof for the treatment or prevention of neurological disorder or neurobiological psychotic disorders.
Need to check novelty before this filing date? Find Prior Art

Description

Atorney Docket No. 770573: MTST-563PC1MRNA THERAPY FOR NEUROLOGICAL DISORDERSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to U.S. provisional application 63 / 704,994, filed on October 8, 2024 and U.S. provisional application 63 / 713,248, filed on October 29, 2024.INCORPORATION BY REFERENCE OF AN ELECTRONIC SEQUENCE LISTING

[0002] This application contains a sequence listing that has been submitted in a computer readable format and is hereby incorporated by reference in its entirety. The computer readable file, created on October 7, 2025, is named MTST-563seq.xml and is 17,363 bytes in size.BACKGROUND

[0003] Psychotic disorders, including schizophrenia, bipolar disorder with psychotic features, and major depression with psychotic features, are severe mental illnesses typically emerging in late adolescence or early adulthood. These conditions are primarily characterized by hallucinations, delusions, and significant behavioral changes, with schizophrenia accounting for approximately 80% of cases. Globally, schizophrenia ranks among the top causes of non- fatal disease burden, contributing substantially to years lived with disability. Despite the high prevalence and impact, current pharmacological interventions, such as antipsychotics and mood stabilizers, are limited by side effects, poor tolerability, and uncertain long-term efficacy, especially in individuals identified as ultra-high risk (UHR) who may not progress to full psychosis. Additionally, although antipsychotics are effective in reducing positive symptoms of some psychotic disorders (e.g., hallucinations), they fail to treat negative and cognitive symptoms of the illness. They also cause debilitating side effects that can lead to medication nonadherence and ultimately inpatient hospitalization. Thus, new treatments for neurological disorders, such as neurobiological psychotic disorders, are still needed.81181968. v1 1Atorney Docket No. 770573: MTST-563PC1SUMMARY

[0004] RNA based therapies that can deliver polynucleotides which encode the GRIN2A and GRIA3 genes represent a promising new approach for the treatment neurological disorders, such as neurobiological psychotic disorders.

[0005] One aspect of the disclosure A polynucleotide sequence comprising a 5’ UTR, a mRNA coding region, and 3’ UTR, wherein the 5’ UTR and / or 3 ’UTR are modified.

[0006] The polynucleotide sequence of claim 1, wherein the modified 5’ UTR and / or modified 3 ’UTR comprise one or more point mutations.

[0007] The polynucleotide of claim 1 or claim 2, wherein the 5’ UTR comprises a nucleic acid sequence at least 70% identical to SEQ ID NO: 1, alternatively at least 75% identical to SEQ ID NO: 1, alternatively at least 80% identical to SEQ ID NO: 1, alternatively at least 85% identical to SEQ ID NO: 1, alternatively at least 90% identical to SEQ ID NO: 1, alternatively at least 95% identical to SEQ ID NO: 1, alternatively 100% identical to SEQ ID NO: 1.

[0008] The polynucleotide of any one of the preceding claims, wherein the 3’ UTR comprises a nucleic acid sequence at least 70% identical to SEQ ID NO: 2, alternatively at least 75% identical to SEQ ID NO: 2, alternatively at least 80% identical to SEQ ID NO: 2, alternatively at least 85% identical to SEQ ID NO: 2, alternatively at least 90% identical to SEQ ID NO: 2, alternatively at least 95% identical to SEQ ID NO: 2, alternatively 100% identical to SEQ ID NO: 2.

[0009] The polynucleotide of any one of the preceding claims, wherein the polynucleotide comprises at least a first mRNA coding region and at least a second mRNA coding region, wherein the first mRNA coding region and the second mRNA coding region are different.

[0010] The polynucleotide of claim 5, wherein the polynucleotide further comprises at least a third mRNA coding region, wherein the first mRNA coding region, the second mRNA coding region, and the third mRNA coding region are different.

[0011] A polynucleotide of claim 1, comprising a nucleic acid sequence at least 70% identical to SEQ ID NO: 3, alternatively at least 75% identical to SEQ ID NO: 3, alternatively at least 80% identical to SEQ ID NO: 3, alternatively at least 85% identical to SEQ ID NO: 3, alternatively at least 90% identical to SEQ ID NO: 3, alternatively at least 95% identical to SEQ ID NO: 3, alternatively 100% identical to SEQ ID NO: 3.81181968. v1 2Atorney Docket No. 770573: MTST-563PC1

[0012] A polynucleotide of claim 1, comprising a nucleic acid sequence at least 70% identical to SEQ ID NO: 4, alternatively at least 75% identical to SEQ ID NO: 4, alternatively at least 80% identical to SEQ ID NO: 4, alternatively at least 85% identical to SEQ ID NO: 4, alternatively at least 90% identical to SEQ ID NO: 4, alternatively at least 95% identical to SEQ ID NO: 4, alternatively 100% identical to SEQ ID NO: 4.

[0013] A polynucleotide of claim 1, comprising a nucleic acid sequence at least 70% identical to SEQ ID NO: 5, alternatively at least 75% identical to SEQ ID NO: 5, alternatively at least 80% identical to SEQ ID NO: 5, alternatively at least 85% identical to SEQ ID NO: 5, alternatively at least 90% identical to SEQ ID NO: 5, alternatively at least 95% identical to SEQ ID NO: 5, alternatively 100% identical to SEQ ID NO: 5.

[0014] A composition comprising the polynucleotide sequence of any one of the preceding claims and a delivery vehicle, wherein the polynucleotide sequence is at least partially encapsulated by the delivery vehicle.

[0015] The composition of claim 10, wherein the delivery vehicle comprises blood-brain barrier (BBB) crossing lipids, phospholipids, cholesterol, and / or polyethylene glycol (PEG)- lipid constructs.

[0016] The composition of claim 11, wherein the BBB-crossing lipids are derived from L- DOPA (LD), D-serine (DS), temozolomide (TM), tryptamine (TD), cinnamic acid (CD), and / or MK-0752 (MK).

[0017] The composition of claim 11 or claim 12, wherein the phospholipids are selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, 1,2-distearoyl-sn- glycero-3 -phosphocholine (DSPC) and l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE).

[0018] The composition of any one of claims 11 to 13, wherein the PEG-lipid construct comprises l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG).

[0019] The composition of any one of claims 10 to 14, wherein the composition is a therapeutic composition.

[0020] The composition of any one of claims 10 to 15, wherein the composition is configured to cross the BBB and deliver the mRNA to neuronal cells, nerve cells, and / or brain cells.81181968. v1 3Atorney Docket No. 770573: MTST-563PC1

[0021] A method of increasing translation of mRNA in neuronal cells, nerve cells, and / or brain cells, the method comprising administering to a subject in need thereof the polynucleotide of any one of claims or 1 to 9 the composition of any one of claims 10 to 15.

[0022] A method of treating a neurological disorder or a neurobiological psychotic disorder in a subject in need thereof, the method comprising administering an effective amount of the polynucleotide of any one of claims or 1 to 9 the composition of any one of claims 10 to 15.

[0023] Use of a polynucleotide as defined in any one of claims 1 to 9, or a composition as defined in any one of claims 10 to 15, for the treatment or prevention of a neurological disorder or a neurobiological psychotic disorder in a subject in need thereof, by administering an effective amount of said polynucleotide or composition.

[0024] Use of a polynucleotide as defined in any one of claims 1 to 9, or a composition as defined in any one of claims 10 to 15, for the manufacture of a medicament for the treatment or prevention of a neurological disorder or a neurobiological psychotic disorder in a subject in need thereof.

[0025] The method of claim 18 or the use of claim 19 or claim 20, wherein the neurobiological psychotic disorder is selected from the group consisting of schizophrenia, schizoaffective disorder, brief psychotic disorder, bipolar disorder with psychotic features, bipolar disorder, delusional disorder, and psychotic depression.

[0026] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein and may be employed to achieve the benefits as described herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] FIG. 1A illustrates the of the formulation of BBB-crossing lipid nanoparticles (BLNPs) and potential BBB- crossing mechanisms; FIGs. IB and 1C illustrate chemical structures of BBB-crossing lipids; FIG. 1C illustrates synthetic routes of BBB-crossing lipids DS11 and MK6. Blue portions stand for BBB-crossing small molecules; Red portions represent amino linkages; Black portions mean various lipid tails.

[0028] FIGs. 2A-2I illustrate characterizations of BBB-crossing lipid nanoparticles (BLNPs) for mRNA delivery. (FIG. 2A-FIG. 2F) The luminescence intensity of BLNP-FLuc81181968. v1 4Atorney Docket No. 770573: MTST-563PC1 mRNA treated N2a cells. The intensity was normalized to the MC3 LNPs group. (FIG. 2G) The luminescence intensity of lead BLNP-Fluc mRNA treated mice (z.v.). The intensity was normalized to the MC3 LNP group. (FIG. 2H) Representative images of brains from the mice i.v. treated with MC3 LNPs and MK6 BLNPs. (FIG. 21) Luminescence quantification of the organs from PBS, free mRNA, MC3 LNPs, or MK6-BLNP -treated mice. Data in FIGs. 2A-2I are from n = 3 biologically independent samples. Data are presented as mean ± SD. Statistical significance was determined by one-way ANOVA followed by Dunnett’s multiple comparison test. n.s. not significant, P > 0.05, *P < 0.05, **P < 0.01, ****p < 0.0001.

[0029] FIGs. 3A-3L illustrates optimization and characterization of MK6 BLNP series for systemic mRNA delivery to mouse brain. (FIG. 3A) Normalized luminescence intensity and (FIG. 3B) representative IVIS images of brains of mice intravenously injected with MK6 BLNPs and MK6E BLNPs encapsulating FLuc-mRNA. Intensity was normalized to the MK6 group. (FIG. 3C) Structure optimization of MK6 BLs. (FIG. 3D) Normalized luminescence intensity and (FIG. 3E) representative images of brains after intravenous injections with MC3 LNPs, MK6E BLNPs, or MK16 BLNPs. The intensity was normalized to the MC3 LNP group. (FIG. 3F) Immunofluorescence flow cytometry (IFCM) analysis of GFP expression in different brain cell types from brain of the mice intravenously injected with MK16 BLNP-GFP mRNA or MC3 LNP-GFP mRNA. BCEC, brain capillary endothelial cell. NSC, neural stem cell. (FIG. 3G) Representative histograms of GFP expression in different brain cell types after various doses of MK16-mediated GFP mRNA delivery (1 mg / kg) from FIG. 3F. (FIG. 3H) Illustration of a bEND.3- N2a transwell cell assay for BBB penetration assessment. The lower compartment was seeded with N2a cells. (FIG. 31) The luminescence intensity of N2a cells in the lower compartment after MK16 BLNP-FLuc mRNA treatment to the bEND.3 cells in the upper compartment. The bEND.3 cells were pre-treated with either MpCD or NGST. (FIG. 3J) The fluorescence intensity and (FIG. 3K) representative IVIS images of the brains of the mice after intravenous injections with MK16 BLNPs encapsulating Alexa-Fluor 647 labeled RNAs. The mice were pre-treated with either MpCD or NGST. (FIG. 3L) Illustration of BBB-crossing mechanisms of MK16 BLNPs. All data are from n = 3 biologically independent samples and are presented as mean ± SD. Statistical significance and P values were determined by one-way ANOVA followed by Dunnett’s multiple comparison test, n.s., not significant, P > 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0030] FIGs 4A-4I illustrate MK16 BLNPs for Cre mRNA delivery in the Ail 4 mouse model. (FIG. 4A) Diagram depicting that delivery of Cre recombinase mRNA turns on tdTomato81181968. v1 5Atorney Docket No. 770573: MTST-563PC1 expression in Ail 4 mice. (FIG. 4B) Representative brain images of Ail 4 mice injected intravenously with PBS, MK16 BLNP-Cre mRNA, or MC3 LNP-Cre mRNA. The tdTomato expression in neurons (Map2+) and astrocytes (GFAP+) in (FIG. 4C) hippocampus, (FIG. 4D) thalamus, and (FIG. 4E) cortex. Scale bar: 50 pm. Quantification of tdTomato-positive neurons and astrocytes in (FIG. 4F) hippocampus, (FIG. 4G) thalamus, and (FIG. 4H) cortex. (FIG. 41) IF CM analysis of tdTomato expression in different brain cell types after single or triple intravenous injections of MK16 BLNP-Cre mRNA and MC3 LNP-Cre mRNA. BCEC, brain capillary endothelial cell. NSC, neural stem cell. All data are from n = 3 biologically independent samples and are presented as mean ± SD. Statistical significance and P values were determined by one-way ANOVA followed by Dunnett’s multiple comparison test, n.s., not significant, P > 0.05, **P < 0.01, ***p < 0.001, ****p < 0.0001.

[0031] FIGs 5A-E illustrate safety profiles of MK16 BLNPs for systemic delivery. (FIG. 5A) Heatmaps displaying relative NOTCH- related gene expression in brain, liver and spleen of the mice treated with MK16 BLNPs or MK-0752 as compared to PBS, and measured by RNA-sequencing. Results are calculated based on normalized counts and indicate three biologically independent samples. (FIG. 5B) Heatmaps displaying dynamic expression of cytokines and chemokines in blood of the mice after systemic administration of MK16 BLNPs or MC3 LNPs. Results indicate three replicates. (FIG. 5C) Dynamic expression level of certain critical cytokines and chemokines from FIG. 5B. (FIG. 5D) Dynamic hepatic and renal functional evaluations of the mice after systemic administration of MK16 BLNPs or MC3 LNPs. ALT, alanine transaminase; AST, aspartate aminotransferase; BUN, blood urea nitrogen. (FIG. 5E) Representative histopathological images from mice after systemic administration of MK16 BLNPs. Scale bars, 250 pm. Data in FIG. 5A-5D are from n = 3 biologically independent samples and are presented as the mean ± SD. Statistical significance and P values were determined by one-way ANOVA followed by Dunnett’s multiple comparison test, n.s., not significant, P > 0.05, **P < 0.01, ***p < 0.001, ****p < 0.0001.

[0032] FIG. 6A-6E. MK16 BLNPs for AFosb mRNA delivery in a cocaine-conditioned place preference (CPP) model. (FIG. 6A) AFOSB expression in the nucleus accumbens (NAc) region of the mouse brain after intravenous administration of MK16 BLNP-AFo Z> mRNA. Scale bar: 100 pm. (FIG. 6B) Schematic depicting the CPP procedure. S means saline and C means cocaine. (FIG. 6C) Preference score calculated as time spent on drug paired side - time spent in saline paired side of the conditioned mice treated with PBS or MK16 BLNP- AFosb mRNA. n=19 mice81181968. v1 6Atorney Docket No. 770573: MTST-563PC1 for PBS group and n=20 mice for MK16 BLNP group. (FIG. 6D) Schematic depicting ex vivo mRNA delivery in human brain tissue. (FIG. 6E) AFOSB expression levels across neurons, astrocytes, and microglia from adult human cerebral cortex dissections after ex vivo treatment with PBS or MK 16 BLNP- AFosb mRNA. n=4 tissue slices for each group. Data in FIG. 6C and FIG. 6E are presented as the mean ± SD. Statistical significance and P values in FIG. 6C were determined by two-way ANOVA with Sidak post-hoc. Statistical significance and P values in FIG. 6E were determined by the two-tailed Student’s t-test. n.s., not significant, P > 0.05, **P < 0.01, ***P < 0.001.

[0033] FIGs. 7A-7D MK16 BLNP- tew mRNA treatment in an orthotopic glioblastoma mouse model. FIG. 7A, Schematic of the treatment regimen in the U-l 18MG GBM model. The treatments were intravenously injected into the tumor-bearing mice via tail vein at the mRNA dose of 1.0 mg / kg. A total of three treatments were given at three-day intervals. FIG. 7B, Luminescence intensity of orthotopic GBM tumor tissues in the mice treated with PBS, MK16 BLNP-control mRNA and MK16 BLNP- tew mRNA via trail vein, respectively. FIG. 7C, Representative IVIS images of the tumor-bearing mice. FIG. 7D, Mouse survival over time. n=9 mice for PBS group and Control mRNA group. n=10 mice for Pten mRNA group. Data in FIG. 7B are presented as the mean ± SD. Statistical significance and P values in FIG. 7B were determined by two-way ANOVA with Fisher’s LSD. Statistical significance and P values in FIG. 7D were analyzed by the log-rank (Mantel-Cox) test. *P < 0.05, **P < 0.01, ***p < 0.001, ****p < 0.0001.

[0034] FIG. 8 depicts GRIN2A mRNA expression in SH-SY5Y cells.

[0035] FIG. 9 depicts GRIA3 mRNA expression in SH-SY5Y cells.

[0036] FIG. 10 depicts GRJN2A expression in mouse brain.

[0037] FIG. 11 depicts GRIA3 mRNA expression in mouse brain.

[0038] FIGs. 12A and 12B depict the therapeutic efficacy of LNP-Gria3 mRNA treatment in a SCZ mouse model. FIG. 12A is a representative immunofluorescence images of mouse brains with or without Gria3-LNP treatment. GRIA3 expression (red) is shown in whole-brain sections and specific brain regions, including the cortex, hippocampus, thalamus, and hypothalamus. Scale bars: 2.5 mm (whole brain) and 100 pm (zoomed-in images). FIG. 12B shows heat maps showing movement traces and latency time of SCZ mice in the open field test. Gria3-LNP treatment significantly reduced locomotor activity in SCZ mice. Flue, a81181968. v1 7Atorney Docket No. 770573: MTST-563PC1 reporter mRNA, was used as a control mRNA. Data in a are from n = 3 mice. Data in b are from n = 20 biologically independent mice. **p < 0.01, ****p < 0.0001; statistical analysis was performed using one-way ANOVA with Tukey’s multiple comparisons test.

[0039] FIG. 13 depicts safety evaluation of LNP treatment by H&E staining. Hematoxylin and eosin (H&E) staining of major organs (heart, liver, spleen, lung, and kidney) from mice treated with LNPs. No obvious pathological changes were observed following treatment. Scale bar = 100 pm. Data are from n = 3 mice.DETAILED DESCRIPTIONI. Introduction

[0040] Over the past two decades, immense progress has been made in mapping the genetic architecture of Schizophrenia (SCZ). Like most human traits and illnesses, SCZ is highly polygenic, meaning risk is conferred not through dysfunction of a single gene product but rather through many common and rare genetic variants spread across the genome. Specifically, 270 common risk alleles have been identified marking 3,542 genes, while 10 genes have been found to harbor rare exonic risk alleles. It is now the task of the field to translate this knowledge into novel therapeutics, as all current antipsychotics work through the same mechanism as the original antipsychotics discovered in the 1950s.

[0041] Surprisingly, there is currently little momentum towards this end. In fact, as the number of genes linked to SCZ has increased, the number of novel experimental therapeutic trials has declined. The field is thus at a crossroads, and the moment calls for bold first-in-human clinical trials to deliver on the promise of genomics in the mental health arena.

[0042] Lipid nanoparticles (LNPs), widely recognized for their application in COVID-19 vaccines, have been established as an effective and safe delivery system for mRNA-based protein replacement therapy with high levels of protein expression. Recent advances in brain- targeted LNPs have shown efficient delivery of therapeutic mRNA to the central nervous system, which lay a foundation for the modulation of schizophrenia (SCZ)-related behavior.

[0043] The delivery of mRNA molecules to the central nervous system (CNS) is challenging largely due to the naturally existing blood-brain barrier (BBB). To address this challenge, the inventors designed and synthesized 72 BBB-crossing lipids by conjugating BBB-crossing moi eties and amino lipids. Together with DOPE, cholesterol, and DMG-PEG, these BBB- crossing lipids can efficiently encapsulate mRNA to produce BBB- crossing lipid nanoparticles81181968. v1 8Atorney Docket No. 770573: MTST-563PC1(BLNPs). Through in vitro and in vivo examinations of these BLNPs, the inventors found that MK6 BLNPs effectively cross the BBB and deliver mRNA to brain cells after intravenous injection. Moreover, the inventors optimized the lipid structures of MK6 by tuning the position of the acetal group and length of lipid chains, which resulted in MK16 BLNPs, a lead formulation. After intravenous injection, MK16 BLNPs showed significantly higher mRNA delivery efficiency in the brain than DLin-MC3-DMA, ALC-0315, and SM-102 LNPs, the FDA-approved lipid formulations. Specifically, MK16 BLNPs can deliver GFP mRNA into about 7.3% of neurons and 9.7% of astrocytes after a single intravenous injection. In an Ail4 mouse model, MK16 BLNP-Cre recombinase mRNA induced tdTomato expression in about 16.7% of neurons and 19.2% of astrocytes of the whole brain after triple intravenous injections. Additionally, MK16 BLNPs were well- tolerated across several dosage regimens.

[0044] Importantly, MK16 BLNPs can deliver AFosb mRNA and express this transcription factor in a mouse model of cocaine action. Effective delivery of this mRNA was also observed in human brain samples ex vivo. Lastly, MK16 BLNPs loaded with a phosphatase and tensin homolog (Pten) mRNA reinstate tumor-suppressor activity, inhibit tumor growth and prolong survival in an orthotopic glioblastoma mouse model. Overall, this BLNP platform effectively delivers mRNA to brain cells such as neurons and astrocytes in broad brain regions, which may be applied to treat a range of CNS diseases.II. Definitions

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei- Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Any reference to standard methods refers to the most recent available version of the method at the time of filing of this disclosure unless otherwise indicated.

[0046] For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.81181968. v1 9Atorney Docket No. 770573: MTST-563PC1

[0047] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

[0048] The words "preferred" and "preferably" refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.

[0049] The term "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims. Such terms will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

[0050] By "consisting of' is meant including, and limited to, whatever follows the phrase "consisting of." Thus, the phrase "consisting of indicates that the listed elements are required or mandatory, and that no other elements may be present. By "consisting essentially of is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase "consisting essentially of indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present depending upon whether or not they materially affect the activity or action of the listed elements.

[0051] The singular form "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. These articles refer to one or to more than one (i.e., to at least one). As used herein, the term "or" is generally employed in its usual sense including "and / or" unless the content clearly dictates otherwise. The term "and / or" means any one or more of the items in the list joined by "and / or". As an example, "x and / or y" means any element of the three-element set {(x), (y), (x, y)}. In other words, "x and / or y" means "one or both of x and y". As another example, "x, y, and / or z" means any element of the seven-element set {(x), (y), (z), (x, y), (x, z), (y, z), (x, y, z)}. In other words, "x, y and / or z" means "one or more of x, y and z".

[0052] Where ranges are given, endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.). Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated81181968. v1 10Atorney Docket No. 770573: MTST-563PC1 ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. Herein, "up to" a number (for example, up to 50) includes the number (for example, 50). The term "in the range" or "within a range" (and similar statements) includes the endpoints of the stated range.

[0053] Reference throughout this specification to "one aspect,” "an aspect,” "certain aspects," or "some aspects," etc., means that a particular feature, configuration, composition, or characteristic described in connection with the aspect is included in at least one aspect of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily referring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more aspects.

[0054] Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." As used herein in connection with a measured quantity, the term "about" refers to that variation in the measured quantity as would be expected by the skilled artisan making the measurement and exercising a level of care commensurate with the objective of the measurement and the precision of the measuring equipment used. The term "about" as used in connection with a numerical value throughout the specification and the claims denotes an interval of accuracy, familiar and acceptable to a person skilled in the art. In general, such interval of accuracy is + / -10%. Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0055] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0056] The term "exemplary" means serving as a non-limiting example, instance, or illustration. As utilized herein, the terms "e.g.," and "for example" set off lists of one or more non-limiting aspects, examples, instances, or illustrations.81181968. v1 11Atorney Docket No. 770573: MTST-563PC1

[0057] As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. Biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term "substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena. For example, "substantially" may refer to being within at least about 20%, alternatively at least about 10%, alternatively at least about 5% of a characteristic or property of interest.

[0058] As used herein, “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post- translational modification of a polypeptide or protein.

[0059] As used herein, the term “identity” refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain aspects, the length of a sequence aligned for comparison purposes is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent.

[0060] Suitable software programs are available from various sources and for alignment of both protein and nucleotide sequences. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of programs available from the U.S. government's81181968. v1 12Atorney Docket No. 770573: MTST-563PC1National Center for Biotechnology Information BLAST website (blast.ncbi.nlm.nih.gov). B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI).

[0061]

[0036] Sequence alignments can be conducted using methods such as, but not limited to, MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), or MUSCLE.

[0062] Different regions within a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity.

[0063] As used herein, the term “zzz vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0064] As used herein, the term “zzz vivo" refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof).

[0065] As used herein, the term “isolated” refers to a substance or entity that has been separated from at least some of the components with which it was associated (whether in nature or in an experimental setting). Isolated substances (e.g., nucleotide sequence or protein sequence) can have varying levels of purity in reference to the substances from which they have been associated. Isolated substances and / or entities can be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some aspects, isolated agents are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is “pure” if it is substantially free of other components. The term “substantially isolated” means that the compound is substantially separated from the environment in which it was formed or detected. Partial separation can include, for example, a composition enriched in the compound of the present disclosure. Substantial separation can include compositions containing at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, or at least about 99% by weight of the compound of the present disclosure, or salt thereof.81181968. v1 13Atorney Docket No. 770573: MTST-563PC1

[0066] A polynucleotide, vector, polypeptide, cell, or any composition disclosed herein which is “isolated” is a polynucleotide, vector, polypeptide, cell, or composition which is in a form not found in nature. Isolated polynucleotides, vectors, polypeptides, or compositions include those that have been purified to the degree that they are no longer in a form in which they are found in nature. In some aspects, a polynucleotide, vector, polypeptide, or composition that is isolated is substantially pure.

[0067] Nucleotides are referred to by their commonly accepted single-leter codes. Unless otherwise indicated, nucleic acids are writen left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-leter symbols recommended by the IUPAC- IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, and U represents uracil.

[0068] As used herein, the term “messenger RNA” (mRNA) refers to any polynucleotide that encodes a polypeptide of interest and is capable of being translated to produce the encoded polypeptide in vitro, in vivo, in situ, or ex vivo.

[0069] As used herein, a “native” or “naturally occurring” polynucleotide sequence means a polynucleotide sequence existing in nature without artificial aid.

[0070] The terms “nucleic acid sequence,” “nucleotide sequence,” or “polynucleotide sequence” are used interchangeably and refer to a continuous nucleic acid sequence. The sequence can be either single stranded or double stranded DNA or RNA, e.g., an mRNA.

[0071] The term “nucleic acid,” in its broadest sense, includes any compound and / or substance that comprises a polymer of nucleotides. These polymers are often referred to as polynucleotides. Example nucleic acids or polynucleotides of the disclosure include, but are not limited to, ribonucleic acids (RNAs) or deoxyribonucleic acids (DNAs).

[0072] The phrase “nucleotide sequence encoding” refers to the nucleic acid (e.g., an mRNA or DNA molecule) coding sequence that encodes a polypeptide. As used herein, the terms “coding region” and “coding sequence”, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression, yields a polypeptide or protein. The coding sequence can further include initiation and termination signals operably linked to regulatory elements, including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence can further include sequences that encode signal peptides.81181968. v1 14Atorney Docket No. 770573: MTST-563PC1

[0073] As used herein, “open reading frame” or “ORF” refers to a sequence that does not contain a stop codon in a given reading frame.

[0074] As used herein, a “part” or “region” of a polynucleotide is defined as any portion of the polynucleotide that is less than the entire length of the polynucleotide. Likewise, a “part” or “region” of a polypeptide is defined as any portion of the polypeptide that is less than the entire length of the polynucleotide.

[0075] As used herein, “point mutation” refers to a genetic mutation in which a single nucleobase is substituted, inserted, or deleted from a polynucleotide sequence. The term “nucleobase substitution”, “substitution”, or “substitution mutation” as used herein refers to replacing a single nucleobase present in a reference polynucleotide sequence (e.g., a wild type or native sequence) with another nucleobase. Accordingly, a reference to a “substitution at position X” refers to the substitution of a nucleobase present at position X with an alternative nucleobase.

[0076] As used herein, “nucleobase insertion”, “insertion”, or “insertion mutation” refers to inserting a single nucleobase immediately adjacent to a nucleobase at a particular position of a reference polynucleotide sequence. As used herein, “nucleobase deletion”, “deletion”, or “deletion mutation” refers to deleting a single nucleobase immediately adj acent to a nucleobase at a particular position of a reference polynucleotide sequence.

[0077] The term “polynucleotide” as used herein refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). More particularly, the term “polynucleotide” includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids “PNAs”) and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. In particular aspects, the polynucleotide comprises an mRNA.81181968. v1 15Atorney Docket No. 770573: MTST-563PC1

[0078] The T bases in the codon maps disclosed herein are present in DNA, whereas the T bases may be replaced by U bases in corresponding RNAs. For example, a codon-nucleotide sequence disclosed herein in DNA form, e.g., a vector or an in vitro translation (IVT) template, may have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both codon- optimized DNA sequences (comprising T) and their corresponding RNA sequences (comprising U) are considered codon-optimized nucleotide sequences of the present disclosure. Equivalent codon-maps can be generated by replacing one or more bases with non-natural bases. Thus, e.g., a TTC codon (DNA map) may correspond to a UUC codon (RNA map), which in turn may correspond to a ‘P’C codon (RNA map in which U has been replaced with pseudouridine).

[0079] Standard A-T and G-C base pairs form under conditions that allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH2, respectively, of adenosine and between the C2-oxy, N3, and C4-NH2, of cytidine and the C2- NH2, N' — H and C6-oxy, respectively, of guanosine. Thus, for example, guanosine (2-amino- 6-oxy-9-3-D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9-3- D-ribofuranosyl-purine). Such modification results in a nucleoside base, which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (1-3-D- ribofuranosyl-2-oxy-4-amino-pyrimidine) to form isocytosine (l-3-D-ribofuranosyl-2-amino- 4-oxy-pyrimidine-) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine.

[0080] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine).

[0081] The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer, or tetramer. They can also comprise single81181968. v1 16Atorney Docket No. 770573: MTST-563PC1 chain or multichain polypeptides. Most commonly, disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some aspects, a “peptide” can be less than or equal to about 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.

[0082] The term “reference nucleic acid sequence”, “reference nucleic acid”, or “reference nucleotide sequence” or “reference sequence” refers to a starting nucleic acid sequence (e.g., a RNA, e.g., an mRNA sequence) that can be sequence optimized. In some aspects, the reference nucleic acid sequence is a wild type or native nucleic acid sequence, a fragment or a variant thereof.

[0083] As used herein, “sequence optimization” refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties. In the context of the present disclosure, sequence optimization refers to modifications in a nucleotide sequence of a 5’ UTR that result in improved translation of a downstream gene target when the 5’ UTR is incorporated into a suitable expression system.

[0084] As used herein, the term “similarity” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions.

[0085] As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. Biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena. For example, “substantially” may refer to being within at least about 20%, alternatively at least about 10%, alternatively at least about 5% of a characteristic or property of interest.

[0086] The term “synthetic” means produced, prepared, and / or manufactured by the hand of man. Synthesis of polynucleotides or other molecules of the present disclosure can be chemical or enzymatic.81181968. v1 17Atorney Docket No. 770573: MTST-563PC1

[0087] As used herein, the terms “termini” or “terminus,”, when referring to polypeptides, refers to an extremity of a peptide or polypeptide. Such extremity is not limited only to the first or final site of the peptide or polypeptide but can include additional amino acids in the terminal regions. The polypeptide based molecules of the disclosure can be characterized as having both an N-terminus (terminated by an amino acid with a free amino group (NH2)) and a C-terminus (terminated by an amino acid with a free carboxyl group (COOH)). Proteins of the disclosure are in some cases made up of multiple polypeptide chains brought together by disulfide bonds or by non-covalent forces (multimers, oligomers). These sorts of proteins will have multiple N- and C-termini. Alternatively, the termini of the polypeptides can be modified such that they begin or end, as the case can be, with a non-polypeptide-based moiety such as an organic conjugate.

[0088] As used herein, “transfection” refers to the introduction of a polynucleotide into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA). As used herein, “expression” of a nucleic acid sequence refers to the translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and / or post-translational modification of a polypeptide or protein.

[0089] As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the “unmodified” starting molecule for a subsequent modification.

[0090] As used herein “untranslated region” or “UTR” refer to regions located at the 5’ and 3’ ends of an mRNA construct that do not form a protein-coding region. The 5’ UTR is upstream from a coding sequence.

[0091] A "disease", as used herein, is a state of health of a subject wherein the subject cannot maintain homeostasis, and wherein if the disease is not ameliorated, the subject's health continues to deteriorate. In contrast, a "disorder" is a state of health in which the subject is able to maintain homeostasis, but in which the subject's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the subject's state of health. A disease or disorder is "alleviated" if the severity of a sign or symptom of the disease or disorder, the frequency with which such a sign or symptom is experienced by a subject, or both, is reduced.81181968. v1 18Atorney Docket No. 770573: MTST-563PC1

[0092] As used herein, the terms “subject”, “individual”, and “patient” are interchangeable, and relate to vertebrates, preferably mammals. For example, mammals in the context of the disclosure are humans, non-human primates, domesticated animals such as dogs, cats, sheep, cattle, goats, pigs, horses, etc., laboratory animals such as mice, rats, rabbits, guinea pigs, etc., as well as animals in captivity such as animals in zoos. The term "animal" as used herein includes humans. The term "subject" may also include a patient, i.e., an animal, having a disease. In exemplary aspects, a subject, individual, or patient refers to a human (e.g., a man, a woman, or a child).

[0093] The terms “treat”, “treating”, or “treatment” refer to administering to a subject a compound or pharmaceutical composition disclosed herein to partially or completely alleviate, inhibit, ameliorate, or relieve the disease or disorder from which the subject is suffering. This means any manner in which one or more of the symptoms of a disease or disorder are ameliorated or otherwise beneficially altered. As used herein, amelioration of the symptoms of a particular disease or disorder refers to any lessening, whether permanent or temporary, lasting or transient, that can be attributed to or associated with treatment by the compounds, compositions, and methods of the present disclosure. For example, treating a subject can mean eliminating or reducing the clinical signs of a disease or disorder in the subject; arrest, inhibit, or slow the progression of the disease or disorder in the subject; and / or decrease the number, frequency, or severity of clinical symptoms and / or recurrence of the disease or disorder in the subject who currently has or who previously had the disease or disorder. In particular, the terms “treatment of a disease” and “treating a disease” include curing, shortening in duration, ameliorating, slowing down, inhibiting progression or worsening, or delaying the onset of clinical symptoms in a subject who has the disease or disorder.

[0094] The terms “prophylactic”, “preventive”, “preventing”, and “prevention” refer to a decrease in the occurrence of a disease or disorder, or a decrease in the risk of acquiring a disease or its associated symptoms in a subject. The prevention can be complete, e.g., the total absence of the disease or disorder) or partial, e.g., the occurrence of the disease or disorder in a subject is less than, occurs later than, or develops more slowly than that which would have occurred without the disclosed compounds, compositions, and methods.

[0095] As used herein, the term “preventing a disease” in a subject means, for example, to stop the development of one or more clinical symptoms of a disease or disorder in a subject before they occur or are detectable. Preferably, the disease or disorder does not develop at all, i.e., no symptoms of the disease or disorder are detectable. In some aspects, it can also mean delaying or slowing of the development of one or more symptoms of the disease or disorder. Alternatively,81181968. v1 19Atorney Docket No. 770573: MTST-563PC1 or in addition, it can mean decreasing the severity of one or more subsequently developed symptoms.

[0096] The invention is defined in the claims. However, below is a non-exhaustive listing of nonlimiting exemplary aspects. Any one or more of the features of these aspects may be combined with any one or more features of another example, embodiment, or aspect described herein.III. BBB-crossing lipid nanoparticles and mRNA delivery in the brain

[0097] Messenger RNA (mRNA) has been explored for a variety of applications, such as vaccines, cancer immunotherapies, and protein replacement therapies. To realize these applications, lipid nanoparticles (LNPs) are emerging as a safe and effective delivery platform from bench to clinic. Notably, LNP-mRNA vaccines were rapidly developed and used against the COVID-19 pandemic in 2020. In general, many LNPs after systemic administration deliver mRNA to the liver. Recently, several approaches have been developed to deliver mRNA to other tissues, such as the pancreas, eye, lung, uterus, and testis. However, delivery of mRNA to the brain remains a formidable challenge due to the blood-brain barrier (BBB).

[0098] In essence, the BBB consists of pericytes, astrocytic processes, and a basement membrane which surround a monolayer of endothelial cells that constitute the brain’s vascular supply. This physiological barrier selectively blocks the passage of many small molecules, proteins, and mRNA into the brain. Previous studies report that several approaches can mediate the crossing of the BBB, including passive diffusion, adsorptive-mediated transcytosis, carrier- mediated transcytosis, and receptor-mediated transcytosis. For example, certain small lipophilic molecules can passively diffuse through the BBB. Through adsorptive-mediated transcytosis, cationic molecules or particles can interact with negatively charged cell surfaces, form transcytotic vesicles, fuse with the abluminal membrane of the BBB, and then deliver cargos into the brain. For carrier-mediated transcytosis, a solute carrier transporter such as glucose transporter 1 and large neutral amino acid transporter 1 can transport glucose or amino acids to the brain. In terms of receptor-mediated transcytosis, molecules can bind to a certain receptor, such as the transferrin receptor (TfR), low-density lipoprotein receptor, or insulin receptor, on the luminal membrane of the BBB and trigger an endocytotic process to form transcytotic vesicles, followed by trafficking to the brain.81181968. v1 20Atorney Docket No. 770573: MTST-563PC1

[0099] Based on the findings of these natural transportation pathways, researchers have explored many strategies to deliver various types of functional cargos to the brain. For example, Wang et al. conjugated glucose and glycoprotein peptides to silica nanoparticles for the delivery of genome editing components in the brain by retroorbital injection. Yang et al. fabricated mRNA-loaded exosomes with brain tumor-targeting peptides to treat orthotopic glioblastoma. Tylawsky et al. developed fucoidan-based nanoparticles to undergo caveolin-1 dependent transcytosis and cross the BBB. Okuyama et al. delivered lysosomal enzyme iduronate 2- sulfatase into the brain by installing an anti-human TfR antibody. Despite these significant advances, there is an urgent demand to effectively and safely deliver mRNA to brain cells, especially neurons.

[0100] Systemic mRNA delivery to the brain remains a formidable challenge in the field of biomaterials and RNA therapeutics. This challenge primarily stems from the BBB's stringent selective permeability, which strictly regulates the transportation of biomacromolecules such as mRNA. Moreover, the inherent instability of mRNA and its predisposition to enzymatic degradation further complicate the delivery issues. To tackle these barriers, considerable endeavors have been devoted to the conceptualization and development of innovative nanoparticle-based delivery systems, including inorganic nanoparticles, polymeric materials, and exosomes. These delivery systems are typically functionalized with BBB-targeting or - penetrating ligands on the particle surface to improve the delivery of mRNA molecules to the brain. In terms of LNPs for brain delivery, researchers investigated several strategies and accomplished the delivery of small molecules, siRNA, and proteins to the brain in multiple animal models. While there have been a few explorations of mRNA-loaded LNPs for systemic brain targeting, prior studies applied external forces to disrupt BBB integrity and facilitate mRNA delivery to the brain. For example, microbubble-assisted focused ultrasound (FUS) has been investigated for its potential to transiently compromise the BBB and enhance the efficiency of LNP -mediated mRNA delivery to the brain. Yet, in the absence of FUS, there was a reduction in delivery efficacy. Additionally, LNPs have been formulated with mannose- conjugated PEG lipids for targeted delivery of mRNA to cerebral ischemic regions in a mouse model of ischemic stroke. This formulation, however, showed limited efficacy in delivering mRNA to the brains of healthy mice, where the BBB is intact. Besides, these approaches require additional procedures and may increase the risk of adverse effects. Consequently, researchers need to design novel strategies to address the transportation challenges of the intact BBB and effectively deliver mRNA to brain in a safe and efficient manner.81181968. v1 21Atorney Docket No. 770573: MTST-563PC1

[0101] Specifically, prior studies have reported various types of small molecules with the capacity to cross the BBB. Inspired by their BBB -penetrating potential, the inventors designed and synthesized six classes of novel ionizable lipids, termed “BBB-crossing lipids”, which are derived from the small molecules including L-DOPA (LD), D-serine (DS), temozolomide (TM), tryptamine (TD), cinnamic acid (CD), and MK-0752 (MK). Delving into the structureactivity relationship of the formulated BLNPs, the inventors found that multiple core structures, positions of bio-responsive acetal groups in the lipid chain, as well as chain lengths would significantly affect in vivo mRNA brain delivery efficacy. Moreover, the molar ratios of the ionizable lipid in the formulation and its weight ratio towards mRNA should be carefully considered in formulation optimization. Ultimately, the inventors identified one optimal BLNP formulation, MK16, for effective systemic mRNA delivery to brain, which showed over 8-fold higher luminescence intensity than that of standard MC3 LNPs.

[0102] MK16 BLNPs can effectively deliver mRNA to various brain cells by intravenous inj ection. The inventors findings revealed that MK16 BLNPs mainly deliver mRNA to neurons, astrocytes, BCECs, and microglia, with relatively low to minimal delivery to oligodendrocytes and neural stem cells. The differential delivery preferences of MK16 BLNPs to distinct brain cell types could be attributed to the unique features of each cell type, affecting the efficiency of endocytosis and subsequent escape from endosomes for mRNA release. Additionally, each cell type may exhibit different intracellular immune responses to the exogenous mRNA, resulting in varying levels of protein expression. These variations in delivery preferences necessitate further examinations to fully understand the underlying mechanisms. Importantly, the mRNA delivery efficacy of MK16 BLNPs was found to be dose-dependent, providing an opportunity to finetune delivery outcomes by adjusting the dose. It is critical to understand the transcytosis mechanism for crossing the BBB. The inventors results indicated that the transcytosis of MK16 BLNPs is mediated by both the caveolae and y-secretase pathways. This finding suggests that the trafficking of MK16 BLNPs across the BBB involves complex interactions and pathways. Importantly, although y-secretase inhibitors have been extensively studied in multiple therapeutic applications, this is the first time, to the inventors knowledge, that y-secretase has been shown to facilitate nanomaterials crossing the BBB.

[0103] Despite incorporating MK-0752, a NOTCH inhibitor, as the head group, MK16 BLNPs do not dramatically modify the NOTCH signaling pathway post-administration as revealed genome-wide through an RNA-seq approach. Furthermore, the immunogenic responses elicited by MK16 BLNPs were found to be comparable to or milder than those81181968. v1 22Atorney Docket No. 770573: MTST-563PC1 induced by the clinically used MC3 LNPs at various post-injection time points. Importantly, MK16 BLNPs did not compromise hepatic or renal functions, and they did not cause detectable abnormalities in the brain or other major organs. This safety assessment underscores the tolerability of MK16 BLNPs for systemic delivery, and highlights their potential as a safe vehicle for effective mRNA delivery to the brain.

[0104] MK16 BLNPs exhibited the potent ability to deliver functional mRNAs, such as Cre recombinase mRNA, to different brain regions, including the hippocampus, thalamus and cerebral cortex. This resulted in the genetic expression of tdTomato signals in neurons and astrocytes across several brain regions of Ail4 transgenic mice. Moreover, triple injections of MK16 BLNPs substantially increased mRNA delivery efficacy in neurons, astrocytes, BCECs, and microglia compared to the one-injection group. Notably, MK16 BLNPs are well-tolerated across repeated administrations, underscoring their safety for multiple doses, which may be crucial for reaching therapeutic levels in the brain. More importantly, systemic administration of AFosb mRNA via MK16 BLNPs successfully targeted AFOSB expression in the NAc and enhanced drug- seeking behaviors in conditioned mice. This is an especially dramatic finding, since the efficacy of the MK16 BLNP approach in regulating cocaine responses roughly matches what has been observed previously upon directly targeting of AFOSB overexpression to NAc neurons in inducible transgenic mice and by direct intra-NAc injections of viral vectors. Moreover, the inventors show that MK 16 BLNPs can efficiently deliver AFosb mRNA to adult human cortical tissues ex vivo and induce considerable AFOSB expression in neurons, astrocytes, and microglia, which further highlights the potential of MK16 BLNPs for gene regulation in brain disorders. Finally, MK16 BLNP- tew mRNA treatment demonstrates potent efficacy in reducing the tumor burden in an orthotopic GBM mouse model with superior therapeutic outcomes compared to the treatment of MC3 LNP-P / c / / mRNA. This treatment significantly increased the survival rates of the tumor-bearing mice compared to those treated with PBS or MK16 BLNP-control mRNA

[0105] In this work, the inventors conceived the BLNP platform, an LNP -mediated mRNA delivery strategy to cross the BBB after intravenous injection. More importantly, this is achieved through the chemical engineering of BBB- crossing molecules with ionizable lipids, which are integrated directly into the existing LNP -mRNA formulation approach. These BLNPs require no surface functionalization and BBB disruption to enable BBB crossing. The BBB-crossing molecules, which serve as the core structure in the BL lipids, would interact81181968. v1 23Atorney Docket No. 770573: MTST-563PC1 with the receptors or transporters on the endothelial cell layer of the BBB, thereby facilitating efficient transcytosis.

[0106] To achieve mRNA delivery in the brain, new strategies need to be conceived. Previously, researchers reported that certain small molecule ligands can cross the BBB through diverse pathways. Specifically, L- DOPA can be recognized by the large neutral amino acids transporter 1 (LAT1) on endothelial cells and be transported across the BBB for the treatment of Parkinson's disease. D-serine serves as a neuromodulator and crosses the BBB by amino acid transporter solute carrier family 6 member 14 (SLC6A14). Temozolomide is an alkylating lipophilic agent that crosses the BBB to treat glioblastoma. Tryptamine derivatives are neurotransmiter precursors that cross the BBB by active transport via Mg2+ and ATP- dependent uptake. Cinnamic derivatives can cross the BBB and insert into the beta-sheet of amyloid Af3 proteins. MK-0752 reduces the generation of Af3s after crossing the BBB in vivo. Based on these important findings, the inventors designed and synthesized six classes of BBB- crossing lipids by conjugating these molecules with various amino lipids. The inventors hypothesize that these BBB-crossing lipids can facilitate formulations of BLNP-mRNA that cross the BBB and efficiently deliver mRNA to the CNS (FIG. 1A).

[0107] To test this concept, the inventors first synthesized these BBB-crossing lipids with building-block approaches, which employed BBB-crossing heads, amino cores, and various lipid tails (FIG. IB - FIG. ID). Bearing diverse synthetic lipid structures, these BBB-crossing lipid nanoparticles (BLNPs) provide a novel strategy for mRNA delivery to the brain. After in vitro and in vivo evaluations, the inventors identified that MK6 BLNPs were able to cross the BBB after intravenous injection. Compared to DLin-MC3 -DMA (MC3) LNPs, an FDA-approved lipid formulation, the optimized MK16 BLNPs showed over 8-fold higher luminescence intensity in brain after intravenous injection. Moreover, delivery of GFP mRNA using MK16 BLNPs resulted in obvious GFP expression in neurons (7.3%) and astrocytes (9.7%). Meanwhile, triple injections of MK16-Cre recombinase mRNA BLNPs induced dramatic tdTomato signals in 16.7% of neurons and 19.2% of astrocytes of the whole brain in Ai 14 mice containing a Cre- dependent tdTomato gene. Furthermore, MK16 BLNPs efficiently deliver AFosb mRNA to the nucleus accumbens (NAc), a key reward region located deep in the forebrain, and substantially modulate the drug-seeking behaviors of mice in a cocaine conditioned place preference (CPP) model. Notably, MK16 BLNPs can efficiently deliver AFosb mRNA to human brain samples ex vivo.81181968. v1 24Atorney Docket No. 770573: MTST-563PC1

[0108] Meanwhile, systemic delivery of Pten mRNA using MK16 BLNPs efficiently restores the tumor-suppressor function in an orthotopically implanted glioblastoma (GBM) mouse model, leading to decreased tumor growth and enhanced survival in mice. Additionally, MK16 BLNPs are well-tolerated with comparable biocompatibility as MC3 LNPs at multiple time intervals after intravenous injections. This new class of BLNP-mRNA formulations thus provides new insights for the development of novel biomaterials to overcome the BBB for brain delivery.

[0109] Synthesis and characterizations of BLNPs for systemic mRNA delivery to brain

[0110] Inspired by the structures and functions of small molecular ligands that can cross the BBB, the inventors designed six classes of BBB -crossing lipids (BLs, FIG. IB, 1C) including L-DOPA derived lipids (LD), D-serine derived lipids (DS), temozolomide derived lipids (TM), tryptamine derived lipids (TD), cinnamic acid derived lipids (CD), and MK-0752 derived lipids (MK). These BLs consist of various amino groups and lipid chains. The inventors incorporated diverse functional groups in the chains such as ester, carbonate, and acetal. Based on the unique structures of these BLs, the inventors conceived synthetic routes for individual lipids. FIG. 1C shows the representative synthesis of DS 11 and MK6. For example, D-serine was first protected by Fmoc to give Fmoc-D-serine, Then, Fmoc-D-serine was coupled to Boc-protected di ethylenetriamine, followed by deprotection of Boc to obtain compound 1. Finally, compound 1 underwent reductive amination with lipid aldehydes and subsequent deprotection to afford DS11. Through a separate synthetic pathway, Boc- protected hexamethylenediamine was condensed with MK-0752 using O-(3,4-Dihydro-4-oxo- 1,2, 3 -benzotriazin-3 -yl) -N,N,N',N'- tetramethyluronium tetrafluoroborate as the condensing agent, subsequent deprotection of Boc to give compound 2. Lastly, a reductive amination reaction between compound 2 and an aldehyde produced MK6. All compounds were purified by flash chromatography and validated by 1H NMR and mass spectrometry.[OHl] Next, the inventors formulated each BBB-crossing lipid with mRNA encoding firefly luciferase (FLuc) to generate BBB- crossing lipid nanoparticles (BLNPs), and studied their physicochemical properties. The particle sizes of BLNPs ranged from 97.5 ± 1.2 nm to 191.3 ± 1.9 nm with a poly dispersity index (PDI)<0.3. They are positively charged and obtained mRNA encapsulation efficiency ranging from 64.4 ± 4.6% to 89.8 ± 1.9%. Then, the inventors evaluated their mRNA delivery efficiency in Neuro-2a (N2a), a mouse neuroblastoma cell line, and bEND.3, a mouse brain endothelial cell line. A series of BLNPs showed over 5-fold greater81181968. v1 25Atorney Docket No. 770573: MTST-563PC1 mRNA delivery efficiency than MC3 LNPs in N2a cells (FIGs. 2A-2F). Particularly, CD6, TD5, TD8, and MK6 BLNPs showed over 10-fold higher luminescence intensity than MC3 LNPs. Notably, these lead BLNPs also exhibited high mRNA delivery efficiency in bEND.3 cells, a mouse brain endothelial cell line. Meanwhile, these BLNPs displayed low to minimal toxicity in both N2a and bEND.3 cell lines at the tested dose (80% or higher cell viability in all treated groups). Additionally, the inventors measured BLNPs apparent pKa, an important parameter of LNP. Their apparent pKa ranged from 6.23 to 7.67. The inventors further analyzed the structureactivity relationships of these BLNPs based on the data from the N2a cells. For example, L- DOPA derived lipids (LD) with two hydrocarbon tails possessed better delivery efficacy than LD lipids with three tails and four tails. Specifically, LD10 BLNPs bearing two tails with carbonate ester were most effective in mRNA delivery, which was 4.7-fold greater than MC3 LNPs. Similarly, among D-serine derived lipids (DS), DS 11 BLNPs, equipped with carbonate ester tails, showed 6.9-fold higher luminescence intensity than MC3 LNPs. In the series of CD lipids, CD6 with three acetal tails showed 14.4-fold higher luminescence intensity compared to MC3 LNPs. In contrast, the luminescence intensity in the TMZ-derived lipids was relatively low. In the case of TD lipids, the length of the hydrocarbons greatly affected the delivery efficiency of mRNA. TD5, installed with myristic hydrocarbon tails, exhibited better delivery efficiency than those with palmitic and lauric tails. TD8 with three acetal tails showed 13.4-fold higher luminescence intensity than MC3 LNPs. For the MK lipid series, 14.6-fold higher luminescence intensity was observed for MK6 with acetal tails compared to MC3. These results suggest that both the length and functional groups in the lipid tails can greatly affect in vitro mRNA delivery efficiency. Generally, acetal and carbonate ester in lipid tails tested in this work improve the mRNA delivery of BLNPs.

[0112] Based on these in vitro results, 12 lead BLNPs were selected for further in vivo evaluation. These 12 BLNPs showed highest luciferase activity among all the BLNPs tested in both N2a cells and b.END3 cells. The inventors formulated these BLNPs with FLuc mRNA and injected them intravenously into mice at the mRNA dose of 0.5 mg / kg via tail vein. Among all the BLNPs tested, MK6 BLNPs induced the highest luminescence intensity in brain tissue 6h after administration, which was significantly better than MC3 LNPs (FIG. 2G and 2H). Both MK6 BLNPs and MC3 LNPs showed similar signal intensity in other major organs (FIG. 21). The inventors did not observe a correlation between particle size and biodistribution. Meanwhile, the inventors characterized the particle properties of MK6 BLNPs using several well-established methods. MK6 BLNPs were around 139.8 ± 3.5 nm in diameter with a81181968. v1 26Atorney Docket No. 770573: MTST-563PC1 poly dispersity index (PDI) < 0.15 (Supplementary Fig. 5c). Approximately, 83.1 ± 2.7% of mRNA was encapsulated in MK6 BLNPs, and they were slightly positively charged.

[0113] Optimization of BLNPs for mRNA delivery to brain

[0114] To further improve the brain delivery efficiency of BLNPs through systemic administration, the inventors conducted several rounds of experiments to optimize MK6 BLNP formulations. In the inventors prior studies, the inventors found that the increase of ionizable lipid molar ratio in the LNP formulation can augment mRNA delivery. Therefore, the inventors increased the molar ratios of MK6 in the formulation, ranging from 20 to 60, while keeping other parameters constant. As the molar ratios of MK6 increased, the inventors observed MK6B BLNPs (a molar ratio of MK6 / DOPE / cholesterol / DMG-PEG2k = 60:30:40:0.75) with a slight improvement in luminescence intensity in brain (i.v., tail vein injection; mRNA dose: 0.5 mg / kg; FIG. 3A). This specific molar ratio was selected for subsequent optimization rounds. Next, by adjusting the weight ratios between MK6 and mRNA, the inventors found that MK6E BLNPs with a weight ratio of MK6 / mRNA = 12.5 / 1 showed a 2.2-fold increase in brain luminescence intensity compared to the original MK6 BLNPs. However, continuous increases in MK6 / mRNA = 15 / 1 weight ratio resulted in a decrease in luminescence intensity (FIG. 3A and FIG. 3B). Thus, this formulation composition - BL / DOPE / cholesterol / DMG-PEG2k = 60:30:40:0.75; BL / mRNA = 12.5 / 1 - was chosen for the following studies.

[0115] In addition to tuning formulation ratios, the inventors modified the chemical structure of MK6 by adjusting the length of carbons and the position of acetal groups in lipid tails, which led to the synthesis of MK13-MK16 BLs (FIG. 3C). These MK BLNPs exhibited similar particle size, encapsulation efficiency, and zeta potential. They also presented similar apparent pKa values, with a narrow range from 6.70 to 6.99. Among this series of MK BLNPs, MK16 BLNPs showed the highest in vivo luminescence intensity in mouse brain (i.v., tail vein injection; mRNA dose: 0.5 mg / kg), which was 1.7-fold higher than MK6E BLNPs and 8-fold greater than MC3 LNPs (FIG. 3D and 3E). These results suggest that the alkyl chain length surrounding the acetal group greatly affected the mRNA delivery efficiency of MK BLNPs to brain. Moreover, MK6, MK6E, and MK16 displayed comparable distribution trends in other major organs. Similar to cellular studies, there is no obvious correlation between the physicochemical properties and in vivo delivery efficiency of the MK BLNP series (FIGs. 3A- 3E). Additionally, MK16 BLNPs showed 7.4-fold and 6.5-fold higher luminescence intensity than ALC-0315 and SM-102 LNPs in brains after intravenous administration, respectively.81181968. v1 27Atorney Docket No. 770573: MTST-563PC1Based on the above results, the inventors selected MK16 BLNPs for detailed characterizations. The MK16 BLNPs exhibited a particle size of 137.0 ± 4.1 nm and an mRNA encapsulation efficiency of approximately 84.8 ± 1.5%. The particles were positively charged and displayed spherical morphology in Cryo-TEM images. Additionally, MK16 BLNPs showed potent mRNA delivery efficiency in both b.END3 cells and N2a cells with negligible cytotoxicity at the tested dose.

[0116] To assess the kinetics of MK16 BLNPs delivery to brain, the inventors measured the fluorescent intensity of MK16 BLNPs loaded with an Alexa Fluor 647-labeled RNA at different time points following a single intravenous injection (tail vein; RNA dose: 0.5 mg / kg). Significant levels of fluorescent signals were observed in brain at the time points of 1 and 6h, with no detectable signals at and after the 18h time point. Moreover, the inventors calculated the doses ending up in major organs based on fluorescence percentage after an intravenous injection of MK16-Alexa 647 RNA BLNPs. Using this method, the inventors observed nearly 56.6 ± 2.5% of the MK16 BLNPs in liver, 6.5 ± 1.1% in spleen, 7.4 ± 0.8% in kidney, 10.5 ± 1.0% in lung, and 3.7 ± 1.4% in heart). Notably, there was 15.3 ± 0.4% of the MK16 BLNPs in brain.

[0117] To examine MK16 BLNPs for mRNA delivery in different types of brain cells in vivo, the inventors formulated MK16 BLNPs with GFP mRNA and performed a single intravenous injection of the formulation in mice (tail vein; RNA dose: 0.5 mg / kg). Then, the inventors quantified the cellular distribution through flow cytometry analysis of brain tissues 12h after administration. MK16 BLNPs preferentially delivered GFP mRNA to neurons (4.6 ± 1.0% GFP+), astrocytes (6.6 ± 0.6% GFP+), and brain capillary endothelial cells (BCECs, 5.6 ± 0.8% GFP+) at an mRNA dose of 0.5 mg / kg, the efficiency of which is notably superior to those achieved by MC3 LNPs in the corresponding cell types (FIG. 3F and FIG. 3G). Additionally, a small proportion of microglia (1.7 ± 0.2% GFP+) also exhibited GFP expression. In contrast, oligodendrocytes and neural stem cells showed negligible GFP expression. Furthermore, increasing the dose of GFP mRNA to 1 mg / kg led to enhanced GFP expression in neurons (7.3 ± 0.8%), astrocytes (9.7 ± 0.7%), BCECs (9.2 ± 1.0%), and microglia (2.8 ± 0.5%), suggesting the mRNA delivery efficiency of MK16 BLNPs to brain cells is dose-dependent (FIG. 3F and FIG. 3G).

[0118] Mechanisms of MK16 BLNPs transportation across the BBB81181968. v1 28Atorney Docket No. 770573: MTST-563PC1

[0119] To explore possible mechanisms of BBB transportation by MK16 BLNPs, the inventors constructed a transwell migration assay consisting of bEnd.3 cells to mimic the BBB using the method reported before, In this model, MK16 BLNPs encapsulated with Alexa-647 labeled RNA exhibited dramatically higher fluorescence intensity in the lower compartment than the groups of PBS and MC3 LNPs, respectively. When cells were pre-incubated with methylbeta- cyclodextrin (MpCD, a caveolae-mediated endocytic inhibitor), a 43.3 ± 1.7% decrease in transcytosis efficiency was observe). However, treatment with chlorpromazine (CPZ, a clathrin- mediated endocytic inhibitor) and 5-(N-ethyl-N-isopropyl)-amiloride (EIPA, a micropinocytosis- mediated endocytic inhibitor) did not significantly reduce the transcytosis efficiency of MK16 BLNPs. Furthermore, pre-treatment with MK-0752, the small molecule incorporated as the BBB crossing molecule in MK lipids, resulted in a 63.8 ± 3.1% decrease in the transcytosis efficiency of MK16 BLNPs, indicating that MK-0752 competitively inhibited the transcytosis of MK16 BLNPs. This finding suggested that MK 16 BLNPs may partially utilize the transportation mechanism employed by MK- 0752 molecules. Since MK-0752 is an y- secretase inhibitor (GSI), the inventors speculated that y-secretase may facilitate the transcytosis of MK16 BLNPs through bEND.3 cells. Therefore, the inventors added nirogacestat (NGST), an FDA-approved y-secretase inhibitor, to the transwell assay and also seeded N2a cells in the lower compartment to examine whether MK 16 BLNPs could cross the endothelial cell layer and then deliver FLuc mRNA to the N2a cells after transcytosis. Co-incubation with M3CD or NGST sharply diminished the luminescence intensity in both bEND.3 cells in the upper compartment and N2a cells in the lower compartment, compared to the groups treated only by MK16 BLNPs (FIG. 3H and FIG. 31). These results indicate that MK16 BLNPs can cross endothelial cells by both caveolae- and y- secretase-mediated transcytosis. To further validate the mechanism in vivo, the inventors pre-treated mice with either M3CD or NGST before intravenous administrations of MK 16 BLNPs loaded with an Alexa Fluor 647-labeled RNA (tail vein; RNA dose: 0.5 mg / kg). As shown in FIG. 3J and FIG. 3K, both M3CD and NGST resulted in a significant decrease in fluorescence intensity in the brains of pre-treated mice when compared to those receiving only MK16 BLNPs, suggesting a substantial reduction in the passage of MK16 BLNPs across the BBB. These findings demonstrate that caveolae and y- secretase are critical mediators in facilitating the BBB crossing of MK16 BLNPs.

[0120] Delivery applicability and safety studies of MK16 BLNPs81181968. v1 29Atorney Docket No. 770573: MTST-563PC1

[0121] The inventors next investigated MK16 BLNPs for functional mRNA delivery in an Ail 4 mouse model. This mouse line is genetically engineered with a LoxP flanked stop cassette that prevents tdTomato expression in vivo at baseline, but induction of tdTomato in the presence of Cre recombinase. This is depicted in FIG. 4A. In this experiment, the inventors evaluated Cre recombinase mRNA-mediated editing by intravenously administering MK16 BLNPs to Ail4 mice (tail vein; mRNA dose: 1.0 mg / kg). In PBS-treated mice, tdTomato expression was undetectable 5 days after administration, but upon MK16 BLNP delivery of Cre mRNA, a tdTomato signal was observed throughout most regions of the brain, with the strongest signal detected in brain borders (FIG. 4B). These areas are adjacent to the meninges, which consist of abundant blood vessels. In contrast, MC3 LNPs resulted in a negligible tdTomato signal, indicating a markedly lower efficiency in delivering Cre mRNA throughout the brain. Importantly, obvious tdTomato signal was observed in the hippocampus, thalamus, and cerebral cortex of the brains from Ail4 mice treated with MK16 BLNP-Cre mRNA (FIG. 4C-E). The expression levels of tdTomato-positive cells were comparable in these three brain regions. Specifically, in the hippocampus, tdTomato-positive neurons in the MK16 BLNP group accounted for 6.0 ± 1.5% of the total, while in the thalamus and cortex the proportions were 5.9 ± 0.4% and 6.7 ± 1.1%, respectively (FIG. 4F-H). Astrocytes with tdTomato signal represented 8.4 ± 1.9% in the hippocampus, 8.5 ± 1.5% in thalamus, and 8.7 ± 2.1% in cortex (FIG. 4F-H). In the MC3 LNP group, the neurons and astrocytes displaying the tdTomato signal within the hippocampus, thalamus, and cerebral cortex regions were observed at approximately 1% (FIG. 4F-H) .To study whether multiple injections of MK16 BLNP-Cre mRNA could enhance gene editing in Ail4 mice, the inventors compared tdTomato expression levels across various brain cell types from the mice receiving single or triple injections of MK16 BLNPs (z.v., tail vein; mRNA dose: 1.0 mg / kg). The results showed that triple injections of MK16 BLNPs resulted in approximately 2-fold higher tdTomato expression in neurons, astrocytes, BCECs, and microglia than those in the single injection group (FIG. 41). Specifically, the tdTomato expression level of these brain cells after three injections was quantified as 16.7 ± 2.2% in neurons, 19.2 ± 3.0% in astrocytes, 17.9 ± 1.6% in BCECs, and 4.5 ± 0.9% in microglia, respectively. Moreover, the tdTomato signals in these brain cells induced by MK16 BLNPs were significantly higher than MC3 LNPs in both single and triple injection groups. Together, these results underscore the potential of MK16 BLNPs as promising mRNA carriers to cross the BBB, deliver multiple types of mRNA to essential brain cells, especially neurons and astrocytes, and induce robust expression of functional proteins across broad regions of the brain.81181968. v1 30Atorney Docket No. 770573: MTST-563PC1

[0122] Next, the inventors conducted a series of experiments to understand the safety profile of MK16 BLNPs. Since MK- 0752, a starting material for chemical synthesis of MK16, is a potent NOTCH inhibitor, the inventors investigated whether MK16 BLNPs might regulate NOTCH pathways in various organs. In this work, the inventors applied an RNA-sequencing (RNA-seq) assay to profile the expression level of NOTCH-related mRNA transcripts in the brain, liver, and spleen. As is shown in FIG. 5A, mice treated with MK16 BLNPs displayed expression levels of most NOTCH genes that were similar to those in the PBS-treated group (z.v., tail vein; mRNA dose: mg / kg). By contrast, mice administrated with MK-0752 based on protocols from clinical trials exhibited substantial alterations in certain key NOTCH-related transcripts. Specifically, MK-0752 reduced the expression of hairy and enhancer of split- 1 (HesF) and Hes5 in the brain, as well as Hesl and NOTCH regulated ankyrin repeat protein (Nrarp) in the liver (FIG. 5A). In the spleen, it also down-regulated Notch3, Notch4, Jagl, Jag2 and Heyl.

[0123] To further study the potential toxicity and cytokine profiles of MK16 BLNPs, the inventors collected plasma samples from the treated mice at intervals of 6, 24, and 48 hours post-administration for comprehensive blood biochemical analysis (z.v., tail vein; mRNA dose: 1.0 mg / kg). The pro-inflammatory cytokine and chemokine profiles elicited by MK16 BLNPs were comparable to or milder than those induced by MC3 LNPs at the same mRNA dose (FIG. 5B). Particularly, certain cytokine levels were increased by both MK16 and MC3 LNPs 6 hours following administration. However, MK16 BLNPs induced lower levels of critical inflammatory biomarkers, such as IL-la, IL-ip, IL-6, TNFa, INFy, G-CSF, CCL2, CCL5, and CXCL9 (FIGs. 5B-5C). The levels of most biomarkers in both groups reverted to baseline, as established by the PBS control, at 24 and 48 hours after injection (FIG. 5B-C). To assess the effects of MK16 BLNPs on liver and kidney function, plasma samples were also analyzed for key biomarkers indicative of metabolic and excretory processes. The levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and blood urea nitrogen (BUN) remained within the normal range, suggesting that hepatic and renal functions were not adversely affected by administration of MK16 BLNPs (FIG. 5D). Furthermore, thorough histopathological evaluations of harvested tissues including the brain, heart, liver, lung, spleen, and kidney at various time intervals revealed no notable pathological alterations (FIG. 5E). Finally, blood biochemical analysis and histopathological evaluations of major organs of the Ail4 mice revealed that multiple injections of MK16 BLNPs did not elicit obvious systemic toxicity. These results highlight the biocompatibility and safety of MK16 BLNPs.81181968. v1 31Atorney Docket No. 770573: MTST-563PC1

[0124] Demonstration ofMK16 BLNP efficacy in a cocaine exposure model

[0125] After the validation of delivery efficiency and tolerability of MK16 BLNPs, the inventors probed their ability to deliver a functional mRNA in a disease model. AFOSB is a pivotal transcription factor involved in the regulation of addictive behaviors and the neuropathology of drug dependence. Given that the major clinical problem in addiction is a reward deficit, it has long been proposed that enhancing AFOSB could be a viable approach to treat drug addiction by making subthreshold, non-reinforcing doses of cocaine more reinforcing, potentially reducing the risks of overdose. Therefore, the inventors formulated MK16 BLNPs with mRNA encoding AFOSB (AFosb mRNA) and tested this formulation in a cocaine CPP model, which provides an indirect measure of drug reward, to assess the effects of AFOSB overexpression in modulating an animal’s ability to form drug-context associations. The inventors first studied whether MK16 BLNPs could deliver AFosb mRNA to the nucleus accumbens (NAc), a key brain reward region where AFOSB is known to exert its most prominent effects.59, 60 Systemic delivery of AFosb mRNA using MK16 BLNPs resulted in strong expression of AFOSB protein within the NAc 24h after injection (z.v., tail vein; mRNA dose: 1.0 mg / kg; FIG. 6A). In contrast, negligible AFOSB signals were observed in PBS- treated mice. The observed differential expression highlights the capacity of MK16 BLNPs to deliver functional mRNA to deep regions of the forebrain.

[0126] Once the inventors observed reliable production of AFOSB driven by MK16 BLNPs in the NAc, the inventors tested its effects in the cocaine CPP model (FIG. 6B). Briefly, animals first underwent a pretest during which the baseline preferences of wild-type (WT) naive mice were established. During the pre-test, animals freely explored a CPP chamber consisting of two distinct compartments (stripe walls with small mesh floor and dark walls with large mesh floors). Animals were then counterbalanced for drug or saline conditioning to adjust for small chamber biases across groups. During two consecutive conditioning days, mice received one daily intraperitoneal (i.pA injection of saline in the morning, and were confined to one chamber for 30 min. In the afternoon, mice received an intraperitoneal (z. .) injection of a subthreshold dose of cocaine and were confined to the opposite side of the chamber. Two doses of MK16 BLNP- AFosb mRNA were intravenously administrated to the mice after each conditioning day (z. v. , tail vein; mRNA dose: 1.0 mg / kg). On day 4, during the post-test phase, the mice were given free access to both compartments and their time spent in each compartment was recorded as a measure of preference for the drug-paired side. As expected, the subthreshold dose of cocaine did not induce CPP in control PBS-treated animals (FIG. 6C). Importantly, mice receiving MK1681181968. v1 32Atorney Docket No. 770573: MTST-563PC1BLNP -AFosb mRNA exhibited a significant preference for the cocaine-associated compartment as compared to the pre-test (FIG. 6C). This increase in preference indicates augmented drugseeking behavior in the MK16 BLNP -AFosb treated mice, which is consistent with previous work that overexpressed AFOSB selectively in NAc neurons either in inducible transgenic mice or by viral-mediated gene transfer.

[0127] Therapeutic efficacy of MK16 BLNP in an orthotopic mouse model of glioblastoma

[0128] Glioblastoma (GBM) represents the most aggressive and lethal form of primary brain tumor.63 Due to its rapid progression and poor prognosis, identifying effective therapeutic targets is crucial. A tumor suppressor gene, like phosphatase and tensin homologue (PTEN), is commonly mutated in wide ranges of GBM, which may be a great candidate for therapeutic intervention.36, 64 To investigate the clinical potential ofMK16 BLNP in treating PTEN-mutated GBM, the inventors formulated MK16 BLNP with Pten mRNA and intravenously administered this formulation to tumor-bearing immunodeficient mice in an orthotopic model of human U- 118MG GBM (z.v., tail vein; mRNA dose: 1.0 mg / kg; FIG. 7A). The inventors first investigated the expression of PTEN after the treatment of MK16 BLNP-Ptezz mRNA in the orthotopic GBM tumor model. Immunofluorescence staining of brain sections containing GBM demonstrated greater accumulation of MK16 BLNP-Ptezz mRNA within the tumor region rather than adjacent normal tissue. Moreover, MK16 BLNP-Ptezz mRNA significantly inhibited tumor growth and prolonged survival in tumor-bearing mice compared to the PBS and MK16 BLNP-control mRNA (mCherry mRNA) groups (FIG. 7B-D). Notably, 70% of the mice treated with MK16 BLNP- Pten mRNA survived over 120 days in the orthotopic GBM model. Histological analysis revealed that mice treated with MK16 BLNP-Ptezz mRNA exhibited smaller residual tumors than both PBS group and MK16 BLNP-control mRNA group. Additionally, mice treated with MK16 BLNP- Pten mRNA showed significantly reduced tumor growth and enhanced survival rates compared to those receiving MC3 LNP-Ptezz mRNA (z.v., tail vein; mRNA dose: 1.0 mg / kg;). These results demonstrate that systemic delivery of MK16 BLNP-Pfezz mRNA is a promising strategy for effective GBM treatment. Together, the impressive effects of MK16 BLNP in both the cocaine action and GBM model establishes its potential as a powerful delivery platform for studying and treating various brain disorders.

[0129] IV. Administration of BBB-crossing lipid nanoparticles81181968. v1 33Atorney Docket No. 770573: MTST-563PC1

[0130] Intrathecal injection is a clinically used administration route. This method has also been examined for delivering mRNA via LNPs to the dorsal root ganglia. Although intrathecal injection enables the delivery of LNPs to the CNS with lower mRNA doses and comparable efficacy, this administration approach is technically more complex and invasive, with risk of severe side effects like meningitis. Intravenous injection of BLNPs to target the brain is less invasive and far more clinically feasible for delivering therapeutic agents to the brain. However, this route necessitates that the BLNPs possess excellent stability in the bloodstream and excellent biocompatibility to minimize potential side effects. Most importantly, the BLNPs must actively interact with the BBB to facilitate efficient transcytosis and subsequently release mRNA to various brain cells. The design of the inventors MK16 BLNPs expedites effective and well- tolerated mRNA delivery to the brain through repeated systemic administrations. Systemic administration of MK16 BLNPs resulted in certain levels of accumulation in the liver and spleen, but no significant organ toxicity was observed at the doses tested. One approach to reduce translation in non-target cells, such as hepatocytes and splenocytes, is to incorporate miRNA targeting sequences into the untranslated regions (UTR) of the mRNA molecules. For future Investigational New Drug (IND) application, it is crucial to conduct a toxicology study based on the guideline of the Food and Drug Administration (FDA), which provides a better understanding of the safety profile of MK16 BLNPs. For example, dose escalation studies and repeat administrations are essential to uncover the maximum tolerated dose (MTD) and potential long-term adverse effects. Additionally, specific mRNA cargos need to be carefully designed and thoroughly examined to ensure precise targeting and efficacy in the treatment of the diverse pathophysiological mechanisms underlying various brain disorders.V. mRNA delivery of glutamate receptor genes

[0131] Messenger RNA (mRNA) has been explored for a variety of applications, such as vaccines, cancer immunotherapies, and protein replacement therapies. To realize these applications, lipid nanoparticles (LNPs) are emerging as a safe and effective delivery platform from bench to clinic. Notably, LNP-mRNA vaccines were rapidly developed and used against the COVID-19 pandemic in 2020.

[0132] GRIN2A is a gene located in chromosome 16 that encodes the 2 A subunit of the NMDA- type glutamate receptor (NMDAR). It is one of only two genes that have been linked to SCZ through both rare and common risk alleles. The other such gene is SP4, a transcription factor that regulates GRIN2A expression. The rare GRIN2A SCZ risk alleles are protein-truncating, suggesting downregulation of NMDAR is the risk-increasing mechanism. Pharmacological81181968. v1 34Atorney Docket No. 770573: MTST-563PC1 studies in humans support this notion, as the NMD AR antagonists phencyclidine and ketamine are psychotomimetic in healthy subjects. Yet more support for NMD AR downregulation as psychosis-inducing in humans comes from clinical immunology, where autoantibodies against NMD AR subunits (including the 2A subunit) downregulate NMD AR activity and cause a SCZ- like syndrome. In rodent models of NMD A receptor hypofunction, restoring NMDA receptor activity rescues SCZ-like phenotypes. Taken together, these diverse lines of evidence support the hypothesis that upregulation of GRIN2A will have therapeutic benefit in SCZ. As there are no known agonists specific to the NMD AR 2A subunit, to date this hypothesis has not been tested.

[0133] GRIA3 is a gene on the X chromosome that codes for the glutamate AMPA receptor (AMP AR) subunit GluA3. AMPARs are ionotropic glutamate receptors involved in many aspects of excitatory neurotransmission. Direct evidence implicating AMPARs in SCZ pathogenesis is the recent discovery in the Schizophrenia Exome Meta-analysis (SCHEMA) that GRIA3 (which codes GluA3) is an SCZ risk gene. The inventors have identified a rare protein-truncating variant (PTV) in GRIA3 that is causal of SCZ across three generations of a family.

[0134] Genome-wide association studies involving patients with SCZ and healthy controls identified GRIN2A and GRIA3 as SCZ risk genes. GRIN2A is a subunit of the NMDA receptor, and GRIA3 is part of the AMPA receptor. Supplementing GRIN2A or GRIA3 could offer potential therapeutic benefits for SCZ patients. In some aspects, supplementing GRIN2A or GRIA3 could offer potential therapeutic benefits for subjects suffering from a neurobiol ogical psychotic disorder. Neurobi ol ogical psychotic disorders are disorders which typically involve symptoms like hallucinations, delusions, and disorganized thinking. Non-limiting examples of a neurobiological psychotic disorder include schizophrenia, schizoaffective disorder, brief psychotic disorder, bipolar disorder with psychotic features, bipolar disorder, delusional disorder, and psychotic depression. In some aspects, supplementing GRIN2A or GRIA3 could offer potential therapeutic benefits for subjects suffering from a neurological disorder. Nonlimiting examples of a neurological disorder include epilepsy and seizure disorders, autism spectrum disorder (ASD), and developmental disorders.

[0135] According to the present disclosure, a polynucleotide may have the following formula: 5’UTR — mRNA coding region — 3’ UTR — Poly A, wherein the mRNA coding region encodes GRIN2A and GRIA3.

[0136] In some aspects, a Signal / Leader is in between the 5’UTR and mRNA coding region.81181968. v1 35Atorney Docket No. 770573: MTST-563PC1

[0137] In some aspects, 5’ UTR and / or 3 ’UTR are modified. In an aspect, the modified 5’ UTR and / or modified 3 ’UTR comprise one or more point mutations.

[0138] In a particular embodiment, the 5’ UTR comprises the nucleic acid sequence GGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAACACAT C ATCAAGACACCACC (SEQ ID NO: 1) and the 3’ UTR comprises the nucleic acid sequence TTGTGTATGCGTTAATAAAAAGAAGGAACTCGTAAAAACTCAATGTATTTCTGAG GAAGCGTGGTGCATAATGCCACGCAGCGTCTGCATAACTTTTATTATTTCTTTTATTA AT CAACAAA (SEQ ID NO: 2).

[0139] In an embodiment, the 5’ UTR comprises a nucleic acid sequence at least 70% identical to SEQ ID NO: 1, alternatively at least 75% identical to SEQ ID NO: 1, alternatively at least 80% identical to SEQ ID NO: 1, alternatively at least 85% identical to SEQ ID NO: 1, alternatively at least 90% identical to SEQ ID NO: 1, alternatively at least 95% identical to SEQ ID NO: 1, alternatively 100% identical to SEQ ID NO: 1.

[0140] In an embodiment, the 3’ UTR comprises a nucleic acid sequence at least 70% identical to SEQ ID NO: 2, alternatively at least 75% identical to SEQ ID NO: 2, alternatively at least 80% identical to SEQ ID NO: 2, alternatively at least 85% identical to SEQ ID NO: 2, alternatively at least 90% identical to SEQ ID NO: 2, alternatively at least 95% identical to SEQ ID NO: 2, alternatively 100% identical to SEQ ID NO:2.

[0141] In an embodiment, the polyA tail contains 120 adenine nucleotides. The coding sequences for GRIN2A and GRIA3 may be modified according to species and codon optimization. In some aspects, the GRIA3 has two splice variants, flip and flop, which enhance the AMPA receptor's function and contribute to SCZ treatment. Any method known in the art for making RNA, including, but not limited to making mRNA, is contemplated herein.

[0142] In an embodiment, the polynucleotide has at least about 70%, alternatively at least about 75%, alternatively at least about 80%, alternatively at least about 85%, alternatively at least about 90%, alternatively at least about 95% nucleic acid sequence identity to SEQ ID NO: 3. In an embodiment, the polynucleotide has at least about 70%, alternatively at least about 75%, alternatively at least about 80%, alternatively at least about 85%, alternatively at least about 90%, alternatively at least about 95% nucleic acid sequence identity to SEQ ID NO: 4. In an embodiment, the polynucleotide has at least about 70%, alternatively at least about 75%,81181968. v1 36Atorney Docket No. 770573: MTST-563PC1 alternatively at least about 80%, alternatively at least about 85%, alternatively at least about 90%, alternatively at least about 95% nucleic acid sequence identity to SEQ ID NO: 5.

[0143] In an aspect, the polynucleotide comprises at least a first mRNA coding region and at least a second mRNA coding region, wherein the first mRNA coding region and the second mRNA coding region are different. In an aspect, the polynucleotide comprises at least a first mRNA coding region, at least a second mRNA coding region, and at least a third mRNA coding region, wherein the first mRNA coding region, the second mRNA coding region, and the third mRNA coding region are different.

[0144] In some aspects, the polynucleotide is formulated with and / or in communication with a delivery vehicle. In an aspect, at least two polynucleotides are formulated with the delivery vehicle, wherein each polynucleotide comprises a different mRNA coding region. In an aspect, at least three polynucleotides are formulated with the delivery vehicle, wherein each polynucleotide comprises a different mRNA coding region.

[0145] In some aspects, the polynucleotide is delivered using brain-targeted delivery vehicles, such as lipid nanoparticles (LNPs), for further therapeutic application.

[0146] A “delivery vehicle” refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells or tissues (e.g., tumors, etc.). Referring to something as a delivery vehicle does not mean that it may not also have therapeutic effects. Delivery vehicles include those disclosed herein, but may also include viral vectors and particles such as lentivirus, adenovirus, adeno-associated virus, herpes simplex virus, retrovirus, and the like. Other modalities may also be used such as mRNA, plasmids, and recombinant proteins.

[0147] In some embodiments, the polynucleotide sequence is at least partially encapsulated by the delivery vehicle. In some embodiments, the delivery vehicle comprises blood-brain barrier (BBB) crossing lipids, phospholipids, cholesterol, and / or polyethylene glycol (PEG)-lipid constructs.

[0148] The BBB-crossing lipids may be derived from L-DOPA (LD), D-serine (DS), temozolomide (TM), tryptamine (TD), cinnamic acid (CD), and / or MK-0752 (MK). The phospholipids may be selected from phosphatidylcholine, phosphatidylethanolamine, 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE). The PEG-lipid construct may include 1,2-dimyristoyl-rac- glycero-3 -methoxypolyethylene glycol (DMG-PEG).81181968. v1 37Atorney Docket No. 770573: MTST-563PC1

[0149] The polynucleotide and delivery vehicle may be part of a composition. In some embodiments, the composition may be administered to a subject in need thereof. In some embodiments, the composition is configured to cross the BBB and deliver the mRNA to neuronal cells, nerve cells, and / or brain cells.

[0150] In some embodiments, the composition may be used in a method of increasing translation of mRNA in neuronal cells, nerve cells, and / or brain cells. In some embodiments, the composition may be used in a method of increasing translation of mRNA in neuronal cells, nerve cells, and / or brain cells, the method comprising promoting translation with a modified 3’ UTR and / or a modified 5’ UTR, wherein the modified 3’ UTR or modified 5’ UTR comprises one or more point mutations.

[0151] The composition may also be used in a method of treating a neurological disorder or a neurobiological psychotic disorder. In these embodiments, an effective amount of the composition may be administered to the subject. As used herein, the term “effective amount” refers to the quantity of a compound, composition, or agent that is sufficient to elicit a desired biological, chemical, or physical effect in a subject or system, without causing undue adverse effects. The specific amount will vary depending on factors such as the nature of the compound, the condition being treated or addressed, the mode of administration, and the characteristics of the subject or system. An effective amount may be determined empirically by those skilled in the art through routine experimentation and is intended to encompass both minimal effective doses and optimal therapeutic or functional concentrations.

[0152] In some embodiments, the neurobiological psychotic disorder is schizophrenia, schizoaffective disorder, brief psychotic disorder, bipolar disorder with psychotic features, bipolar disorder, delusional disorder, or psychotic depression.

[0153] The presently described technology and its advantages will be better understood by reference to the following examples. These examples are provided to describe specific implementations of the present technology. By providing these specific examples, it is not intended limit the scope and spirit of the present technology. It will be understood by those skilled in the art that the full scope of the presently described technology encompasses the subject mater defined by the claims appending this specification, and any alterations, modifications, or equivalents of those claims.81181968. v1 38Atorney Docket No. 770573: MTST-563PC1EXAMPLES

[0154] Example 1

[0155] mRNA Synthesis

[0156] A linear DNA template was generated via PCR. After DNA template cleanup, the mRNA was transcribed in vitro. The vaccinia capping enzyme and cap 2'-O-methyltransferase added a cap 1 to the mRNA. The prepared mRNA was stored at -80°C until use. Briefly, a linear DNA template was amplified by Q5 high-fidelity DNA polymerase (New England Biolabs). The primers included a 120 poly-T sequence to add the poly-A tail and were purified using the QIAquick PCR purification kit (QIAGEN). In vitro transcription (IVT) mRNA synthesis was performed using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs), replacing uridine entirely with 1-N-Methyl -Pseudouridine 5'-Triphosphate solution (Advent Bio). The mRNA was purified using Monarch RNA Cleanup Kits (New England Biolabs). Faustovirus capping enzyme (New England Biolabs) then added the cap-1 to the mRNA. The final mRNA product was purified again using Monarch RNA Cleanup Kits, quantified using a Nanodrop 2000 (Thermo Fisher Scientific), and stored at -80°C until later use.

[0157] Lipid Nanoparticles (LNP) Formulation

[0158] A small volume (100 pL) of LNP was prepared by pipeting. For larger volumes (> 500 pL), the NanoAssemblr (Precision Nano Systems) was used. This process involved blending an ethanol solution containing ionizable lipids, DOPE, cholesterol, and DMG-PEG2k with a citrate solution (10 mM, pH 3.0, Fisher) enriched with mRNA (SEQ ID NOs: 3, 4, & 5) (mass ratio of ionizable lipid to mRNA is 10: 1). Lastly, the LNP was dialyzed in PBS for 1.5 hours to remove ethanol.

[0159] Example 2

[0160] mRNA synthesis and purification

[0161] The mRNA synthesis and purification were conducted as previously described. Briefly, the plasmids were synthesized by Genscript, and linear DNA templates were generated by PCR (Q5® High-Fidelity 2X Master Mix). mRNAs were synthesized by in vitro transcription (IVT) with 100% substitution of UTP by N1 -Methylpseudouridine (TriLink) using HiScribe® T7 High Yield RNA Synthesis Kit (NEB) following the manufacturer's instructions. The mRNA was capped using Vaccinia Capping System (NEB) and Cap 2'-O-methyltransferase (NEB).81181968. v1 39Atorney Docket No. 770573: MTST-563PC1The capped mRNA was purified by Spin RNA Cleanup Kit (NEB), quantified by NanoDrop2000 (Thermo), and stored at -80 °C until future use.

[0162] LNP formulation

[0163] LNP was formulated based on the previously reported method. LNPs were prepared using Ionizable lipid, DOPE, Cholesterol, and DMG-PEG2k at a molar ratio of 40 / 40 / 60 / 0.75, respectively. The mass ratio of ionizable lipid to mRNA was 10: 1. After formulation, the LNPs were dialyzed against PBS to remove ethanol and stored at 4°C until use.

[0164] Immunofluorescence staining of brain slices (FIGs. 12A and 12B)

[0165] After 24 h of LNP injection, mice were transcardially perfused with 20 mL of PBS and 20 mL of 4% paraformaldehyde (PF A). The mouse brains were fixed in 4% PFA at 4 °C overnight and then dehydrated sequentially in 20% and 30% sucrose solution at 4 °C. Coronal brain sections were prepared (15 pm thick) using a cryotome.

[0166] For staining, brain slices were incubated in 0.3% Triton X-100 in PBS for 15 min and then blocked with blocking buffer (CST) for 30 mins. Due to the Gria3 with a V5 tag, slices were incubated with anti-V5 tag (1 :200, Thermo Fisher Scientific) overnight at 4 °C, followed by incubation with secondary antibodies (Anti-mouse IgG (H+L), F(ab')2 Fragment (Alexa Fluor® 594 Conjugate) (1 :200, CST) for 60 min at 37°C the following day. 4',6-Diamino-2- phenylindole dihydrochloride (DAPI, Thermo) was used to counterstain the nuclei. All sections were imaged using fluorescence microscopy (Leica DiM8).

[0167] Open field test

[0168] Mice received MK-801 (O. lmg / kg) daily for 4 days via intraperitoneal (i.p.) injection.To evaluate the efficacy of LNP treatments on general motor activity on day 5, mice were placed in a chamber (40 cm x 40 cm x 50 cm) equipped with recording devices. Locomotor activity was quantified by measuring the total distance traveled within the chamber over a 10- min session using an automated tracking system Fusion 5.6 (SuperFlex).

[0169] GRIN2A mRNA sequence:

[0170] GGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAA CACATCATCAAGACACCACCatgcatcaccatcaccatcaccatcaccatcaccatcaccatcaccatcaccatcac gggggaggaggctccgggagggtcgggtactggaccttgctggtcctgcccgccctcctcgtatggagggggcctgctccgagcg cggctgctgagaagggacctccggccctcaacatcgccgtcatgctcggtcacagccacgatgtgaccgagcgtgagctccggacc ctgtggggtccggagcaggcagcggggctgcctttggacgtcaatgtcgtggcgctcctgatgaaccgtacggatcccaagtcgttg atcacgcacgtgtgcgatctgatgagtggagctcggatccacggcctcgtgttcggtgacgacaccgatcaggaggccgtggctcag atgctcgacttcatcagttcgcacacgttcgtgccaattcttgggatccacggtggagcgtccatgataatggcggacaaggatccgac gtccacgttcttccagtcggggcgtcgatccagcagcaggctacagtcatgctaaagataatgcaggattatgattggcatgtctttagc ctggtcacgacgatattcccgggtaccgggaattcatatcgttcgtgaagacgacagttgacaacagcttcgtcgggtgggacatgca gaatgtcatcaccctggacacctcgttcgaggacgcaaagacgcaggttcagctgaagaagatccattcttcagtgatcctgctctattg81181968. v1 40Atorney Docket No. 770573: MTST-563PC1 ctccaaggacgaggctgtcctgattctttcggaagctcggtccctgggactgactgggtacgattttttctggatcgtgcccagtctagtc tcagggaacaccgagctgattccgaaagagttcccttcaggcttgatctcagtgtcttatgacgactgggattacagcctggaggcgag ggtccgcgatgggatcgggatcctcacgacggcggcctccagtatgttggagaagttctcctacataccggaggccaaggcgtcgtg ttacggccagatggagaggccggaggtccctatgcataccttgcacccgttcatggtcaacgtgacctgggacgggaaggatctttcg ttcacggaggagggctaccaggtgcacccgcgcctggtagtcatcgtcctgaacaaagatcgcgagtgggagaaggtagggaagt gggagaaccacaccctatctctccggcacgccgtctggccgcggtacaagagttctctgactgcgagccagacgataatcatctcag catcgtgactctggaggaggcccccttcgtgatcgtggaggatattgatccgttgacggagacttgcgtacggaacaccgttccgtgcc gcaagttcgtcaagatcaataactccacgaatgagggtatgaatgtgaagaagtgctgcaagggcttctgcattgatatcctcaagaag ctctcccgtaccgttaagttcacgtatgacctttatctcgtgaccaacggtaagcacgggaagaaggtcaacaacgtgtggaacggtat gatcggagaggttgtgtatcagagggccgtgatggcggtcgggtcgctcaccatcaacgaagagcgcagtgaagtcgtggacttca gtgtgcccttcgttgagaccgggataagcgtgatggtgagccgttccaacggaacggtctcaccatccgctttcctggaaccgtttagc gctagcgtgtgggtcatgatgttcgtgatgctcctcatcgttagcgctatagcggtttttgtcttcgagtacttctcccctgtggggtacaac cggaacctggctaaaggcaaggccccacatgggccaagcttaccatcggtaaagctatctggctcttgtggggccttgtctttaacaa cagcgttccggttcagaaccccaaggggacgacttcgaagataatggtgagcgtctgggccttcttcgcggtcatcttcctggcatcat acaccgccaacctggcggcgttcatgatccaggaagagttcgtagaccaggtgactggtctgtcggacaagaaattccagcggccac acgactacagccctccatttcggttcgggaccgtccccaacgggtcaactgagcgcaatatacggaacaactatccgtatatgcatcag tacatgaccaagttcaaccagaagggcgtagaggacgcgctagtttccctgaagacagggaagctagacgcgttcatctacgacgct gctgtgttgaactacaaggcgggccgtgatgaagggtgtaagctcgtgaccattggtagcggatacattttcgctaccactggttacgg gatcgcccttcagaagggctcgccgtggaagcgccagatcgatctggcgcttctacagttcgttggggacggtgagatggaggagct ggagacgttgtggctgactggaatttgtcacaacgagaagaacgaggtgatgtcgtcgcagctagatatagataacatggccggtgtg ttctatatgctagctgcggcgatggccttgtcgctcatcacgttcatatgggagcacctcttctactggaagcttcggttctgtttcactggg gtctgctcagatcgtccggggcttctcttctcgatatcccgtgggatatattcttgtatccacggggtacacatcgaggagaagaagaag tccccggactcaatctgaccggatcccagtcgaacatgctgaagcttcttcggtccgcgaagaatattagctctatgagcaatatgaac tcttcgcggatggacagcccgaagcgggctgcggattttatccagagggggtctctcataatggacatggtgagcgacaagggcaac ctcatgtactccgataatcgctccttccaggggaaggagtcgattttcggagacaacatgaacgagtgcagaccttcgtggcgaaccg ccagaaggataatctgaacaactatgtctttcagggtcagcacccgctgaccctgaatgagtcaaaccccaacaccgttgaggttgcg gtctcgacggagagcaaggccaatagccggccgcgtcagctctggaagaagagcgtggactcgattcgacaggactcgctgagtc agaatccggtatctcagcgggacgaggctaccgcggagaatcggactcacagtctgaagtctccgcggtacctccccgaggagatg gcgcattctgacatcagcgagacgtcgaatcgagccacgtgtcatcgggagccggataattcgaagaaccacaagacgaaggataa cttcaagcgttctgtggcttcgaagtatccgaaagattgttccgaggtggagaggacttatctgaagactaagtcctcttcacctcgggac aagatttacacgatcgatggagagaaggagcctggattccatctggatcctcctcaattcgtagagaacgtcacccttcccgagaatgtt gacttcccggatccgtaccaggatccgagtgaaaattttcggaagggtgactcgaccctcccgatgaaccggaacccgctcataacg aggagggtctttcgaataacgaccagtacaagttgtattcgaaacacttcaccttgaaggacaagggaagtcctcactcggagacgag tgagcgctatcggcagaatagcacgcactgtcggagctgccttagtaatatgcccacttatagtgggcattttactatgcgcagcccgtt caagtgcgatgcttgtctgcggatggggaatctctacgacattgacgaggaccagatgctccaggagactggcaacccggctactgg ggagcaggtttatcagcaggactgggcgcagaacaatgcgctccagctgcagaagaacaagctccgcattagccggcagcacagt acgacaacatcgtagataagccccgcgagctggacctctcccggccttcaaggagtatctccttgaaggaccgggagaggttgctcg aggggaacttctacggctctttgttctctgtgccgtcctccaagctcagcgggaagaagtccagcttgttcccgcagggcttggaggac agcaagagatcaaagagcctgttgcccgaccacacgtcggacaacccttttctccattcgcatcgtgatgaccagcggctggttattgg ccgctgtccgtcggacccctataagcattcactgccgagccaggcagtgaatgactcgtatctacgtagctcgctgaggagtacagcg tcgtattgctcccgggactcccgggggcataacgacgtgtacatcagcgagcacgtgatgccatacgcggcgaacaagaataacatg tattctacgccgcgtgtgctgaacagttgctccaatcgacgcgtctacaagaagatgccgtcgattgagagcgacgtttagTTGTG TATGCGTTAATAAAAAGAAGGAACTCGTAAAAACTCAATGTATTTCTGAGGAAG CGTGGTGCATAATGCCACGCAGCGTCTGCATAACTTTTATTATTTCTTTTATTAAT CAACAAA (SEQ ID NO: 3)

[0171] GRIA3 Flip mRNA sequence:81181968. v1 41Atorney Docket No. 770573: MTST-563PC1

[0172] GGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAA CACATCATCAAGACACCACCatgcatcaccatcaccatcaccatcaccatcaccatcaccatcaccatcaccatcac gggggaggaggctccgggagggtcgggtactggaccttgctggtcctgcccgccctcctcgtatggagggggcctgctccgagcg cggctgctgagaagggacctccggccctcaacatcgccgtcatgctcggtcacagccacgatgtgaccgagcgtgagctccggacc ctgtggggtccggagcaggcagcggggctgcctttggacgtcaatgtcgtggcgctcctgatgaaccgtacggatcccaagtcgttg atcacgcacgtgtgcgatctgatgagtggagctcggatccacggcctcgtgttcggtgacgacaccgatcaggaggccgtggctcag atgctcgacttcatcagttcgcacacgttcgtgccaattcttgggatccacggtggagcgtccatgataatggcggacaaggatccgac gtccacgttcttccagtcggggcgtcgatccagcagcaggctacagtcatgctaaagataatgcaggattatgattggcatgtctttagc ctggtcacgacgatattcccgggtaccgggaattcatatcgttcgtgaagacgacagttgacaacagcttcgtcgggtgggacatgca gaatgtcatcaccctggacacctcgttcgaggacgcaaagacgcaggttcagctgaagaagatccattcttcagtgatcctgctctattg ctccaaggacgaggctgtcctgattctttcggaagctcggtccctgggactgactgggtacgattttttctggatcgtgcccagtctagtc tcagggaacaccgagctgattccgaaagagttcccttcaggcttgatctcagtgtcttatgacgactgggattacagcctggaggcgag ggtccgcgatgggatcgggatcctcacgacggcggcctccagtatgttggagaagttctcctacataccggaggccaaggcgtcgtg ttacggccagatggagaggccggaggtccctatgcataccttgcacccgttcatggtcaacgtgacctgggacgggaaggatctttcg ttcacggaggagggctaccaggtgcacccgcgcctggtagtcatcgtcctgaacaaagatcgcgagtgggagaaggtagggaagt gggagaaccacaccctatctctccggcacgccgtctggccgcggtacaagagttctctgactgcgagccagacgataatcatctcag catcgtgactctggaggaggcccccttcgtgatcgtggaggatattgatccgttgacggagacttgcgtacggaacaccgttccgtgcc gcaagttcgtcaagatcaataactccacgaatgagggtatgaatgtgaagaagtgctgcaagggcttctgcattgatatcctcaagaag ctctcccgtaccgttaagttcacgtatgacctttatctcgtgaccaacggtaagcacgggaagaaggtcaacaacgtgtggaacggtat gatcggagaggttgtgtatcagagggccgtgatggcggtcgggtcgctcaccatcaacgaagagcgcagtgaagtcgtggacttca gtgtgcccttcgttgagaccgggataagcgtgatggtgagccgttccaacggaacggtctcaccatccgctttcctggaaccgtttagc gctagcgtgtgggtcatgatgttcgtgatgctcctcatcgttagcgctatagcggtttttgtcttcgagtacttctcccctgtggggtacaac cggaacctggctaaaggcaaggccccacatgggccaagcttaccatcggtaaagctatctggctcttgtggggccttgtctttaacaa cagcgttccggttcagaaccccaaggggacgacttcgaagataatggtgagcgtctgggccttcttcgcggtcatcttcctggcatcat acaccgccaacctggcggcgttcatgatccaggaagagttcgtagaccaggtgactggtctgtcggacaagaaattccagcggccac acgactacagccctccatttcggttcgggaccgtccccaacgggtcaactgagcgcaatatacggaacaactatccgtatatgcatcag tacatgaccaagttcaaccagaagggcgtagaggacgcgctagtttccctgaagacagggaagctagacgcgttcatctacgacgct gctgtgttgaactacaaggcgggccgtgatgaagggtgtaagctcgtgaccattggtagcggatacattttcgctaccactggttacgg gatcgcccttcagaagggctcgccgtggaagcgccagatcgatctggcgcttctacagttcgttggggacggtgagatggaggagct ggagacgttgtggctgactggaatttgtcacaacgagaagaacgaggtgatgtcgtcgcagctagatatagataacatggccggtgtg ttctatatgctagctgcggcgatggccttgtcgctcatcacgttcatatgggagcacctcttctactggaagcttcggttctgtttcactggg gtctgctcagatcgtccggggcttctcttctcgatatcccgtgggatatattcttgtatccacggggtacacatcgaggagaagaagaag tccccggactcaatctgaccggatcccagtcgaacatgctgaagcttcttcggtccgcgaagaatattagctctatgagcaatatgaac tcttcgcggatggacagcccgaagcgggctgcggattttatccagagggggtctctcataatggacatggtgagcgacaagggcaac81181968. v1 42Atorney Docket No. 770573: MTST-563PC1 ctcatgtactccgataatcgctccttccaggggaaggagtcgattttcggagacaacatgaacgagtgcagaccttcgtggcgaaccg ccagaaggataatctgaacaactatgtctttcagggtcagcacccgctgaccctgaatgagtcaaaccccaacaccgttgaggttgcg gtctcgacggagagcaaggccaatagccggccgcgtcagctctggaagaagagcgtggactcgattcgacaggactcgctgagtc agaatccggtatctcagcgggacgaggctaccgcggagaatcggactcacagtctgaagtctccgcggtacctccccgaggagatg gcgcattctgacatcagcgagacgtcgaatcgagccacgtgtcatcgggagccggataattcgaagaaccacaagacgaaggataa cttcaagcgttctgtggcttcgaagtatccgaaagattgttccgaggtggagaggacttatctgaagactaagtcctcttcacctcgggac aagatttacacgatcgatggagagaaggagcctggattccatctggatcctcctcaattcgtagagaacgtcacccttcccgagaatgtt gacttcccggatccgtaccaggatccgagtgaaaattttcggaagggtgactcgaccctcccgatgaaccggaacccgctcataacg aggagggtctttcgaataacgaccagtacaagttgtattcgaaacacttcaccttgaaggacaagggaagtcctcactcggagacgag tgagcgctatcggcagaatagcacgcactgtcggagctgccttagtaatatgcccacttatagtgggcattttactatgcgcagcccgtt caagtgcgatgcttgtctgcggatggggaatctctacgacattgacgaggaccagatgctccaggagactggcaacccggctactgg ggagcaggtttatcagcaggactgggcgcagaacaatgcgctccagctgcagaagaacaagctccgcattagccggcagcacagt acgacaacatcgtagataagccccgcgagctggacctctcccggccttcaaggagtatctccttgaaggaccgggagaggttgctcg aggggaacttctacggctctttgttctctgtgccgtcctccaagctcagcgggaagaagtccagcttgttcccgcagggcttggaggac agcaagagatcaaagagcctgttgcccgaccacacgtcggacaacccttttctccattcgcatcgtgatgaccagcggctggttattgg ccgctgtccgtcggacccctataagcattcactgccgagccaggcagtgaatgactcgtatctacgtagctcgctgaggagtacagcg tcgtattgctcccgggactcccgggggcataacgacgtgtacatcagcgagcacgtgatgccatacgcggcgaacaagaataacatg tattctacgccgcgtgtgctgaacagttgctccaatcgacgcgtctacaagaagatgccgtcgattgagagcgacgtttagTTGTG TATGCGTTAATAAAAAGAAGGAACTCGTAAAAACTCAATGTATTTCTGAGGAAG CGTGGTGCATAATGCCACGCAGCGTCTGCATAACTTTTATTATTTCTTTTATTAATCAACAAA(SEQ ID NO: 4)

[0173] GRIA3 Flop mRNA sequence

[0174] GGCAAAAATCAAAATCAATCATCATCACAACATCAACAATCAATCATCAA CACATCATCAAGACACCACCatggcccgtcagaagaagatgggccagagtgtacttcgggcggtgttcttcttggt cttggggctcctgggccattcgcatggagggttccccaatactataagtattgggggactcttcatgcgaaacacggtccaggagcata gcgcttttcggtttgcggtccagctctacaataccaaccagaatacgacggaaaagcccttccatcttaattatcatgtcgaccacctgga cagtagcaacagtttttctgtgaccaacgccttctgttcgcagttcagtcggggtgtttatgcgatatttggtttctatgaccagatgtccatg aacaccctgacgagcttctgcggggcgcttcacacgagcttcgtcacgccgtcgttcccgacggacgctgacgtgcagttcgtgatcc agatgcgccccgcactgaagggtgctatactctcgctcctgggtcattacaagtgggagaagttcgtctacttgtatgacacggagcga gggtttagcatccttcaggcgatcatggaggcggcggtccagaataactggcaggttactgccaggtcggtcggcaatataaaagatg tgcaggagttccgtcgtattattgaggagatggaccgcagacaggagaagcgctacctcatagactgtgaggtggagaggatcaaca cgatcctcgaacaagtggtaatcctcgggaagcattcccgaggataccactacatgttggcgaatctgggattcactgatattctgctcg81181968. v1 43Atorney Docket No. 770573: MTST-563PC1 agcgtgttatgcacggtggagcaaatatcactggattccagatcgtcaacaacgagaaccccatggtccagcagttcatccagagatg ggtgaggctggacgagcgggagttccccgaggccaagaatgcacccctgaagtacactagtgcgctgacccatgatgcgatactgg ttattgccgaggcattccggtacctgcgccgtcagcgcgtcgatgtcagccggcggggttcggcaggcgactgcctggcgaacccc gccgtcccctggtcacaggggattgacatcgagcgcgctctgaagatggtgcaggtgcagggaatgaccggcaatatccagttcgac acttatgggcggcgcactaactacacgatcgacgtgtacgagatgaaggtgagtggttcgagaaaggctggttactggaacgagtac gaaaggttcgtgccgttcagtgaccagcagatctcgaacgactcagcttcatccgagaaccgcacaatagtcgtcactaccatcttgga gtccccatatgtcatgtacaagaagaatcatgagcagttggagggcaacgagaggtatgagggctattgtgtggatctcgcgtacgag atcgccaagcatgtccgtatcaaatacaagctctcgatcgtgggcgacggcaagtacggagcccgcgatccagagactaagatttgg aacggcatggttggcgagctcgtatacggtcgcgcggacatcgctgttgctcctctaacgataacactcgtacgggaagaagtgattg actttagcaagccattcatgagcctcggtataagcatcatgataaagaagccccagaagtcgaagccaggggtgttcagttttctggac cccctggcttacgagatctggatgtgtatcgtgtttgcttatatcggggtctcagtggtcttgtttctggtcagtcgcttctccccgtacgagt ggcatctagaggacaacaacgaggagccgcgcgacccacagtcgcccccagacccgcccaacgagttcggaatcttcaactcgttg tggttcagtctgggggccttcatgcagcagggctgcgatatctctccacggtcgctgtcaggtcgcattgtaggaggagtatggtggttt ttcaccctgatcatcatctcctcctacactgcgaacctggcagcgttcctgaccgtggagagaatggtcagccctatcgagtccgccga ggacttggcgaagcagaccgagatcgcttacggcactcttgatagtggctccacaaaggagttttttcgacgcagcaagattgctgtgt acgagaagatgtggagctacatgaagagtgccgagccctcggtcttcaccaagaccacggcggacggtgtcgcccgcgtcgtaag tcgaagggcaagttgcgtcctgctcgagagtactatgaacgagtacatcgagcagcggaagccctgcgacaccatgaaggtcggt ggaaacttggatagcaaggggtacggggttgcaactcctaaggggtcagcactgaggaacgccgtgaacctggcagtattgaaactc aatgagcaaggactgctagataagctgaagaacaagtggtggtatgacaaaggcgagtgtggctcagggggaggggactcgaagg acaagacgagtgccctctccctgagcaacgtcgccggtgtcttctacatacttgtcggcggactcggcctggctatgatggtagcgctc atcgagttctgctataagagccgggccgagtccaagcgcatgaagcttaccaagaatacacagaatttcaagcccgccccggctacg aacacgcagaactatgcgacgtaccgggagggctataatgtgtatggtactgagtcggtcaagatcggcgggggggggagtggga agcccattcccaaccccctgctcggtcttgactcgacttagTTGTGTATGCGTTAATAAAAAGAAGGAACTCGTAAAAACTCAATGTATTTCTGAGGAAGCGTGGTGCATAATGCCACGCAGCGT CTGCATAACTTTTATTATTTCTTTTATTAATCAACAAA(SEQ ID NO: 5)

[0175] REFERENCESB.; Luo, X.; Deng, B.; Wang, J.; McComb, D. W.; Shi, Y.; Gaensler, K. M. L.; Tan, X.; Dunn, A. L.; Kerlin, B. A.; Dong, Y. An Orthogonal Array Optimization of Lipid-like Nanoparticles for mRNA Delivery in Vivo. Nano Letters 2015, 75, 8099-8107.81181968. v1 44Atorney Docket No. 770573: MTST-563PC1Purcell, S. M. et al. Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. Nature. 2009 Aug 6;460(7256):748-52. doi: 10.1038 / nature08185. Epub 2009 Jul 1. PMID: 19571811; PMCID: PMC3912837.International Schizophrenia, C. et al. Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. Nature. 2009 Aug 6;460(7256):748-52. doi: 10.1038 / nature08185. Epub 2009 Jul 1. PMID: 19571811; PMCID: PMC3912837.Singh, T. et al. Rare coding variants in ten genes confer substantial risk for schizophrenia. Nature. 2022 Apr;604(7906):509-516. doi: 10.1038 / s41586-022-04556-w. Epub 2022 Apr 8. PMID: 35396579; PMCID: PMC9805802.Miyamoto S, Duncan GE, Marx CE, Lieberman JA. Treatments for schizophrenia: a critical review of pharmacology and mechanisms of action of antipsychotic drugs. Mol Psychiatry. 2005 Jan;10(l):79-104. doi: 10.1038 / sj .mp.4001556. PMID: 15289815.Torrey EF, Yolken RH, Lamb HR. NIMH Drug Trials for Schizophrenia. J Clin Psychiatry. 2019 Jan 15;80(l): 18coml2597. doi: 10.4088 / JCP.18coml2597. PMID: 30677268.Consortium TSWG of the PG, Ripke S, Walters JT, O’Donovan MC. Mapping genomic loci prioritises genes and implicates synaptic biology in schizophrenia. medRxiv 2020; : 2020.09.12.20192922.Fuller Torrey E et al. Why NIMH Should Not Stop New Drug Trials for Schizophrenia, http : / / www.treatm entadvocacy center, org / storage / documents / why-nimh-should-not-stop-new- drug-trials-for-schizophrenia.pdf (accessed 3 Oct2018).Frohlich J, Van Horn JD. Reviewing the ketamine model for schizophrenia. J. Psychopharmacol. 2014; 28: 287-302.Hughes EG et al. Cellular and synaptic mechanisms of anti-NMDA receptor encephalitis. J Neurosci 2010; 30: 5866-5875.Lee G, Zhou Y. NMD AR Hypofunction Animal Models of Schizophrenia. Front. Mol. Neurosci. 2019; 12: 185.Diering GH, Huganir RL. The AMPA Receptor Code of Synaptic Plasticity. Neuron. 2018 Oct 24; 100(2):314-329. doi: 10.1016 / j.neuron.2018.10.018. PMID: 30359599; PMCID: PMC6214363.81181968. v1 45Atorney Docket No. 770573: MTST-563PC1Malinow R, Malenka RC. AMPA receptor trafficking and synaptic plasticity. Annu Rev Neurosci. 2002;25: 103-26. doi: 10.1146 / annurev. neuro.25.112701.142758. Epub 2002 Mar 4. PMID: 12052905.Hollmann M, Heinemann S. Cloned glutamate receptors. Annu Rev Neurosci. 1994;17:31-108. doi: 10.1146 / annurev.ne. l7.030194.000335. PMID: 8210177.Schwenk, J. et al. Regional diversity and developmental dynamics of the AMPA-receptor proteome in the mammalian brain. Neuron. 2014 Oct 1 ;84(1):41 -54. doi: 10.1016 / j. neuron.2014.08.044. Epub 2014 Sep 18.PMID: 25242221.Bredt DS, Nicoll RA. AMPA receptor trafficking at excitatory synapses. Neuron. 2003 Oct 9;40(2):361-79. doi: 10.1016 / s0896-6273(03)00640-8. PMID: 14556714.Shi S, Hayashi Y, Esteban JA, Malinow R. Subunit-specific rules governing AMPA receptor trafficking to synapses in hippocampal pyramidal neurons. Cell. 2001 May 4; 105(3):33143. doi: 10.1016 / s0092- 8674(01)00321-x. PMID: 11348590.

[0176] Other embodiments of the present disclosure include:1. A polynucleotide sequence comprising a 5’ UTR, a mRNA coding region, and 3’ UTR, wherein the 5’ UTR and / or 3 ’UTR are modified.2. The polynucleotide sequence of embodiment 1, wherein the modified 5’ UTR and / or modified 3 ’UTR comprise one or more point mutations.3. A composition comprising the polynucleotide sequence of embodiment 1 or embodiment 2 and a delivery vehicle, wherein the polynucleotide sequence is at least partially encapsulated by the delivery vehicle.4. The composition of embodiment 3, wherein the delivery vehicle comprises blood-brain barrier (BBB) crossing lipids, phospholipids, cholesterol, and / or polyethylene glycol (PEG)- lipid constructs.5. The composition of embodiment 4, wherein the BBB-crossing lipids are derived from L- DOPA (LD), D-serine (DS), temozolomide (TM), tryptamine (TD), cinnamic acid (CD), and / or MK-0752 (MK).6. The composition of embodiment 4 or embodiment 5, wherein the phospholipids are selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, 1,2-distearoyl-sn-81181968. v1 46Atorney Docket No. 770573: MTST-563PC1 glycero-3 -phosphocholine (DSPC) and l,2-dioleoyl-sn-glycero-3 -phosphoethanolamine (DOPE).7. The composition of any one of embodiments 4 to 6, wherein the PEG-lipid construct comprises l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG).8. The composition of any one of embodiments 3 to 7, wherein the composition is configured to cross the BBB and deliver the mRNA to neuronal cells, nerve cells, and / or brain cells.9. A method of increasing translation of mRNA in neuronal cells, nerve cells, and / or brain cells, the method comprising administering to a subject in need thereof the composition of any one of embodiments 3 to 8.10. A method of increasing translation of mRNA in neuronal cells, nerve cells, and / or brain cells, the method comprising promoting translation with a modified 3’ UTR and / or a modified 5’ UTR, wherein the modified 3’ UTR or modified 5’ UTR comprises one or more point mutations.11. A polynucleotide comprising a 5 ’ UTR, at least one mRNA coding region, and 3 ’ UTR, wherein the mRNA coding region has at least about 70% nucleic acid sequence identity to SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.12. The polynucleotide of embodiment 11, wherein the polynucleotide comprises at least a first mRNA coding region and at least a second mRNA coding region, wherein the first mRNA coding region and the second mRNA coding region are different.13. The polynucleotide of embodiment 12, wherein the polynucleotide further comprises a at least a third mRNA coding region, wherein the first mRNA coding region, the second mRNA coding region, and the third mRNA coding region are different.14. The polynucleotide of any one of embodiments 11 to 13, wherein the 5’ UTR comprises the nucleic acid sequence of SEQ ID NO: 1.15. The polynucleotide of any one of embodiments 11 to 14, wherein the 3’ UTR comprises the nucleic acid sequence of SEQ ID NO: 2.16. A composition comprising a delivery vehicle and at least one polynucleotide according to any one of embodiments 11 to 15, wherein the polynucleotide is at least partially encapsulated by the delivery vehicle.81181968. v1 47Atorney Docket No. 770573: MTST-563PC117. The composition of embodiment 16, wherein the composition is a therapeutic composition.18. A method of treating a neurological disorder or a neurobi ologi cal psychotic disorder in a subject in need thereof, the method comprising administering an effective amount of the polynucleotide of any one of embodiments 11 to 15 or the composition of embodiment 16 or embodiment 17.19. The method of embodiment 18, wherein the neurobiol ogical psychotic disorder is selected from the group consisting of schizophrenia, schizoaffective disorder, brief psychotic disorder, bipolar disorder with psychotic features, bipolar disorder, delusional disorder, and psychotic depression.

[0177] While the present disclosure has been described with reference to certain embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the present disclosure or appended claims. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the present disclosure without departing from its scope. Therefore, it is intended that the present disclosure not be limited to the particular embodiments disclosed, but that the present disclosure will include all aspects falling within the scope of the appended claims.

[0178] All patents, patent applications, publications, and descriptions mentioned above are herein incorporated by reference in their entirety.81181968. v1 48

Claims

Attorney Docket No. 770573: MTST-563PC1CLAIMS1. A polynucleotide sequence comprising a 5’ UTR, a mRNA coding region, and 3’ UTR, wherein the 5’ UTR and / or 3 ’UTR are modified.

2. The polynucleotide sequence of claim 1, wherein the modified 5’ UTR and / or modified 3 ’UTR comprise one or more point mutations.

3. The polynucleotide of claim 1 or claim 2, wherein the 5’ UTR comprises a nucleic acid sequence at least 70% identical to SEQ ID NO: 1, alternatively at least 75% identical to SEQ ID NO: 1, alternatively at least 80% identical to SEQ ID NO: 1, alternatively at least 85% identical to SEQ ID NO: 1, alternatively at least 90% identical to SEQ ID NO: 1, alternatively at least 95% identical to SEQ ID NO: 1, alternatively 100% identical to SEQ ID NO: 1.

4. The polynucleotide of any one of the preceding claims, wherein the 3’ UTR comprises a nucleic acid sequence at least 70% identical to SEQ ID NO: 2, alternatively at least 75% identical to SEQ ID NO: 2, alternatively at least 80% identical to SEQ ID NO: 2, alternatively at least 85% identical to SEQ ID NO: 2, alternatively at least 90% identical to SEQ ID NO: 2, alternatively at least 95% identical to SEQ ID NO: 2, alternatively 100% identical to SEQ ID NO: 2.

5. The polynucleotide of any one of the preceding claims, wherein the polynucleotide comprises at least a first mRNA coding region and at least a second mRNA coding region, wherein the first mRNA coding region and the second mRNA coding region are different.

6. The polynucleotide of claim 5, wherein the polynucleotide further comprises at least a third mRNA coding region, wherein the first mRNA coding region, the second mRNA coding region, and the third mRNA coding region are different.81181968. v1 49Attorney Docket No. 770573: MTST-563PC17. A polynucleotide of claim 1, comprising a nucleic acid sequence at least 70% identical to SEQ ID NO: 3, alternatively at least 75% identical to SEQ ID NO: 3, alternatively at least 80% identical to SEQ ID NO: 3, alternatively at least 85% identical to SEQ ID NO: 3, alternatively at least 90% identical to SEQ ID NO: 3, alternatively at least 95% identical to SEQ ID NO: 3, alternatively 100% identical to SEQ ID NO: 3.

8. A polynucleotide of claim 1, comprising a nucleic acid sequence at least 70% identical to SEQ ID NO: 4, alternatively at least 75% identical to SEQ ID NO: 4, alternatively at least 80% identical to SEQ ID NO: 4, alternatively at least 85% identical to SEQ ID NO: 4, alternatively at least 90% identical to SEQ ID NO: 4, alternatively at least 95% identical to SEQ ID NO: 4, alternatively 100% identical to SEQ ID NO: 4.

9. A polynucleotide of claim 1, comprising a nucleic acid sequence at least 70% identical to SEQ ID NO: 5, alternatively at least 75% identical to SEQ ID NO: 5, alternatively at least 80% identical to SEQ ID NO: 5, alternatively at least 85% identical to SEQ ID NO: 5, alternatively at least 90% identical to SEQ ID NO: 5, alternatively at least 95% identical to SEQ ID NO: 5, alternatively 100% identical to SEQ ID NO: 5.

10. A composition comprising the polynucleotide sequence of any one of the preceding claims and a delivery vehicle, wherein the polynucleotide sequence is at least partially encapsulated by the delivery vehicle.

11. The composition of claim 10, wherein the delivery vehicle comprises bloodbrain barrier (BBB) crossing lipids, phospholipids, cholesterol, and / or polyethylene glycol (PEG)-lipid constructs.

12. The composition of claim 11, wherein the BBB-crossing lipids are derived from L-DOPA (LD), D-serine (DS), temozolomide (TM), tryptamine (TD), cinnamic acid (CD), and / or MK-0752 (MK).81181968. v1 50Attorney Docket No. 770573: MTST-563PC113. The composition of claim 11 or claim 12, wherein the phospholipids are selected from the group consisting of phosphatidylcholine, phosphatidylethanolamine, 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC) and l,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE).

14. The composition of any one of claims 11 to 13, wherein the PEG-lipid construct comprises l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG).

15. The composition of any one of claims 10 to 14, wherein the composition is a therapeutic composition.

16. The composition of any one of claims 10 to 15, wherein the composition is configured to cross the BBB and deliver the mRNA to neuronal cells, nerve cells, and / or brain cells.

17. A method of increasing translation of mRNA in neuronal cells, nerve cells, and / or brain cells, the method comprising administering to a subject in need thereof the polynucleotide of any one of claims or 1 to 9 the composition of any one of claims 10 to 15.

18. A method of treating a neurological disorder or a neurobiological psychotic disorder in a subject in need thereof, the method comprising administering an effective amount of the polynucleotide of any one of claims or 1 to 9 the composition of any one of claims 10 to 15.

19. Use of a polynucleotide as defined in any one of claims 1 to 9, or a composition as defined in any one of claims 10 to 15, for the treatment or prevention of a neurological disorder or a neurobiological psychotic disorder in a subject in need thereof, by administering an effective amount of said polynucleotide or composition.

20. Use of a polynucleotide as defined in any one of claims 1 to 9, or a composition as defined in any one of claims 10 to 15, for the manufacture of a medicament for the81181968. v1 51Attorney Docket No. 770573: MTST-563PC1 treatment or prevention of a neurological disorder or a neurobiological psychotic disorder in a subject in need thereof.

21. The method of claim 18 or the use of claim 19 or claim 20, wherein the neurobiological psychotic disorder is selected from the group consisting of schizophrenia, schizoaffective disorder, brief psychotic disorder, bipolar disorder with psychotic features, bipolar disorder, delusional disorder, and psychotic depression.81181968. v1 52

Citation Information

Patent Citations

  • Terminal modifications of polynucleotides

    US20170362605A1

  • Engineered mRNA sequences and uses thereof

    WO2020198337A1