Self-replicating mRNA vaccine, preparation method therefor, and use thereof

Abstract

A provided self-replicating mRNA is transcribed from an alphavirus backbone vector. The alphavirus backbone vector comprises gene sequences of alphavirus non-structural proteins nsP2, nsP3, nsP4, and mutated nsP1. A cysteine at position 492 of the mutated nsP1 is mutated into serine. The self-replicating mRNA has a higher expression level and a longer expression time for a target gene. The self-replicating mRNA is used for expressing IMP3, and can be prepared into a vaccine having good preventive and therapeutic effects on IMP3-positive tumors. Therefore, the present invention has good application prospects in drug and vaccine development.

Description

A self-replicating mRNA vaccine, its preparation method and uses Technical Field

[0001] This invention belongs to the field of mRNA vaccine technology, specifically relating to a self-replicating mRNA vaccine, its preparation method, and its uses. Background Technology

[0002] Currently, various mRNA vaccine platforms have been established both domestically and internationally, including non-replicating (nr) mRNA and self-replicating (sa) mRNA. Among them, samRNA vaccines use sequences derived from alphaviruses, which encode additional proteins required for mRNA molecule replication, thereby prolonging protein expression time.

[0003] samRNAs are a class of mRNAs capable of self-replication using their own RNA sequences as templates. Compared to linear non-replicating mRNAs, samRNAs, in addition to having a 5' cap structure, a 3' polyA tail, a 5' untranslated region (5'-UTR), and a 3' untranslated region (3'-UTR), also introduce self-replicating elements upstream or downstream of the target gene. The main components of these self-replicating elements include virus-derived RNA-dependent RNA polymerases, functional proteins associated with viral RNA replication, and subgenomic promoters located upstream of the target gene.

[0004] Its working mechanism mimics the replication characteristics of positive single-stranded RNA viruses. By replacing the viral structural gene with the target antigen gene (GOI), it can significantly prolong the time of antigen expression, increase the amount of antigen expressed, and enhance the effectiveness of related immune responses after being delivered to the cytoplasm of target cells.

[0005] Currently, most self-replicating elements used to prepare self-replicating mRNA are derived from alphaviruses, including Sindbisvirus (SIN), Semliki Forest virus (SFV), and Venezuelan equine encephalitis virus (VEEV). Some studies have also used genomic elements from Kunzin viruses (flavivir viruses) as self-replicating elements for mRNA. However, these unmodified viral genomic elements exhibit varying degrees of cytotoxicity when transfected into cultured cells in vitro, and can induce innate immune responses in vivo, leading to decreased expression of the target gene mRNA and consequently affecting the efficacy of vaccines and drug treatments. Therefore, there is an urgent need to find a self-replicating element that can easily enhance the expression of the target gene mRNA in vivo.

[0006] The IMP3 gene, or insulin-like growth factor II mRNA-binding protein 3, is a messenger RNA-binding protein belonging to the IGF2BP family, which includes IMP1, IMP2, and IMP3. As an oncoemulsifiable protein, IMP3 is expressed at low levels in normal adults, but exhibits significantly high expression during embryonic development and in various malignant tumors. Its positive expression may be associated with various cancers, such as prostate cancer, bladder cancer, and breast cancer. Therefore, the IMP3 gene not only has potential value in early tumor diagnosis, prognostic assessment, and therapeutic targets, but also represents a potential oncoemulsifiable antigen for development into tumor vaccines.

[0007] Currently, there are no reports on using IMP3-expressing mRNA to create samRNA tumor vaccines. Designing samRNA sequences to achieve efficient and sustained expression of the target antigen will be a key challenge in developing IMP3-expressing samRNA tumor vaccines. Summary of the Invention

[0008] To address the problems of existing technologies, this invention provides a self-replicating mRNA vaccine, its preparation method, and its uses.

[0009] A self-replicating mRNA transcribed from an alphavirus backbone vector, the alphavirus backbone vector comprising the gene sequences of alphavirus non-structural proteins nsP2, nsP3, nsP4 and a mutated nsP1, wherein the mutated nsP1 has a cysteine ​​residue at position 492 mutated to a serine residue.

[0010] Preferably, the gene sequence of the mutated nsP1 is as described in SEQ ID NO.6.

[0011] Preferably, the alphavirus backbone vector SA further includes the gene sequence of an immunogen selected from IMP3, and the gene sequence of the immunogen is shown in SEQ ID NO.1.

[0012] Preferably, the alphavirus backbone vector includes a promoter, a 5'UTR, a mutated nsP1 gene sequence, a nsP2 gene sequence, a nsp3 gene sequence, a nsp4 gene sequence, an immunogen gene sequence, a 3'UTR, and a PolyA tail.

[0013] Preferably, the gene sequence of nsP2 is as described in SEQ ID NO.3, the gene sequence of nsP3 is as described in SEQ ID NO.4, and the gene sequence of nsP4 is as described in SEQ ID NO.5;

[0014] The nucleotide sequence of the promoter is as described in SEQ ID NO.7, the nucleotide sequence of the 5'UTR is as described in SEQ ID NO.8, the nucleotide sequence of the 3'UTR is as described in SEQ ID NO.10, and the nucleotide sequence of the PolyA tail is as described in SEQ ID NO.11.

[0015] Preferably, the nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.12.

[0016] The present invention also provides a method for preparing the above-mentioned self-replicating mRNA, comprising the following steps:

[0017] Step 1: Digest the plasmid containing the DNA sequence shown in SEQ ID NO.12 with enzymes to obtain a linearized template, and then purify it;

[0018] Step 2: The purified linearized template is transcribed in vitro and purified to obtain purified RNA;

[0019] Step 3: Cap and purify the purified RNA obtained in Step 2 to obtain self-replicating mRNA.

[0020] The present invention also provides the use of the above-described self-replicating mRNA in the preparation of immunogenic compositions.

[0021] Preferably, the immunogenic composition is used for the prevention and / or treatment of tumors.

[0022] The present invention also provides an immunogenic composition, which is prepared by adding pharmaceutically acceptable excipients to the above-mentioned self-replicating mRNA as the active ingredient.

[0023] Beneficial Effects: To construct a highly efficient and persistent samRNA for expressing immunogens, this invention involves a point mutation of nsP1 in the alphavirus backbone vector. The mutated alphavirus backbone vector exhibits higher expression levels and longer-lasting expression of target genes (e.g., tumor antigen IMP3, luciferase Luc). Therefore, the samRNA constructed in this invention can more effectively express the target gene. For example, the IMP3-expressing samRNA constructed in this invention shows better preventive and therapeutic effects against IMP3-positive tumors. Therefore, this invention has excellent application prospects in drug and vaccine development.

[0024] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0025] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0026] Figure 1 shows the EGFP subgene level of different mutant samRNAs expressed in HeLa cells in Experiment Example 1.

[0027] Figure 2 shows the detection of nsP1 in live imaging in Experiment Example 2. C492S - Expression diagram of Luc-samRNA in mice;

[0028] Figure 3 shows the expression of nsP1 in Example 3. C492S -IMP3-samRNA vector map;

[0029] Figure 4 shows nsP1 in Experimental Example 3 of this invention. C492S -Graph showing the level of IMP3 protein expression in cells using the IMP3-samRNA vaccine;

[0030] Figure 5 shows nsP1 in Experiment Example 4 of this invention. C492S Image showing changes in melanoma volume after IMP3-samRNA vaccine injection;

[0031] Figure 6 shows nsP1 in Experimental Example 5 of this invention. C492S -Graph showing changes in colorectal tumor volume after IMP3-samRNA vaccine injection. Detailed Implementation

[0032] The following specific embodiments will be provided to explain the solution of the present invention. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0033] In this invention, the nsP1 point mutation alphavirus vector refers to the use of genetic engineering and artificial intelligence-assisted technology to mutate key sites of the non-structural protein 1 (nsP1) of the VEEV strain, and finally screen to obtain the three sites with the highest mutation rate (as shown in Table 1).

[0034] Table 1 shows the different nsP1 mutation sites obtained after screening.

[0035] Example 1: Different mutant samRNAs expressing EGFP

[0036] In this embodiment, the EGFP gene fragment was cloned into alphavirus vectors with different mutations to obtain recombinant plasmids capable of expressing EGFP-samRNA. Then, samRNA expressing EGFP was obtained through transcription. Specifically, the construction process of the recombinant plasmid is as follows:

[0037] 1.1 Primer Design

[0038] Based on the location of nsP1 on the alphavirus vector, PCR amplification primers and site-directed mutagenesis primers were designed.

[0039] V122L mutant upstream and downstream primers:

[0040] Top primer: 5'GAGCTGGCCGCCCTCATGAGCGACC 3' (SEQ ID NO.14)

[0041] Lower primer: 5'GGTCGCTCATGAGGGCGGCCAGCTC 3' (SEQ ID NO.15)

[0042] P300A mutant upstream and downstream primers:

[0043] Top primer: 5'GGCCTGTATGGGAAGGCTTCAGGCTATGCTG 3' (SEQ ID NO.16)

[0044] Lower primer: 5'CAGCATAGCCTGAAGCCTTCCCATACAGGCC 3' (SEQ ID NO.17)

[0045] C492S mutant upstream and downstream primers:

[0046] Top primer: 5'GTACAAGAAGCTAAGAGCGCAGCCGATGAGG 3' (SEQ ID NO.18)

[0047] Lower primer: 5'CCTCATCGGCTGCGCTCTTAGCTTCTTGTAC 3' (SEQ ID NO.19)

[0048] Upstream and downstream primers for the alphavirus vector:

[0049] Top primer: 5'CCAGTCCGCCCTGAGCAAGAC 3' (SEQ ID NO.20)

[0050] Lower primer: 5'GTCTTTGCTCAGGGCGGACTGG 3' (SEQ ID NO.21)

[0051] The specific construction steps are as follows:

[0052] 1.2 Amplification of alphavirus vector genome fragments from different mutants

[0053] Using the synthesized primers described above as upstream and downstream primers, respectively, PCR was used to amplify the nsP1-containing genomic segments, as detailed below:

[0054] The PCR reaction system was as follows: 100 ng of alphavirus vector plasmid (1:1000 dilution) as template, 1.5 μL each of upstream and downstream primers (10 μM), 10 μL of 5×Prime STAR Buffer, 4 μL of dNTP Mixture, 0.5 μL of Prime STAR HS DNA Polymerase (2.5 U / μL), and water added to a final volume of 50 μL.

[0055] The PCR reaction parameters were: 98℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 25 cycles, followed by 72℃ extension for 5 min.

[0056] PCR products were collected and detected by 1% agarose gel electrophoresis. The products were then recovered from the gel and ligated into an alphavirus vector using homologous recombination. Recombinant plasmids carrying different mutants were constructed, including the T7 promoter (SEQ ID NO.7), 5'UTR (SEQ ID NO.8), nsP1 sequences with different mutation sites, nsP2 (SEQ ID NO.3), nsP3 (SEQ ID NO.4), nsP4 (SEQ ID NO.5), EGFP (SEQ ID NO.13), 3'UTR (SEQ ID NO.10), and a PolyA tail (SEQ ID NO.11). The mutations in nsP1 were as follows: cysteine ​​at position 122 was mutated to leucine (V122L); cysteine ​​at position 492 was mutated to serine (C492S); and proline at position 300 was mutated to alanine (P300A). Finally, the gene was synthesized and cloned into the PUC57-kan vector.

[0057] The constructed plasmid was mixed with 50 μL of DH5α competent E. coli cells (purchased from Qingke Technology Co., Ltd.), and then incubated together on ice for 30 min. After heat shock at 42°C for 90 s, the mixture was immediately returned to ice and incubated on ice for 2 min, followed by incubation at 37°C for 1 hour. The mixture was then sent to Shanghai Qingke Biotechnology Co., Ltd. for sequencing verification. Successfully mutated plasmids were selected and reserved for future use.

[0058] Plasmid extraction was performed using an endotoxin-free plasmid extraction kit (purchased from Tiangen Biotech Co., Ltd.).

[0059] The extracted plasmids were digested with restriction endonucleases to form linearized plasmids, which were then used as transcription templates.

[0060] The specific enzyme digestion steps for in vitro transcription to prepare samRNA are as follows:

[0061] 1. Preparation of linearized templates

[0062] Take 1 mg of the above-mentioned -EGFP-samRNA recombinant plasmids carrying different nsP1 mutations, and digest them at 37℃ for 4 h with the enzyme digestion system (MluI enzyme, purchased from Yisheng Biotechnology Co., Ltd.) to form linearized DNA transcription templates (see Table 2 for the enzyme digestion system); incubate at 50℃ for 2-3 h.

[0063] Table 2 Components of the enzyme digestion system for generating linearized DNA templates

[0064] 2. In vitro transcription

[0065] For the linearized template DNA sequence, vortex all components except for the T7 RNA Polymerase Mix, briefly centrifuge to collect the residue at the bottom of the tube, and store on ice for later use. Prepare the system according to Table 3 below. Here, "Template" refers to the purified linearized template. Use T7 RNA polymerase to generate mRNA on the linearized plasmid (the transcription system for the template DNA is shown in Table 3).

[0066] Add 1 μL of RNase inhibitor (purchased from Nanjing Novizan Biotechnology Co., Ltd.) to a 20 μL system. Gently mix all components with a pipette, briefly centrifuge to collect, and incubate at 37°C for 3 h. Add 1 μL of DNase I to the reaction system and incubate at 37°C for 15 min to digest the transcribed DNA template. Purify using standard methods, specifically lithium chloride precipitation, to obtain the corresponding mRNA.

[0067] Table 3. Composition of the transcription system using linearized DNA template.

[0068] 3. Capping and purifying mRNA

[0069] mRNA was cap1 mRNA final product obtained by capping the mRNA with 2′-O-methyltransferase using the m7G capping kit. All mRNAs were analyzed by agarose gel electrophoresis and stored frozen at -20°C.

[0070] The above mutations can promote the binding of nsP1 with nsP2, nsP3, and nsP4 to form polymerase complex RdRp while maintaining the normal function of nsP1, thereby increasing the expression of the target antigen.

[0071] Example 2: Expression of luciferase Luc samRNA

[0072] In this embodiment, the luciferase (Luc) gene fragment was cloned into nsP1. C492S In the alphavirus vector, to produce nsP1 C492S - Luc-samRNA recombinant plasmid. Then transcribed to obtain samRNA expressing luciferase Luc.

[0073] Specifically, the construction process of the recombinant plasmid is as follows:

[0074] The gene sequences encoding the non-structural proteins nsP1, nsP2, nsP3, and nsP4 of the alphavirus, after mutation, are SEQ ID NO.6, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively. A viral gene replication complex was synthesized based on these sequences. Specifically, the mutation of nsP1 involves a change from cysteine ​​to serine at position 492 of the nsP1 domain (C492S).

[0075] The constructed nsP1 C492S The Luc-samRNA recombinant plasmid structure includes the T7 promoter (SEQ ID NO.7), 5'UTR (SEQ ID NO.8), and nsP1. C492S The genes were synthesized and cloned into the PUC57-kan vector, including nsP2 (SEQ ID NO.6), nsP2 (SEQ ID NO.3), nsP3 (SEQ ID NO.4), nsP4 (SEQ ID NO.5), Luc gene (SEQ ID NO.9), 3'UTR (SEQ ID NO.10), and PolyA tail (SEQ ID NO.11).

[0076] The construction of samRNA in this embodiment is the same as in Example 1, except that the EGFP gene is replaced with the expression of the Luc gene, and the mRNA product is encapsulated using lipid nanoparticles (LNPs). Finally, a samRNA vaccine is prepared. The product in this embodiment is denoted as nsP1. C492S -Luc-samRNA vaccine.

[0077] The preparation method of cationic liposomes (LNP) is as follows:

[0078] The four lipid components were dissolved in ethanol and prepared according to the existing liposome nanoparticle preparation formula, using cationic lipids (including but not limited to SM-102, preferably SM-102 in this embodiment): auxiliary lipids (DSPC): cholesterol: PEG lipids (DMG-PEG) 2000The lipid mixture was prepared by mixing the components in a molar ratio of 50:10:38.5:1.5.

[0079] Microfluidic mixing method: 3 mL of the synthesized mRNA buffer solution and 1 mL of the lipid mixture solution were mixed in a microfluidic apparatus at a total flow rate of 12 mL / min (typically using an organic phase to aqueous phase buffer ratio of 1:3) to obtain mRNA-encapsulated LNPs. After mixing, the LNPs were dialyzed in PBS (pH 7.4) for 2 hours, then aseptically filtered using a 0.2-micron filter, concentrated, and the samRNA vaccine was obtained and stored at 4°C for subsequent application research. The product in this example is designated as nsP1. C492S -Luc-samRNA vaccine.

[0080] Example 3: samRNA expressing IMP3

[0081] The construction of samRNA in this embodiment is the same as in Example 2, except that the Luc gene is replaced with a gene expressing IMP3 (SEQ ID NO.1), as shown in Figure 3. The product of this embodiment is denoted as nsP1. C492S -IMP3-samRNA vaccine.

[0082] Comparative Example 1

[0083] The samRNAs prepared in this comparative example with single-point mutation sites V122L, P300A, and C492S of nsP1 are denoted as V122L, P300A, and C492S, respectively; the samRNAs prepared in this comparative example with two mutation sites are denoted as V122L+P300A, C492S+V122L, and C492S+P300A, respectively; and the samRNAs prepared in this comparative example with three mutation sites are denoted as V122L+P300A+C492S.

[0084] Comparative examples were prepared using the method in Example 2 to produce samRNA expressing luciferase Luc, or using the method in Example 3 to produce samRNA expressing IMP3. The difference was that the recombinant plasmids used did not contain a mutated nsP1 gene, and the nucleotide sequence of the unmutated nsP1 gene was as described in SEQ ID NO. 2.

[0085] The samRNA expressing luciferase Luc prepared in this comparative example is denoted as nsP1. wt -Luc-samRNA vaccine;

[0086] The samRNA expressing IMP3 prepared in this comparative example is denoted as nsP1. wt -IMP3-samRNA vaccine.

[0087] The following is the nucleotide sequence involved in this invention:

[0088] The gene sequence of IMP3 (SEQ ID NO.1):

[0089] The gene sequence of nsP1 (SEQ ID NO.2):

[0090] The gene sequence of nsP2 (SEQ ID NO.3):

[0091] The gene sequence of nsP3 (SEQ ID NO.4):

[0092] The gene sequence of nsP4 (SEQ ID NO.5):

[0093] The gene sequence of the point mutation nsP1(C492S) (SEQ ID NO.6):

[0094] T7 promoter (SEQ ID NO.7):

[0095] 5'UTR (SEQ ID NO.8)

[0096] The gene for luciferase Luc (SEQ ID NO.9):

[0097] 3'UTR (SEQ ID NO.10):

[0098] PolyA tail (SEQ ID NO.11):

[0099] nsP1 C492S -IMP3-samRNA full sequence (SEQ ID NO.12):

[0100] EGFP gene (SEQ ID NO.13):

[0101] The technical solution of the present invention will be further illustrated by the following experiments. In the following experiments, the samples used were prepared according to…

[0102] nsP1 prepared in Examples 1, 2, 3 and Comparative Examples 突变体 / wt -EGFP-samRNA, nsP1 C492S -Luc-samRNA, nsP1 C492S -IMP3-samRNA, nsP1 wt -Luc-samRNA and nsP1 wt -IMP3-samRNA.

[0103] Example 1: EGFP expression levels in HeLa cells 24 hours after transfection with samRNA from different mutants.

[0104] The experimental samRNAs in this experiment were prepared according to Example 1 and were divided into unmutated WT and seven mutant alphavirus vector samRNA groups (single-point mutation: V122L, P300A, C492S; two-site mutation: V122L+P300A, C492S+V122L, C492S+P300A; three-site mutation: V122L+P300A+C492S).

[0105] Pre-treat with 12 mL of complete culture medium (DMEM (PM150210) + 10% FBS (164210-50) + 1% P / S (PB180120)) to seed HeLa cells into 24-well plates. After culturing the next day, cells reached 60% confluence. Add samRNA (10 μg / well) of mutants V122L, P300A, C492S, V122L+P300A, C492S+V122L, C492S+P300A, and V122L+P300A+C492S, and lipo3000 transfection reagent (1:1 mixture). Mix well and incubate at 37°C. After 24 h of culture, collect cells, tissues, or plasma, and isolate total RNA using Trizol reagent. Reverse transcription was performed using the PrimeScript RT kit (Takara, catalog number #RR047A) according to the manufacturer's instructions. Primer pairs were designed using Primer3Plus (3.3.0): EGFP gene primers SEQ ID NO.22: 5'GCCACCATGATGGTGAGCAAG 3' and SEQ ID NO.23: 5'GTTGCCTTGTACAGCTCGTCC 3'. Gene amplification was performed on a real-time quantitative PCR system using SYBR Green Master Mix (Vazyme, catalog number #Q411-02).

[0106] qPCR results showed that 24 hours after transfection, cells carrying nsP1 were detected. C492S The samRNA with a single point mutation exhibited a significantly higher EGFP RNA copy number than other nsP1 single point mutants; while mutants containing two or more mutations showed significantly reduced replication ability. These results demonstrate that the nsP1 described in this invention... C492S The mutant can mediate higher levels of EGFP expression compared to other mutant forms (Figure 1).

[0107] Experimental Example 2 nsP1 C492S -Luc-samRNA and nsP1 wt Comparison of Luc-samRNA expression levels and duration

[0108] The experimental group in this experiment consisted of the unmutated alphavirus vector samRNA vaccine group (nsP1). wt -Luc-samRNA) and mutant alphavirus vector (C492S) samRNA vaccine group (nsP1) C492S -Luc-samRNA).

[0109] 5 female BALB / c mice (n=5) were intravenously injected with 5 μg nsP1 into the tail portion. C492S -Luc-samRNA or nsP1 wt -Luc-samRNA expression was detected by a mouse in vitro imaging system (PerkinElmerIVIS Lumina III). Ten minutes before measurement, 200 μL of fluorescein dissolved in PBS (30 mg / mL) was injected intraperitoneally. Changes in Luc expression in mice were observed at 5, 7, 9, 11, 13, 15, and 20 days after injection. The results are shown in Figure 2.

[0110] nsP1 was observed using an in vivo imaging system (IVIS). C492S -Enhanced transgene expression levels and duration of the Luc-samRNA vaccine. nsP1 C492S - Luc expression in the Luc-samRNA group peaked on day 5. nsP1 wt Luc expression in the Luc-samRNA group also peaked on day 5, but its expression decreased significantly faster than that of nsP1. C492S -Luc-samRNA group. Furthermore, on day 7, Luc expression was significantly lower than nsP1. C492S -Luc-samRNA group. Figure 2 shows that nsP1 at 20 days post-drug administration. C492S -Luc-samRNA vaccine shows Luc expression higher than nsP1 wtThe expression of the Luc-samRNA vaccine was approximately twice as high.

[0111] The above experimental results show that the nsP1 provided by this invention... C492S -Luc-samRNA compared to nsP1 made from unmutated nsP1 wt -Luc-samRNA has a higher expression level.

[0112] Experimental Example 3 nsP1 C492S Detection of IMP3-samRNA vaccine expression level in vitro

[0113] The experimental group in this experiment consisted of the unmutated samRNA vaccine group (nsP1). wt -IMP3-samRNA) and mutant alphavirus vector samRNA vaccine group (nsP1) C492S -IMP3-samRNA).

[0114] Prepare 12 mL of complete culture medium (DMEM (PM150210) + 10% FBS (164210-50) + 1% P / S (PB180120) beforehand. Seed HEK293T (human embryonic kidney cells) cells into 24-well plates. After culturing the next day, the cells reached 60% confluence. Add nsP1 to each well. C492S -IMP3-samRNA and nsP1 wt -IMP3-samRNA (10μg / well), mix well and place in a 37℃ incubator. After culturing for 48h, extract the protein.

[0115] The expression of the IMP3 target protein was detected by Western blotting. The specific method is as follows:

[0116] (1) Collect HEK293T expression cells from different groups into 1.5mL EP tubes, centrifuge at 1000rpm for 5min, wash once with PBS, and centrifuge at 1000rpm for 5min.

[0117] (2) Add 100 μL of RIPA (with added protease inhibitor) to each well, lyse on ice for 30 min, centrifuge at 12000 rpm and 4℃ for 10 min, and collect the supernatant into a 1.5 mL EP tube.

[0118] (3) Sample electrophoresis, sample preparation, add 5X sample loading buffer, 100℃ metal bath for 5 min; prepare electrophoresis buffer, protein sample loading, sample loading volume of 15 μL per well; 80V electrophoresis for 10 min, 150V electrophoresis for 40 min.

[0119] (4) Transfer membrane: pry open the electrophoresis gel plate, cut out the gel and put it into the transfer solution, prepare the PVDF membrane, and place one filter paper, gel, PVDF membrane and one filter paper in order from top to bottom. Assemble the transfer tank, add the transfer solution, and perform wet transfer at room temperature 400mA for 60 minutes.

[0120] (5) After the transfer is completed, cut the PVDF membrane and seal it with 5% skim milk at room temperature for 1 hour; rinse once with TBST for 5 minutes.

[0121] (6) Primary antibody was left to stand overnight at 4°C; TBST was used to rinse 3 times, 5 min each time.

[0122] (7) Secondary antibody shaker at room temperature for 2 hours; TBST rinse 3 times, 5 min each time.

[0123] (8) Color development: Mix solution A and solution B of ECL luminescent agent in a 1:1 ratio and add them dropwise to the PVDF film with protein side.

[0124] Exposure, development, photography, and data processing are all conducted in a darkroom.

[0125] The developed bands were processed and analyzed using ImageJ software. The results are shown in Figure 4, and compared with nsP1. wt Compared to the -IMP3-samRNA group, nsP1 C492S Transfection of HEK293T with IMP3-samRNA for 48 hours can effectively increase the expression level of IMP3 protein, with the expression level of IMP3 protein increasing by about 2 times.

[0126] Experimental Example 4 nsP1 C492S Validation of the anti-melanoma efficacy of IMP3-samRNA vaccine

[0127] This experimental example provides nsP1 C492S The experimental procedure for validating the antitumor efficacy of the IMP3-samRNA vaccine is as follows:

[0128] Establishment of a subcutaneous IMP3-positive mouse melanoma model: Eighteen healthy 6-8 week old C57BL / 6 mice were selected and subcutaneously injected with 5 × 10⁶ B16F10 cells. 5 / each, the cells overexpress humanized IMP3, the number of mice in each group was 6.

[0129] C57BL / 6 mice were first administered the drug on day 5 after inoculation with melanoma cells, followed by a second administration three days later, for a total of three administrations. The control group received PBS, while the other two groups received nsP1. wt -IMP3-samRNA and nsP1 C492SImmunotherapy with IMP3-samRNA was administered at a volume of 50 μL (10 μg / mouse / treatment). Tumor size in mice was measured at regular intervals using calipers on days 5, 7, 9, 11, 13, 15, 20, 25, and 30.

[0130] The results are shown in Figure 5, which depicts the changes in mouse tumors after treatment. As shown in Figure 5, the tumors in the control group mice grew rapidly, reaching a volume of 1200 mm². 3 Give nsP1 C492S -IMP3-samRNA and nsP1 wt In mice with -IMP3-samRNA, tumor growth was slower, compared to nsP1. wt Compared to the -IMP3-samRNA group, nsP1 C492S The IMP3-samRNA group showed slower tumor growth in mice. Tumor volume growth curves indicate that the IMP3-based samRNA vaccine effectively inhibits tumor growth, with nsP1 being a key component. C492S -IMP3-samRNA group more effectively inhibited tumor growth (Figure 5).

[0131] Experimental Example 5 nsP1 C492S Validation of the efficacy of IMP3-samRNA vaccine against colorectal cancer

[0132] This experimental example provides nsP1 C492S The experimental procedure for validating the antitumor efficacy of the IMP3-samRNA vaccine is as follows:

[0133] Establishment of IMP3-positive mouse subcutaneous colorectal cancer model: Eighteen healthy 6-8 week old BALB / c mice were selected and subcutaneously injected with 1×10⁻⁶ CT26 cells. 6 / each, the cells overexpress humanized IMP3, the number of mice in each group was 6.

[0134] BALB / c mice were given their first dose of CT26 cells on day 8 after inoculation, followed by a second dose two days later, for a total of three doses. The control group received PBS, while the other two groups received nsP1. wt -IMP3-samRNA and nsP1 C492S Immunotherapy with IMP3-samRNA was administered at a volume of 50 μL (10 μg / mouse / treatment). Tumor size in mice was measured at regular intervals using calipers on days 8, 10, 12, 14, 16, and 18.

[0135] The results are shown in Figure 6, which depicts the changes in mouse tumors after treatment. As shown in Figure 6, the tumors in the control group mice grew rapidly, reaching a volume of 1300 mm². 3 Give nsP1 C492S -IMP3-samRNA and nsP1 wt In mice with -IMP3-samRNA, tumor growth was slower, compared to nsP1. wt Compared to the -IMP3-samRNA group, nsP1 C492S The IMP3-samRNA group showed slower tumor growth in mice. Tumor volume growth curves indicate that the IMP3-based samRNA vaccine effectively inhibits tumor growth, with nsP1 being a key component. C492S -IMP3-samRNA group more effectively inhibits tumor growth.

[0136] The above experimental results show that, compared to the unmutated nsP1 wt -IMP3-samRNA vaccine, nsP1 made from a mutant alphavirus vector. C492S -IMP3-samRNA vaccines can more effectively inhibit the development of IMP3-positive tumors.

[0137] As can be seen from the above embodiments and experimental examples, constructing samRNA according to the scheme of the present invention can express the target gene more efficiently and continuously, and can also more effectively exert the efficacy of the prepared vaccine, such as nsP1. C492S The IMP3-samRNA vaccine demonstrates its inhibitory effect on IMP3-positive tumors. Therefore, this invention shows great promise for application in drug and vaccine development.

Claims

1. A self-replicating mRNA, characterized in that: The self-replicating mRNA is transcribed from an alphavirus backbone vector, which includes the gene sequences of alphavirus non-structural proteins nsP2, nsP3, nsP4 and a mutated nsP1, wherein the mutated nsP1 has a cysteine ​​residue at position 492 mutated to a serine residue.

2. The self-replicating mRNA according to claim 1, characterized in that: The gene sequence of the mutated nsP1 is as described in SEQ ID NO.

6.

3. The self-replicating mRNA according to claim 1, characterized in that: The alphavirus backbone vector also includes the gene sequence of an immunogen selected from IMP3, and the gene sequence of the immunogen is shown in SEQ ID NO.

1.

4. The self-replicating mRNA according to any one of claims 1 to 3, characterized in that: The alphavirus backbone vector includes a promoter, a 5'UTR, a mutated nsP1 gene sequence, a nsP2 gene sequence, a nsp3 gene sequence, a nsp4 gene sequence, an immunogen gene sequence, a 3'UTR, and a PolyA tail.

5. The self-replicating mRNA according to claim 4, characterized in that: The gene sequence of nsP2 is as described in SEQ ID NO.3, the gene sequence of nsP3 is as described in SEQ ID NO.4, and the gene sequence of nsP4 is as described in SEQ ID NO.5; The nucleotide sequence of the promoter is as described in SEQ ID NO.7, the nucleotide sequence of the 5'UTR is as described in SEQ ID NO.8, the nucleotide sequence of the 3'UTR is as described in SEQ ID NO.10, and the nucleotide sequence of the PolyA tail is as described in SEQ ID NO.

11.

6. The self-replicating mRNA according to claim 1, characterized in that: The nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.

12.

7. The method for preparing self-replicating mRNA according to any one of claims 1 to 6, characterized in that, Includes the following steps: Step 1: Digest the plasmid containing the DNA sequence shown in SEQ ID NO.12 with enzymes to obtain a linearized template, and then purify it; Step 2: The purified linearized template is transcribed in vitro and purified to obtain purified RNA; Step 3: Cap and purify the purified RNA obtained in Step 2 to obtain self-replicating mRNA.

8. Use of the self-replicating mRNA according to any one of claims 1 to 6 in the preparation of immunogenic compositions.

9. The use according to claim 8, characterized in that: The immunogenic composition is used for the prevention and / or treatment of tumors.

10. An immunogenic composition, characterized in that, It is prepared by adding pharmaceutically acceptable excipients to the self-replicating mRNA as described in any one of claims 1 to 6 as the active ingredient.

Images