Composition for inducing differentiation of human induced pluripotent stem cells into insulin-producing cells and method for inducing differentiation into insulin-producing cells by using same

The use of isoproterenol in a differentiation composition enhances the differentiation and insulin secretion function of insulin-producing cells derived from human induced pluripotent stem cells, addressing the limitations of current methods and improving their clinical applicability.

WO2026084398A1PCT designated stage Publication Date: 2026-04-23THE ASAN FOUND +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
THE ASAN FOUND
Filing Date
2025-10-13
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Current methods for differentiating insulin-producing cells from human induced pluripotent stem cells face challenges in enhancing differentiation potential and insulin secretion function, leading to insufficient clinical applicability.

Method used

A composition comprising isoproterenol (ISO) is used to induce differentiation of insulin-producing cells from human induced pluripotent stem cells, enhancing differentiation ability and insulin secretion function through culturing in a medium containing ISO.

Benefits of technology

The method increases the differentiation potential and insulin secretion function of insulin-producing cells, making them suitable for clinical applications in diabetes treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025016050_23042026_PF_FP_ABST
    Figure KR2025016050_23042026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for inducing differentiation of human induced pluripotent stem cells into insulin-producing cells, and a method for inducing differentiation into insulin-producing cells by using the composition.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells and method for inducing differentiation of insulin-producing cells using the same

[0001] [Cross-reference with related applications]

[0002] This application claims the benefit of priority based on Korean Patent Application No. 10-2024-0139582 filed on October 14, 2024, and all contents disclosed in said Korean Patent Application are incorporated herein as part of this specification.

[0003] The present invention relates to a composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells and a method for inducing differentiation of insulin-producing cells using the same.

[0004]

[0005] Diabetes is a chronic disease affecting many people worldwide and is a metabolic disorder characterized by a lack of proper insulin production or insulin function. Diabetic patients are characterized by hyperglycemia, which is an elevated concentration of glucose in the blood; this hyperglycemia causes various symptoms and signs and leads to the excretion of glucose in the urine.

[0006] Currently, alternative therapies such as insulin injections are primarily used to treat diabetes, but these are merely temporary solutions and pose problems that can cause various complications. Therefore, regulating glucose metabolism through the body's natural physiological metabolism by transplanting intracellular insulin-secreting pancreatic cells or Langerhans islets could be a fundamental treatment for diabetes. However, pancreatic transplantation has limitations, as it can cause side effects such as surgical complications and requires the lifelong use of excessive immunosuppressants. In particular, unlike the aforementioned pancreatic transplantation, islet cell transplantation can be easily performed without complications through a relatively simple surgery, making it the most ideal treatment method.

[0007] Meanwhile, transplantable pancreatic islet cells for diabetic patients can only be obtained from pancreatic donors and can only be produced through a method of isolating the islet cells in a pure form, making it difficult to provide treatment through transplantation to many diabetic patients. Accordingly, research is actively underway to develop insulin-secreting cells or pancreatic beta cells differentiated from stem cells as new sources of pancreatic islet cells.

[0008] In particular, induced pluripotent stem cells (iPSCs) possess effective utility value for clinical diabetes treatment because they can proliferate sufficiently and produce high-quality insulin-producing cells suitable for human transplantation due to their high differentiation potential. However, even when iPSCs are differentiated into pancreatic islet cells, the differentiation potential remains low or the differentiated islet cells lack glucose responsiveness, resulting in a lack of clinically applicable outcomes. Therefore, there is a need to develop methods to enhance the differentiation potential of insulin-producing cells and improve the functionality of the differentiated insulin-producing cells.

[0009]

[0010] One objective of the present invention is to provide a composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells, which can improve differentiation ability into insulin-producing cells and the insulin secretion function of the differentiated insulin-producing cells.

[0011] Another objective of the present invention is to provide a medium for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells comprising the above composition.

[0012] Another objective of the present invention is to provide a method for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells that can improve the differentiation ability and insulin secretion function of insulin-producing cells.

[0013] Another objective of the present invention is to provide insulin-producing pancreatic cells produced by the above method.

[0014] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of diabetes comprising the insulin-producing pancreatic cells.

[0015]

[0016] To achieve the above objective, one aspect of the present invention provides a composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells comprising isoproterenol (ISO).

[0017] Another aspect of the present invention provides a medium for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells comprising the above composition as an active ingredient.

[0018] Another aspect of the present invention provides a method for inducing differentiation of human induced pluripotent stem cells into insulin-producing cells, comprising the steps of: culturing human induced pluripotent stem cells to induce differentiation into pancreatic progenitor cells; and culturing the pancreatic progenitor cells in a medium containing isoproterenol (ISO) to induce differentiation into insulin-producing cells.

[0019] Another aspect of the present invention provides insulin-producing pancreatic cells produced by the above method.

[0020] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of diabetes comprising the insulin-producing pancreatic cells.

[0021]

[0022] The composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells according to the present invention uses isoproterenol, a beta-adrenergic receptor agonist, to enhance the differentiation ability of human-derived induced pluripotent stem cells into insulin-producing pancreatic endocrine cells or pancreatic beta cells, and has the effect of increasing the functionality of said insulin-producing cells, such as insulin secretion function, responsiveness to glucose metabolism, and cell viability. The differentiation induction method of the present invention can be effectively applied to both 2D and 3D culture systems, allowing for the differentiation of insulin-producing cells from induced pluripotent stem cells in high yield, and since these insulin-producing cells have excellent functionality, they can be utilized for the fundamental prevention or treatment of diabetes.

[0023] However, the effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the description below.

[0024]

[0025] Figure 1 is a figure showing the 2D culture and ISO treatment process of human-derived induced pluripotent stem cells.

[0026] Figure 2 is a figure showing the 3D culture and ISO processing of the human-derived induced pluripotent stem cells.

[0027] Figure 3 is a figure showing the morphology and viability of cells according to the treatment concentration of ISO after treating pancreatic progenitor cells with ISO.

[0028] Figure 4 shows the mRNA expression levels of insulin, Pdx1, Nkx6.1, and MAFA in insulin-producing cells differentiated with and without ISO addition, confirmed by qPCR.

[0029] Figure 5 shows the levels of insulin and PDX1 expression confirmed through immunofluorescence staining analysis in insulin-producing cells differentiated with and without ISO addition.

[0030] Figure 6 is a figure showing the degree of insulin secretion in insulin-producing cells differentiated with and without ISO addition, through an analysis of the responsiveness of the differentiated cells to glucose.

[0031] Figure 7 is a figure showing the results of visually observing the total of 5 differentiation stages of Figure 2 to compare differentiation ability according to ISO treatment in a 3D culture differentiation protocol of human-derived induced pluripotent stem cells.

[0032] Figure 8 shows the mRNA expression levels of PDX1, NEUROG3, insulin, somatostatin, MAFA, and IAPP in insulin-producing cells differentiated with or without ISO addition in a 3D culture differentiation protocol of human-derived induced pluripotent stem cells, confirmed by qPCR.

[0033] Figure 9 shows the levels of C-peptide in insulin-producing cells differentiated with and without ISO addition in a 3D culture differentiation protocol of human-derived induced pluripotent stem cells, confirmed through flow cytometry analysis.

[0034] Figure 10 shows the results of transcriptome analysis of insulin-producing cells differentiated with and without ISO addition.

[0035]

[0036] The present invention will be described in detail below.

[0037]

[0038] 1. Composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells

[0039] One aspect of the present invention provides a composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells (iPSCs), comprising isoproterenol (ISO).

[0040] The above-mentioned isoproterenol is an isopropyl analog of adrenaline. It acts specifically on beta-adrenergic receptors among sympathomimetic amines. The above-mentioned isoproterenol acts on the heart, bronchial smooth muscle, skeletal muscle blood vessels, and the digestive tract, possessing properties that cause a decrease in peripheral vascular resistance, an increase in cardiac output, and relaxation of smooth muscles in the trachea and digestive tract. Clinically, it is used as a bronchodilator for asthma and as a cardiac stimulant for heart disease. The above-mentioned isoproterenol can induce insulin secretion by stimulating beta-adrenergic receptors. Furthermore, by stimulating the above-mentioned beta-adrenergic receptors, the above-mentioned isoproterenol can activate intracellular PKA (Protein kinase A) and ERK (Extracellular signal-regulated kinase) signals. Due to the various effects of the above-mentioned isoproterenol, it may possess various functions related to cell survival and metabolism, in addition to increasing insulin secretion.

[0041] The above-mentioned pluripotent stem cells refer to stem cells that possess pluripotency and can differentiate into all three germ layers that constitute a living organism: the endoderm, mesoderm, and ectoderm. The above-mentioned induced pluripotent stem cells (iPSCs) were used. Induced pluripotent stem cells are pluripotent stem cells artificially created by inducing adult somatic cells, which are mastocytes, through the artificial expression of specific genes, and are known to be similar in many respects to natural pluripotent stem cells such as embryonic stem cells.

[0042] In one embodiment of the present invention, human induced pluripotent stem cells may be derived from skin tissue, and specifically, may be fibroblasts of the skin that have been dedifferentiated.

[0043] The aforementioned differentiation refers to the phenomenon in which structures or functions become specialized among cells during their growth through division and proliferation; in other words, it describes the phenomenon in which the form or function of biological cells, tissues, etc., changes in order to perform the specific tasks assigned to them.

[0044] The above insulin is a hormone secreted by beta (β) cells in the islets of Langerhans of the pancreas, which functions to lower blood sugar levels in the body and is involved in metabolic regulation directly or indirectly in many tissues and organs.

[0045] The above insulin-producing cells refer to all types of cells that produce or secrete insulin and can be understood as identical to insulin-secreting cells. Specifically, the above insulin-producing cells may be pancreatic cells or Langerhans islet cells, and in particular, pancreatic beta cells.

[0046] In one embodiment of the present invention, human induced pluripotent stem cells can be differentiated into endocrine cells by using the differentiation-inducing composition of the present invention, and specifically, human induced pluripotent stem cells can be differentiated into insulin-producing cells by using the differentiation-inducing composition of the present invention.

[0047] In one embodiment of the present invention, human induced pluripotent stem cells can be differentiated into pancreatic beta cells by using the differentiation-inducing composition of the present invention.

[0048] When the differentiation-inducing composition of the present invention is applied to the endocrine differentiation process of the human induced pluripotent stem cells into insulin-producing cells, the differentiation ability of the insulin-producing cells can be enhanced.

[0049] In a specific embodiment of the present invention, the mRNA expression levels of pancreatic beta cell differentiation-related factors (Insulin, PDX1, NKX6.1, MAFA, and GLUT2) were analyzed in differentiated cells treated with and untreated with the ISO of the differentiation-inducing composition of the present invention during the endocrine differentiation process of human induced pluripotent stem cells. As a result, it was confirmed that the mRNA expression levels of the differentiation-related factors were higher in the ISO-treated group compared to the untreated group.

[0050] When the differentiation-inducing composition of the present invention is applied to the insulin-producing cells of the human induced pluripotent stem cells during the endocrine differentiation process, the insulin secretion ability of the insulin-producing cells can be enhanced. Therefore, by inducing endocrine differentiation of human induced pluripotent stem cells using the differentiation-inducing composition of the present invention, the insulin secretion function of the differentiated insulin-producing cells can be increased.

[0051] In a specific embodiment of the present invention, insulin expression and secretion levels were compared and analyzed in differentiated cells treated with and untreated with the ISO of the differentiation-inducing composition of the present invention during the endocrine differentiation process of human induced pluripotent stem cells. As a result, it was confirmed that insulin expression and secretion were significantly higher in the ISO-treated group compared to the untreated group.

[0052] When the differentiation-inducing composition of the present invention is applied to human induced pluripotent stem cells during the endocrine differentiation process into insulin-producing cells, the C-peptide secretion ability of the insulin-producing cells can be enhanced. Therefore, by inducing endocrine differentiation of human induced pluripotent stem cells using the differentiation-inducing composition of the present invention, the C-peptide secretion function of the differentiated insulin-producing cells can be increased.

[0053] The above C-peptide is a type of peptide in which two or more amino acids are combined. It is secreted along with insulin from secretory granules of pancreatic cells, but because it is not broken down in the blood, it is used as an indicator of the insulin secretion function of the pancreas.

[0054] In a specific embodiment of the present invention, intracellular C-peptide levels were compared by flow cytometry in differentiated cells treated with and untreated with the ISO of the differentiation-inducing composition of the present invention during the endocrine differentiation process of human induced pluripotent stem cells. As a result, it was confirmed that the intracellular C-peptide concentration was higher in the group treated with ISO compared to the untreated group.

[0055] The above differentiation-inducing composition can be used in the process of generating insulin-secreting cells by differentiating human induced pluripotent stem cells into planar cells (2D differentiation) and spherical clusters into three-dimensional cells (3D differentiation).

[0056] The process of generating insulin-secreting cells by 2D differentiating the above human induced pluripotent stem cells may include the step of differentiating human induced pluripotent stem cells into a definitive endoderm (DE), the step of differentiating the definitive endoderm into pancreatic progenitor cells (PP), and the step of differentiating the pancreatic progenitor cells into insulin-producing cells (Fig. 1).

[0057] The process of generating insulin-secreting cells by 3D differentiating the above human induced pluripotent stem cells may include the steps of differentiating human induced pluripotent stem cells into a definitive endoderm (DE), differentiating the definitive endoderm into a primitive gut tube (PGT), differentiating the primitive gut tube into a pancreatic progenitor (PP), and differentiating the pancreatic progenitor into an insulin-producing cell.

[0058] The differentiation-inducing composition of the present invention may be applied during the step of differentiating pancreatic progenitor cells into insulin-producing cells during the 2D differentiation and 3D differentiation processes of the human induced pluripotent stem cells. That is, the differentiation-inducing composition of the present invention may be applied to pancreatic progenitor cells differentiated from human induced pluripotent stem cells, and may be applied to the pancreatic progenitor cells to induce differentiation into insulin-producing cells.

[0059]

[0060] 2. Application of the differentiation-inducing composition of the present invention

[0061] Another aspect of the present invention provides a medium for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells, comprising the differentiation-inducing composition as an active ingredient.

[0062] The above culture medium is a mixture in which nutrients required by the culture medium as a main component are added for the purpose of culturing microorganisms or animal and plant cells or tissues.

[0063] The medium of the present invention may contain the isoproterenol of the differentiation-inducing composition at a concentration of 10 to 700 nM, for example, the isoproterenol in the medium at 20 to 680 nM, 30 to 660 nM, 40 to 640 nM, 50 to 620 nM, 60 to 600 nM, 70 to 580 nM, 80 to 560 nM, 90 to 540 nM, 100 to 520 nM, 110 to 500 nM, 120 to 480 nM, 130 to 460 nM, 140 to 450 nM, 150 to 440 nM, 160 to 430 nM, 170 to 420 nM, 180 to 410 nM, or 190 to It can be included at a concentration of 410 nM, and in particular, at a concentration of 200 to 400 nM.

[0064] The medium of the present invention may further include nutrients necessary for the culture of cells or tissues together with the ISO of the differentiation-inducing composition.

[0065] Accordingly, the medium of the present invention may further include at least one selected from the group consisting of B27, forskolin, dexamethasone, nicotinamide, exendin-4, and T3.

[0066] In one embodiment of the present invention, during the 2D differentiation process of human induced pluripotent stem cells, pancreatic progenitor cells differentiated from human induced pluripotent stem cells can be cultured in a medium comprising ISO, B27, forskolin, dexamethasone, nicotinamide, exendin-4, and T3.

[0067] In addition, the medium of the present invention may further include at least one selected from the group consisting of ALK5 inhibitor II, T3, SANT-1, retinoic acid (RA), heparin, XXi (γ-secretase inhibitor), and forskolin.

[0068] In one embodiment of the present invention, during the 3D differentiation process of human induced pluripotent stem cells, pancreatic progenitor cells differentiated from human induced pluripotent stem cells can be cultured in a medium comprising ISO, ALK5 inhibitor II, T3, SANT-1, retinoic acid (RA), heparin, XXi (γ-secretase inhibitor), and forskolin.

[0069] The above medium may include a medium selected from the group consisting of DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), improved MEM (iMEM), BME (Basal Medium Eagle), RPMI 1640 (Roswell Park Memorial Institute medium 1640), Advanced RPMI 1640 (Advanced RPMI1640), F-10, F-12, DMEM-F12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), and MCDB 131, but is not limited thereto; any medium capable of inducing differentiation of pluripotent stem cells into insulin-producing cells or supporting cell survival may be used without limitation.

[0070] In one embodiment of the present invention, the medium may be an iMEM medium containing the ISO. Specifically, in the 2D differentiation process of human induced pluripotent stem cells, pancreatic progenitor cells differentiated from human induced pluripotent stem cells may be cultured in an iMEM medium containing the ISO.

[0071] In one embodiment of the present invention, the medium may be an MCDB131 medium containing ISO. Specifically, in the 3D differentiation process of human induced pluripotent stem cells, pancreatic progenitor cells differentiated from human induced pluripotent stem cells may be cultured in an MCDB131 medium containing ISO.

[0072]

[0073] Another aspect of the present invention provides a method for inducing differentiation of human induced pluripotent stem cells into insulin-producing cells, comprising the steps of: (a) culturing human induced pluripotent stem cells (iPSCs) to induce differentiation into pancreatic progenitor cells (PPs); and (b) culturing the differentiated pancreatic progenitor cells in a medium containing isoproterenol (ISO) to induce differentiation into insulin-producing cells.

[0074] The above step (a) of culturing human induced pluripotent stem cells to induce differentiation into pancreatic progenitor cells may include a step of differentiating human induced pluripotent stem cells into endoderm and a step of differentiating from endoderm into pancreatic progenitor cells.

[0075] In addition, the step (a) of culturing human induced pluripotent stem cells to induce differentiation into pancreatic progenitor cells may include the step of differentiating human induced pluripotent stem cells into endoderm, the step of differentiating from endoderm into primitive gout, and the step of differentiating from primitive gout into pancreatic progenitor cells.

[0076] The step of differentiating the human induced pluripotent stem cells into the endoderm may involve culturing the human induced pluripotent stem cells in a medium capable of differentiating the human induced pluripotent stem cells into the endoderm to generate the endoderm. As for the medium capable of differentiating the human induced pluripotent stem cells into the endoderm, any medium having the property of inducing differentiation of the human induced pluripotent stem cells into the endoderm may be used without limitation, and for example, a medium containing at least one selected from the group consisting of fetal bovine serum (FBS), human activin A (PeproTech, USA), and CHIR99021 (Sigma-Aldrich, USA) may be used.

[0077] The step of differentiating the endoderm into pancreatic progenitor cells may involve culturing the endoderm differentiated from the human induced pluripotent stem cells in a medium capable of differentiating them into pancreatic progenitor cells to generate pancreatic progenitor cells. As for the medium capable of differentiating the endoderm into pancreatic progenitor cells, any medium having the property of inducing differentiation of pancreatic progenitor cells from the endoderm may be used without limitation, and for example, a medium containing at least one selected from the group consisting of B27, dorsomorphin, retinoic acid, SB431542 (Tocris Bioscience, UK), FGF2 (Fibroblast growth factor 2), and SANT-1 (Sigma-Aldrich, USA) may be used.

[0078] The step of differentiating the endoderm into a primitive gut may involve culturing the endoderm differentiated from the human induced pluripotent stem cells in a medium capable of differentiating it into a primitive gut to generate a primitive gut. As for the medium capable of differentiating the endoderm into a primitive gut, any medium having the property of inducing differentiation of the endoderm into a primitive gut may be used without limitation, and for example, a medium containing KGF (Keratinocyte Growth Factor) may be used.

[0079] The step of differentiating the above-described differentiated primitive gut into pancreatic progenitor cells may involve generating pancreatic progenitor cells by culturing the primitive gut differentiated from the above-described endoderm in a medium capable of differentiating into pancreatic progenitor cells. As for the medium capable of differentiating the above-described primitive gut into pancreatic progenitor cells, any medium having the property of inducing differentiation of the primitive gut into pancreatic progenitor cells may be used without limitation, and for example, a medium containing at least one selected from the group consisting of KGF (Keratinocyte Growth Factor), retinoic acid, TPPB, LDN, and SANT-1 (Sigma-Aldrich, USA) may be used.

[0080] Step (b) above involves culturing the differentiated pancreatic progenitor cells in a medium containing isoproterenol (ISO) to induce differentiation into insulin-producing cells.

[0081] The medium in step (b) above can be understood to be the same as the differentiation induction medium of the present invention, and thus the medium is not described redundantly.

[0082] The above differentiation may be carried out through a 2D differentiation or 3D differentiation culture system.

[0083]

[0084] Another aspect of the present invention provides insulin-producing pancreatic cells produced by the above method of the present invention.

[0085] The above pancreatic cells may be endocrine aggregates of pancreatic endocrine cells, and the above pancreatic cells may be pancreatic beta cells.

[0086] The pancreatic cells of the present invention may have enhanced insulin secretion ability and C-peptide secretion ability.

[0087] In addition, the pancreatic cells of the present invention may have enhanced responsiveness to glucose metabolism.

[0088] In addition, the pancreatic cells of the present invention may have increased expression of the genes Insulin, PDX1 (pancreatic and duodenal homeobox 1), NKX6.1 (NK6 Homeobox 1), MAFA (Pancreatic Beta-Cell-Specific Transcriptional Activator), and GLUT2 (Glucose transporter 2), which are differentiation-related factors of pancreatic beta cells that play an important role in glucose transport or insulin secretion.

[0089] In addition, the pancreatic cells of the present invention may have an enhanced survival rate.

[0090] In addition, the pancreatic cells of the present invention may have increased expression of genes for endocrine cell differentiation-related factors PDX1, NEUROG3 (neurogenin 3), insulin (insulin, INS), somatostatin (somatostatin, SST), MAFA, and IAPP (Islet Amyloid Polypeptide).

[0091]

[0092] Another aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of diabetes comprising the insulin-producing pancreatic cells as an active ingredient.

[0093] In this specification, "active ingredient" means an ingredient that exhibits the intended activity alone or can exhibit the intended activity together with a carrier, etc., which is inactive itself.

[0094] The term "diabetes mellitus" as used in this specification refers to a metabolic disease characterized by high blood glucose levels, such as insufficient insulin secretion or failure to perform normal function.

[0095] The content of the insulin-producing pancreatic cells in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of symptoms, the condition of the patient, etc. For example, it may be 0.0001 to 99.9% by weight or 0.001 to 50% by weight based on the total weight of the composition, but is not limited thereto. The above content ratio is a value based on the dry weight after removing the solvent.

[0096] The pharmaceutical composition of the present invention may further comprise a suitable carrier, excipient, and diluent commonly used in the manufacture of pharmaceutical compositions. The excipient may be one or more selected from the group consisting of, for example, diluents, binders, disintegrants, lubricants, adsorbents, humectants, film-coating materials, and controlled-release additives.

[0097] The pharmaceutical composition of the present invention may be formulated and used in the form of external preparations such as powders, granules, sustained-release granules, enteric granules, liquids, eye drops, ellipsoids, emulsions, suspensions, ethanol tablets, troches, fragrances, limonades, tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, warning agents, lotions, pastes, sprays, inhalants, patches, sterile injectable solutions, or aerosols, according to conventional methods, and the external preparations may have formulations such as creams, gels, patches, sprays, ointments, warning agents, lotions, liniments, pastes, or cataplasms.

[0098] Carriers, excipients, and diluents that may be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0099] When formulating, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. The pharmaceutical composition of the present invention can be formulated so that insulin-producing pancreatic cells contained within the composition are available in vivo when administered into a subject. After administration, vaccinia virus present in tumor tissue, blood, and other tissues can be monitored through detection methods such as ELISA.

[0100] The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field.

[0101] The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by taking all of the above-mentioned factors into consideration, and this can be easily determined by a person skilled in the art to which the present invention belongs. Preferably, the pharmaceutical composition of the present invention may be administered as a single dose or repeatedly two or more times to an individual requiring it, and may be administered repeatedly until the tumor is reduced or disappears.

[0102] The pharmaceutical composition of the present invention may be administered to an individual via various routes. All modes of administration are expected, for example, oral administration, subcutaneous injection, intraperitoneal administration, intramuscular injection, intrathecal injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, ear administration, nasal administration, inhalation, spray through the mouth or nose, skin administration, transdermal administration, etc. Preferably, the insulin-producing pancreatic cells of the present invention may be administered via direct intratumoral administration or intravenous administration, and an appropriate method of administration may be selected depending on the condition and type of the tumor.

[0103] The pharmaceutical composition of the present invention is determined by the type of active ingredient drug, along with various relevant factors such as the disease to be treated, the route of administration, the patient's age, gender, weight, and the severity of the disease.

[0104] In addition, the present invention provides a method for preventing or treating diabetes, comprising the step of administering the insulin-producing pancreatic cells to an individual in need thereof.

[0105] In addition, the present invention provides the use of the insulin-producing pancreatic cells for the prevention or treatment of diabetes.

[0106] In addition, the present invention provides a use for the manufacture of a diabetes treatment using the insulin-producing pancreatic cells.

[0107] In the present invention, "individual" refers to a subject requiring treatment for a disease, and more specifically, to mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cattle.

[0108] In the present invention, "administration" means providing a specific composition of the present invention to an individual by any appropriate method.

[0109] In the present invention, "prevention" refers to any act of suppressing or delaying the onset of a target disease, "treatment" refers to any act of improving or beneficially altering the target disease and associated metabolic abnormality symptoms through the administration of the pharmaceutical composition of the present invention, and "improvement" refers to any act of reducing parameters related to the target disease, such as the severity of symptoms, through the administration of the composition of the present invention.

[0110] The above pharmaceutical composition may be used in combination or mixed with any approved diabetes treatment. When used in combination or mixed with a diabetes treatment, examples of such diabetes treatments include sulfonylurea agents (glibenclamide, glimepiride, gliclazide), rapid-acting insulin secretagogues (nateglinide, mitiglinide calcium hydrate), α-glucosidase inhibitors (acarbose, voglibose), biguanide agents (metformin hydrochloride, buformin hydrochloride), thiazolidine agents (pioglitazone hydrochloride), etc. In addition to these exemplified diabetes treatments, other diabetes treatments known in the art may also be used mixed or combined with the composition of the present invention without limitation.

[0111] In addition, the present invention may provide a food composition for the prevention or improvement of diabetes comprising the insulin-producing pancreatic cells of the present invention as an active ingredient, and said food composition may be a health functional food composition.

[0112] When the insulin-producing pancreatic cells of the present invention are used as a food additive, the insulin-producing pancreatic cells may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient can be appropriately determined according to the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the insulin-producing pancreatic cells of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less, relative to the raw material. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the above amount may be less than the above range, and since there are no issues regarding safety, the active ingredient may be used in an amount greater than the above range.

[0113] There are no specific restrictions on the types of the above-mentioned foods. Examples of foods to which the above-mentioned substance may be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all health functional foods in the conventional sense.

[0114] The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The natural carbohydrates mentioned above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As sweeteners, natural sweeteners such as taumatin and stevia extract, or synthetic sweeteners such as saccharin and aspartame may be used. The proportion of the natural carbohydrates is generally about 0.01-0.20g or about 0.04-0.10g per 100 mL of the composition of the present invention.

[0115] In addition to the above, the composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, the composition of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, it is generally selected in the range of 0.01 to 0.20 parts by weight per 100 parts by weight of the composition of the present invention.

[0116]

[0117] The present invention will be explained in detail below through examples.

[0118] However, the following examples are intended to specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0119]

[0120] [Example 1]

[0121] Culture of human-derived induced pluripotent stem cells

[0122] Human-derived induced pluripotent stem cells were cultured in 2D and 3D using the composition of the present invention for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells and differentiated into insulin-producing pancreatic beta cells.

[0123] Specifically, the human induced pluripotent stem cells (iPSCs) used in this invention were provided by the Stem Cell Research Center of the Asan Institute, and specifically, after isolating and culturing fibroblasts from skin fibrous tissue, CytoTune TM The Klf4, Oct3 / 4, Sox2, and cMyc genes were introduced using the iPS 2.0 Sendai Reprogramming Kit (ThermoFisher). The first colony was identified 12 days after virus treatment, and colonies consisting of 20 to 30 cells were transferred to new culture dishes for proliferation. The prepared iPSCs were cultured in vitronectin-coated culture dishes using 8™ basal medium (Gibco, USA) containing essential 8™ supplements (Gibco, USA) and antibiotics (Gibco, USA). Induced pluripotent stem cells were subcultured in StemPro Accutase medium (Gibco, USA) at a ratio of 1:5 to 1:6 and cultured at 37°C under 5% CO2 conditions. The 2D and 3D culture steps are described separately below.

[0124] The above 2D culture system comprises three main culture steps. (1) To induce differentiation of the above human induced pluripotent stem cells into Definitive Endoderm (DE) cells, the cells were first cultured for 24 hours in RPMI 1640 medium (11875093, Gibco) containing 2% Fetal Bovine Serum (FBS), 100 ng / ml Activin (human activin A, PeproTech, USA), 3 μM CHIR99021 (Sigma-Aldrich, USA), and 10 μM Y-27632 (Sigma-Aldrich, USA), then transferred to RPMI 1640 medium containing FBS and Activin and cultured for 48 hours, and the first and second cultures were carried out for 24 hours to induce endoderm differentiation. (2) Next, differentiation induction from the above endoderm into pancreatic progenitor cells was performed for a total of 6 days, and 1% B27 TM Differentiation induction was performed by culturing for 7 days in iMEM medium (Improved MEM Zinc Option culture medium, Invitrogen, USA) containing 1 μM dorsomorphin (Sigma-Aldrich, USA), 2 μM retinoic acid (Tocris Bioscience, UK), 10 μM SB431542 (Tocris Bioscience, UK), and 0.25 μM SANT-1 (Sigma-Aldrich, USA). (3) Finally, to induce differentiation of the above pancreatic progenitor cells into insulin-producing pancreatic beta cells, 1% B27 TMIsoproterenol (ISO, Sigma-Aldrich, USA) was added to iMEM medium containing 10 μM forskolin (forskolin, Sigma-Aldrich, USA), 10 μM dexamethasone (dexamethasone, Sigma-Aldrich, USA), 10 μM nicotinamide (nicotinamide, Sigma-Aldrich, USA), 10 μM exendin-4 (exendin 4, Sigma-Aldrich, USA), and 1 μM triiodothyronine (T3, Sigma-Aldrich, USA), and the cells were cultured in the medium for 10 days, during which time the medium was replaced every 2 days. Differentiation of human induced pluripotent stem cells into insulin-producing pancreatic beta cells was induced through such 2D culture (Fig. 1).

[0125] In addition, the above 3D culture system includes five major culture steps. (1) First, to induce differentiation of human induced pluripotent stem cells into endoderm cells, endoderm differentiation was induced by culturing for 24 hours in MCDB 131 medium (#10372019, Gibco) containing 10 ng / ml activin (human activin A, PeproTech, USA) and 3 μM CHIR99021 (Sigma-Aldrich, USA). (2) Next, differentiation from the endoderm into primitive gut tubes (PGT) was induced for a total of 6 days, and differentiation was induced by culturing in MCDB 131 medium containing 50 ng / ml KGF (Keratinocyte Growth Factor). (3) Afterwards, to induce differentiation into pancreatic progenitor cells from the above primitive intestinal tract, the cells were first cultured in MCDB 131 medium containing 2 μM retinoic acid (Tocris Bioscience, UK), 0.25 μM SANT-1 (Sigma-Aldrich, USA), 50 ng / ml KGF (Keratinocyte Growth Factor), 0.2 μM TPPB (TOCRIS, UK) and 0.2 μM LDN193189 (Stemgent, USA), and then (4) were secondarily cultured in MCDB 131 medium containing 0.1 μM retinoic acid (Tocris Bioscience, UK), 0.25 μM SANT-1 (Sigma-Aldrich, USA), 50 ng / ml KGF (Keratinocyte Growth Factor), 0.2 μM TPPB and 0.2 μM LDN to induce differentiation into pancreatic progenitor cells.(5) Finally, to induce differentiation of the above pancreatic progenitor cells into insulin-producing pancreatic beta cells, 200 nM isoproterenol was added to MCDB 131 medium containing 10 μM heparin (heparin, Sigma-Aldrich, USA), 1 μM XXi (γ-secretase inhibitor, Sigma-Aldrich, USA), 10 μM ALK5 inhibitor II (ALK5 Inhibitor II, Alk5i II, Sigma-Aldrich, USA), 1 μM T3, 0.25 μM Sant1, 0.1 μM retinoic acid, and 10 μM forskolin, and the cells were cultured in the medium for 7 days, with the medium being replaced daily. Differentiation of human induced pluripotent stem cells into insulin-producing pancreatic beta cells was induced through the above 3D culture (Fig. 2). The above 3D culture undergoes the five differentiation stages as described above, and the results of observing the cells under a microscope at each stage are shown in Fig. 7.

[0126]

[0127] [Example 2]

[0128] Confirmation of characteristics of insulin-producing cells according to ISO concentration

[0129] 2-1. Cell Morphology and Viability

[0130] When inducing differentiation of insulin-producing cells through 2D culture of Example 1, the morphology and viability of pancreatic beta cells were analyzed according to the content of ISO added to the medium. Specifically, the ISO was added to the medium at various concentrations (0, 100, 200, 400, 600, and 800 nM), and pancreatic progenitor cells were cultured in the medium to differentiate into insulin-producing pancreatic beta cells. Subsequently, the morphology of the pancreatic beta cells was observed through a microscope, and the viability (%) of the pancreatic beta cells was analyzed.

[0131] As a result, as shown in Figure 3, when ISO was treated at a concentration of 600 nM or higher, cell viability decreased, and at 200 to 400 nM, it was confirmed that there was no significant difference in cell condition compared to the untreated ISO group.

[0132] 2-2. Degree of Cell Differentiation

[0133] After inducing differentiation of insulin-producing pancreatic beta cells using a medium containing the above ISO at concentrations of 0, 100, or 200 nM, the mRNA expression levels of beta cell differentiation-related factors within the pancreatic beta cells, namely Insulin, PDX1 (pancreatic and duodenal homeobox 1), NKX6.1, MAFA, and GLUT2 (Glucose transporter 2), were analyzed using real-time PCR. Total RNA was isolated using Trizol reagent (Invitrogen, USA) according to the product manual, and cDNA was synthesized using Reverse Transcription Master Premix (ELPiS, Korea). Real-time PCR was performed using Cyber ​​Green Supermix (SsoAdvanced™ Universal SYBR Green Supermix; BIO-RAD, USA), and each mRNA was amplified using the primers listed below. PCR was performed for 45 cycles, with one cycle consisting of 15 seconds at 95°C, 30 seconds at 58°C, and 30 seconds at 72°C, and the relative levels of each gene's mRNA expression levels relative to GAPDH mRNA were 2 -△△CT Analysis was performed using the method. The mRNA of each of the above differentiation factors was amplified using the primers shown in Table 1 below.

[0134] Differentiation Factor Nucleotide Sequence Sequence Number InsulinforwardGCAGCCTTTGTGAACCAACAC1reverseCCCCGCACACTAGGTAGAGA2PDX1forwardGCATCCCAGGTCTGTCTTCT3reverseCACTGCCAGAAAGGTTTGAA4NKX6.1forwardCACACGAGACCCACTTTTTC5reverseCCGCCAAGTATTTTGTTTCT6MAFAforwardATTTCCCTATGTGTTGGTTGCG7reverseCGTTCTTGCTGAAGCCGATG8GLUT2forwardGCTGCTCAACTAATCACCATGC9reverseTGGTCCCAATTTTGAAAACCCC10

[0135] In addition, as shown in Figure 4, analysis of the mRNA of the pancreatic beta cell differentiation-related factors revealed that when treated with 200 nM of ISO, the RNA expression level was highest compared to the untreated group. In particular, the mRNA level of GLUT2, which is responsible for glucose transport in insulin secretion, increased in all ISO-added groups and was found to be highest at a concentration of 200 nM. Based on the above experimental results, the following insulin-producing cell differentiation ability verification experiment was conducted by adding ISO at a concentration of 200 nM.

[0136]

[0137] [Example 3]

[0138] Confirmation of the degree of differentiation by the insulin-producing cell differentiation-inducing composition of the present invention

[0139] 3-1. Confirmation of differentiation efficiency through immunocytochemical staining

[0140] The expression levels of insulin and PDX1 produced in insulin-producing cells differentiated through 2D culture in Example 1 above were confirmed by immunocytochemical staining. The insulin-producing pancreatic beta cells were treated with 4% paraformaldehyde (PFA), fixed at room temperature for 30 minutes, and then washed three times with PBS. The fixed cells were prepared by infiltrating with 0.1% Triton X-100 for 5 minutes and then washing with PBS. For blocking, the cells were treated with a solution containing normal horse serum (1:30) for 30 minutes, followed by treatment with a rabbit anti-insulin antibody (BS-0056R, Thermo) and a goat anti-PDX1 antibody (AF2419, R&D systems), respectively, and incubated overnight at 4°C. Afterward, the cells were washed with PBS, and then treated with a secondary antibody (donkey antibody or goat antibody) against mouse IgG or rabbit IgG conjugated with Alexa Fluor 488 or Alexa Fluor 594, diluted 1:250, and incubated at room temperature for 1 hour. Afterward, the cells were washed several times with PBS, and the fluorescently labeled secondary antibody was applied to each cell to observe the cells expressing the antibody using a fluorescence microscope. At this time, as a control group, an ISO-free group was used, in which differentiation was induced in the same manner as in Example 1 but without ISO treatment.

[0141] As a result, as shown in Figure 5, immunofluorescence analysis of differentiated insulin-producing pancreatic beta cells with insulin and PDX1 antibodies confirmed that the ISO-added group showed higher insulin expression levels compared to the control group. Accordingly, it was found that ISO enhanced the endocrine differentiation ability during the differentiation process from human induced pluripotent stem cells into pancreatic beta cells.

[0142] 3-2. Glucose Reactivity Analysis

[0143] To confirm the insulin secretion ability of the pancreatic beta cells stimulated by glucose, pancreatic beta cells differentiated through 2D culture of Example 1 were treated with glucose-free Krebs buffer (Krebs-Ringer bicarbonate HEPES buffer, Krebs buffer; 115 mM NaCl, 24 mM NaHCO3, 5 mM KCl, 2.5 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, 25 mM HEPES, and 0.5% BSA) at 37°C for 2 hours, and then reacted sequentially with 2.8 mM glucose and 30 mM glucose Krebs buffer for 1 hour. Subsequently, the insulin secreted into the Krebs buffer was measured according to the product manual using an ELISA kit (ALPCO, USA).

[0144] As a result, as shown in Fig. 6, it was confirmed that insulin secretion significantly increased in the ISO-added group in the analysis of pancreatic beta cell responsiveness to glucose. This means that the differentiation-inducing composition of the present invention containing ISO not only enhances the differentiation ability of insulin-producing cells during the process of inducing endocrine differentiation by stimulating intracellular neurofactors, but also creates a mature cell state exhibiting pancreatic beta cell-like functions.

[0145] 3-3. Confirmation of the degree of differentiation of differentiated insulin-producing cells by 3D culture

[0146] In previous studies, it is known that spherical cluster differentiation (3D) is more effective than planar cell differentiation (2D) in generating functional pancreatic beta cells from induced pluripotent stem cells. Accordingly, the effect of the differentiation-inducing composition containing the ISO of the present invention on a 3D differentiation protocol of human induced pluripotent stem cells was confirmed. At this time, the ISO-untreated group was used as a control group.

[0147] Specifically, for pancreatic beta cells differentiated through 3D culture of Example 1, the mRNA expression levels of endocrine cell markers PDX1, NEUROG3, insulin (INS), somatostatin (SST), MAFA (Pancreatic Beta-Cell-Specific Transcriptional Activator), and IAPP (Islet Amyloid Polypeptide) were analyzed by real-time PCR. The PCR was performed in the same manner as in Example 2, and the mRNA of each of the marker factors was amplified using the primers shown in Table 2 below.

[0148] differentiation Insulin(INS)forwardGCAGCCTTTGTGAACCAACAC1reverseCCCCGCACACTAGGTAGAGA2PDX1forwardGCATCCCAGGTCTGTCTTCT3reverseCACTGCCAGAAAGGTTTGAA4NEUROG3forwardCTTCGTCTTCCGAGGCTCT11reverseCTATTCTTTTGCGCCGGTAG 12Somatostatin(SST)forwardCTGTCTGAACCCAACCAGAC13reverseCAGCTCAAGCCTCATTTCAT14MAFAforwardATTTCCCTATGTGTTGGTTGCG7reverseCGTTCTTGCTGAAGCCGATG8IAPPforwardACATGTGGCAGTGTTGCATT15reverseTCATTGTGCTCTCTGTTGCAT16

[0149] In addition, the amount of C-peptide secreted by beta cells differentiated through 3D culture was analyzed. Specifically, the beta cells were isolated from a culture dish using Accutase, and then fixed by treating with 4% paraformaldehyde (PFA). The cells were treated with a solution containing normal horse serum (1:30) for 30 minutes, and then treated with a mouse anti-insulin antibody, a rabbit anti-glucagon antibody, and a rabbit anti-Ngn3 antibody, and reacted at room temperature for 30 minutes. Next, a secondary antibody (donkey antibody) against mouse IgG or rabbit IgG conjugated with Alexa Fluor 488 or Alexa Fluor 594 was applied and reacted at room temperature for 30 minutes, after which the results were analyzed using a flow cytometer (FACSAria II; Becton Dickinson). As a result, as shown in Figure 8, the mRNA expression levels of PDX1, NEUROG3, somatostatin, insulin, etc., were significantly increased in the ISO-treated group. In particular, it was confirmed that the expression of MAFA and IAPP genes, which are major factors in beta cell maturation, was significantly increased. Additionally, as shown in Figure 9, it was confirmed that the intracellular level of C-peptide in pancreatic beta cells in the ISO-treated group was higher than in the control group, and the concentration of C-peptide secreted into the culture medium of the pancreatic beta cells was also higher in the ISO-treated group compared to the control group. Accordingly, it was found that the differentiation-inducing composition of the present invention enhances the ability to differentiate into insulin-producing cells, particularly during the differentiation of induced pluripotent stem cells through 3D culture and the differentiation of endocrine progenitor cells.

[0150]

[0151] [Example 4]

[0152] Transcriptome comparison of insulin-producing cells based on ISO treatment

[0153] Statistical analysis of a total of 21,155 genes was performed through transcriptome comparative analysis between the control group and the ISO treatment group. In addition, the KEGG pathway of the control group and the ISO treatment group was analyzed.

[0154] As a result, as shown in Fig. 10, it was confirmed that 73 genes were significantly upregulated and 31 genes were downregulated. Furthermore, as shown in Table 3, five common biological pathways were identified from the genes that showed significant changes. Specifically, it was confirmed that TRP (Transient Receptor Potential) channels, neuroactive ligand-receptor interactions, cAMP signaling, Ras signaling, and calcium signaling pathways mediated by inflammatory mediators during endocrine differentiation are activated by ISO. In addition, the expression of nine genes—CAMK2A, NTRK1, PLA2GB4B, ADRB1, PYY, RLN2, TMEM189-UBE2V1, PRPH, and NDUFC2—was found to significantly increase in the ISO-treated group, which was verified via qPCR (Fig. 10c). Accordingly, it was found that as the above five biological pathways are activated by ISO, the differentiation ability of cells increases in the cell culture medium to which ISO is added.

[0155] 생물학적 경로유전자 명칭유전자 설명ISO / Control.FcP.ValueInflammatorymediator regulationof TRP channelsCAMK2Acalcium / calmodulindependent proteinkinase II alpha4.0130.002NTRK1neurotrophic receptortyrosine kinas5.7720.002PLA2G4Bphospholipase A2group IVB3.9690.002Calcium signalingpathwayADRB1adrenoceptor beta 14.6630.011CAMK2Acalcium / calmodulindependent proteinkinase II alpha4.0130.011NTRK1neurotrophic receptortyrosine kinase 15.7720.011NeuroactiveligandreceptorinteractionADRB1adrenoceptor beta 14.6630.023PYYpeptide YY3.7060.023RLN2relaxin 24.3150.023Ether lipidmetabolismTMEM189-UBE2V1TMEM189-UBE2V1readthrough5.9630.032PLA2G4Bphospholipase A2group IVB3.9690.032Pathways ofneurodegeneration -multiple diseasesCAMK2Acalcium / calmodulindependent proteinkinase II alpha4.0130.037PRPHperipherin3.7360.037NDUFC2-KCTD14NDUFC2-KCTD14readthrough26.320.037

[0156]

[0157] Although the present invention has been described in detail above only with respect to the described embodiments, it is obvious to those skilled in the art that various modifications and variations are possible within the scope of the technical spirit of the invention, and it is natural that such modifications and variations fall within the scope of the appended claims.

Claims

1. A composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells (iPSCs), comprising isoproterenol (ISO).

2. In Claim 1, A composition in which the above human induced pluripotent stem cells are derived from skin tissue.

3. In Claim 1, A composition in which the above human induced pluripotent stem cells are fibroblasts that have been dedifferentiated.

4. In Claim 1, A composition further comprising at least one selected from the group consisting of B27, forskolin, dexamethasone, nicotinamide, exendin-4, and triiodothyronine (T3).

5. In Claim 1, A composition comprising at least one selected from the group consisting of ALK5 Inhibitor II, triiodothyronine (T3), SANT-1, retinoic acid (RA), heparin, XXi (γ-secretase inhibitor), and forskolin.

6. In Claim 1, A composition in which the above insulin-producing cells are pancreatic beta cells.

7. In Claim 1, The above composition is a composition that induces differentiation into insulin-producing cells by treating pancreatic progenitor cells (PP) differentiated from human induced pluripotent stem cells.

8. A medium for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells, comprising as an active ingredient a composition for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells according to any one of claims 1 to 7.

9. In Claim 8, The medium is characterized by being selected from the group consisting of DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), improved MEM (iMEM), BME (Basal Medium Eagle), RPMI 1640 (Roswell Park Memorial Institute medium 1640), advanced RPMI 1640 (Advanced RPMI1640), F-10, F-12, DMEM-F12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), and MCDB 131.

10. In Claim 8, The above medium is a medium containing the ISO at a concentration of 100 to 600 nM.

11. (a) a step of culturing human induced pluripotent stem cells (iPSCs) to induce differentiation into pancreatic progenitor cells (PPs); and (b) a step of culturing the above-mentioned differentiated pancreatic progenitor cells in a medium containing isoproterenol (ISO) to induce differentiation into insulin-producing cells; A method for inducing differentiation of insulin-producing cells from human induced pluripotent stem cells, including 12. In Claim 11, A method for inducing differentiation of insulin-producing cells, wherein the medium of step (b) above contains the ISO at a concentration of 100 to 600 nM.

13. In Claim 11, A method for inducing differentiation of insulin-producing cells, wherein the medium of step (b) above further comprises at least one selected from the group consisting of B27, forskolin, dexamethasone, nicotinamide, exendin-4, and T3.

14. In Claim 11, A method for inducing differentiation of insulin-producing cells, wherein the medium of step (b) above further comprises at least one selected from the group consisting of ALK5 Inhibitor II, T3, SANT-1, retinoic acid (RA), heparin, XXi (γ-secretase inhibitor), and forskolin.

15. In Claim 11, A method for inducing differentiation of insulin-producing cells, characterized in that the medium of step (b) above is selected from the group consisting of DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), improved MEM (iMEM), BME (Basal Medium Eagle), RPMI 1640 (Roswell Park Memorial Institute medium 1640), Advanced RPMI 1640 (Advanced RPMI1640), F-10, F-12, DMEM-F12, α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), and MCDB 131.

16. Insulin-producing pancreatic cells produced by the method of any one of claims 11 to 15.

17. A pharmaceutical composition for the prevention or treatment of diabetes mellitus comprising the insulin-producing pancreatic cells of claim 16 as an active ingredient.