Individualized neoantigen vaccines for the treatment of bladder cancer

A combination therapy with immune checkpoint inhibitors, enfortumab vedotin, and individualized neoantigen vaccines targeting tumor-specific neoepitopes addresses the limited response of current treatments for urothelial and bladder cancer, enhancing immune response and treatment efficacy.

WO2026085242A1PCT designated stage Publication Date: 2026-04-23MODERNATX INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MODERNATX INC
Filing Date
2025-10-15
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

Many patients with urothelial or bladder cancer do not respond adequately to current checkpoint inhibitor therapies, highlighting an unmet need for more effective treatments.

Method used

Administering a combination therapy comprising an immune checkpoint inhibitor, enfortumab vedotin, and an individualized neoantigen therapy, where the neoantigen therapy includes an mRNA polynucleotide encoding neoepitopes formulated in a lipid delivery vehicle, before and after surgical resection of the tumor.

Benefits of technology

Enhances immune response against urothelial or bladder cancer by targeting tumor-specific neoepitopes, potentially improving treatment outcomes for patients who do not respond to single-agent checkpoint inhibitors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025051103_23042026_PF_FP_ABST
    Figure US2025051103_23042026_PF_FP_ABST
Patent Text Reader

Abstract

Indivi dualized neoantigen vaccines, as well as methods for their use in subjects to treat urothelial orbladder cancer are provided. In some embodiments, individualized neoantigen vaccines are used with an immune checkpoint inhibitor and optionally enfortumab vedotin to treat a urothelial or bladder cancer after surgical resection. Prior to surgical resection, in some embodiments, the subject is administered a neoadjuvant therapy comprising an immune checkpoint inhibitor, individualized neoantigen vaccines, and, optionally, enfortumab vedotin.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No. 131986-71 1 1

[0002] INDIVIDUALIZED NEOANTIGEN VACCINES FOR TH E TREATMENT OF

[0003] BLADDER CANCER

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] The present application claims priority to U.S. Provisional Application No. 63 / 708,226, filed October 16, 2024, the entire contents of which are incorporated herein by reference.

[0006] SEQUENCE LISTING

[0007] The present application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML file, created on September 22, 2025, is named “131986-7111 SL. xml” and is 354,726 bytes in size.

[0008] BACKGROUND

[0009] Recent breakthroughs in cancer immunotherapy (e.g., checkpoint inhibitors and chimeric antigen receptor-T cell therapies) have demonstrated that powerful anti -turn or responses can be achieved by activating large numbers of T cells in a variety of cancer settings. Several checkpoint inhibitor biologic agents (e.g., anti-CTLA-4 [anti-cytotoxic T lymphocyte-associated antigen-4], anti-PD-1 [anti -programmed cell death protein 1], and anti-PD-Ll [anti -programmed death-ligand 1]) are currently approved for human use in several cancer types, including metastatic melanoma, non-small cell lung carcinoma and bladder carcinoma. These inhibitory receptors and their ligands play complementary roles in down-regulating adaptive immunity; PD-1 / PD-L1 contributes to T cell exhaustion in peripheral tissues (Sharma and Allison 2015). Though single agent checkpoint inhibitor therapy can provide significant benefit for some patients, many patients have incomplete or no response to therapy presenting a clear unmet need.

[0010] SUMMARY

[0011] Provided herein are individualized neoantigen therapies for the treatment of urothelial or bladder cancer. The therapies include individualized neoantigen therapies specific to mutations present in a subject’s tumor and either or both of an immune checkpoint inhibitor and enfortumab vedotin. Also provided are methods of inducing an immune response to a urothelial or bladder cancer tumor in a subject, e.g.. by administering an individualized neoantigen therapy and either or both of an immune checkpoint inhibitor and enfortumab vedotin to the subject, optionally prior to and / or following surgical resection of the tumor. In some embodiments, the subject is additionally administered a neoadjuvant therapy (optionally either or both of an immune Attorney Docket No. 131986-71 1 1 checkpoint inhibitor and enfortumab vedotin, further optionally an individualized neoantigen therapy).

[0012] The disclosure, in some aspects, provides a method of treating urothelial or bladder cancer in a subject, the method comprising administering to the subject an effective amount of one or both of a neoadjuvant therapy and an adjuvant therapy that comprises administering (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen therapy, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in a tumor in the subject formulated in a lipid delivery vehicle, wherein the neoadjuvant therapy is administered prior to surgical resection of the tumor of the subject and the adjuvant therapy is administered after surgical resection of the tumor.

[0013] In some embodiments, the method comprises (a) identifying a subject with urothelial or bladder cancer that has received a neoadjuvant therapy prior to undergoing a surgical resection of a tumor; and (b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and an individualized neoantigen therapy, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid deliver}' vehicle.

[0014] In some embodiments, the method comprises (a) identifying a subject with urothelial or bladder cancer that has received a neoadjuvant therapy prior to undergoing a surgical resection of a tumor; and (b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor, wherein the adjuvant therapy comprises administering (i) an immune checkpoint inhibitor, (ii) enfortumab vedotin, and (iii) an individualized neoantigen therapy, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.

[0015] In some embodiments, the method comprises (a) administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject; and (b) administering to the subject an effective amount of an adjuvant therapy after the surgical resection, wherein the adjuvant therapy comprises administering an individualized neoantigen therapy, an immune checkpoint inhibitor, and, optionally, enfortumab vedotin, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle. Attorney Docket No. 131986-71 1 1

[0016] In some embodiments, the urothelial or bladder cancer is muscle-invasive bladder cancer (MIBC). In some embodiments, the urothelial or bladder cancer is a muscle-invasive urothelial carcinoma (M1UC).

[0017] In some embodiments, the subject is ineligible to receive cisplatin. In some embodiments, the subject has an Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 2. In some embodiments, the ECOG score was determined within about 7 days of beginning neoadjuvant therapy or undergoing surgical resection.

[0018] In some embodiments, the neoadjuvant therapy is administered at three-week intervals; optionally wherein the neoadjuvant therapy is administered for about 2-6 cycles, e.g., 2-6 three- week cycles.

[0019] In some embodiments, the neoadjuvant therapy comprises administering the immune checkpoint inhibitor and enfortumab vedotin. In some embodiments, the neoadjuvant therapy comprises administering the immune checkpoint inhibitor, enfortumab vedotin, and an individualized neoantigen therapy, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle..

[0020] In some embodiments, a method of the present disclosure further comprises surgical resection of a tumor of the subject, optionally wherein the surgical resection is performed within about 15 weeks of administering a first dose of the neoadjuvant therapy and within about 6 weeks (optionally plus a 2-week window) after administering a last dose of the neoadjuvant therapy. In some embodiments, the surgical resection is an RO resection. In some embodiments, the surgical resection is an R1 resection. In some embodiments, the surgical resection is a radical cystectomy (RC) plus pelvic lymph node dissection (PLND). In some embodiments, the subject has not achieved a pathological complete response (pCR) following the surgical resection. In some embodiments, the subject does not have apparent disease in an image taken after the surgical resection.

[0021] In some embodiments, the immune checkpoint inhibitor is an anti-PD-1 antibody, optionally wherein the anti-PD-1 antibody comprises: (i) light chain complementarity determining regions (CDRs) comprising a sequence of amino acids as set forth in SEQ ID NOs: 43, 44 and 45 and heavy chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 48, 49 and 50; (ii) a light chain variable region comprising SEQ ID NO: 46 and a heavy chain variable region comprising SEQ ID NO: 51; and / or (iii) a light chain comprising SEQ ID NO: 47 and a heavy chain comprising SEQ ID NO: 52. In some embodiments, the immune checkpoint inhibitor is pembrolizumab. Attorney Docket No. 131986-71 1 1

[0022] In some embodiments comprising administering an immune checkpoint inhibitor (such as pembrolizumab), the immune checkpoint inhibitor is administered by intravenous infusion or subcutaneous injection. In some embodiments, a neoadjuvant therapy and / or adjuvant therapy comprises administering an immune checkpoint inhibitor every three weeks. In some embodiments, a neoadjuvant therapy and / or adjuvant therapy comprises administering an immune checkpoint inhibitor every six weeks.

[0023] In some embodiments, the immune checkpoint inhibitor is administered at a dose of about 100-300 mg per administration, including a dose of about 200 mg per administration, optionally by intravenous infusion, optionally every three weeks. In some embodiments, the immune checkpoint inhibitor is administered at a dose of about 280 to about 420 mg per administration, including a dose of about 380 nig, optionally by subcutaneous injection, optionally every three weeks.

[0024] In some embodiments, the immune checkpoint inhibitor is administered at a dose of about 300-500 mg per administration, including a dose of about 400 mg per administration, optionally by intravenous infusion, optionally every six weeks. In some embodiments, the immune checkpoint inhibitor is administered at a dose of about 700-800 mg per administration, including a dose of about 790 mg per administration, optionally by subcutaneous injection, optionally every six weeks.

[0025] In some embodiments comprising administering enfortumab vedotin, the enfortumab vedotin is administered twice every three weeks, optionally at a dose of about 1.25 mg / kg enfortumab vedotin per administration. In some embodiments, the neoadjuvant therapy and / or adjuvant therapy comprises administering enfortumab vedotin on Day 1 and Day 8 of repeated three-week cycles, optionally at a dose of about 1.25 mg / kg enfortumab vedotin per administration.

[0026] In some embodiments, the neoadjuvant therapy and / or adjuvant therapy comprises administering an individualized neoantigen therapy in an amount that administers about 1 mg of mRNA every three weeks.

[0027] In some embodiments, the immune checkpoint inhibitor (e.g., pembrolizumab) is administered for up to 2 cycles in a neoadjuvant therapy. In some embodiments, the pembrolizumab is administered for up to 4 cycles in a neoadjuvant therapy. In some embodiments, the immune checkpoint inhibitor (e g., pembrolizumab) is administered for up to 7 cycles in an adjuvant therapy. In some embodiments, the immune checkpoint inhibitor (e g., pembrolizumab) is administered for up to 9 cycles in an adjuvant therapy. In some embodiments, the immune checkpoint inhibitor (e.g., pembrolizumab) is administered for up to 13 cycles in an adjuvant therapy. Attorney Docket No. 131986-71 1 1

[0028] In some embodiments, the individualized neoantigen therapy is administered for up to 4 cycles in a neoadjuvant therapy. In some embodiments, the individualized neoantigen therapy is administered for up to 5 cycles in an adjuvant therapy. In some embodiments, the individualized neoantigen therapy is administered for up to 9 cycles in an adjuvant therapy. In some embodiments, the individualized neoantigen therapy is administered for up to 9 total cycles across neoadjuvant therapy and adjuvant therapy combined.

[0029] In some embodiments, the neoadjuvant therapy comprises (i) administering the immune checkpoint inhibitor every three weeks for up to four cycles (optionally at a dose of about 200 mg per administration, optionally by intravenous infusion, or at a dose of about 380 mg per administration, optionally by subcutaneous injection) and enfortumab vedotin on Days 1 and 8 of every three-week cycle, for up to four cycles; and (ii) administering the individualized neoantigen therapy every three weeks for 1 to 4 cycles, optionally beginning on Day 1 of a third cycle of step (i), or beginning on a day selected from Day 1 of a second cycle of step (i) through Day 22 of a fourth cycle of step (i) (e.g., the day after the last day of a fourth three-week cycle).

[0030] In some embodiments, the neoadjuvant therapy comprises (i) administering the immune checkpoint inhibitor every six weeks for up to two cycles (optionally at a dose of about 400 mg per administration, optionally by intravenous infusion, or at a dose of about 790 mg per administration, optionally by subcutaneous injection), and enfortumab vedotin on Days 1 and 8 of a three-week cycle, for up to four three-week cycles; and (ii) administering the individualized neoantigen therapy every / three weeks for 1 to 4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (i), or beginning on a day selected from Day 1 of a second three-week cycle of step (i) through Day 22 of a fourth three-week cycle of step (i) (e.g., the day after the last day of a fourth three-week cycle).

[0031] In some embodiments, the adjuvant therapy comprises administering the immune checkpoint inhibitor for 5-15 cycles, optionally for 7 cycles, further optionally for 9 cycles, or further optionally for 13 cycles, optionally for 13 cycles when administered every' three weeks or for 7 or 9 cycles when administered every six weeks. In some embodiments, an adjuvant therapy comprises administering the immune checkpoint inhibitor for about 10-20 cycles, optionally wherein the subject is not administered immune checkpoint inhibitor in a neoadjuvant therapy.

[0032] In some embodiments, the adjuvant therapy comprises administering the individualized neoantigen therapy to the subject every three weeks. In some embodiments, the adjuvant therapy comprises administering 5-15 doses of the individualized neoantigen therapy, optionally wherein the adjuvant therapy comprises administering about 9 doses of the individualized neoantigen Attorney Docket No. 131986-71 1 1 therapy to the subject, optionally wherein the subject is not administered individualized neoantigen therapy in a neoadjuvant therapy.

[0033] In some embodiments, a treatment comprising neoadjuvant therapy and adjuvant therapy comprises administering the immune checkpoint inhibitor for a total of about 5-20 cycles across neoadjuvant and adjuvant treatments, optionally for a total of about 9 cycles or about 13 cycles or about 17 cycles, optionally for a total of about 17 cycles or about 13 cycles when administered every three weeks or for a total of about 9 cycles when administered every' six weeks. In some embodiments, a treatment comprising neoadjuvant therapy and adjuvant therapy comprises administering a total of about 5-15 doses of the individualized neoantigen therapy, optionally a total of about 9 doses of the individualized neoantigen therapy.

[0034] In some embodiments, the method is for treating muscle-invasive urothelial carcinoma (MIUC) in a subject having MIUC and comprises (a) identifying a subject with MIUC that has undergone radical cystectomy and (b) administering to the subject an effective amount of adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab on Day 1 of a six-week cycle and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks starting on Day 22 of the six-week cycle.

[0035] In some embodiments, the method comprises (a) identifying the subject with MIUC that has undergone radical cystectomy and (b) administering to the subject an effective amount of adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises subcutaneously administering 790 mg of pembrolizumab on Day 1 of a six-week cycle and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks starting on Day 22 of the six-week cycle.

[0036] In some embodiments, the method comprises (a) identifying the subject with MIUC that has undergone radical cystectomy; and (b) administering to the subject an effective amount of adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab on Day 1 of a three-week cycle and intramuscularly administering the individualized neoantigen vaccine in an amount that administers 1 mg of the mRNA every three weeks starting on Day I of the three-week cycle.

[0037] In some embodiments, the method comprises (a) identifying the subject with MIUC that has undergone radical cystectomy and (b) administering to the subject an effective amount of the adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises subcutaneously administering 380 mg of pembrolizumab on Day 1 of a three-week cycle and Attorney Docket No. 131986-71 1 1 intramuscularly administering the individualized neoantigen vaccine in an amount that administers 1 mg of the mRNA every' three weeks starting on Day 1 of the three-week cycle.

[0038] In some embodiments, the method is for treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC and comprises (a) administering to the subject neoadjuvant therapycomprising intravenously administering 200 mg of pembrolizumab every three weeks for up to 4 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third cycle of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through Day 22 of a fourth cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2 -week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab every' three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three- week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks, for up to a total of 9 cycles in step (b) and step (d) combined.

[0039] In some embodiments, the method comprises (a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 380 mg of pembrolizumab every three weeks for up to 4 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every' three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third cycle of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through Day 22 of a fourth cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks ofRC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 380 mg of pembrolizumab every three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Attorney Docket No. 131986-71 1 1

[0040] Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks, for up to a total of 9 cycles in step (b) and step (d) combined.

[0041] In some embodiments, the method is for treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC and comprises: (a) administering to the subject a neoadjuvant therapycomprising intravenously administering 400 mg of pembrolizumab every six weeks for up to 2 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every- three weeks for 1-4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle (e g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery-; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvanttherapy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab every six weeks for up to 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d).

[0042] In some embodiments, the method comprises (a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 790 mg of pembrolizumab every six weeks for up to 2 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject the neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every' three weeks for 1-4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of the neoadjuvant therapy, admini stering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 790 mg Attorney Docket No. 131986-71 1 1 of pembrolizumab eveiy six weeks for up to 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks, for up to a total of 9 cycles in step (b) and step (d) combined.

[0043] In some embodiments, the method is for treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC and comprises: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering 400 mg of pembrolizumab every' six weeks for up to 2 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every' three weeks for 1-4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2 -week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab every three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA eveiy three weeks for up to a total of 9 cycles in step (b) and step (d).

[0044] In some embodiments, the method comprises (a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 790 mg of pembrolizumab every six weeks for up to 2 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject the neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for 1-4 cycles, optional ly beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle of step (a) (e.g., the day after the last day of a fourth three-week cycle); (c) within about 6 weeks (e.g., optionally plus a 2 -week window) of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery'; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of Attorney Docket No. 131986-71 1 1 adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 380 mg of pembrolizumab every' three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks, for up to a total of 9 cycles in step (b) and step (d) combined.

[0045] In some embodiments, the method is for treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC, wherein the method comprises: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering 200 mg of pembrolizumab every three weeks for up to 4 cycles and intravenously administering 1 .25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every’ three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third cycle of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through Day 22 of a fourth cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PL, ND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab every six weeks for up to 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks, for up to a total of 9 cycles in step (b) and step (d) combined.

[0046] In some embodiments, the method comprises (a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 380 mg of pembrolizumab every three weeks for up to 4 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject the neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third cycle of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through Day 22 of a fourth cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks Attorney Docket No. 131986-71 1 1 of RC plus PLND, administering to the subject an effective amount of adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 790 nig of pembrolizumab every six weeks for up to 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of mRN A every three weeks, for up to a total of 9 cycles in step (b) and step (d) combined.

[0047] In some embodiments, the method is for treating urothelial or bladder cancer in a subject having urothelial or bladder cancer and comprises: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering about 200 mg of pembrolizumab every three weeks for at least two cycles or intravenously administering about 400 mg of pembrolizumab every six weeks for at least one cycle and administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles; (b) administering to the subject a neoadjuvant therapy comprising intravenously administering about 200 nig of pembrolizumab every three weeks for at least two cycles or intravenously administering about 400 mg of pembrolizumab every six weeks for at least one cycle, administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of mRNA once every three weeks for at least one cycle prior to surgical resection of a tumor in the subject; and (c) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises intravenously administering about 200 mg pembrolizumab every three weeks for at least 13 cycles or intravenously administering about 400 mg of pembrolizumab every' six weeks for at least 7 cycles; administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks for at least five cycles, wherein theindividualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG- modified lipid.

[0048] In some embodiments, the method comprises: (a) administering to the subject neoadjuvant therapy comprising subcutaneously administering about 380 mg of pembrolizumab every three weeks for at least two cycles or subcutaneously administering about 790 mg of pembrolizumab every six weeks for at least one cycle, and administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles; (b) administering to the subject the Attorney Docket No. 131986-71 1 1 neoadjuvant therapy comprising administering about 380 mg of pembrolizumab every three weeks for at least two cycles or about 790 mg of pembrolizumab every six weeks for at least one cycle, administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for at least one cycle prior to surgical resection of the tumor in the subject; and (c) administering to the subject an effective amount of adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises subcutaneously administering about 380 mg pembrolizumab every three weeks for at least 13 cycles or subcutaneously administering about 790 mg of pembrolizumab every six weeks for at least 7 cycles, administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for at least five cycles, , wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid.

[0049] In some embodiments, the method is for treating urothelial or bladder cancer in a subject having urothelial orbladder cancer and comprises: administering to the subject an effective amount of an adjuvant therapy after a surgical resection of a tumor, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and administering an individualized neoantigen therapy, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle. In some embodiments, administering the immune checkpoint inhibitor comprises administering about 400 mg of the immune checkpoint inhibitor every six weeks, optionally by intravenous infusion. In some embodiments, administering the immune checkpoint inhibitor comprises administering about 790 mg of the immune checkpoint inhibitor every six weeks, optionally by subcutaneous injection. In some embodiments, administering the immune checkpoint inhibitor comprises administering about 200 mg of the immune checkpoint inhibitor every three weeks, optionally by intravenous infusion. In some embodiments, administering the immune checkpoint inhibitor comprises administering about 380 mg of the immune checkpoint inhibitor every three weeks, optionally by subcutaneous injection. In some embodiments, administering the individualized neoantigen therapy comprises administering the individualized neoantigen therapy in an amount that administers about 1 mg of mRNA every three weeks. Attorney Docket No. 131986-71 1 1

[0050] In some embodiments, the individualized neoantigen therapy, enfortumab vedotin, and / or the immune checkpoint inhibitor of the adjuvant therapy and / or neoadjuvant therapy are each administered separately and are each independently administered via an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route. In some embodiments, the individualized neoantigen therapy is administered intramuscularly, the immune checkpoint inhibitor is administered intravenously, and the enfortumab vedotin is administered intravenously. In some embodiments, the individualized neoantigen therapy is administered intramuscularly, the immune checkpoint inhibitor is administered subcutaneously, and the enfortumab vedotin is adm ini stered in travenousl y .

[0051] In any embodiments comprising administration of pembrolizumab, the pembrolizumab may be formulated as a liquid medicament that comprises about 7% (w / v) sucrose, about 0.02% (w / v) polysorbate 80, about 10 mM histidine buffer, optionally at a pH of about 5.5. In any embodiments comprising intravenous administration of pembrolizumab, the pembrolizumab may be formulated as a liquid medicament that comprises about 25 mg / ml pembrolizumab, about 7% (w / v) sucrose, about 0.02% (w / v) polysorbate 80, about 10 mM histidine buffer, optionally at a pH of about 5.5, or as a liquid medicament that comprises 25 mg / ml pembrolizumab, 7% (w / v) sucrose, 0.02% (w / v) polysorbate 80, 10 mM histidine buffer, at pH 5.5. In any embodiments comprising subcutaneous administration of pembrolizumab, the pembrolizumab may be formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5, or may be formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5.

[0052] In any embodiments comprising subcutaneous administration of pembrolizumab, the pembrolizumab may be co-administered with a human hyaluronidase. The pembrolizumab and human hyaluronidase may be formulated in the same composition. The composition may be formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5. The human hyaluronidase may be selected from rHuPH20 and berahyaluronidase alia, optionally wherein the human hyaluronidase is berahyaluronidase alfa. Attorney Docket No. 131986-71 1 1

[0053] In some embodiments, one or both of the neoadjuvant therapy and the adjuvant therapy comprises subcutaneously administering pembrolizumab at a dose of 395 mg every three weeks with 4800 Units of berahyaluronidase alfa .

[0054] In some embodiments, one or both of the neoadjuvant therapy and the adjuvant therapy comprises subcutaneously administering pembrolizumab at a dose of 790 mg every six weeks with 9600 Units of berahyaluronidase alfa.

[0055] In some embodiments of any of the foregoing embodiments, the open reading frame of the mRNA polynucleotide of the individualized neoantigen therapy comprises nucleosides selected from the group consisting of N1 -methylpseudouridine, adenosine, guanosine, and cytidine.

[0056] In some embodiments of any of the foregoing embodiments, the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes, wherein: (a) at least one of the neoepitopes are MHC class I epitopes; (b) at least 10% of the neoepitopes are MHC class I epitopes; (c) at least 50% of the neoepitopes are MHC class I epitopes; (d) at least 70% of the neoepitopes are MHC class I epitopes; (e) at least one of the neoepitopes are MHC class II epitope; (f) at least 30% of the neoepitopes are MHC class II epitopes; (g) each of the neoepitopes is 20-50 amino acids in length; (h) each of the neoepitopes comprises 25-35 amino acids, (i) the neoepitopes are T cell epitopes; (j) each of the neoepitopes comprises an antigenic region and an MHC stabilizing region; (k) two or more of the neoepitopes are connected directly to one another; (1) two or more of the neoepitopes are connected to one another through a linker that is not a cleavage sensitive site; (m) each of the neoepitopes includes a centrally located mutation encoded by a single nucleotide polymorphism (SNP); (n) the mRN / X polynucleotide comprises at least 30 neoepitopes; and / or (o) the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting of Nl- methylpseudouridine, adenosine, guanosine, and cytidine.

[0057] In some embodiments of any of the foregoing embodiments, the lipid delivery vehicle of the individualized neoantigen therapy comprises a lipid nanoparticle, a liposome, or a lipoplex. In some embodiments, the lipid delivery vehicle comprises a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG-modified lipid. In some embodiments, the ionizable amino lipid compri ses a compound of Formula (I): Attorney Docket No. 131986-71 1 1

[0058] Ri is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, and -R"M'R';

[0059] R2 and R3 are independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0060] R4 is -(CEEJnQ, wherein Q is -OR, and n is selected from 1, 2, 3, 4, and 5; each R5 is II; each Re is H;

[0061] M and M' are independently selected from -C(O)O- and -OC(O)-;

[0062] R7 is H;

[0063] R is II;

[0064] R' is selected from the group consisting of C1-is alkyl and C2-18 alkenyl;

[0065] R" is selected from the group consisting of C3-14 alkyl and C3-14 alkenyl; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0066] In some embodiments, the compound of Formula (I) comprises Compound (1-25):

[0067] (Compound 1-25).

[0068] In some embodiments, the neutral lipid comprises l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC), the sterol comprises cholesterol, and the PEG-modified lipid comprises 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG).

[0069] In some embodiments, the lipid nanoparticle comprises 20-60 mol% ionizable cationic lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid; optionally wherein the lipid nanoparticle comprises about 45-55 mol% ionizable cationic lipid, about 5-15 mol% non-cationic lipid, about 35-40 mol% sterol, and about 1-2 mol% PEG-modified lipid; further optionally wherein the lipid nanoparticle comprises about 50 mol% ionizable cationic lipid, about 10 mol% non-cationic lipid, about 38.5 mol% sterol, and about 1.5 mol% PEG- modified lipid.

[0070] Each of the limitations of the disclosure can encompass various embodiments of the disclosure. It is therefore to be understood that each of the limitations of the disclosure involving any one element or combinations of elements can be included in each aspect of the disclosure. This Attorney Docket No. 131986-71 1 1 disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The disclosure is capable of other embodiments and of being practiced or of being carried out in various ways.

[0071] BRIEF DESCRIPTION OF DRAWING

[0072] FIG. 1 shows a schematic of the perioperative cohort of the clinical trial described in Example 1. FIG. 2 shows a schematic of the adjuvant cohort and active comparator of the clinical trial described in Example 1.

[0073] FIG. 3 shows potential dosing schedules for the adjuvant cohort of the clinical trial described in Example 1.

[0074] FIG. 4 shows potential dosing schedules for the perioperative cohort of the clinical trial described in Example 1.

[0075] FIG. 5 shows potential dosing schedules for the perioperative cohort who do not undergo radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery of the clinical trial described in Example 1 .

[0076] DETAILED DESCRIPTION

[0077] The present disclosure relates to methods for treating urothelial or bladder cancer in a subject (e.g., inducing an immune response against a tumor) using individualized neoantigen therapies. The vaccines described herein are designed to induce an immune response that recognizes tumor-specific mutations and / or neoantigens. The tumor mutations and their antigen presenting molecules (i.e., HLA) are unique to each subject, and an individualized antigen / HLA strategy, such as the individualized neoantigen vaccines of the disclosure, maximize the personalized immune response. The design of the vaccine which incorporates multiple, subjectspecific neoepitopes as provided herein may improve clinical benefit for subjects having urothelial or bladder cancer. In some aspects, the individualized neoantigen vaccines as provided herein may help to prevent the subject’s urothelial or bladder cancer from recurring by instructing their immune system to better identify cancerous tissue derived from the original cancer lesion.

[0078] In some aspects, the present disclosure relates to methods of treating urothelial or bladder cancer in a subject (e.g., inducing an immune response against a tumor) by administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject, and then administering to the subject an adjuvant therapy after the surgical resection of the tumor in the subject, wherein one or both of the adjuvant therapy and the neoadjuvant therapy comprises a combination treatment as described herein that comprises (i) an immune checkpoint inhibitor, Attorney Docket No. 131986-71 1 1

[0079] (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.

[0080] In some aspects, the present disclosure relates to methods of treating urothelial or bladder cancer in a subject (e.g., inducing an immune response against a tumor) by administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject, and then administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises a combination treatment as described herein that comprises (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.

[0081] In some aspects, the present disclosure relates to methods of treating urothelial or bladder cancer in a subject (e.g., inducing an immune response against a tumor) by treatment with an adjuvant therapy, the method comprising identifying a subject with urothelial or bladder cancer that has received a neoadjuvant therapy and has undergone surgical resection of a tumor, and then administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises a combination treatment as described herein that comprises (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoantigens expressed in the tumor in the subject formulated in a lipid delivery vehicle.

[0082] In some aspects, the present disclosure relates to methods of treating urothelial or bladder cancer in a subject (e.g., inducing an immune response against a tumor) by administering to the subject a neoadjuvant therapy prior to a surgical resection of a tumor in the subject, wherein the neoadjuvant therapy comprises a combination treatment as described herein that comprises (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle. In some aspects, the method may further comprise, after surgical resection of a tumor, administering to the subject an effective amount of an adjuvant therapy that comprises a combination treatment as described herein, e.g., Attorney Docket No. 131986-71 1 1 that comprises (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen vaccine.

[0083] In other aspects, the methods provided herein involve improving other anti-cancer therapies such as checkpoint inhibitor therapies (e g., anti-PD-1 antibodies). Immune checkpoint inhibitor efficacy may be driven by blocking the negative signals generated by engagement of these inhibitory receptors on T cells with their ligands on tumors and other immune cells, especially antigen presenting cells. The loss of inhibition following checkpoint blockade allows the subjects’ T cells to recognize neoantigens as foreign. Combining the individualized neoantigen vaccines of the present disclosure with immune checkpoint inhibitor therapy leads to T cell-mediated destruction of the tumor cells by increasing both the number and antitumor activity of a subject’s T cells that recognize tumor-specific mutations / neoantigens.

[0084] Thus, for example, in a newly diagnosed subject, a neoadjuvant therapy comprising an immune checkpoint inhibitor (such as pembrolizumab) optionally in combination with enfortumab vedotin, may begin as soon as possible. Then, the subject’s tumor sample can be screened for neoantigens and an individualized neoantigen vaccine as described herein may be designed and synthesized, before, during, or after surgical resection of the tumor. Then, before and / or after surgical resection of the tumor (typically at least including after surgical resection) the subject may be started on a combination treatment as described herein comprising the individualized neoantigen vaccine, immune checkpoint inhibitor, and, optionally, enfortumab vedotin, as a neoadjuvant and / or adjuvant therapy. In any embodiments, the immune checkpoint inhibitor may be administered together with the individualized neoantigen vaccine and / or enfortumab vedotin (e.g., on the same day) or they may be administered separately on different schedules. Treatment in this manner may improve clinical benefit and may help to prevent the subject’s urothelial or bladder cancer from recurring.

[0085] In some embodiments, the present disclosure provides methods of treating muscle-invasive urothelial carcinoma (MIUC) in a subject having MIUC, the method comprising (a) identifying a subject with MIUC that has undergone radical cystectomy; and (b) administering to the subject an effective amount of an adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab on Day 1 of a six-week cycle and intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks starting on Day 22 of the six-week cycle, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery7vehicle. Attorney Docket No. 131986-71 1 1

[0086] In some embodiments, the present disclosure provides methods of treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC, the method comprising: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering 200 mg of pembrolizumab every' three weeks for up to 4 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third cycle of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through Day 22 of a fourth cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab every three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

[0087] In some embodiments, the present disclosure provides methods of treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC, the method comprising: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering 400 mg of pembrolizumab every' six weeks for up to 2 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of neoadjuvant therapy, admini stering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab every three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and Attorney Docket No. 131986-71 1 1 intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of niRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

[0088] In some embodiments, the present disclosure provides methods of treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC, the method comprising: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering 400 mg of pembrolizumab every six weeks for up to 2 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks for 1 -4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2 -week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab every' three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

[0089] In some embodiments, the present disclosure provides methods of treating muscle-invasive bladder cancer (MIBC) in a subject having MIBC, the method comprising: (a) administering to the subject a neoadjuvant therapy comprising intravenously administering 200 mg of pembrolizumab every three weeks for up to 4 cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles; (b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every' three weeks for 1-4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through Day 22 of a fourth three-week cycle (e.g., the day after the last day of a fourth three-week cycle) of step (a); (c) within about 6 weeks (e.g., optionally plus a 2-week window) of the last dose of neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and (d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously Attorney Docket No. 131986-71 1 1 administering 400 mg of pembrolizumab every six weeks for up to 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 5 cycles, and intramuscularly administering an individualized neoantigen vaccine in an amount that administers 1 mg of mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined. In some embodiments, the present disclosure provides methods of treating urothelial or bladder cancer in a subject having urothelial or bladder cancer, the method comprising: (a) administering to the subject a neoadjuvant therapy comprising administering about 200 mg of pembrolizumab every three weeks for at least two cycles or about 400 mg of pembrolizumab every six weeks for at least one cycle, and administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for at least two cycles; (b) administering to the subject a neoadjuvant therapy comprising administering about 200 mg of pembrolizumab every' three weeks for at least two cycles or about 400 mg of pembrolizumab every six weeks for at least one cycle, administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for at least two cycles, and administering 1 mg of individualized neoantigen vaccine for at least one cycle prior to surgical resection of a tumor in the subject; and (c) administering to the subject an effective amount of an adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises administering about 200 mg pembrolizumab every three weeks for at least 13 cycles or about 400 mg of pembrolizumab every six weeks for at least 7 cycles, administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for at least two cycles, and administering an individualized neoantigen vaccine in an amount that administers about 1 mg of mRNA every three weeks for at least five cycles, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG- modified lipid

[0090] In some embodiments, the present disclosure provides methods of treating urothelial or bladder cancer in a subject having urothelial or bladder cancer, the method comprising: administering to the subject an effective amount of an adjuvant therapy after a surgical resection of a tumor, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and administering an individualized neoantigen vaccine, wherein the individualized neoantigen vaccine comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in the tumor in the subject formulated in a lipid delivery vehicle.

[0091] The use of mRNA technology in the vaccine allows for induced production of a broad array of secreted, membrane-bound, and intracellular proteins in humans. Antigen-encoded mRNA is an Attorney Docket No. 131986-71 1 1 attractive technology platform for neoantigen vaccination, as an mRNA cancer vaccine can deliver multiple neoepitopes in a single molecule. In this way, a vaccine unique to each particular subject can be rapidly manufactured, and the encoded neoepitopes are endogenously translated and enter into the natural cellular antigen processing and presentation pathway. Moreover, mRNA-based vaccine technology overcomes the challenges commonly associated with DNA- based vaccines, such as risk of genome integration or the high doses and devices needed for administration (e.g., electroporation). As discussed in more detail below, each individualized neoantigen mRNA vaccine comprises an mRNA encoding multiple neoepitopes designed specifically for each individual subject’s tumor mutanome and HLAtype. This allows for the inclusion of the maximum number of neoepitopes while both maintaining a sufficient amount of flanking sequence to facilitate both HLA Class I and Class II presentation of the peptides (neoepitopes) and retaining an mRNA construct length that can be reliably and rapidly manufactured.

[0092] As discussed in more detail below, embodiments provide individualized neoantigen vaccines that include one or more nucleic acids having one or more open reading frames encoding neoepitopes. As provided herein, individualized neoantigen vaccines encoding neoepitopes having different properties may be used to induce a balanced immune response, comprising cellular and / or humoral immunity. As described in more detail below, the individualized neoantigen vaccines may be used in conjunction with an immune checkpoint inhibitor (e.g., anti-PD-1 antibody such as pembrolizumab) and / or enfortumab vedotin as an adjuvant therapy administered after surgical resection of a urothelial or bladder cancer tumor. In some embodiments, surgical resection of the tumor is preceded by administration of a neoadjuvant therapy, which optionally may comprise an immune checkpoint inhibitor (e.g., anti-PD-1 antibody such as pembrolizumab), optionally, enfortumab vedotin, and, optionally, an individualized neoantigen vaccine as described herein (e.g., a combination treatment as described herein).

[0093] Urothelial and Bladder Cancer

[0094] Provided herein, in some aspects, are method for treating urothelial or bladder cancer. According to the International Agency for Research on Cancer (IARC), urothelial cancer kills more than 165,000 patients annually and is the ninth most common cancer overall worldwide. Approximately 151,000 new cases of urothelial cancer are diagnosed annually in Europe, with 52,000 deaths per year. Over 22,000 new cases are diagnosed annually in Japan, with 7,600 deaths per year (Cancer Fact Sheets: All cancers excluding Non-Melanoma Skin. International Agency for Research on Cancer 2017. Retrieved from gco.iarc.fr / today / fact-sheets- cancers?cancer=29&type=0&sex=0. / Xccessed 19 Dec 2017). In the U.S., the National Cancer Attorney Docket No. 131986-71 1 1

[0095] Institute estimates more than 79,000 new cases of bladder cancer were diagnosed in 2017, and more than 16,800 people died from the disease (National Cancer Institute 2018).

[0096] Metastatic urothelial cancer has a 5-year mortality rate of approximately 85% (American Cancer Society (ACS) 2016).

[0097] Urothelial cancer is the most common type of bladder cancer (90 percent of cases), and can also be found in the urothelial cells that line the renal pelvis (where urine collects inside the kidney), ureter (tube that connects the kidneys to the bladder) and urethra.

[0098] First-line therapy for metastatic urothelial cancer in patients with sufficient renal function consists of cis-diamminedichloroplatinum (II) (cisplatin)-based combinations, like methotrexate, vinblastine, doxorubicin, and cisplatin (MV AC) or gemcitabine plus cisplatin, which demonstrate an objective response rate (ORR) up to 55%, including approximately 12% complete responses (CRs) (von der Maase 2000). Despite initial chemosensitivity, patients are not cured and the outcome of metastatic urothelial cancer after these regimens is poor: median time to progression is 7 months and median overall survival (OS) is 14 months. Long-term survival is poor (approximately 15%) and the prognosis is particularly grim for patients with visceral metastases, for whom the five year survival rate is 7% (von der Maase 2005; Bellmunt 2011).

[0099] Almost half of urothelial cancer patients are unfit for cisplatin-containing chemotherapy due to impaired renal function, poor performance status, or comorbidity (Dash et al. Cancer (2006); 107(3): 506-13). In these patients, no standard first-line treatment has been defined, but current options typically include cis-Di ammine (cyclobutane 1,1 dicarboxylato) platinum (carboplatin)-based regimens or single-agent taxane or gemcitabine (Cathomas 2015). In this setting, long term survival is even lower (De Santis et al. J Clin Oncol (2009); 27(33): 5634-9). In April 2017, the Food and Drug Administration (FDA) approved the anti -program med death-ligand 1 (PD-L1) immune checkpoint inhibitor (CPI) atezolizumab (TECENTRIQ®) as first line treatment for locally advanced or metastatic urothelial carcinoma (la / mUC) patients ineligible for cisplatin. The accelerated approval was based on an open-label single arm study that showed long durations of response, indicating activity in this difficult-to-treat population, with an objective response rate (ORR) of 23% that was similar across varying levels of target expression (Balar 2017). The median OS for these patients was 15.9 months, although this is a single arm study and any OS benefit will need to be confirmed in a randomized experience (Balar et al., Lancet (2017); 389(10064): 67-76).

[0100] Pembrolizumab (Keytruda®) received accelerated approval from the FDA in May 2017 as first line treatment for patients with la / mUC ineligible for cisplatin. The study on which approval was based resulted in an ORR of 29% and median response duration not reached at the time of the Attorney Docket No. 131986-71 1 1 analysis (median follow-up time of 7.8 months) (Pembrolizumab Prescribing Information, Merck Sharp and Dohme Corp., 2017). In May 2018, the FDA issued an alert regarding decreased survival of patients with low expression of PD-L1 being treated in the first line setting with pembrolizumab or atezolizumab, compared with platinum-based chemotherapy. Subsequently prescribing information for these two CPIs were revised to require high PD-L1 expression in first-line metastatic urothelial cancer patients who are eligible for platinum-containing chemotherapy. This development has further limited the options for metastatic urothelial cancer patients with low expression of PD-L1.

[0101] Other options for first line cisplatin-ineligible patients typically include carboplatin-based regimens or single-agent taxane or gemcitabine (Cathomas et al., Hematol Oncol Clin North Am (2015); 29(2): 329-40.).

[0102] Few options are available for second-line treatment of metastatic disease. In the European Union, the small-molecule tubulin inhibitor vinflunine (Javlor®) was authorized in 2009 based on modest activity (overall response rate 9%), moderate survival benefit of 2 months (6.9 months for vinflunine + best supportive care (BSC) vs 4.6 months for BSC alone, hazard ratio 0.88), and a favorable safety profile (Bellmunt et al. Clin Oncol (2009); 27(27): 4454-61). In May 2016, the FDA provided accelerated approval of atezolizumab as the first salvage therapy following platinum agents for la / mUC in the US, followed by EU approval in September 2017. In February 2017, nivolumab (Opdivo®) became the second immunotherapy granted accelerated approval by the FDA, which was followed by EU approval in June 2017. In March and May 2017, the FDA granted accelerated approval for avelumab (Bavencio®) and durvalumab (ImfinziTM), respectively, both PD-L1 blocking antibodies indicated for the treatment of patients with locally- advanced or metastatic urothelial carcinoma who have disease progression during or following platinum-containing chemotherapy or have disease progression within 12 months of neoadjuvant or adjuvant treatment with platinum-containing chemotherapy. Pembrolizumab received regular approval from the FDA in May 2017 as second-line treatment (Keytruda Prescribing Information, Merck, May 2017). The approval was based on the first randomized experience reported for a CPI in the locally advanced or metastatic post-platinum urothelial cancer setting, a phase 3 study in 542 patients showing an OS of 10.3 months as compared to 7.4 months with taxane chemotherapy or vinflunine. / Additionally, ORR was 21% for pembrolizumab and 11% for chemotherapy. No statistically significant difference in progression-free survival (PFS) between the two arms was observed (Bellmunt et al., N Engl J Med (2017);376(l 1): 1015-26). EU approval for the same indication was granted in September 2017 and Japanese approval in January' 2018. Other programmed cell death protein 1 (PD-1) and PD-L1 inhibitors are currently being evaluated in Attorney Docket No. 131986-71 1 1 clinical trials for urothelial cancer, as first and second-line therapy (Mullane et al., Curr Opin Urol (2016);26(6): 556-63).

[0103] While CPIs offer a new approach to treatment of metastatic urothelial cancer, tumor responses have occurred in a minority of patients and the improvement in long-term survival is only a few months. For example, in May 2017, Roche announced that a confirmatory phase 3 trial of second-line atezolizumab had failed to meet its primary' endpoint of OS (Roche, press release “Roche provides update on phase III study of Tecentriq (atezolizumab) in people with previously treated advanced bladder cancer,” 10-May-2017). Most patients with locally advanced or metastatic urothelial cancer do not respond to CPIs and many who do respond ultimately develop disease progression (Rosenberg et al., Lancet (2016); 387(10031): 1909-20). Novel treatments are still needed, particularly for patients who have not responded to CPIs or who have progressed following CPI therapy.

[0104] The lack of approved first line therapies for patients with metastatic urothelial cancer and the limited activity observed with second-line chemotherapy adequately demonstrate that this population has significant unmet medical need.

[0105] Of all new cases of cancer in the United States, bladder cancer represents approximately 5 percent in men (fifth most common neoplasm) and 3 percent in women (eighth most common neoplasm). The incidence is increasing slowly, concurrent with an increasing older population. American Cancer Society (cancer.org) estimates that there are 81,400 new cases annually, including 62,100 in men and 19,300 in women, which accounts for 4.5% of all cancer cases. The age-adjusted incidence in the United States is 20 per 100,000 for men and women. There are an estimated 17,980 deaths from bladder cancer in annually (13,050 in men and 4,930 in women), which accounts for 3% of cancer related deaths. Bladder cancer incidence and mortality strongly increase with age and will be an increasing problem as the population becomes more elderly. Globally, approximately 580,000 people will be diagnosed with bladder cancer in 2020, and bladder cancer will be attributed to approximately 210,000 deaths worldwide.

[0106] Most bladder cancers recur in the bladder. Bladder cancer is managed with a combination of transurethral resection of the bladder (TUR) and intravesical chemotherapy or immunotherapy. The multifocal and recurrent nature of bladder cancer points out the limitations of TUR. Most muscle-invasive cancers are not cured by TUR alone. Radical cystectomy and urinary diversion are the most effective means to eliminate the cancer but carry an undeniable impact on urinary and sexual function. There continues to be a significant need for treatment modalities that are beneficial for bladder cancer patients. Attorney Docket No. 131986-71 1 1

[0107] There is a significant need for additional therapeutic methods for urothelial and bladder cancers. These include the use of antibodies and antibody drug conjugates, including in combination with other agents, as treatment modalities.

[0108] The methods and compositions provided herein are designed to treat urothelial and bladder cancer and improve subjects’ outcomes.

[0109] Bladder cancers and / or urothelial cancers may be treated using the methods and compositions described herein. In some embodiments, the subject has bladder cancer. In some embodiments, the bladder cancer is squamous cell bladder cancer. In some embodiments, the bladder cancer is an adenocarcinoma. In some embodiments, the bladder cancer is a sarcoma. In some embodiments, the bladder cancer is small call bladder cancer. In some embodiments, the bladder cancer is a non-muscle invasive bladder cancer. In some embodiments, the bladder cancer is a muscle-invasive bladder cancer. In some embodiments, the bladder cancer is a locally advanced or metastatic bladder cancer. In some embodiments, the bladder cancer is unresectable (e.g., unresectable locally advanced, unresectable metastatic).

[0110] In some embodiments, the subject has urothelial cancer. In some embodiments, the urothelial cancer is a non-muscle invasive urothelial cancer. In some embodiments, the urothelial cancer is a muscle-invasive urothelial cancer. In some embodiments, the urothelial cancer is a locally advanced or metastatic urothelial cancer. In some embodiments, the urothelial cancer is unresectable (e.g., unresectable locally advanced, unresectable metastatic). In some embodiments, the urothelial or bladder cancer is a muscle-invasive urothelial carcinoma (MIUC). In some embodiments, the MIUC is high-risk MIUC.

[0111] In some embodiments, the urothelial cancer is a urothelial cancer that express 191P4D12 RNA, express 191P4D12 protein, or express both 191P4D12 RNA and 191P4D12 protein. In some embodiments, the urothelial cancer is a locally advanced urothelial cancer that express 191P4D12 RNA, express 191P4D 12 protein, or express both 19IP4D12 RNA and 191P4D 12 protein. In some embodiments, the urothelial cancer is a metastatic urothelial cancer that express 191P4D12 RNA, express 191P4D12 protein, or express both I91P4D12 RNA and 19IP4D12 protein.

[0112] In some embodiments, the locally advanced or metastatic urothelial cancers are confirmed histologically, cytologically, or both histologically and cytologically. In some embodiments, the locally advanced or metastatic bladder cancers are confirmed histologically, cytologically, or both histologically and cytologically.

[0113] The stage of urothelial or bladder cancer has important prognostic implications for subjects. In some embodiments, the urothelial or bladder cancer is stage II urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is stage III urothelial or bladder cancer. In Attorney Docket No. 131986-71 1 1 some embodiments, the urothelial or bladder cancer is stage IIIA urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is stage IIIB urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is stage IV urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is resectable; that is, it may be cured by surgery / alone or by surgery followed by adjuvant treatment. In some embodiments, the urothelial or bladder cancer is resectable stage II urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is resectable stage III urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is resectable stage IIIA urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is resectable stage IIIB urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is resectable stage IV urothelial or bladder cancer. In some embodiments, the urothelial or bladder cancer is unresectable urothelial or bladder cancer.

[0114] In some embodiments, the subject’s Tumor Proportion Score (TPS) is determined. The TPS is a measure of the percentage of viable tumor cells showing partial or complete membrane staining at any intensity for programmed cell death ligand 1 (PD-L1), and is typically used to predict the efficacy of immune checkpoint inhibitor therapy (Ulas et al. Predictive Value of Combined Positive Score and Tumor Proportion Score for Immunotherapy Response in Advanced NSCLC. JTO Clin Res Rep. 2023 May 25 ;4(9) : 100532). A TPS may be calculated using any method known in the art, for example, using commercially available assays. In some embodiments, the subject’s TPS is less than 50%, for example, 49%, 48%, 47%, 46%, 45%, 44%, 43%, 42%, 41%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or 0%. In some embodiments, the TPS is 0%-10%, 0% - 15%, 0% - 20%, 0% - 25%, 0% - 30%, 0% - 35%, 0% - 40%, 0% - 45%, 0% - 50%, 10% - 20%, 10% - 25%, 10% - 30%, 10%

[0115] - 35%, 10% - 40%, 10% - 45%, 10% - 50%, 15% - 20%, 15% - 25%, 15% - 30%, 15% - 35%, 15%

[0116] - 40%, 15% - 45%, 15% - 50%, 20% - 25%, 20% - 30%, 20% - 35%, 20% - 40%, 20% - 45%, 20%

[0117] - 50%, 25% - 30%, 25% - 35%, 25% - 40%, 25% - 45%, 25% - 50%, 30% - 35%, 30% - 40%, 30%

[0118] - 45%, 30% - 50%, 35% - 40%, 35% - 45%, 35% - 50%, 40% - 45%, 40% - 50%, or 45% - 50%. In some embodiments, the subject’s TPS is equal to or greater than 50% (the specimen / tumor has high PD-L1 expression), for example 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the TPS is 50% - 55%, 50% - 60%, 50% - 65%, 50% - 70%, 50% - 75%, 50% - 80%, 50% - 85%, 50% - 90%, 50% - 95%, 50% Attorney Docket No. 131986-71 1 1

[0119] - 100%, 55% - 60%, 55% - 65%, 55% - 70%, 55% - 75%, 55% - 80%, 55% - 85%, 55% - 90%, 55% - 95%, 55% - 100%, 60% - 65%, 60% - 70%, 60% - 75%, 60% - 80%, 60% - 85%, 60% - 90%, 60% - 95%, 60% - 100%, 65% - 70%, 65% - 75%, 65% - 80%, 65% - 85%, 65% - 90%, 65%

[0120] - 95%, 65% - 100%, 70% - 75%, 70% - 80%, 70% - 85%, 70% - 90%, 70% - 95%, 70% - 100%, 75% - 80%, 75% - 85%, 75% - 90%, 75% - 95%, 75% - 100%, 80% - 85%, 80% - 90%, 80% - 95%, 80% - 100%, 85% - 90%, 85% - 95%, 85% - 100%, 90% - 95%, 90% - 100%, or 95% - 100%.

[0121] In some embodiments, the subject has a particular score according to a patient evaluation metric. For example, in some embodiments, the subject has a given Eastern Cooperative Oncology Group (ECOG) performance status score. In some embodiments, the subject has an ECOG performance status score of 0, 1, 2, 3, or 4 (e.g., 0, 1, or 2). In some embodiments, the subject has an ECOG performance status score in the range of 0-1. In some embodiments, the subject has an ECOG performance status score in the range of 0-2. In some embodiments, the subject has an ECOG performance status score of 0. In some embodiments, the subject has an ECOG performance status score of 1. In some embodiments, the subject has an ECOG performance status score of 2. ECOG performance status score is determined according to the scale:

[0122] The ECOG performance status score is described in Oken, et al. “Toxicity and response criteria of the Eastern Cooperative Oncology Group” Am J Clin Oncol. 5(6):649-655 (1982), the entire contents of which are incorporated by reference herein for this purpose.

[0123] The subject, in some embodiments, is also one who is able to undergo surgical resection of the tumor (for example, the physician-recommended treatment of the urothelial or bladder cancer in the subject includes surgical resection of the tumor). In some embodiments, the subject is able to receive enfortumab vedotin (e.g., the physician-recommended treatment of the urothelial or Attorney Docket No. 131986-71 1 1 bladder cancer in the subject includes chemotherapy). In some embodiments, the subject is able to receive immune checkpoint inhibitor therapy (e.g., the physician-recommended treatment of the urothelial or bladder cancer in the subject includes administration of an immune checkpoint inhibitor, such as pembrolizumab). In some embodiments, the subject is able to receive an individualized neoantigen vaccine (e.g., the physician-recommended treatment of the urothelial or bladder cancer in the subject includes administration of an individualized neoantigen vaccine, e.g., as described herein).

[0124] The subject, in some embodiments, is a human subject. The subject, in some embodiments is at least 18 years of age. In some embodiments, the subject is over 50 years of age. In some embodiments, the subject is over 65 years of age. In some embodiments, the subject is over 70 years of age.

[0125] Cisplatin-ineligible patien ts

[0126] In some embodiments, a subject treated with a method of the present disclosure is ineligible to receive cisplatin. Various conditions can be used to determine the cisplatin ineligibility for the human subjects for the methods provided herein, including but not limited to the methods of the preceding paragraphs. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of impaired renal function (e.g,, glomerular filtration rate (GFR) or creatinine clearance <60 mL / min but >30 mL / min (estimated by the Cockcroft-Gault formula, modification of diet in renal disease [MDRD] or 24-hour urine)). In certain embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of no less than Grade 2 hearing loss (e.g., CI CTCAE Version 4.03 Grade > 2 hearing loss). In certain embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and impaired renal function. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of impaired renal function and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of impaired renal function and N YHA Class Ill heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2, impaired renal function, and no less than Grade 2 hearing loss. In some Attorney Docket No. 131986-71 1 1 embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of impaired renal function, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of ECOG performance status score of 2, impaired renal function, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of impaired renal function, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, impaired renal function, and no less than Grade 2 hearing loss, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of impaired renal function, no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, impaired renal function, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of impaired renal function, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum-based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0127] Impaired renal function can be determined as various means known and available in the art. Various embodiments are provided herein to determine the impaired renal function for the human subjects for the methods provided herein, including but not limited to the methods of the preceding paragraph. In some embodiments, the impaired renal function is determined by glomerular filtration rate (GFR) less than 60 mL / min. In some embodiments, the impaired renal function is determined by GFR less than 60 but no less than 30 mL / min. In certain embodiments, the impaired renal function is determined by GFR less than 30 but no less than 15 mL / min. In some embodiments of the methods provided in this paragraph, the GFR is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the GFR is estimated by the Cockcroft-Gault criteria. In other embodiments of the methods provided in this paragraph, the GFR is measured by modification of diet in renal disease [MDRD], Attorney Docket No. 131986-71 1 1

[0128] In a further embodiment, the impaired renal function is determined by creatinine clearance (CrCl) less than 60 mL / min. In some embodiments, the impaired renal function is determined by CrCl less than 60 but no less than 30 mL / min. In certain embodiments, the impaired renal function is determined by CrCl less than 30 but no less than 15 mL / min. In some embodiments of the methods provided in this paragraph, the CrCl is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the CrCl is estimated by the Cockcroft- Gault criteria.

[0129] As such, some specific conditions based on GFR or creatinine clearance can be used to determine the cisplatin ineligibility for the human subjects for the methods provided herein, including but not limited to the methods of the preceding paragraphs. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 mL / min. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and CrCl less than 60 mL / min. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 mL / min and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 mL / min, and NYHA Class III heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2, GFR less than 60 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of ECOG performance status score of 2, GFR less than 60 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of GFR less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, GFR less than 60 mL / min, and no less than Grade 2 hearing loss, in any combination or permutation. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of GFR 1 less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or pennutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, GFR less than 60 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of GFR less than 60 mL / min, Attorney Docket No. 131986-71 1 1 and no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided in this paragraph, the GFR is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the GFR is estimated by the Cockcroft- Gault criteria. In other embodiments of the methods provided in this paragraph, the GFR is measured by modification of diet in renal disease [MDRD], In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum-based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0130] In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 mL / min. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and CrCl less than 60 mL / min. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 mL / min and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 mL / min, and NYHA Class III heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2, CrCl less than 60 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of ECOG performance status score of 2, CrCl less than 60 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of CrCl less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, CrCl less than 60 mL / min, and no less than Grade 2 hearing loss, in any combination or permutation. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of CrCl less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, CrCl less than 60 mL / min, and no less than Grade 2 hearing loss. In some Attorney Docket No. 131986-71 1 1 embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of CrCl less than 60 mL / min, and no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided in this paragraph, the CrCl is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the CrCl is estimated by the Cockcroft-Gault criteria. In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum-based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0131] Alternatively, other specific conditions based on GFR or creatinine clearance can be used to determine the cisplatin ineligibility for the human subjects for the methods provided herein, including but not limited to the methods of the preceding paragraphs. In some embodiments, embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 but no less than 30 mL / min. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and GFR less than 60 but no less than 30 mL / min. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 but no less than 30 mL / min and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 but no less than 30 mL / min and NYHA Class III heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2, GFR less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of anyone of ECOG performance status score of 2, GFR less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of GFR less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, GFR less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss, in any combination or permutation. In some embodiments, the conditions for Attorney Docket No. 131986-71 1 1 determining the cisplatin ineligibility comprise or consist of any two of GFR less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, GFR less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of GFR less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided in this paragraph, the GFR is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the GFR is estimated by the Cockcroft-Gault criteria. In other embodiments of the methods provided in this paragraph, the GFR is measured by modification of diet in renal disease [MDRD], In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum -based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0132] In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 but no less than 30 mL / min. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and CrCl less than 60 but no less than 30 mL / min. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 but no less than 30 mL / min and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 but no less than 30 mL / min and NYHA Class III heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility' comprise or consist of ECOG performance status score of 2, CrCl less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of ECOG performance status score of 2, CrCl less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility' comprise or consist of any one of CrCl less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In Attorney Docket No. 131986-71 1 1 some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, CrCl less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of CrCl less than 60 but no less than 30 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, CrCl less than 60 but no less than 30 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of CrCl less than 60 but no less than 30 niL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided in this paragraph, the CrCl is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the CrCl is estimated by the Cockcroft-Gault criteria. In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum-based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0133] Similarly, further specific conditions based on GFR or creatinine clearance can be used to determine the cisplatin ineligibility for the human subjects for the methods provided herein, including but not limited to the methods of the preceding paragraphs, some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 30 but no less than 15 mL / min. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and GFR less than 30 but no less than 15 mL / min. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 30 but no less than 15 mL / min and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 30 but no less than 15 mL / min, and NYHA Class III heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2, GFR less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of GFR less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some Attorney Docket No. 131986-71 1 1 embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of ECOG performance status score of 2, GFR less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of GFR less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYFIA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, GFR less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of GFR less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, GFR less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of GFR less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided in this paragraph, the GFR is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the GFR is estimated by the Cockcroft-Gault criteria. In other embodiments of the methods provided in this paragraph, the GFR is measured by modification of diet in renal disease [MDRD], In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum-based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0134] In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 30 but no less than 15 mL / min. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2 and CrCl less than 30 but no less than 15 mL / min. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 30 but no less than 15 mL / min and no less than Grade 2 hearing loss. In further embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 30 but no less than 15 mL / min, and NYHA Class III heart failure. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of ECOG performance status score of 2, Attorney Docket No. 131986-71 1 1

[0135] CrCl less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss. In yet other embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of CrCl less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of ECOG performance status score of 2, CrCl less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any one of CrCl less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of ECOG performance status score of 2, CrCl less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of any two of CrCl less than 30 but no less than 15 mL / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure, in any combination or permutation. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of ECOG performance status score of 2, CrCl less than 30 but no less than 15 mL / min, and no less than Grade 2 hearing loss. In some embodiments, the conditions for determining the cisplatin ineligibility comprise or consist of all three of CrCl less than 30 but no less than 15 m L / min, no less than Grade 2 hearing loss, and NYHA Class III heart failure. In some embodiments of the methods provided in this paragraph, the CrCl is measured by 24-hour urine collection. In other embodiments of the methods provided in this paragraph, the CrCl is estimated by the Cockcroft-Gault criteria. In some embodiments of the methods provided herein, the subject did not receive prior systemic treatment for locally- advanced or metastatic disease. In some embodiments of the methods provided herein, the subject did not receive adjuvant / neoadjuvant platinum-based therapy within 12 months prior to randomization. In some embodiments of the methods provided herein, wherein the subject has ECOG performance status score of 2, the subject (i) has Hemoglobin >10 g / dL; (ii) has GFR > 50 mL / min; and (iii) does not have NYHA Class III heart failure.

[0136] Urothelial or Bladder Cancer Treatments; Immune Responses

[0137] The disclosure, in some aspects, provides methods of treating urothelial or bladder cancer and / or inducing an immune response against a urothelial or bladder cancer tumor by administering a neoadjuvant therapy prior to surgical resection of the tumor and then administering an effective amount of an adjuvant therapy after the surgical resection of the tumor. In other aspects, the disclosure provides methods of treating urothelial or bladder cancer and / or inducing an immune Attorney Docket No. 131986-71 1 1 response against an urothelial or bladder cancer tumor by identifying a subject with urothelial or bladder cancer that has received neoadjuvant therapy prior to undergoing a surgical resection of the tumor and then administering an effective amount of an adjuvant therapy after the surgical resection of the tumor.

[0138] As used herein, “treating urothelial or bladder cancer” refers to an intervention that alters the natural course of urothelial or bladder cancer, for example, alleviating at least one symptom of urothelial or bladder cancer, diminishing any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, ameliorating or palliating the disease state, and / or remission (e.g., partial or complete) or improved prognosis. In some embodiments, the methods described herein are used to slow the progression of urothelial or bladder cancer, for example, by inducing an immune response against the urothelial or bladder cancer tumor.

[0139] As used herein, “inducing an immune response” against a urothelial or bladder cancer tumor refers to the induction of a humoral and / or cellular-mediated response against urothelial or bladder cancer (e.g., tumor cells). In some embodiments, an induced immune response to a tumor comprises a cellular response to one or more antigens (e.g., neoantigens) expressed in the tumor. In some embodiments, a cellular response comprises a T cell response, e.g., a CD4 T cell response and / or a CD8 T cell response. In some embodiments, a T cell response comprises generation of one or more de novo T cell responses to a tumor antigen. For example, in some embodiments, a T cell response to a tumor antigen results in the presence of a T cell with specificity for the tumor antigen, wherein the T cell with specificity for the tumor antigen was not previously present or was not previously detectable (e.g., in a subject or in a biological sample collected from a subject). Such a T cell response to a tumor antigen can result from the immune system’s response to a neoantigen, or to a peptide corresponding to the neoantigen (e.g., a peptide encoded by a nucleic acid vaccine provided herein). In some embodiments, a T cell response to a tumor antigen is not detectable in a subject prior to administration to the subject of a cancer vaccine (e.g., individualized neoantigen vaccine) but is detectable in the subject after administration of the vaccine. In some embodiments, a T cell response to a tumor antigen is increased in a subject following administration to the subject of a cancer vaccine (e.g., individualized neoantigen vaccine) relative to a level of immune response to the tumor antigens prior to administration of the vaccine.

[0140] A T cell response to a specific antigen can be detected, for example, by collecting a sample comprising immune cells (e.g., peripheral blood mononuclear cells (PBMCs), such as PBMCs from a blood sample), stimulating the immune cells with the specific antigen, and subsequently measuring immune activation signals (e.g., cytokine production) from the immune cells. T cells with specificity for the specific antigen produce activation signals (e.g., cytokines) in response to Attorney Docket No. 131986-71 1 1 the stimulation, and can thereby be detected. A T cell response to a specific antigen can also be detected by a method described in U.S. Patent Application Pub. No. US2022 / 0236253A1, the contents of which are herein incorporated by reference in their entirety for this purpose.

[0141] In some embodiments, a T cell response comprises an increase in an existing T cell responses to a tumor antigen in the subject. This increase can be the result of an increase in the individual strength of the reaction of the antigen-specific T cells to the antigen, an increase in the size of the population of T cells specific for the antigen, and / or a decrease in immunosuppressive signals (e.g., a decrease in the size of a population of cells which suppress T cell activity against the antigen, such as regulatory T cells (Tregs)).

[0142] An increase in the individual strength of the reaction of antigen-specific T cells to the antigen can be measured, e.g., as described above, by first selecting for antigen-specific T cells and normalizing the measured immune activation signals (e.g., cytokines) to the total number of antigen-specific T cells.

[0143] An increase in the size of a population of antigen-specific T cells can be detected by comparing the measured immune activation signals (e.g., cytokines) from a defined number of T cells (e.g., from PBMCs) in a sample collected prior to the immune response induction (e.g,, prior to the administration of an individualized neoantigen vaccine) with that in a sample collected after the immune response induction. Sizes of populations of cells (e.g., antigen-specific T cells and cells which suppress T cell activity) can also be measured, for example, by flow cytometric analysis using markers for the particular population(s) of interest. Such flow cytometric analysis can, for example, allow one to determine the ratio of a specific population of T cells (e.g., antigenspecific T cells) to a broader population of cells (e.g., to all T cells) in a biological sample.

[0144] An “effective amount” of a neoadjuvant or adjuvant therapy may be provided based, at least in part, on the target tissue, target cell type, means of administration, and, with respect to the individualized neoantigen vaccine, physical characteristics of the polynucleotide (e.g., size, and extent of modified nucleosides) and other components of the vaccine. In general, an effective amount of the adjuvant therapy provides an induced or boosted immune response as a function of neoantigen production in the cell, preferably more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same neoantigen or a neoepitope. Increased neoantigen production may be demonstrated by increased cell transfection (the percentage of cells transfected with the individualized neoantigen vaccine), increased protein translation from the polynucleotide, decreased nucleic acid degradation (as demonstrated, for example, by increased duration of protein translation from a modified polynucleotide), or altered antigen specific immune response of the host. Attorney Docket No. 131986-71 1 1

[0145] Neoadjuvant Therapy

[0146] As used herein, “neoadjuvant therapy” refers to any treatment given before surgical resection of a urothelial or bladder cancer tumor in the subject being treated.

[0147] In some aspects, methods provided herein relate, at least in part, to selecting a subject who has urothelial or bladder cancer and treating the subj ect with a neoadjuvant therapy prior to surgical resection of a tumor. Additionally or alternatively, in some aspects, methods provided herein relate, at least in part, to selecting a subject who has urothelial or bladder cancer and has received a neoadjuvant therapy prior to undergoing a surgical resection of a tumor, and treating the subject with an adjuvant therapy as described herein. One or both of the neoadjuvant therapy and the adjuvant therapy may comprise a combination treatment as described herein (e.g., comprising an individualized neoantigen vaccine as described herein, an immune checkpoint inhibitor and, optionally, enfortumab vedotin).

[0148] In some embodiments, the neoadjuvant therapy comprises administration of an immune checkpoint inhibitor. In some embodiments, the neoadjuvant therapy comprises administration of an immune checkpoint inhibitor and enfortumab vedotin. In some embodiments, the neoadjuvant therapy comprises administration of an immune checkpoint inhibitor and an individualized neoantigen vaccine (e.g., a combination treatment as described herein). In some embodiments, the neoadjuvant therapy comprises administration of an immune checkpoint inhibitor, enfortumab vedotin, and an individualized neoantigen vaccine (e.g., another combination treatment as described herein). In some embodiments, neoadjuvant therapy may comprise an immune checkpoint inhibitor administered together with enfortumab vedotin (e.g., on the same day) or administration separately on different days and / or different schedules. In some embodiments, neoadjuvant therapy may comprise an immune checkpoint inhibitor administered together with enfortumab vedotin and / or an individualized neoantigen vaccine (e.g., on the same day) or separately on different day and / or different schedules.

[0149] In some embodiments, the immune checkpoint inhibitor is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the immune checkpoint inhibitor is administered every 3 weeks. In some embodiments, the immune checkpoint inhibitor is administered every 6 weeks. In some embodiments, the immune checkpoint inhibitor is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more total times (each time is a cycle of immune checkpoint administration). In some embodiments, the immune checkpoint inhibitor is administered 2-6 times (i.e., 2-6 cycles). In some embodiments, the immune checkpoint inhibitor Attorney Docket No. 131986-71 1 1 is administered 3-5 times (i.e., 3-5 cycles). In some embodiments, the immune checkpoint inhibitor is administered four times (i.e., four cycles). In a preferred embodiment, the immune checkpoint inhibitor is administered once every three weeks for four total cycles.

[0150] In some embodiments, enfortumab vedotin is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, enfortumab vedotin is administered every 3 weeks. In some embodiments, enfortumab vedotin is administered every 6 weeks. In some embodiments, enfortumab vedotin is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more total times (each time is a cycle of enfortumab vedotin administration). In some embodiments, enfortumab vedotin is administered 2-6 times (i.e., 2-6 cycles). In some embodiments, enfortumab vedotin is administered 3-5 times (i.e., 3-5 cycles). In some embodiments, enfortumab vedotin is administered four times (i.e., four cycles). In a preferred embodiment, enfortumab vedotin is administered once every three weeks for four total cycles.

[0151] In some embodiments, the individualized neoantigen vaccine is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every' seven weeks, or every eight weeks. In some embodiments, the individualized neoantigen vaccine is administered every 3 weeks. In some embodiments, the individualized neoantigen vaccine is administered every 6 weeks. In some embodiments, the individualized neoantigen vaccine is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more total times (each time is a cycle of the individualized neoantigen vaccine administration). In some embodiments, the individualized neoantigen vaccine is administered 1-4 times (i.e., 1-4 cycles). In some embodiments, the individualized neoantigen vaccine is administered 2-4 times (i.e., 2-3 cycles). In some embodiments, the individualized neoantigen vaccine is administered four times (i.e., four cycles). In a preferred embodiment, the individualized neoantigen vaccine is administered once every three weeks for four total cycles.

[0152] In some embodiments, the neoadjuvant therapy’s duration is 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks or more. In some embodiments, the neoadjuvant therapy’s duration is 10-14 weeks. In some embodiments, the neoadjuvant therapy’s duration is 12 weeks.

[0153] Immune Checkpoint Inhibitors

[0154] In some embodiments, a method may comprise a neoadjuvant therapy that comprises administration of at least one immune checkpoint inhibitor. As described in more detail below, in Attorney Docket No. 131986-71 1 1 some embodiments, a method may comprise an adjuvant therapy that may comprise administration of at least one immune checkpoint inhibitor.

[0155] Immune checkpoint inhibitors (e g., inhibitoiy checkpoint molecules) include, but are not limited to: PD-1, TIM-3, VISTA, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR and LAG3. CTLA-4, PD-1, and ligands thereof are members of the CD28-B7 family of co-signaling molecules that play important roles throughout all stages of T-cell function and other cell functions. CTLA- 4, Cytotoxic T -Lymphocyte-Associated protein 4 (CD 152), is involved in controlling T cell proliferation.

[0156] The PD-1 receptor is expressed on the surface of activated T cells (and B cells) and, under normal circumstances, binds to its ligands (PD-L1 and PD-L2) that are expressed on the surface of antigen-presenting cells, such as dendritic cells or macrophages. This interaction sends a signal into the T cell and inhibits it. Cancer cells take advantage of this system by driving high levels of expression of PD-L1 on their surface. This allows them to gain control of the PD-1 pathway and switch off T cells expressing PD-1 that may enter the tumor microenvironment, thus suppressing the anticancer immune response.

[0157] In some embodiments, the immune checkpoint inhibitor is PD-1 antagonist such as an anti- PD-1 antibody. In some embodiments, the anti-PD-1 antibody is pembrolizumab (formerly MK- 3475 and lambrolizumab, trade name KETRUDA®), a human antibody used in cancer immunotherapy that targets the PD-1 receptor. In some embodiments, the anti-PD-1 antibody is BMS-936558 (nivolumab).

[0158] In some embodiments, the anti-PD-1 antibody is a human antibody. In other embodiments, the anti-PD-1 antibody is a humanized antibody. In other embodiments, the anti-PD-1 antibody is a chimeric antibody. In specific embodiments, the anti-PD-1 antibody or antigen binding fragment thereof is a monoclonal antibody.

[0159] In some embodiments, the anti-PD-1 antibody comprises: (a) light chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 43, 44 and 45 and heavy chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 48, 49 and 50. In some embodiments, the anti-PD-1 antibody specifically binds to human PD-1 and comprises (a) a heavy chain variable region comprising an amino acid sequence as set forth in SEQ ID NO: 51, or a variant thereof, and (b) a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NO :46. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody which specifically binds to human PD-1 and comprises (a) a heavy chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:52, or a variant thereof; and (b) a light chain comprising or consisting of a sequence of amino acids as set forth in Attorney Docket No. 131986-71 1 1

[0160] SEQ ID NO:47, or a variant thereof. In some embodiments, the anti-PD-1 antibody is a monoclonal antibody which specifically binds to human PD-1 and comprises (a) a heavy chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:52 and (b) a light chain comprising or consisting of a sequence of amino acids as set forth in SEQ ID NO:47. In some embodiments, the anti-PD-1 antibody is pembrolizumab or a variant thereof.

[0161] Exemplary PD-1 Antibody Sequences

[0162] A variant of a heavy chain variable region sequence or full-length heavy chain sequence is identical to the reference sequence except having up to 17 conservative amino acid substitutions in the framework region (i.e., outside of the CDRs), and preferably has less than ten, nine, eight, seven, six or five conservative amino acid substitutions in the framework region. A variant of a light chain variable region sequence or full-length light chain sequence is identical to the reference sequence except having up to five conservative amino acid substitutions in the framework region Attorney Docket No. 131986-71 1 1

[0163] (z'.e., outside of the CDRs), and preferably has less than four, three or two conservative amino acid substitution in the framework region.

[0164] In some embodiments, the anti-PD-1 antibody has a variable light domain and / or a variable heavy domain with at least 95%, 90%, 85%, 80%, 75% or 50% sequence identity to one of the variable light domains or variable heavy domains described above and exhibits specific binding to PD-1. In another embodiment of the methods of treatment of the disclosure, the anti-PD-1 antibody comprises variable light and variable heavy domains having up to I, 2, 3, 4, or 5 or more amino acid substitutions, and exhibits specific binding to PD-1.

[0165] The dose of an immune checkpoint inhibitor in a neoadjuvant therapy, in some embodiments, is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, or 500 mg. In some embodiments, the dose is 100 mg - 300 mg. In some embodiments, the dose is 200 mg. In some embodiments the dose of an immune checkpoint inhibitor in a neoadjuvant therapy is administered weekly, every two weeks, every / three weeks, every' four weeks, every / five weeks, every six weeks, every / seven weeks, or every eight weeks. In some embodiments, the dose of an immune checkpoint inhibitor in a neoadjuvant therapy is administered every / 3 weeks. For example, in some embodiments, the dose of the immune checkpoint inhibitor in a neoadjuvant therapy is 200 mg administered every 3 weeks.

[0166] In some embodiments, an immune checkpoint inhibitor is pembrolizumab. The dose of pembrolizumab in a neoadjuvant therapy, in some embodiments, is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, or 500 mg. In some embodiments, the dose is 200 mg. In some embodiments the dose of pembrolizumab in a neoadjuvant therapy is administered weekly, every' two weeks, every' three weeks, every / four weeks, every' five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the dose of pembrolizumab in a neoadjuvant therapy is administered every' 3 weeks. In some embodiments, the dose of pembrolizumab in a neoadjuvant therapy is 400 mg administered every / 6 weeks. For example, in some embodiments, the dose of pembrolizumab in a neoadjuvant therapy is 200 mg administered every 3 weeks. The dose approved in the United States for treatment of cutaneous melanoma subjects is 2 mg / kg every 3 weeks. It has been concluded that a dose of 200 mg consistently across multiple tumor types is similar to 2 mg / kg.

[0167] In some embodiments, an immune checkpoint inhibitor is administered to a subject on a regular basis (e.g., once a week, once every / two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every' 10 weeks, once every 11 weeks, once every' 12 weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified Attorney Docket No. 131986-71 1 1 total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments, the specified total period of time is 2-6 doses of the immune checkpoint inhibitor (e.g., pembrolizumab) in the neoadjuvant therapy. In some embodiments, the specified total period of time is four doses of the immune checkpoint inhibitor (e.g., pembrolizumab) in the neoadjuvant therapy.

[0168] In some embodiments, the immune checkpoint inhibitors are delivered in the form of mRNA encoding the immune checkpoint inhibitor(s). In other embodiments, the immune checkpoint inhibitors are delivered in the form of polypeptides. The immune checkpoint inhibitor may be administered by any route. In some embodiments, the immune checkpoint inhibitor is administered by an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route. In some embodiments, the immune checkpoint inhibitor is administered by an intravenous route. In some embodiments, the immune checkpoint inhibitor is administered by a subcutaneous route.

[0169] In some embodiments, the immune checkpoint inhibitor in a neoadjuvant therapy is a PD- 1 antagonist (e.g., an anti-PD-1 antibody), such as pembrolizumab. In some embodiments, the immune checkpoint inhibitor in a neoadjuvant therapy is a PD-1 antagonist (e.g., an anti-PD-1 antibody), such as pembrolizumab, is administered intravenously or subcutaneously, e.g., by intravenous (IV) infusion or subcutaneous injection.

[0170] In some neoadjuvant therapy embodiments, pembrolizumab is formulated as a liquid medicament. In some embodiments, pembrolizumab is formulated as a liquid medicament that comprises about 25 mg / ml pembrolizumab, about 7% (w / v) sucrose, about 0.02% (w / v) polysorbate 80, about 10 mM histidine buffer, optionally at a pH of about 5.5. In some embodiments wherein pembrolizumab is administered by intravenous (IV) infusion, the pembrolizumab is formulated as a liquid medicament that comprises 25 mg / ml pembrolizumab, 7% (w / v) sucrose, 0.02% (w / v) polysorbate 80, 10 mM histidine buffer, optionally at pH 5.5. In some embodiments, pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L- methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80. In some embodiments wherein pembrolizumab is administered by subcutaneous injection, pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab about 10 mM histidine buffer, about 10 mM L- methionine, or a pharmaceutically acceptable salt thereof about 7% (w / v) sucrose, and about 0.02 Attorney Docket No. 131986-71 1 1

[0171] % (w / v) polysorbate 80. In some embodiments wherein pembrolizumab is co-formulated with a human hyaluronidase (as discussed below), pembrolizumab is provided as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80. In some embodiments wherein pembrolizumab is administered by subcutaneous injection and coformulated with a human hyaluronidase (as discussed below), pembrolizumab is provided as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80.

[0172] In some neoadjuvant therapy embodiments, pembrolizumab is administered by intravenous (IV) infusion at a dose of 2 mg / kg every three weeks, 200 mg every' three weeks, or 400 mg every six weeks. In some embodiments, the pembrolizumab is formulated as a liquid medicament that comprises 25 mg / ml pembrolizumab, 7% (w / v) sucrose, 0.02% (w / v) polysorbate 80 in 10 mM histidine buffer at pH 5.5.

[0173] In some neoadjuvant therapy embodiments, pembrolizumab is subcutaneously administered at a dose of about 280 mg to about 420 mg every three weeks, including at a dose of 280 mg to 420 mg every’ three weeks. In some embodiments, pembrolizumab is subcutaneously administered at a dose of about 350 mg to about 420 mg every three weeks, including at a dose of 350 mg to 420 mg every three weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 360 mg to about 400 mg every three weeks, including at a dose of 360 mg to 400 mg every three weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 380 mg every' three weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of 380 mg every three weeks. In some embodiments, the pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5.

[0174] In some neoadjuvant therapy embodiments, pembrolizumab is subcutaneously coadministered at a dose of about 300 mg to about 500 mg, including at a dose of 300 mg to 500 mg, every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of about 350 mg to about 400 mg, including at a dose of 350 mg to 400 mg, every three weeks with a human hyaluronidase. In some embodiments, Attorney Docket No. 131986-71 1 1 pembrolizumab is subcutaneously co-administered at a dose of about 380 mg to about 395 mg, including at a dose of 380 nig to 395 mg, every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of about 395 mg every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of 395 mg every three weeks with a human hyaluronidase.

[0175] In any embodiments of the foregoing embodiments comprising co-administration of a human hyaluronidase, the dose of the human hyaluronidase may be about 700 Units to about 50000 Units. The dose of the human hyaluronidase may be about 2000 Units to about 20000 Units. The dose of the human hyaluronidase may be about 5000 Units to about 15000 Units. The dose of the human hyaluronidase may be about 4000 Units to about 6000 Units. In specific embodiments of the foregoing embodiments, the dose of the human hyaluronidase is 4800 Units. In further specific embodiments, the human hyaluronidase is co-formulated or co-administered with the pembrolizumab.

[0176] In some neoadjuvant therapy embodiments, pembrolizumab is subcutaneously administered at a dose of about 700 mg to about 800 mg, including at a dose of 700 mg to 800 mg, every six weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 760 to about 790 mg, including at a dose of 760 to 790 mg, every six weeks. In some embodiments, the pembrolizumab is subcutaneously admini stered at a dose of about 790 mg every six weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of 790 mg every six weeks. In some embodiments, the pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5. In some aspects of the foregoing embodiments, pembrolizumab is co-administered with a human hyaluronidase, as discussed above. In some aspect of the foregoing embodiments, pembrolizumab is co-formulated with a human hyaluronidase.

[0177] In some embodiments comprising co-administration of pembrolizumab and a human hyaluronidase, pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab; about 10 mM histidine buffer; about 10 mM L-methionine or a pharmaceutically acceptable salt thereof; about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80.

[0178] It is known that there are six types of hyaluronidases in humans: Hyall, Hyal2, Hyal3, Hyal4, HyalPSl, and PH20 / SPAM1. Recombinant forms of these hyaluronidases with modifications, mutations, addition, truncations can be used in the disclosed methods, uses, Attorney Docket No. 131986-71 1 1 compositions, and kits. In one embodiment, the human hyaluronidase is a human hyaluronidase PH20 fragment or variant described in for example, U.S. Patent Nos.7, 767, 429, 8,431,380, 7,871,607, International Publication No. WO 2020 / 022791, U.S. Patent Publication No. US2006 / 0104968 and European Patent 1858926, incorporated herein by reference in its entirety'. Exemplary' of such human hyaluronidase PI 120 fragment or variants is the known agent PEGPH20 or rHuPH20. In one aspect of the above embodiments, the human hyaluronidase is a PH20 fragment or variant that is rHuPH20. In another aspect of the above embodiments, the human hyaluronidase is a PH20 fragment or variant that is berahyaluronidase alfa.

[0179] In some neoadjuvant therapy embodiments, pembrolizumab is subcutaneously administered at a dose of 395 mg every three weeks with 4800 Units of berahyaluronidase alfa. In some embodiments, pembrolizumab is subcutaneously administered at a dose of 790 mg every six weeks with 9600 Units of berahyaluronidase alfa. See Prescribing Information for KEYTRUDA QLEX™.

[0180] Enfortumab Vedotin

[0181] In some embodiments, a method may comprise a neoadjuvant therapy that comprises administration of enfortumab vedotin. As described in more detail below, in some embodiments, a method may comprise an adjuvant therapy that comprises administration of enfortumab vedotin.

[0182] Enfortumab vedotin is an Antibody Drag Conjugate (ADC) comprised of a fully human immunoglobulin G1 kappa (IgGIK) antibody conjugated to the microtubule-disrupting agent (MMAE) via a protease-cleavable linker (Challita-Eid PM et al, Cancer Res. 2016;76(10):3003- 13], Enfortumab vedotin induces antitumor activity by binding to 191P4D12 protein on the cell surface leading to internalization of the ADC-191 P4D12 complex, which then traffics to the lysosomal compartment where MMAE is released via proteolytic cleavage of the linker. Intracellular release of MMAE subsequently disrupts tubulin polymerization resulting in G2 / M phase cell cycle arrest and apoptotic cell death (Francisco JA et al, Blood.2003 Aug 15; 102(4): 1458-65).

[0183] As described in US Patent No.8, 637, 642, AGS-22M6E is an ADC derived from a murine hybridoma cell line. Enfortumab vedotin is a Chinese hamster ovary (CHO) cell line-derived equivalent of AGS-22M6E ADC and is an exemplary product used for human treatment. Enfortumab vedotin has the same amino acid sequence, linker and cytotoxic drug as AGS-22M6E. The comparability between enfortumab vedotin and AGS- 22M6E was confirmed through extensive analytical and biological characterization studies, such as binding affinity to 191P4D12, in vitro cytotoxicity, and in vivo antitumor activity. Attorney Docket No. 131986-711 1

[0184] Enfortumab vedotin is also known as EV, PADCEV, AGS-22M6E, AGS-22C3E, ASG- 22C3E. The enfortumab vedotin includes an anti-191P4D12 antibody, wherein the antibody or antigen binding fragment thereof comprises a heavy chain comprising amino acid residue 20 to amino acid residue 466 of SEQ ID NO: 60 and a light chain comprising amino acid residue 23 to amino acid residue 236 of SEQ ID NO: 61.

[0185] SEQ ID NO: 60: MELGLCWVFL VAILEGVQCE VQLVESGGGL VQPGGSLRLS CAASGFTFSS YNMNWVRQAP GKGLEWVSYI SSSSSTIYYA DSVKGRFTIS RDNAKNSLSL QMNSLRDEDT AVYYCARAYY YGMDVWGQGT TVTVSSASTK

[0186] GPSVFPLAPS SKSTSGGTAA LGCLVKDYFP EPVTVSWNSG ALTSGVHTFP

[0187] AVLQSSGLYS LSSVVTVPSS SLGTQTYICN VNHKPSNTKV DKRVEPKSCD

[0188] KTHTCPPCPA PELLGGPSVF LFPPKPKDTL MISRTPEVTC VVVDVSHEDP

[0189] EVKFNWYVDG VEVHNAKTKP REEQYNSTYR VVSVLTVLHQ DWLNGKEYKC KVSNKALPAP IEKTISKAKG QPREPQVYTL PPSREEMTKN QVSLTCLVKG

[0190] FYPSDIAVEW ESNGQPENNY KTTPPVLDSD GSFFLYSKLT VDKSRWQQGN

[0191] VFSCSVMHEA LIINHYTQKSL SLSPGK

[0192] SEQ ID NO: 61: MDMRVPAQLL GLLLLWFPGS RCDIQMTQSP SSVSASVGDR VTITCRASQG ISGWLAWYQQ KPGKAPKFLI YAASTLQSGV PSRFSGSGSG TDFTLTISSL QPEDFATYYC QQANSFPPTF GGGTKVEIKR TVAAPSVFIF PPSDEQLKSG TASWCLLNN FYPREAKVQW KVDNALQSGN SQESVTEQDS KDSTYSLSST LTLSKADYEK HKVYACEVTH QGLSSPVTKS FNRGEC

[0193] Enfortumab vedotin is a Nectin-4 directed antibody -drug conjugate (ADC) comprised of a fully human anti -nectin-4 IgGl kappa monoclonal antibody (AGS-22C3) conjugated to the small molecule microtubule disrupting agent, monomethyl auristatin E (MMAE) via a protease- cleavable maleimidocaproyl valine-citrulline (vc) linker (SGD- 1006). Conjugation takes place on cysteine residues that comprise the interchain disulfide bonds of the antibody to yield a product with a drug-to-antibody rati o of approximately 3.8:1. The molecular weight is approximately 152 kDa.

[0194] Enfortumab vedotin has the following structural formula: Attorney Docket No. 131986-71 1 1

[0195] Approximately 4 molecules of MMAE are attached to each antibody molecule. Enfortumab vedotin is produced by chemical conjugation of the antibody and small molecule components. The antibody is produced by mammalian (Chinese hamster ovary) cells and the small molecule components are produced by chemical synthesis.

[0196] Enfortumab vedotin injection is provided as a sterile, preservative-free, white to off-white lyophilized powder in single-dose vials for intravenous use. Enfortumab vedotin is supplied as a 20 mg per vial and a 30 mg per vial and requires reconstitution with Sterile Water for Injection, USP, (2.3 mL and 3.3 mL, respectively) resulting in a clear to slightly opalescent, colorless to slightly yellow solution with a final concentration of 10 mg / mL. After reconstitution, each vial allows the withdrawal of 2 mL (20 mg) and 3 mL (30 mg). Each mL of reconstituted solution contains 10 mg of enfortumab vedotin, histidine (1.4 mg), histidine hydrochloride monohydrate (2.31 mg), polysorbate 20 (0.2 mg) and trehalose dihydrate (55 mg) with a pH of 6.0.

[0197] The dose of enfortumab vedotin in a neoadjuvant therapy, in some embodiments, is 0.75 mg / kg, 1.0 mg / kg, 1.25 mg / kg, 1.5 mg / kg, 1.75 mg / kg, or 2.0 mg / kg. In some embodiments, the dose is 1 mg / kg - 1.5 mg / kg. In some embodiments, the dose is 1.5 mg / kg. In some embodiments the dose of enfortumab vedotin in a neoadjuvant therapy is administered weekly, every two weeks, every three weeks, every four weeks, every' five weeks, every six weeks, every seven weeks, or every eight weeks. In some embodiments, the dose of enfortumab vedotin in a neoadjuvant therapy is administered on Day 1 and Day 8 of every three-week cycle. For example, in some embodiments, the dose of enfortumab vedotin in a neoadjuvant therapy is 1.5 mg / kg administered on Day 1 and Day 8 of every three-week cycle.

[0198] In some embodiments, enfortumab vedotin is administered to a subject on a regular basis (e.g., once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every' six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every 10 weeks, once every 1 1 weeks, once every 12 weeks, on Day 1 and Day 8 of every 3 week cycle) for a specified total period of time, or until a particular endpoint is Attorney Docket No. 131986-71 1 1 reached. The specified total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments, the specified total period of time is 2-6 doses of enfortumab vedotin in the neoadjuvant therapy. In some embodiments, the specified total period of time is four doses of enfortumab vedotin in the neoadjuvant therapy.

[0199] Enfortumab vedotin may be administered by any route. In some embodiments, enfortumab vedotin is administered by an intravenous route.

[0200] Individualized Neoantigen Vaccines

[0201] In some embodiments, a method may comprise a neoadjuvant therapy that comprises administration of an individualized neoantigen vaccine. As described below, in some embodiments, a method may comprise an adjuvant therapy that comprises administration of an individualized neoantigen vaccine.

[0202] The term “individualized neoantigen vaccine” and “individualized neoantigen therapy” (or INT) are used interchangeably herein. An individualized neoantigen vaccine, as used herein, refers to a vaccine comprising a nucleic acid (e.g., an mRNA polynucleotide) encoding at least two neoepitopes specific to the subject’s cancer. A neoantigen is a tumor-specific antigen that is present in a tumor of an individual that is not expressed or expressed at low levels in normal non-cancerous tissue (e.g., blood, serum, plasma) of the subject. The neoantigen may or may not be present in tumors of other individuals. As used herein, “neoepitope” refers to an epitope of a neoantigen that is present in the tumor of the subject and not expressed or expressed at low levels in normal non- cancerous tissue of the subject. Herein, an individualized neoantigen vaccine may also be referred to as a “nucleic acid (cancer) vaccine” and / or an “mRNA (cancer) vaccine”.

[0203] For instance, the individualized neoantigen vaccine may include nucleic acids encoding a portion of one or more cancer antigens (e.g., neoantigens, tumor associated antigens) specific for each subject, referred to as neoepitopes. Cancer antigens are antigens expressed in or by cancer cells. Antigens that are expressed in or by tumor cells (e.g., of a malignant tumor) are referred to as “tumor associated antigens.” A particular tumor associated antigen may or may not also be expressed in non-cancerous cells. Many tumor mutations are well known in the art. Neoantigens (or tumor-specific antigens) are tumor associated antigens that are not expressed or rarely- expressed in non-cancerous cells, or whose expression in non-cancerous cells is sufficiently- reduced in comparison to that in cancerous cells and that induce an immune response induced upon vaccination. Neoepitopes, which are immunogenic portions of cancer antigens (neoantigens, tumor Attorney Docket No. 131986-71 1 1 associated antigens), are ideally foreign to the body and thus would not normally produce an immune response against healthy tissue or be masked by the protective components of the immune system. In some embodiments, individualized vaccines based on neoepitopes of neoantigens are desirable because such vaccines will maximize specificity against a subject’s specific tumor. Mutation-derived neoepitopes can arise from point mutations, non-synonymous mutations leading to different amino acids in the protein; read-through mutations in which a stop codon is modified or deleted, leading to translation of a longer protein with a novel tumor-specific sequence at the C- terminus; splice site mutations that lead to the inclusion of an intron in the mature mRNA and thus a unique turn or- specific protein sequence; chromosomal rearrangements that give rise to a chimeric protein with tumor-specific sequences at the junction of 2 proteins (i.e., gene fusion); frameshift mutations or deletions that lead to a new open reading frame with a novel tumor-specific protein sequence; and / or translocations.

[0204] The individualized neoantigen vaccines of the disclosure may encode one or more neoepitopes (which are portions of cancer antigens, also known as neoantigens). A neoepitope, also known as an antigenic determinant, as used herein, is a portion of an antigen (e.g., neoantigen) that is recognized by the immune system in the appropriate context, specifically by antibodies, B cells, or T cells. Neoepitopes may include B cell epitopes (e.g., predicted B cell reactive epitopes) and / or T cell epitopes (e.g., predicted T cell reactive epitopes). B-cell epitopes (e.g., predicted B cell reactive epitopes) are peptide sequences which are required for recognition by specific antibody producing B-cells. B cell epitopes (e g., predicted B cell reactive epitopes) refer to a specific region of the antigen that is recognized by an antibody. T-cell epitopes (e.g., predicted T cell reactive epitopes) are peptide sequences which, in association with proteins on APC, are required for recognition by specific T-cells. T cell epitopes (e.g., predicted T cell reactive epitopes) are processed intracellularly and presented on the surface of APCs, where they are bound to MHC molecules including MHC class II and MHC class I molecules. The portion of an antibody that binds to the epitope is called a paratope. An epitope may be a conformational epitope or a linear epitope, based on the structure and interaction with the paratope. A linear, or continuous, epitope is defined by the primary amino acid sequence of a particular region of a protein. The sequences that interact with the antibody are situated next to each other sequentially on the protein, and the epitope can usually be mimicked by a single peptide. Conformational epitopes are epitopes that are defined by the conformational structure of the native protein. These epitopes may be continuous or discontinuous (i.e., may be components of the epitope can be situated on disparate parts of the protein, which are brought close to each other in the folded native protein structure). Attorney Docket No. 131986-71 1 1

[0205] Each neoepitope (e.g., peptide epitope) may be any length that is reasonable for a neoepitope. In some embodiments, one or more predicted T cell reactive epitopes of the individualized neoantigen vaccine comprises between 8-11 amino acids. In some embodiments, one or more predicted T cell reactive epitope of the individualized neoantigen vaccine comprises between 13-25 amino acids. In some embodiments, one or more predicted B cell reactive epitope of the individualized neoantigen vaccine comprises between 13-17 amino acids. In some embodiments, one or more predicted B cell reactive epitope of the individualized neoantigen vaccine comprises between 13-25 amino acids.

[0206] In some embodiments, the length of each neoepitope in an individualized neoantigen vaccine is not necessarily equal. In some embodiments, each neoepitope in the individualized neoantigen vaccine is a different length. In certain embodiments, at least two (e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, and up to and including all) of the neoepitopes in the individualized neoantigen vaccine are different lengths.

[0207] In some embodiments, the length of at least one (such as one or more, two or more, or all) of the neoepitopes is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at. least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at. least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, or at least 100 amino acids. In other embodiments, the length of at least one of the neoepitopes is 100 or less, 95 or less, 90 or less, 85 or less, 80 or less, 75 or less, 70 or less, 65 or less, 60 or less, 55 or less, 50 or less, 45 or less, 40 or less, 35 or less, 30 or less, 25 or less, 20 or less, 15 or less, 14 or less, 13 or less, 12 or less, 11 or less, 10 or less, 9 or less, 8 or less, 7 or less, 6 or less, 5 or less, 4 or less, 3 or less, or 2 or less amino acids. In other embodiments, the length of at least one of the neoepitopes is up to 100, up to 95, up to 90, up to 85, up to 80, up to 75, up to 70, up to 65, up to 60, up to 55, up to 50, up to 45, up to 40, up to 35, up to 30, up to 25, up to 20, up to 15, or up to 10 amino acids. In some embodiments, the length of at least one of the neoepitopes is 25 amino acids. In some embodiments, the length of at least one of the neoepitopes is 15-25 amino acids. In some embodiments, the length of at least one of the neoepitopes is 20-25 amino acids. In some embodiments, the length of at least one of the neoepitopes is 25-35 amino acids. In some embodiments, the length of at least one of the neoepitopes is 13-25 amino acids. In some embodiments, the length of all of the neoepitopes is 13-25 amino acids. Attorney Docket No. 131986-71 1 1

[0208] In some embodiments, different percentages of neoepitope lengths are encoded by the nucleic acids. All of the percentages described in the following listings may be approximate (i.e., within 5% of the stated amount). The use of the terms “approximate” and “about” is equivalent.

[0209] In some embodiments, the percentages of neoepitope lengths encoded by the nucleic acids may be as follows: about 100% < 15 amino acids, about 0% > 15 amino acids; about 95% < 15 amino acids, about 5% > 15 amino acids; about 90% < 15 amino acids, about 10% > 15 amino acids; about 85% < 15 amino acids, about 15% > 15 amino acids; about 80% < 15 amino acids, about 20% > 15 amino acids; about 75% < 15 amino acids, about 25% > 15 amino acids; about 70% < 15 amino acids, about 30% > 15 amino acids; about 65% < 15 amino acids, about 35% > 15 amino acids; about 60% < 15 amino acids, about 40% > 15 amino acids; about 55% < 15 amino acids, about 45% > 15 amino acids; about 50% < 15 amino acids, about 50% > 15 amino acids; about 45% < 15 amino acids, about 55% > 15 amino acids; about 40% < 15 amino acids, about 60% > 15 amino acids; about 35% < 15 amino acids, about 65% > 15 amino acids; about 30% < 15 amino acids, about 70% > 15 amino acids; about 25% < 15 amino acids, about 75% > 15 amino acids; about 20% < 15 amino acids, about 80% > 15 amino acids; about 15% < 15 amino acids, about 85% > 15 amino acids; about 10% < 15 amino acids, about 90% > 15 amino acids; about 5% < 15 amino acids, about 95% > 15 amino acids; or about 0% < 15 amino acids, about 100% > 15 amino acids.

[0210] In some embodiments, the neoepitope lengths may be categorized in one of the following groups (for a total of 100%); 8-12 amino acids, 13-17 amino acids, 18-21 amino acids, 13-25 amino acids, 22-26 amino acids, or 27-31 amino acids. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 8-12 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 13-17 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 18-21 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 13-25 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 22-26 amino acids in length. About 0%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, Attorney Docket No. 131986-71 1 1

[0211] 75%, 80%, 85%, 90%, 95%, or 100% of the neoepitopes encoded by the open reading frames of the nucleic acids may be 27-31 amino acids in length. Several non-limiting examples of the percentages of neoepitope lengths encoded by the open reading frames of the nucleic acids follow.

[0212] In some embodiments, the neoepitopes comprise at least one MHC class I epitope and at least one MHC class II epitope. In some embodiments, at least 10% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 20% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 30% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 40% of the neoepitopes are MHC class I epitopes. In some embodiments, at least 0%, 60%, 70%, 80%, 90%, or 100% of the neoepitopes are MHC class I epitopes.

[0213] In some embodiments, none (0%) of the neoepitopes are MHC class II epitopes. In some embodiments, at least 10% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 20% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 30% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 40% of the neoepitopes are MHC class II epitopes. In some embodiments, at least 50%, 60%, 70%, 80%, 90% or 100% of the neoepitopes are MHC class II epitopes.

[0214] In some embodiments, the ratio of MHC class I epitopes to MHC class II epitopes is a ratio selected from about 10%:about 90%; about 20%:about 80%; about 30%:about 70%; about 40%:about 60%; about 50%:about 50%; about 60%:about 40%; about 70% '.about 30%; about 80%: about 20%; about 90%: about 10% MHC class 1 : MHC class II epitopes. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 1 : 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 2:1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 3: 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 4: 1. In some embodiments, the ratio of MHC class I : MHC class II epitopes is 5: 1. In some embodiments, the ratio of MHC class II epitopes to MHC class I epitopes is a ratio selected from about 10%:about 90%; about 20%:about 80%; about 30%:about 70%; about 40%:about 60%; about 50%:about 50%; about 60%:about 40%; about 70%:about 30%; about 80%: about 20%; about 90%: about 10% MHC class II: MHC class I epitopes. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 : 1. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :2. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :3. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :4. In some embodiments, the ratio of MHC class II : MHC class I epitopes is 1 :5.

[0215] The individualized neoantigen vaccine of the disclosure, in some aspects comprises an mRNA vaccine encoding multiple neoepitopes arranged in a head-to-tail structure. In some embodiments, the mRNA encodes multiple neoepitopes directly connected to one another without Attorney Docket No. 131986-71 1 1 a spacer between the neoepitopes. In some embodiments, the mRNA encodes multiple neoepitopes with an amino acid spacer (e g., a single amino acid spacer, a double amino acid spacer, a triple amino acid spacer, etc.) between the neoepitopes. In some embodiments, the mRNA encodes multiple neoepitopes wherein two or more neoepitopes are directly connected to one another (without a spacer). In some embodiments, two or more neoepitopes are connected with a single amino acid spacer between the neoepitopes. Additionally or alternatively, two or more neoepitopes may be connected by a short linker between the epitopes. The multiple neoepitopes may include both MHC class I epitopes and MHC class II epitopes.

[0216] The individualized neoantigen vaccine, in some aspects, comprises a nucleic acid encoding one or more neoepitopes that include a mutation causing a unique expressed peptide sequence. In some embodiments, a mutation causing a unique expressed peptide sequence may be, but is not limited to, an insertion, deletion, frameshift mutation, and / or splicing variant. In some embodiments, the nucleic acid individualized neoantigen vaccine encodes multiple neoepitopes including one or more single nucleotide polymorphism (SNP) mutations with flanking amino acids on each side of the SNP mutation. In some embodiments, the number of flanking amino acids on each side of the SNP mutation may be 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, or 30. In some embodiments, the SNP mutation is centrally located and the number of flanking amino acids on each side of the SNP mutation is approximately the same. In some embodiments, the SNP mutation does not have an equivalent number of flanking amino acids on each side. In some embodiments, a neoepitope of the individualized neoantigen vaccine comprises an SNP flanked by two Class I sequences, each sequence comprising seven amino acids. In some embodiments, a neoepitope of the individualized neoantigen vaccine comprises a SNP flanked by two Class II sequences, each sequence comprising 10 amino acids. In some embodiments, a neoepitope may comprise a centrally located SNP and flanks which are both Class I sequences, both Class II sequences, or one Class I and one Class II sequence.

[0217] In some embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising neoepitopes. As used herein a “a concatemeric cancer antigen comprising neoepitopes” refers to a plurality of neoepitopes arranged in a head-to-tail structure, wherein each pair of adjacent neoepitopes independently may be linked together directly or via a linker. Any number of neoepitopes may be used. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 5-200 neoepitopes. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 5-130 neoepitopes. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer antigen comprising 5-40 neoepitopes. In certain embodiments, the neoepitopes are in the form of a concatemeric cancer Attorney Docket No. 131986-71 1 1 antigen comprising 7-34 neoepitopes. In some embodiments, the concatemeric cancer antigen comprises one or more of: a) the neoepitopes (e.g., the 5-200 or 5-130 or 5-40 or 7-34 neoepitopes) are interspersed by cleavage sensitive sites; and / or b) each neoepitope is linked directly to one another without a linker; and / or c) each neoepitope is linked to one or another with a single amino acid linker; and / or d) each neoepitope is linked to one or another with a short linker; and / or e) each neoepitope comprises 8-31 or 13-31 amino acids and includes one or more SNP mutations (e.g., a centrally located SNP mutation); and / or f) each neoepitope comprises 8-31 or 13-31 amino acids and includes a mutation causing a unique expressed peptide sequence; and / or g) the nucleic acids encoding the neoepitopes are arranged such that the neoepitopes are ordered to minimize pseudoepitopes, and / or h) no class II MHC molecule neoepitopes are present. A single open reading frame of a nucleic acid molecule (e.g., an mRNA) may encode a concatemeric cancer antigen comprising a plurality of neoepitopes.

[0218] It will be appreciated that a concatemer of 2 or more peptides, e g., 2 or more neoepitopes, may create unintended new epitopes (pseudoepitopes) at peptide boundaries. To prevent or eliminate such pseudoepitopes, class I alleles may be scanned for hits across peptide boundaries in a concatemer. In some embodiments, the neoepitope order within the concatemer is shuffled to reduce or eliminate pseudoepitope formation. In some embodiments, a linker is used between neoepitopes, e.g., a single amino acid linker such as glycine (Gly) or a double amino acid linker such as Gly-Gly, to reduce or eliminate pseudoepitope formation. In some embodiments, anchor amino acids can be replaced with other amino acids which will reduce or eliminate pseudoepitope formation. In some embodiments, neoepitopes are trimmed at the peptide boundary within the concatemer to reduce or eliminate pseudoepitope formation.

[0219] In some embodiments, the multiple neoepitopes are arranged and ordered to minimize pseudoepitopes. In some embodiments, glycine insertion can be used to disrupt pseudoepitopes. In other embodiments, the multiple neoepitopes are a polypeptide that is free of pseudoepitopes. When the cancer antigen epitopes (e.g., neoepitopes) are arranged in a concatemeric structure in a head to tail formation, a junction is formed between each of the cancer antigen epitopes. That includes several, e.g., 1-10, amino acids from a neoepitope on a N-terminus of the peptide and several, e.g., 1-10, amino acids on a C -terminus of an adjacent directly linked neoepitope. It is important that the junction not be an immunogenic peptide that may produce an immune response. In some embodiments, the junction forms a peptide sequence that binds to an HL A protein of a subject for which the individualized neoantigen vaccine is designed with an IC50 greater than about 50 nM. In other embodiments, the junction peptide sequence binds to an HLA protein of a Attorney Docket No. 131986-71 1 1 subject with an IC50 greater than about 10 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nm, or 500 nM.

[0220] In some embodiments, the mRNA of an individualized neoantigen vaccine as described herein comprises an open reading frame that encodes 5-34 neoepitopes arranged in a head-to-tail structure, optionally wherein each neoepitope has a length of 13-25 amino acids. As discussed in more detail below, the encoded neoepitopes may include MHC Class I epitopes and MHC class II epitopes, and typically will include more MHC Class I epitopes than MHC class II epitopes. As also discussed in more detail below, the encoded neoepitopes may be T cell epitopes.

[0221] Hotspot / Driver Mutations

[0222] In population analyses of cancer, certain mutations occur in a higher percentage of patients than would be expected by chance. These “recurrent” or “hotspot” mutations have often been shown to have a “driver” role in the tumor, producing some change in the cancer cell function that is important to tumor initiation, maintenance, or metastasis, and is therefore selected for in the evolution of the tumor. These mutations are often also termed “driver” mutations. In addition to their importance in tumor biology and therapy, recurrent mutations provide the opportunity for precision medicine, in which the patient population is stratified into groups more likely to respond to a particular therapy, including but not limited to targeting the mutated protein itself.

[0223] Therefore, in some embodiments, the individualized neoantigen vaccine comprises or further comprises one or more cancer hotspot neoepitopes (e.g., comprising a driver mutation) as a subset of the individualized neoepitopes and, optionally, traditional cancer antigens. In some embodiments, one or more cancer hotspot neoepitopes are cancer hotspot antigens. In some embodiments, cancer hotspot mutations that occur over a threshold prevalence in an indication of interest are included in the vaccine. The threshold prevalence, in some embodiments, is greater than 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.

[0224] In some embodiments, a nucleic acid (e.g., mRNA) individualized neoantigen vaccine provided herein encodes 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more peptides corresponding to driver mutations. In some embodiments, one or more of the driver mutations are present in the tumor of the subject and not expressed or expressed at low levels in normal non-cancerous tissue of the subject. In some embodiments, the nucleic acid (e.g., mRNA) individualized neoantigen vaccine encodes at least 5 (e.g.. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) neoepitopes corresponding to driver mutations. In some embodiments, the nucleic acid (e.g., mRNA) individualized neoantigen vaccine encodes fewer than 15 (e.g., 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 , or 0) neoepitopes corresponding to driver mutations. Attorney Docket No. 131986-71 1 1

[0225] Exemplary driver mutations are provided in Table B below.

[0226] Table B. Exemplary driver mutations

[0227] Much effort and research on recurrent mutations has focused on non-synonymous (or “missense”) single nucleotide variants (SNVs), but population analyses have revealed that a variety of more complex (non-SNV) variant classifications, such as synonymous (or “silent”), splice site, multi -nucleotide variants, insertions, and deletions, can also occur at high frequencies.

[0228] The p53 gene (official symbol TP53) is mutated more frequently than any other gene in human cancers. Large cohort studies have shown that, for most p53 mutations, the genomic position is unique to one or only a few patients and the mutation cannot be used as recurrent neoantigens for therapeutic vaccines designed for a specific population of patients. Surprisingly, a small subset of p53 loci do, however, exhibit a “hotspot” pattern, in which several positions in the gene are mutated with relatively high frequency. Strikingly, a large portion of these recurrently mutated regions occur near exon-intron boundaries, disrupting the canonical nucleotide sequence motifs recognized by the mRNA splicing machinery. Mutation of a splicing motif can alter the final mRNA sequence even if no change to the local amino acid sequence is predicted (i.e., for synonymous or intronic mutations). Therefore, these mutations are often annotated as “noncoding” by common annotation tools and neglected for further analysis, even though they may alter mRNA splicing in unpredictable ways and exert severe functional impact on the translated protein. If an alternatively spliced isoform produces an in-frame sequence change (i.e., no PTC is produced), it can escape depletion by NMD and be readily expressed, processed, and presented on the cell surface by the HLA system. Further, mutation-derived alternative splicing is usually “cryptic”, i.e., not expressed in normal tissues, and therefore may be recognized by T-cells as non-self neoantigens. Attorney Docket No. 131986-71 1 1

[0229] Additional Antigens (Traditional Cancer Antigens)

[0230] In some embodiments, the individualized neoantigen vaccines described herein may include or may further include neoepitopes expressed by cancer-germline genes (e.g., antigens common to tumors found in multiple patients, referred to herein as “traditional cancer antigens” or “shared cancer antigens”). In some embodiments, a traditional antigen is one that is known to be found in cancers or tumors generally or in a specific type of cancer or tumor. In some embodiments, a traditional cancer antigen is a non-mutated tumor antigen. In some embodiments, a traditional cancer antigen is a mutated tumor antigen.

[0231] In some embodiments, the individualized neoantigen vaccines described herein may include neoepitopes based on cancer / testis (CT) antigens. Cancer / testis antigen expression is limited to male germ cells in healthy adults, but ectopic expression has been observed in tumor cells of multiple types of human cancer. Since male germ cells are devoid of HLA-class I molecules and cannot present antigens to T cells, cancer / testis antigens are generally considered neoantigens when expressed in cancer cells and have the capacity to elicit immune responses that are strictly cancer-specific. Cancer / testis antigens for use with the compositions and methods described herein may be any such cancer / testis antigen known in the field including, but not limited to, MAGEA1, MAGEA2, MAGEA3, MAGEA4, MAGEA5, MAGEA6, MAGEA8, MAGEA9, MAGEA10, MAGEA11, MAGEA12, BAGE, BAGE2, BAGE3, BAGE4, BAGE5, MAGEB1, MAGEB2, MAGEB5, MAGEB6, MAGEB3, MAGEB4, GAGE1, GAGE2A, GAGE3, GAGE4, GAGE5, GAGE6, GAGE7, GAGE8, SSX1, SSX2, SSX2b, SSX3, SSX4, CTAG1B, LAGE-lb, CTAG2, MAGECI, MAGEC3, SYCP1, BRDT, MAGEC2, SPANXA1, SPANXB1, SPANXC, SPANXD, SPANXN1, SPANXN2, SPANXN3, SPANXN4, SPANXN5, XAGE1D, XAGE1C, XAGE1B, XAGE1, XAGE2, XAGE3, XAGE-3b, XAGE-4 / RP11-167P23.2, XAGE5, DDX43, SAGE1, ADAM2, PAGE5, CT16.2, PAGE1, PAGE2, PAGE2B, PAGE3, PAGE4, LIPI, VENTXP1, IL13RA2, TSP50, CTAGE1, CTAGE-2, CTAGE5, SPA17, ACRBP, CSAG1, CSAG2, DSCR8, MMAlb, DDX53, CTCFL, LUZP4, CASC5, TFDP3, JARID1B, LDHC, MORC1, DKKL1, SPO11, CRISP2, FMR1NB, FTHL17, NXF2, TAF7L, TDRD1, TDRD6, TDRD4, TEX15, FATE1, TPTE, CT45A1, CT45A2, CT45A3, CT45A4, CT45A5, CT45A6, H0RMAD1, HORMAD2, CT47A1, CT47A2, CT47A3, CT47A4, CT47A5, CT47A6, CT47A7, CT47A8, CT47A9, CT47A10, CT47A11, CT47B1 , SLCO6A1, TAG, LEMD1, HSPB9, CCDC110, ZNFT 65, SPACA3, CXorf48, THEG, ACTL8, NLRP4, COX6B2, LOC348120, CCDC33, LOC196993, PASD1, LOC647107, TULP2, CT66 / AA884595, PRSS54, RBM46, CT69 / BC040308, CT70 / BI818097, SP1NLW1, TSSK6, ADAM29, CCDC36, LOC440934, Attorney Docket No. 131986-71 1 1

[0232] SYCE1, CPXCRl, TSPY3, TSGA10, HIWI, M1WI, PIWI, PIWIL2, ARMC3, AKAP3, Cxorf61, PBK, C21ortP9, OIP5, CEP290, CABYR, SPAG9, MPHOSPH1, ROPN1, PLAC1, CALR3, PRM1, PRM2, CAGE1, TTK, LY6K, IMP-3, AKAP4, DPPA2, KLAA0100, DCAF12, SEMG1, POTED, POTEE, POTEA, POTEG, POTEB, POTEC, POTEH, GOLGAGL2 FA, CDCA1, PEPP2, OTOA, CCDC62, GPATCH2, CEP55, FAM46D, TEX14, CTNNA2, FAM133A, LOC130576, ANKRD45, ELOVL4, IGSF11, TMEFF1, TMEFF2, ARX, SPEF2, GPAT2, TMEM108, NOL4, PTPN20A, SPAG4, MAEL, RQCD1, PRAME, TEX101, SPATA19, ODF1, ODF2, ODF3, ODF4, ATAD2, ZNF645, MCAK, SPAG1, SPAG6, SPAG8, SPAG17, FBXO39, RGS22, cyclin Al , Cl 5orf60, CCDC83, TEKT5, NR6A1, TMPRSS12, TPPP2, PRSS55, DMRT1, EDAG, NDR, DNAJB8, CSAG3B, CTAG1A, GAGE12B, GAGE12C, GAGE12D, GAGE12E, GAGE12F, GAGE12G, GAGE12H, GAGE12I, GAGE12J, GAGE13, LOC728137, MAGEA2B, MAGEA9B / LOC728269, NXF2B, SPANXA2, SPANXB2, SPANXE, SSX4B, SSX5, SSX6, SSX7, SSX9, TSPY1D, TSPY1E, TSPY1F, TSPY1G, TSPY1H, TSPY1I, TSPY2, XAGE1E, XAGE2B / CTD-2267G17.3, and / or variants thereof.

[0233] In some embodiments, the traditional cancer antigen is present in the tumor of the subject and not expressed or expressed at low levels in normal non-cancerous tissue of the subject, e.g., is a neoepitope of the subject.

[0234] In some embodiments, individualized neoantigen vaccines may include or further include one or more nucleic acids encoding one or more non-mutated tumor antigens. In some embodiments, the individualized neoantigen vaccines may include or further include one or more nucleic acids encoding one or more mutated tumor antigens.

[0235] Many tumor antigens are known in the art. Cancer or tumor antigens (e.g., traditional cancer antigens) for use with the compositions and methods described herein may be any such cancer or tumor antigens known in the field. In some embodiments, the cancer or tumor antigen (e.g., the traditional cancer antigen) is one of the following antigens: CD2, CD19, CD20, CD22, CD27, CD33, CD37, CD38, CD40, CD44, CD47, CD52, CD56, CD70, CD79, CD137, 4- IBB, 5T4, AGS-5, AGS-16, Angiopoietin 2, B2M, B7. 1, B7.2, B7DC, B7H1, B7H2, B7H3, BT-062, BTLA, CAIX, Carcinoembryonic antigen, CTLA4, Cripto, ED-B, ErbBl, ErbB2, ErbB3, ErbB4, EGFL7, EpCAM, EphA2, EphA3, EphB2, FAP, Fibronectin, Folate Receptor, Ganglioside GM3, GD2, glucocorticoid-induced tumor necrosis factor receptor (GITR), gplOO, gpA33, GPNMB, ICOS, IGF1R, Integrin av, Integrin avP , LAG-3, Lewis Y, Mesothelin, c-MET, MN Carbonic anhydrase IX, MUC1, MUC16, Nectin-4, NKGD2, NOTCH, 0X40, OX40L, PD-1, PDL1, PSCA, PSMA, RANKL, ROR1, ROR2, SLC44A4, Syndecan-1, TACI, TAG-72, Tenascin, TIM3, TRAILR1 , TRAILR2,VEGFR- 1 , VEGFR-2, VEGFR-3, and / or variants thereof. Attorney Docket No. 131986-71 1 1

[0236] Additional Neoepitope Design Considerations

[0237] Epitopes (e.g., neoepitopes) can be identified using a free or commercial database (Lonza Epibase, antitope for example). Such tools are useful for predicting the most immunogenic epitopes within a target antigen protein (e.g., neoantigen). The selected peptides may then be synthesized and screened in human HLA panels, and the most immunogenic sequences are used to construct the nucleic acids encoding the neoepitope(s). One strategy for mapping epitopes of Cytotoxic T- Cells based on generating equimolar mixtures of the four C-terminai peptides for each nominal 11- mer across a protein. This strategy would produce a library antigen containing all the possible active CTL epitopes.

[0238] The neoepitopes may be designed to optimally bind to MHC in order to promote a robust immune response. In some embodiments, each neoepitope comprises an antigenic region and an MHC stabilizing region. An MHC stabilizing region is a sequence which stabilizes the peptide in the MHC. MHC stabilizing regions within the neoepitopes may be the same or they may be different. The MHC stabilizing regions may be at the N terminal portion of the neoepitope or the C terminal portion of the neoepitope. Alternatively, the MHC stabilizing regions may be in the central region of the neoepitope. The MHC stabilizing region may be 5-10, 5-15, 8-10, 1-5, 3-7, or 3-8 amino acids in length. In yet other embodiments, the antigenic region is 5-100 amino acids in length. The peptides interact with the molecules of MHC class I by competitive affinity binding within the endoplasmic reticulum, before they are presented on the cell surface. The affinity of an individual peptide is directly linked to its amino acid sequence and the presence of specific binding motifs in defined positions within the amino acid sequence. The peptide being presented in the MHC is held by the floor of the peptide-binding groove, in the central region of the al / a2 heterodimer (a molecule composed of two nonidentical subunits). The sequence of residues of the peptide-binding groove’s floor determines which particular peptide residues it binds.

[0239] Optimal binding regions may be identified by a computer assisted comparison of the affinity of a binding site (MHC pocket) for a particular amino acid at each amino acid in the binding site for each of the target epitopes to identify an ideal binder for all of the examined antigens. The MHC stabilization regions of the epitopes may be identified using amino acid prediction matrices of data points for a binding site. An amino acid prediction matrix is a table having a first and a second axis defining data points. Prediction matrices can be generated as shown in Singh, H. and Raghava, G.P.S. (2001), “ProPred: prediction of HLA-DR binding sites.” Bioinformatics, 17(12), 1236-37). In some embodiments, the prediction matrix is based on evolutionary conservation. In some embodiments, the prediction matrix uses physiochemical similarity to examine how similar Attorney Docket No. 131986-71 1 1 a somatic amino acid is to the germline amino acid (e.g., Kim et al., J Immunol. 2017: 3360-3368). The similarity of the somatic amino acid to the germline amino acid approximates how a mutation affects binding (e.g., T cell receptor recognition). In some embodiments, less similarity is indicative of improved binding (e.g., T cell receptor recognition).

[0240] In some embodiments, the MHC stabilizing region is designed based on the subject’s particular MHC. In that way, the MHC stabilizing region can be optimized for each subject.

[0241] The neoepitopes selected for inclusion in the individualized neoantigen vaccine will typically be high affinity binding peptides. In some aspects, the neoepitope binds an HLA protein with greater affinity than a wild-type peptide. The neoepitope has an IC50 of at least less than 5000 nM, at least less than 500 nM, at least less than 250 nM, at least less than 200 nM, at least less than 150 nM, at least less than 100 nM, at least less than 50 nM or less in some embodiments. Typically, neoepitopes with predicted IC50 <50 nM are generally considered medium to high affinity binding neoepitopes and will be selected for testing their affinity empirically using biochemical assays of HLA-binding. Finally, it will be determined whether the human immune system can mount effective immune responses against these mutated tumor antigens and thus effectively kill tumor but not normal cells.

[0242] In some embodiments, the neoepitopes are 13 residues or less in length and may comprise between about 8 and about 1 1 residues, particularly 9 or 10 residues. In some embodiments, the neoepitopes are 25 residues or less in length and may comprise between about 13 and about 25 residues, particularly 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 residues. In other embodiments, the neoepitopes may be designed to be longer. For instance, the neoepitopes may have extensions of 2-5 amino acids toward the N- and C -terminus of each corresponding gene product. The use of a longer peptide may allow endogenous processing by subject cells and may lead to more effective antigen presentation and induction of T cell responses.

[0243] Neoepitopes having the desired activity may be modified as necessary to provide certain desired attributes, e.g., improved pharmacological characteristics, while increasing or at least retaining substantially all of the biological activity of the unmodified peptide to bind the desired MHC molecule and activate the appropriate T cell or B cell. For instance, the neoepitopes may be subject to various changes, such as substitutions, either conservative or non-conservative, where such changes might provide for certain advantages in their use, such as improved MHC binding. By conservative substitutions is meant replacing an amino acid residue with another which is biologically and / or chemically similar, e.g., one hydrophobic residue for another, or one polar residue for another. The substitutions include combinations such as Gly, Ala; Vai, He, Leu, Met; Asp, Glu; Asn, Gin; Ser, Thr; Lys, / Vg; and Phe, Tyr. The effect of single amino acid substitutions Attorney Docket No. 131986-71 1 1 may also be probed using D-amino acids. Such modifications may be made using well known peptide synthesis procedures, as described in e.g., Merrifield, Science 232:341-347 (1986), Barany & Merrifield, The Peptides, Gross & Meienhofer, eds. (N.Y., / Xcademic Press), pp. 1-284 (1979); and Stewart & Young, Solid Phase Peptide Synthesis, (Rockford, Ill., Pierce), 2d Ed. (1984).

[0244] The neoepitopes can also be modified by extending or decreasing the compound’s amino acid sequence, e.g., by the addition or deletion of amino acids. The peptides, polypeptides or analogs can also be modified by altering the order or composition of certain residues, it being readily appreciated that certain amino acid residues essential for biological activity, e.g., those at critical contact sites or conserved residues, may generally not be altered without an adverse effect on biological activity.

[0245] Typically, a series of peptides with single amino acid substitutions are employed to determine the effect of electrostatic charge, hydrophobicity, etc. on binding. For instance, a series of positively charged (e.g., Lys or Arg) or negatively charged (e.g., Glu) amino acid substitutions are made along the length of the peptide revealing different patterns of sensitivity towards various MHC molecules and T cell or B cell receptors. In addition, multiple substitutions using small, relatively neutral moieties such as Ala, Gly, Pro, or similar residues may be employed. The substitutions may be homo-oligomers or hetero-oligomers. The number and types of residues which are substituted or added depend on the spacing necessary between essential contact points and certain functional attributes which are sought (e.g., hydrophobicity versus hydrophilicity). Increased binding affinity for an MHC molecule or T cell receptor may also be achieved by such substitutions, compared to the affinity of the parent peptide. In any event, such substitutions should employ amino acid residues or other molecular fragments chosen to avoid, for example, steric and charge interference which might disrupt binding.

[0246] The neoepitopes may also comprise isosteres of two or more residues in the neoepitopes. An isostere as defined here is a sequence of two or more residues that can be substituted for a second sequence because the steric conformation of the first sequence fits a binding site specific for the second sequence. The term specifically includes peptide backbone modifications well known to those skilled in the art. Such modifications include modifications of the amide nitrogen, the alpha-carbon, amide carbonyl, complete replacement of the amide bond, extensions, deletions or backbone crosslinks. See, generally, Spatola, Chemistry and Biochemistry of Amino Acids, Peptides and Proteins, Vol. VII (Weinstein ed., 1983).

[0247] The consideration of immunogenicity is an important component in the selection of neoepitopes for inclusion in a vaccine. As a set of non-limiting examples, immunogenicity may be assessed by analyzing the MHC binding capacity of a neoepitope, HL A promiscuity, mutation Attorney Docket No. 131986-71 1 1 position, predicted T cell reactivity, actual T cell reactivity, structure leading to particular conformations and resultant solvent exposure, and representation of specific amino acids.

[0248] One important aspect of a neoepitope included in a vaccine is a lack of seif-reactivity. The putative neoepitopes may be screened to confirm that the epitope is restricted to tumor tissue, for instance, arising as a result of genetic change within malignant cells. Ideally, the neoepitope should not be present in normal tissue of the subject and thus, self-similar epitopes are filtered out of the dataset. A personalized coding genome may be used as a reference for comparison of neoantigen candidates to determine lack of self-reactivity. In some embodiments, a personalized coding genome is generated from an individualized transcriptome and / or exome.

[0249] In some embodiments, the individualized neoantigen vaccine is composed of open reading frames that may encode any number of neoepitopes. In some embodiments, the individualized neoantigen vaccine comprises open reading frames encoding 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more,

[0250] 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more,

[0251] 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more,

[0252] 38 or more, 39 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more,

[0253] 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, 95 or more, 100 or more, 105 or more, 110 or more, 115 or more, 120 or more, 125 or more, 130 or more, 135 or more, 140 or more, 145 or more, 150 or more, 155 or more, 160 or more, 165 or more, 170 or more, 175 or more, 180 or more, 185 or more, 190 or more, 195 or more, or 200 or more neoepitopes. In other embodiments, the individualized neoantigen vaccine comprises open reading frames encoding 200 or less, 195 or less, 190 or less, 185 or less, 180 or less, 175 or less, 170 or less, 165 or less, 160 or less, 155 or less, 150 or less, 145 or less, 140 or less, 135 or less, 130 or less, 125 or less, 120 or less, 115 or less, 1 10 or less, 100 or less, 95 or less, 90 or less, 85 or less, 80 or less, 75 or less, 70 or less, 65 or less, 60 or less, 55 or less, 50 or less, 45 or less, 40 or less, 35 or less, 30 or less, 25 or less, 20 or less, 15 or less, or 10 or less, or 5 or less neoepitopes. In other embodiments, the individualized neoantigen vaccine comprises open reading frames encoding up to 200, up to 195, up to 190, up to 185, up to 180, up to 175, up to 170, up to 165, up to 160, up to 155, up to 150, up to 145, up to 140, up to 135, up to 130, up to 125, up to 120, up to 115, up to 110, up to 100, up to 95, up to 90, up to 85, up to 80, up to 75, up to 70, up to 65, up to 60, up to 55, up to 50, up to 45, up to 40, up to 35, up to 30, up to 25, up to 20, up to 15, up to 10 neoepitopes, up to 5 neoepitopes, or up to 3 neoepitopes. Attorney Docket No. 131986-71 1 1

[0254] In some embodiments, the individualized neoantigen comprises one open reading frame encoding up to 50 (e.g., 1, 2, 3, 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15. 16, 17, 18, 19. 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) neoepitopes. In some embodiments, the individualized neoantigen vaccine comprises one open reading frame encoding 20-40 (e.g., 25-40, 30-40, 30-35, 20-35, 20-30, 22-27, 26-31, 32-37, or 34-40) neoepitopes. In some embodiments, the individualized neoantigen vaccine comprises one open reading frame encoding 5-34 neoepitopes. For example, in some embodiments, the individualized neoantigen vaccine comprises one open reading frame encoding 5, 6, 7, 8, 9, 10, I I , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 neoepitopes.

[0255] In some embodiments, the individualized neoantigen vaccines and vaccination methods described herein include open reading frames that encode neoepitopes or neoantigens based on specific mutations and / or those expressed by cancer-germline genes (e.g., antigens common to tumors found in multiple patients). Some antigens that can be encoded by open reading frames of nucleic acid vaccines disclosed herein correspond to “driver mutations,” which initiate cancer formation or accelerate cancer progression. In some embodiments, the encoded neoepitopes or neoantigens of the nucleic acid vaccines do not correspond to, and / or do not comprise portions corresponding to “driver mutations”, e.g., such that the vaccine does not contain any driver mutations.

[0256] Administration of Individualized Neoantigen Vaccine

[0257] Once an mRNA vaccine is synthesized (e.g., as discussed in more detail below), it is administered to the subject. In some embodiments, the vaccine is administered on a schedule for up to two months, up to three months, up to four month, up to five months, up to six months, up to seven months, up to eight months, up to nine months, up to ten months, up to eleven months, up to 1 year, up to I and V years, up to two years, up to three years, or up to four years. The schedule may be the same or varied. In some embodiments, the schedule is weekly for the first 3 weeks and then monthly thereafter. In some embodiments, the individualized neoantigen vaccine is administered to subject weekly, every 2 weeks, every 3 weeks, every 4 weeks, every 5 fives, every 6 weeks, every 7 weeks, or every 8 weeks. In some embodiments, the individualized neoantigen vaccine, as part of the adjuvant therapy, is administered once every 3-5 weeks. In some embodiments, the individualized neoantigen vaccine, as part of the adjuvant therapy, is administered once every three weeks. In some embodiments, the individualized neoantigen vaccine is administered once every' three weeks at a dose that administers about 1 mg of the mRNA per administration. Attorney Docket No. 131986-71 1 1

[0258] In some embodiments, the individualized neoantigen vaccine is administered to the subject on a regular basis (e.g., once a week, once every two weeks, once every / three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments, the specified total period of time is 5-13, 6-12, 7-11, or 8-10 doses of the individualized neoantigen vaccine in the adjuvant therapy. In some embodiments, the specified total period of time is nine doses of the individualized neoantigen vaccine in the adjuvant therapy. In some embodiments, the subject is administered the individualized neoantigen vaccine in the adjuvant therapy once every three weeks for nine total doses.

[0259] In embodiments in which an immune response (e g., an immune response to a tumor) is or is not detected to a specific antigen (e.g., a neoantigen), such detection or lack thereof can inform optimization of the vaccine (e.g., individualized neoantigen vaccine). For example, if an immune response to a specific neoantigen is not detected following administration of an individualized neoantigen vaccine encoding a neoepitope corresponding to that neoantigen, that neoepitope may be removed from the individualized neoantigen vaccine. Similarly, if a new immune response (or an increase in a preexisting immune response) to a specific neoantigen is detected following administration of an individualized neoantigen vaccine encoding a neoepitope corresponding to that neoantigen, more than one copy of that neoepitope may be encoded by an individualized neoantigen vaccine, and / or additional similar neoepitopes corresponding to that neoantigen may be added to the individualized neoantigen vaccine.

[0260] Surgical Resection / Screening

[0261] As noted above, in some embodiments, the methods involve treating a subject who has been, or will be, treated by surgical resection, and may optionally include surgical resection. For example, a subject may be one who has received neoadjuvant therapy and surgical resection prior to administration of adjuvant therapy comprising a combination treatment as described herein. Additionally or alternatively, a subject may be treated with neoadjuvant therapy comprising a combination treatment as described herein prior to surgical resection.

[0262] Surgical resection refers to the surgical removal of all or part of a bladder affected by cancer. Such resection is referred to as cystectomy, and when the entire bladder is removed, the Attorney Docket No. 131986-71 1 1 surgical resection is referred to as a radical cystectomy. In some cases, cystectomy (e.g., radical cystectomy) can additionally include removal of surrounding lymph nodes, referred to as pelvic lymph node dissection (PLND) Thus, in some embodiments, the surgical resection is a radical cystectomy (RC) plus pelvic lymph node dissection (PLND). The surgical resection, in some embodiments is an RO surgical resection. As used herein, an “RO surgical resection” refers to a surgical resection procedure that removed ail of the visible cancerous tissue; additionally, there are no cancer cells at the margins of the area of the resection. In some embodiments, the surgical resection is an R1 surgical resection. As used herein, an “R1 surgical resection” refers to a surgical resection in which all visible cancer tissue was removed during the procedure; however, cancer cells are present at the margins of the area of the resection.

[0263] In some embodiments, the surgical resection is performed 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks after the neoadjuvant therapy was first administered. In some embodiments, the surgical resection is performed 1, 2, 3, 4, 5, 6, 7, or 8 weeks after the last dose of the neoadjuvant therapy has been administered. In some embodiments, the surgical resection is performed 15 weeks after the neoadjuvant therapy was first administered and 6 weeks (optionally, plus a 2 -week window) from the last dose of neoadjuvant therapy. Thus, in some embodiments, the surgical resection is performed 7 weeks from the last dose of neoadjuvant therapy. In some embodiments, the surgical resection is performed 8 weeks from the last dose of neoadjuvant therapy.

[0264] Before, during, or after surgical resection, the subject may be screened for adjuvant therapy. In a preferred embodiment, following surgical resection, the subject is screened for adjuvant therapy. In some embodiments, the pathological complete response status is determined. Pathological complete response (pCR) is the complete absence of cancer in tissue samples after treatment (e.g., after neoadjuvant therapy and surgical resection). If the subject has a pCR, then, in some embodiments, the subject may be administered immune checkpoint inhibitor therapy, if recommended. If the subject does not have pCR after neoadjuvant therapy and surgical resection, the subject may be administered an adjuvant therapy, as described in more detail below.

[0265] In addition, following surgical resection, a new baseline image (re-baseline image) of the diseased area may be taken. In some embodiments, the re-baseline image does not show any apparent disease (i.e., there is no apparent or visible cancer tissue). In subjects in which the rebaseline image does not show any apparent disease, the adjuvant therapy may be administered.

[0266] Adjuvant Therapy

[0267] As used herein, “adjuvant therapy” refers to a treatment or therapy administered after the primary treatment (surgical resection). As noted above, in some aspects methods described herein Attorney Docket No. 131986-71 1 1 comprise treating a subject with adjuvant therapy following administration of a neoadjuvant therapy and surgical resection. In some aspects, methods described herein comprise treating a subject with adjuvant therapy following surgical resection (e.g., without administration of neoadjuvant therapy). In any embodiments, the adjuvant therapy may comprise a combination treatment as described herein, comprising administration of (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen vaccine, each of which have been discussed in detail above and are discussed briefly again in the context of adjuvant therapy. In some embodiments, the adjuvant therapy comprises a combination of treatment as described herein comprising administration of an immune checkpoint inhibitor and an individualized neoantigen vaccine. In some embodiments, the adjuvant therapy comprises a combination of treatment as described herein comprising administration of an immune checkpoint inhibitor; enfortumab vedotin; and an individualized neoantigen vaccine.

[0268] Immune Checkpoint Inhibitors in Adjuvant Therapy

[0269] In some aspects, the disclosure provides anti-cancer immunotherapies, such as immune checkpoint inhibitors, for use in combination with the individualized neoantigen vaccines described herein and / or enfortumab vedotin as an adjuvant therapy. As discussed above, immune checkpoint modulators include both stimulatory checkpoint molecules and inhibitory checkpoint molecules (e.g., an anti-CTLA4 and / or an anti-PDl antibody). The specific immune checkpoint inhibitor and dosing thereof for use in an adjuvant therapy as described herein may be the same as or different from that of a neoadjuvant therapy as described herein. In some embodiments, the neoadjuvant therapy and adjuvant therapy comprise administration of the same immune checkpoint inhibitor, optionally according to the same dosing regimen.

[0270] In some embodiments of adjuvant therapy, a dose of an immune checkpoint inhibitor is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, or more. In some embodiments of adjuvant therapy, the dose is 200 mg. In some embodiments of adjuvant therapy, the dose is 400 mg. In some embodiments of adjuvant therapy, a dose of an immune checkpoint inhibitor is administered weekly, every two weeks, every three weeks, every four weeks, every' five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every 10 weeks, every 11 weeks, or every 12 weeks. In some embodiments of adjuvant therapy, a dose of an immune checkpoint inhibitor is administered every 3 weeks. In some embodiments of adjuvant therapy, a dose of an immune checkpoint inhibitor is administered every' 6 weeks. For example, in some embodiments of adjuvant therapy, a 400 mg Attorney Docket No. 131986-71 1 1 dose of the immune checkpoint inhibitor is administered every 6 weeks. In some embodiments, a 200 mg dose of immune checkpoint inhibitor is administered every 3 weeks.

[0271] In some embodiments, the immune checkpoint inhibitor is an anti-PD-1 antibody, such as pembrolizumab or a variant thereof. In some embodiments of adjuvant therapy, the dose of pembrolizumab is 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, or more. In some embodiments of adjuvant therapy, the dose of pembrolizumab is 200 mg. In some embodiments of adjuvant therapy, the dose of pembrolizumab is 400 mg. In some embodiments of adjuvant therapy, a dose of pembrolizumab is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every 10 weeks, every 11 weeks, or every 12 weeks. In some embodiments of adjuvant therapy, a dose of pembrolizumab is administered every 3 weeks. In some embodiments of adjuvant therapy, a dose of pembrolizumab is administered every 6 weeks. For example, in some embodiments of adjuvant therapy, a 400 mg dose of pembrolizumab is administered every 6 weeks. In some embodiments of adjuvant therapy, a 200 mg dose of pembrolizumab is administered every 3 weeks.

[0272] In some embodiments of adjuvant therapy, an immune checkpoint inhibitor is administered to a subject on a regular basis (e.g., once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every' eight weeks, once every nine weeks, once every 10 weeks, once every' 11 weeks, once every 12 weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments of adjuvant therapy, the specified total period of time is the time corresponding to administration of 5-15 doses of the immune checkpoint inhibitor (e.g., pembrolizumab). In some embodiments, the specified total period of time is the time corresponding to administration of 13 doses of the immune checkpoint inhibitor (e.g., pembrolizumab).

[0273] In some embodiments, the immune checkpoint inhibitors are delivered in the form of mRNA encoding the immune checkpoint inhibitor(s). In other embodiments, the immune checkpoint inhibitors are delivered in the form of polypeptides. The immune checkpoint inhibitor may be administered by any route. In some embodiments, the immune checkpoint inhibitor is administered by an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route. In some embodiments, the immune checkpoint inhibitor is administered by an intravenous Attorney Docket No. 131986-71 1 1 route. In some embodiments, the immune checkpoint inhibitor is administered by a subcutaneous route.

[0274] In some adjuvant therapy embodiments, pembrolizumab is formulated as a liquid medicament. In some embodiments, pembrolizumab is formulated as a liquid medicament that comprises about 25 mg / ml pembrolizumab, about 7% (w / v) sucrose, about 0.02% (w / v) polysorbate 80, about 10 mM histidine buffer, optionally at a pH of about 5.5. In some embodiments wherein pembrolizumab is administered by intravenous (IV) infusion, the pembrolizumab is formulated as a liquid medicament that comprises 25 mg / ml pembrolizumab, 7% (w / v) sucrose, 0.02% (w / v) polysorbate 80, 10 mM histidine buffer, optionally at pH 5.5. In some embodiments, pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L- methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80. In some embodiments wherein pembrolizumab is administered by subcutaneous injection, pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab about 10 mM histidine buffer, about 10 mM L- methionine, or a pharmaceutically acceptable salt thereof about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80. In some embodiments wherein pembrolizumab is co-formulated with a human hyaluronidase (as discussed below), pembrolizumab is provided as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80. In some embodiments wherein pembrolizumab is administered by subcutaneous injection and coformulated with a human hyaluronidase (as discussed below), pembrolizumab is provided as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 2000 U7ml of a human hyaluronidase, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80.

[0275] In some adjuvant therapy embodiments, pembrolizumab is administered by intravenous (IV) infusion at a dose of 2 mg / kg every three weeks, 200 mg every three weeks, or 400 mg every six weeks. In some embodiments, the pembrolizumab is formulated as a liquid medicament that comprises 25 mg / ml pembrolizumab, 7% (w / v) sucrose, 0.02% (w / v) polysorbate 80 in 10 mM histidine buffer at pH 5.5.

[0276] In some adjuvant therapy embodiments, pembrolizumab is subcutaneously administered at a dose of about 280 mg to about 420 mg every three weeks, including at a dose of 280 mg to Attorney Docket No. 131986-71 1 1

[0277] 420 mg every three weeks. In some embodiments, pembrolizumab is subcutaneously administered at a dose of about 350 mg to about 420 nig every three weeks, including at a dose of 350 mg to 420 mg every three weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 360 mg to about 400 nig every three weeks, including at a dose of 360 mg to 400 mg every three weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 380 mg every three weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of 380 mg every three weeks. In some embodiments, the pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5.

[0278] In some adjuvant therapy embodiments, pembrolizumab is subcutaneously coadministered at a dose of about 300 nig to about 500 mg, including at a dose of 300 mg to 500 nig, every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of about 350 mg to about 400 mg, including at a dose of 350 mg to 400 mg, every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of about 380 mg to about 395 mg, including at a dose of 380 mg to 395 mg, every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of about 395 mg every three weeks with a human hyaluronidase. In some embodiments, pembrolizumab is subcutaneously co-administered at a dose of 395 mg every three weeks with a human hyaluronidase.

[0279] In any embodiments of the foregoing embodiments comprising co-administration of a human hyaluronidase, the dose of the human hyaluronidase may be about 700 Units to about 50000 Units. The dose of the human hyaluronidase may be about 2000 Units to about 20000 Units. The dose of the human hyaluronidase may be about 5000 Units to about 15000 Units. The dose of the human hyaluronidase may be about 4000 Units to about 6000 Units. In specific embodiments of the foregoing embodiments, the dose of the hum an hyaluronidase is 4800 Units. In further specific embodiments, the human hyaluronidase is co-formulated or co-administered with the pembrolizumab.

[0280] In some adjuvant therapy embodiments, pembrolizumab is subcutaneously administered at a dose of about 700 mg to about 800 mg, including at a dose of 700 mg to 800 mg, every six weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 760 to about 790 mg, including at a dose of 760 to 790 nig, every six weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of about 790 mg every Attorney Docket No. 131986-71 1 1 six weeks. In some embodiments, the pembrolizumab is subcutaneously administered at a dose of 790 mg every six weeks. In some embodiments, the pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5. In some aspects of the foregoing embodiments, pembrolizumab is co-administered with a human hyaluronidase, as discussed above. In some aspect of the foregoing embodiments, pembrolizumab is co-formulated with a human hyaluronidase.

[0281] In some embodiments comprising co-administration of pembrolizumab and a human hyaluronidase, pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab; about 10 mM histidine buffer; about 10 mM L-niethionine or a pharmaceutically acceptable salt thereof; about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80.

[0282] The human hyaluronidase may be any of those discussed above with reference to neoadjuvant therapy. In one embodiment, the human hyaluronidase is a human hyaluronidase PH20 fragment or variant described in for example, U.S. Patent Nos.7, 767, 429, 8,431,380, 7,871,607, International Publication No. WO 2020 / 022791, U.S. Patent Publication No. US2006 / 0104968 and European Patent 1858926, incorporated herein by reference in its entirety. Exemplary of such human hyaluronidase PH20 fragment or variants is the known agent PEGPH20 or rIIuPH20. In one aspect of the above embodiments, the human hyaluronidase is a PH20 fragment or variant that is rHuPH20. In another aspect of the above embodiments, the human hyaluronidase is a PH20 fragment or variant that is berahyaluronidase alfa.

[0283] In some adjuvant therapy embodiments, pembrolizumab is subcutaneously administered at a dose of 395 mg every' three weeks with 4800 Units of berahyaluronidase alfa. In some embodiments, pembrolizumab is subcutaneously administered at a dose of 790 mg every six weeks with 9600 Units of berahyaluronidase alfa. See Prescribing Information for KEYTRUDA QLEX™.

[0284] Enfortumab Vedotin in Adjuvant Therapy

[0285] In some aspects, the disclosure provides anti-cancer immunotherapies, such as enfortumab vedotin, for use in combination with the individualized neoantigen vaccines described herein and / or immune checkpoint inhibitors as an adjuvant therapy. The dosing regimen for enfortumab vedotin for use in an adjuvant therapy as described herein may be the same as or different from Attorney Docket No. 131986-71 1 1 that of a neoadjuvant therapy as described herein. In some embodiments, the neoadjuvant therapy and adjuvant therapy comprise the same dosing regimen.

[0286] In some embodiments of adjuvant therapy, a dose of enfortumab vedotin is 0.75 mg / kg, 1.0 mg / kg, 1.25 mg / kg, 1.5 mg / kg, 1.75 mg / kg, or 2.0 mg / kg. In some embodiments, the dose is 1 mg / kg - 1 ,5 mg / kg. In some embodiments, the dose is 1.5 mg / kg. In some embodiments of adjuvant therapy, a dose of enfortumab vedotin is 200 mg. In some embodiments of adjuvant therapy, a dose of enfortumab vedotin is 1.5 mg / kg. In some embodiments of adjuvant therapy, a dose of enfortumab vedotin is administered weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, every eight weeks, every nine weeks, every' 10 weeks, every 11 weeks, or every 12 weeks. In some embodiments of adjuvant therapy, a dose of enfortumab vedotin is administered on Day 1 and Day 8 of every' 3 week cycle. For example, in some embodiments of adjuvant therapy, a 1.5 mg / kg dose of enfortumab vedotin is administered on Day 1 and Day 8 of every' three-week cycle.

[0287] In some embodiments of adjuvant therapy, enfortumab vedotin is administered to a subject on a regular basis (e.g., once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every / seven weeks, once every eight weeks, once every / nine weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments of adjuvant therapy, the specified total period of time is the time corresponding to administration of 2-6 doses of enfortumab vedotin. In some embodiments of adjuvant therapy, the specified total period of time is the time corresponding to administration of 5 doses of enfortumab vedotin.

[0288] As noted above, enfortumab vedotin may be administered by any route. In some embodiments, enfortumab vedotin is administered by an intravenous route.

[0289] Individualized Neoantigen Vaccines in Adjuvant Therapy

[0290] In some aspects the disclosure provides anti-cancer immunotherapies, such as individualized neoantigen vaccines, for use in combination with enfortumab vedotin and / or immune checkpoint inhibitors as an adjuvant therapy. If used for both neoadjuvant and adjuvant therapy, the specific individualized neoantigen vaccine and dosing thereof for use in an adjuvant therapy as described herein typically (but not necessarily) will be the same as that used for Attorney Docket No. 131986-71 1 1 neoadjuvant therapy as described herein. In some embodiments, the neoadjuvant therapy and adjuvant therapy comprise administration of the same individualized neoantigen vaccine, optionally according to the same dosing regimen.

[0291] In some embodiments of adjuvant therapy, the vaccine is administered on a schedule for up to two months, up to three months, up to four month, up to five months, up to six months, up to seven months, up to eight months, up to nine months, up to ten months, up to eleven months, up to 1 year, up to 1 and V2 years, up to two years, up to three years, or up to four years. The schedule may be the same or varied. In some embodiments, the schedule is weekly for the first 3 weeks and then monthly thereafter. In some embodiments, the individualized neoantigen vaccine is administered to subject weekly, every 2 weeks, every 3 weeks, every 4 weeks, every 5 fives, every 6 weeks, every 7 weeks, or every' 8 weeks. In some embodiments of adjuvant therapy, the individualized neoantigen vaccine is administered once every 3-5 weeks. In some embodiments of adjuvant therapy, the individualized neoantigen vaccine is administered once every' three weeks.

[0292] In some embodiments of adjuvant therapy, the individualized neoantigen vaccine is administered to the subject on a regular basis (e.g., once a week, once every' two weeks, once every three weeks, once every' four weeks, once every' five weeks, once every six weeks, once every' seven weeks, once every eight weeks, etc.) for a specified total period of time, or until a particular endpoint is reached. The specified total period of time, in some embodiments, is the time corresponding to the administration of 2 doses, 3 doses, 4 doses, 5 doses, 6 doses, 7 doses, 8 doses, 9 doses, 10 doses, 11 doses, 12 doses, 13 doses, 14 doses, 15 doses, 16 doses, 17 doses, 18 doses, 19 doses, 20 doses, 21 doses, 22 doses, 23 doses, 24 doses or more. In some embodiments of adjuvant therapy, the specified total period of time is the time corresponding to the administration of 5-13, 5-15, or 10-15 doses of the individualized neoantigen vaccine. In some embodiments of adjuvant therapy, the specified total period of time is the time corresponding to the administration of nine doses of the individualized neoantigen vaccine. In some embodiments of adjuvant therapy, the subject is administered the individualized neoantigen vaccine once every three weeks for 13 total doses. In some embodiments, the individual neoantigen vaccine is administered at a dose that administers 1 mg of mRNA (e.g., every three weeks for 13 cycles in the adjuvant therapy).

[0293] Methods for Preparation of Individualized Neoantigen Vaccines

[0294] In other aspects, the disclosure provides a method for preparing an individualized neoantigen vaccine, comprising a combination (e.g., some or all) of the following steps: (a) identifying between 5-130 (or 5-40 or 7-34) neoantigens for a subject; (b) determining the antitumor efficacy of at least two neoepitopes for each of the 5-130 (or 5-40 or 7-34) neoantigens; and Attorney Docket No. 131986-71 1 1

[0295] (c) preparing an individualized neoantigen vaccine in which the total anti-cancer efficacy of the individualized neoantigen vaccine is maximized (e.g., the predicted total anti -cancer efficacy of the individualized neoantigen vaccine is maximized) for a given total length of the individualized neoantigen vaccine.

[0296] Methods for generating individualized neoantigen vaccines according to the disclosure may involve identification of mutations using techniques such as deep nucleic acid or protein sequencing methods of tissue samples as described herein. In some embodiments, an initial identification of mutations in a subject’s (e.g., a patient’s) transcriptome is performed. The data from the subject’s (e.g, the patient’s) transcriptome is compared with sequence information from the subject’s (e.g, the patient’s) exome in order to identify patient-specific and tumor-specific mutations that are expressed. The comparison produces a dataset of putative neoepitopes, referred to as a mutanome. The mutanome may include approximately 100-10,000 candidate mutations per subject. In some embodiments, an mRNA neoantigen vaccine is designed and manufactured. The subject is then treated with the vaccine. In certain embodiments, such a neoantigen-containing vaccine may be a polycistronic vaccine including multiple neoepitopes or one or more single RNA vaccines or a combination thereof.

[0297] In some embodiments, the entire method from the initiation of the mutation identification process to the start of subject treatment is achieved in less than 2 months. In other embodiments, the whole process is achieved in 7 weeks or less, 6 weeks or less, 5 weeks or less, 4 weeks or less, 3 weeks or less, 2 weeks or less or less than 1 week. In some embodiments, the whole method is performed in less than 30 days.

[0298] In an individualized neoantigen vaccine, the subject-specific cancer antigens may be identified in a sample (biological sample) of a subject. The term “biological sample” refers to a sample that contains biological materials such as a DNA, an RNA and / or a protein. In some embodiments, the biological sample may suitably comprise a bodily fluid from a subject. The bodily fluids can be fluids isolated from anywhere in the body of the subject, preferably a peripheral location, including but not limited to, for example, blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid and combinations thereof. In some embodiments, the sample may be a tissue sample or a tumor sample. For instance, a sample of one or more tumor cells may be examined for the presence of subject-specific cancer antigens. Attorney Docket No. 131986-71 1 1

[0299] At any point in the treatment, the subject may be examined to determine whether the mutations in the vaccine are still appropriate. Based on that analysis, the vaccine may be adjusted or reconfigured to include one or more different mutations or to remove one or more mutations.

[0300] It has been recognized and appreciated that, by analyzing certain properties of cancer associated mutations, optimal neoepitopes may be assessed and / or selected for inclusion in an individualized neoantigen vaccine. A property of a neoepitope or set of neoepitopes may include, for instance, an assessment of gene or transcript-level expression in subject RNA-seq or other nucleic acid analysis, tissue-specific expression in available databases, known oncogenes / tumor suppressors, variant call confidence score, RNA-seq allele-specific expression, conservative vs. non-conservative AA substitution, position of point mutation (Centering Score for increased TCR engagement), position of point mutation (Anchoring Score for differential HLA binding), Selfness: <100% core epitope homology with subject WES data, HLA-A and B ICso for 8mers-l Imers, HLA-DRB 1 IC50 for 15mers-20mers, promiscuity Score (i.e., number of subject HLAs predicted to bind), HLA-C IC50 for 8mers-l Imers, HLA-DRB3-5 IC50 for 15mers-20mers, HLA-DQB1 / A1 IC50 for 15mers-20mers, HLA-DPB1 / A1 IC50 for 15mers-20mers, Class I vs Class II proportion, Diversity of subject HLA-A, -B and DRB1 allotypes covered, proportion of point mutation vs complex epitopes (e.g., frameshifts), and / or pseudo-epitope HLA binding scores.

[0301] In some embodiments, the properties of cancer-associated mutations used to identify neoepitopes are properties related to the type of mutation, abundance of mutation in subject sample, immunogenicity, lack of self-reactivity, and nature of peptide composition.

[0302] The type of mutation should be determined and considered as a factor in determining whether a putative epitope should be included in a vaccine. The type of mutation may vary. In some instances, it may be desirable to include multiple different types of mutations in a single vaccine. In other instances, a single type of mutation may be more desirable. A value for each particular mutation can be weighted and calculated. In some embodiments, a particular mutation is a single nucleotide polymorphism (SNP). In some embodiments, a particular mutation is a complex variant, for example, a peptide sequence resulting from intron retention, complex splicing events, or insertion / deletion mutations changing the reading frame of a sequence.

[0303] The abundance of the mutation in a subject sample may also be scored and factored into the decision of whether a putative epitope should be included in a vaccine. Highly abundant mutations may promote a more robust immune response.

[0304] In some embodiments, methods for generating individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. W02020 / 006242 (published January 2, 2020, entitled “PERSONALIZED CANCER VACCINE Attorney Docket No. 131986-71 1 1

[0305] EPI TOPE SELEC TION”), the contents of which are herein incorporated by reference in their entirety for this purpose. In some embodiments, methods for generating individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. WO2024 / 151811 (published July 18, 2024, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose.

[0306] In some embodiments, a method to optimize an individualized neoantigen vaccine comprises a step of selecting a subset of neoepitopes encoded by an individualized neoantigen vaccine for inclusion in an optimized individualized neoantigen vaccine, e.g., based on their determined immunogenicity. The selection may, for example, result in exclusion of certain neoepitopes from the optimized individualized neoantigen vaccine, e.g., if they are poorly immunogenic in subject following administration of the unoptimized vaccine. The selection may also, for example, result in identification of certain neoantigen(s) (e.g., corresponding to certain neoepitope(s) of the unoptimized vaccine) that are represented multiple times (e.g., 2, 3, 4, 5, 6, 7, 9, or more times) in the optimized individualized neoantigen vaccine. In such embodiments, the multiple representations of the neoantigen(s) may involve expression of multiple copies of the same neoepitope by the nucleic acid (e.g., mRNA), or may involve expression of multiple distinct neoepitopes that each correspond to the same neoantigen(s). For example, if neoantigen A is selected for multiple representations in the optimized vaccine, neoepitope Al corresponding to neoantigen A may be encoded multiple times in the open reading frame of the nucleic acid (e.g., mRN / X), or neoepitopes Al, A2, A3, etc., each corresponding to neoantigen A but with distinct amino acid sequences, may each be encoded in the open reading frame.

[0307] In some embodiments, a method to optimize an individualized neoantigen vaccine comprises selection of additional neoantigens from the subject but not represented in an unoptimized vaccine. This may include any neoantigens identified in the subject but that were excluded from the unoptimized vaccine. The selection of additional neoantigens can be made according to the methods provided herein. For example, one or more neoantigens having a lower predicted efficacy than those included in the unoptimized vaccine may be selected to be included in the optimized vaccine. Neoepitope(s) corresponding to the additional neoantigen(s), in some embodiments, are encoded by the optimized individualized neoantigen vaccine (e.g., an mRNA of the optimized individualized neoantigen vaccine).

[0308] In some embodiments, an optimized individualized neoantigen vaccine encodes more peptides corresponding to driver mutations (e.g., 1 more, 2 more, 3 more, 4 more, 5 more, 6 more, 7 more, 8 more, 9 more, 10 more, or more) relative to a corresponding unoptimized individualized Attorney Docket No. 131986-71 1 1 neoantigen vaccine. In some embodiments, an optimized individualized neoantigen vaccine encodes fewer peptides corresponding to driver mutations (e.g., 1 fewer, 2 fewer, 3 fewer, 4 fewer, 5 fewer, 6 fewer, 7 fewer, 8 fewer, 9 fewer, 10 fewer, or more) relative to a corresponding unoptimized individualized neoantigen vaccine. In some embodiments, 1 or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) peptides corresponding to driver mutations are added to an optimized individualized neoantigen vaccine relative to a corresponding unoptimized individualized neoantigen vaccine. In some embodiments, 1 or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) peptides corresponding to driver mutations are removed from an optimized individualized neoantigen vaccine relative to a corresponding unoptimized individualized neoantigen vaccine.

[0309] In some embodiments, methods for optimizing individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. W02020 / 006242 (published January 2, 2020, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose. In some embodiments, methods for optimizing individualized neoantigen vaccines comprise steps or methods described in International Patent Application Pub. No. WO2024 / 151811 (published July 18, 2024, entitled “PERSONALIZED CANCER VACCINE EPITOPE SELECTION”), the contents of which are herein incorporated by reference in their entirety for this purpose.

[0310] In some embodiments, the individualized neoantigen vaccines described herein may be used for treatment of cancer (e.g., urothelial or bladder cancer). As one non-limiting example, the disclosure provides methods for treating a subject having urothelial or bladder cancer, comprising: a) analyzing a sample derived from the subject in order to identify one or more neoantigens (personalized neoantigens); b) determining the anti-tumor efficacy of at least two neoepitopes for each of the identified neoantigens; c) preparing an individualized neoantigen vaccine in which the total anti-cancer efficacy of the individualized neoantigen vaccine is maximized (e.g., the predicted total anti-cancer efficacy of the individualized neoantigen vaccine is maximized) for a given total length of the individualized neoantigen vaccine; and d) administering the individualized neoantigen vaccine to the subject, and optionally further preparing an optimized individualized neoantigen vaccine and administering the individualized neoantigen vaccine to the subject.

[0311] In some embodiments, the individualized neoantigen vaccine may be administered with an anti-cancer therapeutic agent, for example, as part of an adjuvant and / or neoadjuvant therapy. The individualized neoantigen vaccine and anti-cancer therapeutic can be combined to enhance immune therapeutic responses. The individualized neoantigen vaccine and other therapeutic agent may be administered simultaneously or sequentially. When the other therapeutic agents (e.g., an Attorney Docket No. 131986-71 1 1 immune checkpoint inhibitor, enfortumab vedotin) are administered simultaneously they can be administered in the same or separate formulations but are administered at the same time. The other therapeutic agents (e g., immune checkpoint inhibitors, enfortumab vedotin) are administered sequentially with one another and with the individualized neoantigen vaccine, when the administration of the other therapeutic agents and the individualized neoantigen vaccine is temporally separated. The separation in time between administrations of these compounds may be a matter of minutes or it may be longer, e.g., hours, days, weeks, months. Other therapeutic agents include but are not limited to anti-cancer therapeutic, adjuvants, cytokines, antibodies, antigens, etc. Examples of anti-cancer therapeutics include, but are not limited to, DNA-alkylating agents (e.g., cyclophosphamide, ifosfamide), antimetabolites (e.g., methotrexate, a folate antagonist, and 5 -fluorouracil, a pyrimidine antagonist), microtubule disrupters (e.g., vincristine, vinblastine, paclitaxel), DNA intercalators (e.g., doxorubicin, daunomycin, cisplatin), hormone therapy (e.g., tamoxifen, flutamide), and gene-targeted therapies, such as protein-tyrosine kinase inhibitors (e.g. imatinib; the EGER kinase inhibitor, erlotinib). In some embodiments, the anti-cancer therapeutic is pembrolizumab. In some embodiments, the anti -cancer therapeutic is enfortumab vedotin.

[0312] In some embodiments, the progression of the cancer can be monitored to identify changes in the expressed neoantigens. Thus, in some embodiments, the method also involves at least one month after the administration of an individualized neoantigen mRNA vaccine, identifying at least two neoepitopes from a sample of the subject to produce a second set of neoepitopes, and administering to the subject an mRNA vaccine having an open reading frame encoding the second set of neoepitopes to the subject. The mRNA vaccine having an open reading frame encoding second set of neoepitopes, in some embodiments, is administered to the subject 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, or 1 year after the mRNA vaccine having an open reading frame encoding the first set of neoepitopes. In other embodiments, the mRN / X vaccine having an open reading frame encoding second set of neoepitope is administered to the subject 1 ’ / 2, 2, 2 'A , 3, 3 ' / 2, 4, 4 E2, or 5 years after the mRNA vaccine having an open reading frame encoding the first set of neoepitopes.

[0313] Nucleic Acids / Polynucleotides

[0314] Individualized neoantigen vaccines, as provided herein, comprise at least one (one or more) nucleic acid having an open reading frame encoding at least one neoepitope. The term “nucleic acid,” in its broadest sense, includes any compound and / or substance that comprises a polymer of nucleotides. These polymers are also referred to as polynucleotides. Attorney Docket No. 131986-71 1 1

[0315] Nucleic acids may be or may include, for example, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a p-D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino-a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or chimeras or combinations thereof.

[0316] As a non-limiting example, when a DNA nucleic acid individualized neoantigen vaccine is delivered to a cell, the DNA is transcribed into RNA, and the RNA will be processed into a polypeptide by the intracellular machinery which can then process the polypeptide into immunosensitive fragments capable of stimulating an immune response against a tumor or population of cancerous cells. As a non-limiting example, when an RNA (e.g., mRNA) nucleic acid individualized neoantigen vaccine is delivered to a cell, the RNA (e.g., mRNA) will be processed into a polypeptide by the intracellular machinery which can then process the polypeptide into immunosensitive fragments capable of stimulating an immune response against a tumor or population of cancerous cells.

[0317] In some embodiments, nucleic acids function as messenger RNA (mRNA). “Messenger RNA” (mRNA) refers to any nucleic acid that encodes a (at least one) polypeptide (a naturally occurring, non-naturally-occurring, or modified polymer of amino acids) and can be translated to produce the encoded polypeptide in vitro, in vivo, in situ or ex vivo.

[0318] The basic components of an mRN A molecule typically include at least one coding region, a 5' untranslated region (UTR), a 3' UTR, a 5' cap, and a poly-A tail. Nucleic acids may function as mRNA but can be distinguished from wild-type mRNA in their functional and / or structural design features, which serve to overcome existing problems of effective polypeptide expression using nucleic-acid based therapeutics.

[0319] Polynucleotides, in some embodiments, are codon optimized. Codon optimization methods are known in the art and may be used as provided herein. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains Attorney Docket No. 131986-71 1 1 of the protein to fold properly; or to reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - nonlimiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.

[0320] In some embodiments, a codon optimized sequence shares less than 95% sequence identity with a naturally occurring or wild-type sequence (e.g, a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g, an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 90% sequence identity with a naturally occurring or wild-type sequence (e.g, a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g, an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 85% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g, an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g, an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares less than 75% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g, an antigenic protein or polypeptide).

[0321] In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g, between about 67% and about 85% or between about 67% and about 80%) sequence identity with a naturally-occurring or wild-type sequence (e.g, a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g, an antigenic protein or polypeptide). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity with a naturally occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide).

[0322] In some embodiments, a codon optimized RNA may, for instance, be one in which the levels of G / C are enhanced. The G / C-content of nucleic acid molecules may influence the stability of the RNA. RNA having an increased amount of guanine (G) and / or cytosine (C) residues maybe functionally more stable than nucleic acids containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. WO02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. Due to the Attorney Docket No. 131986-71 1 1 degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote greater RNA stability without changing the resulting amino acid. The approach is limited to coding regions of the RNA.

[0323] Chemically Modified Nucleotide Sequences

[0324] An mRNA may include nucleotides that are not chemically modified (z.e., unmodified nucleoti des), nucleotides that are chemically modified, or both. Nucleotides that are not chemically modified are the standard ribonucleotides consisting of adenosine, guanosine, cytidine, and uridine.

[0325] In some embodiments, the nucleic acid individualized neoantigen vaccine of the disclosure comprises one or more chemically modified nucleobases. Some aspects include modified polynucleotides comprising a polynucleotide described herein (e.g., a nucleic acid comprising a nucleotide sequence encoding one or more neoepitopes). The modified nucleic acids can be chemically modified and / or structurally modified. When the nucleic acids are chemically and / or structurally modified, the polynucleotides can be referred to as “modified nucleic acids.”

[0326] The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding one or more cancer neoepitopes. A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside including a phosphate group. Modified nucleotides can by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.

[0327] The skilled artisan will appreciate that, except where otherwise noted, nucleic acid sequences set forth in the instant application will recite “T”s in a representative DNA sequence but where the sequence represents RNA, the “T”s would be substituted for “U”s.

[0328] Individualized neoantigen vaccines comprise, in some embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding at least one (e.g., 5-200 or 5-130 or 5-40 or 7-34) neoepitope(s), wherein the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally occurring modified nucleotides and nucleosides or non-naturally Attorney Docket No. 131986-71 1 1 occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and / or nucleoside as are recognized in the art.

[0329] In some embodiments, a naturally occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the MODOMICS database.

[0330] In some embodiments, a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found, inter alia, in International Patent Application Nos. PCT / US2012 / 058519; PCT / US2013 / 075177;

[0331] PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771 ; or PCT / IB2017 / 051367 all of which are incorporated by reference herein for this purpose.

[0332] In some embodiments, a modified RNA nucleic acid (e.g, a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0333] In some embodiments, a modified RNA nucleic acid (e.g, a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.

[0334] Nucleic acids (e.g, RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on intemucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.

[0335] In some embodiments, modified nucleobases in mRNA comprise N1 -methylpseudouridine (mly), Nl-ethyl-pseudouridine (ely), 5-methoxy -uridine (mo5U), 5-methyl- uridine (m5U), 5-methyl-cytidine (m5C), and / or pseudouridine (y). In some embodiments, modified nucleobases in mRNAs comprise 5 -methoxy methyl uridine, 5-methylthio uridine, 1- methoxymethyl pseudouridine, 5-methyl cytidine, and / or 5-methoxy cytidine. In some embodiments, the mRNA includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications. Attorney Docket No. 131986-71 1 1

[0336] In some embodiments, an RNA nucleic acid of the disclosure comprises 1-methyl- pseudouridine (mlijj) substitutions at one or more or all uridine positions of the nucleic acid. In some embodiments, an RNA nucleic acid of the disclosure comprises nucleosides consisting of N1 -methylpseudouridine, adenosine, guanosine, and cytidine. In some embodiments 100% of uracil nucleosides in the open reading frame are N 1 -methylpseudouridine.

[0337] In some embodiments, an RNA nucleic acid of the disclosure comprises 1-methyl- pseudouridine (mly) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid. In some embodiments, an RNA nucleic acid of the disclosure comprises nucleosides consisting of Nl- methylpseudouridine, adenosine, guanosine, and 5-methyl cytidine. In some embodiments 100% of uracil nucleosides in the open reading frame are N1 -methylpseudouridine.

[0338] In some embodiments, an RNA nucleic acid of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid.

[0339] In some embodiments, an RNA nucleic acid of the disclosure comprises pseudouridine (y) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nuclei c acid.

[0340] In some embodiments, an RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.

[0341] In some embodiments, a mRNA comprises 5-methyl-uridine and 5-methyl cytidine at one or more or all uridine and cytidine positions, respectively, of the mRNA.

[0342] In some embodiments, mRNAs are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a mRNA can be uniformly modified with 1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. In some embodiments, the ORF is uniformly modified for a particular modification, such as I -methyl-pseudouridine. In some embodiments, the uniform modification does not include the mRNA cap. For instance, a cap with different modifications from the remainder of the mRNA can be added co-transcriptionally or post-transcriptionally to the mRNA. Attorney Docket No. 131986-71 1 1

[0343] In Vitro Transcription ofRNA (e.g., mRNA)

[0344] Individualized neoantigen vaccines may comprise at least one nucleic acid (e.g, an RNA polynucleotide, such as an mRNA (messenger RNA) or an mmRNA (modified mRNA)). mRNA, for example, is transcribed in vitro from template DNA, referred to as an 'In vitro transcription template.” cDNA encoding RNA polynucleotides may be transcribed using an in vitro transcription (IVT) system. In vitro transcription ofRNA is known in the art and is described in PCT Publication WO 2014 / 152027, which is incorporated by reference herein to the extent it discloses IVT methods. In some embodiments, the RNA is prepared in accordance with any one or more of the methods described in WO 2018 / 053209 and WO 2019 / 036682, each of which is incorporated by reference herein to the extent it discloses RNA production methods.

[0345] In some embodiments, the RNA transcript is generated using a non-amplified, linearized DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide, for example, but not limited to mRNA encoding at least one neoepitope. In some embodiments, cells, e.g., bacterial cells, e.g., E. coJi, e.g., DH-1 cells are transfected with the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA which is then isolated and purified. In some embodiments, the DNA template includes an RNA polymerase promoter, e.g., a T7 promoter located 5' to and operably linked to the gene of interest.

[0346] In some embodiments, an in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, and encodes a 3' UTR and a poly(A) tail. The particular nucleic acid sequence composition and length of an in vitro transcription template will depend on the mRNA encoded by the template.

[0347] An in vitro transcription system typically comprises a transcription buffer, nucleotide triphosphates (NTPs), an RNase inhibitor, and an RNA polymerase.

[0348] The NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized. The NTPs may be selected from natural and unnatural NTPs, and may be selected from unmodified (e.g., ATP, GTP, UTP, CTP) or modified NTPs.

[0349] Any number of RNA polymerases or variants may be used to transcribe RNA. The polymerase may be selected from, but is not limited to, a phage RNA polymerase, e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, and / or mutant polymerases such as, but not limited to, polymerases able to incorporate modified nucleic acids and / or modified Attorney Docket No. 131986-71 1 1 nucleotides, including chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase.

[0350] In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises 5' terminal cap, for example, 7mG(5')ppp(5')NlmpNp.

[0351] In some embodiments the RNA polymerase is a wild-type RNA polymerase. In some embodiments, the RNA polymerase is an RNA polymerase variant, such as those described in WO 2020 / 172239, incorporated herein by reference to the extent it describes RNA polymerase variants. RNA polymerase variants may include at least one amino acid substitution, relative to the wildtype (WT) RNA polymerase.

[0352] Purification

[0353] Purification of the nucleic acids may include, but is not limited to, nucleic acid clean-up, quality assurance and quality' control. Clean-up may be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark); HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC- HPLC); and / or tangential flow filtration. The term “purified'’ when used in relation to a nucleic acid such as a “purified nucleic acid” refers to one that is separated from at least one contaminant. A “contaminant” is any substance that makes another unfit, impure or inferior. Thus, a purified nucleic acid (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment or purification method.

[0354] Untranslated Regions (UTRs)

[0355] Untranslated regions (UTRs) are sections of a nucleic acid before a start codon (5' UTR) and after a stop codon (3' UTR) that are not translated. In some embodiments, a nucleic acid (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the disclosure comprising an open reading frame (ORF) encoding one or more neoepitopes further comprises one or more UTRs (e.g., a 5 ' UTR or functional fragment thereof, a 3 ' UTR or functional fragment thereof, or a combination thereof).

[0356] A UTR can be homologous or heterologous to the coding region in a nucleic acid. In some embodiments, the UTR is homologous to the ORF encoding the one or neoepitopes. In some embodiments, the UTR is heterologous to the ORF encoding the one or more neoepitopes. In some Attorney Docket No. 131986-71 1 1 embodiments, the nucleic acid comprises two or more 5' UTRs or functional fragments thereof, each of which have the same or different nucleotide sequences. In some embodiments, the nucleic acid comprises two or more 3' UTRs or functional fragments thereof, each of which have the same or different nucleotide sequences.

[0357] In some embodiments, the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.

[0358] In some embodiments, the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., 5 -meth oxy uracil.

[0359] UTRs can have features that provide a regulator}' role, e.g., increased or decreased stability, localization, and / or translation efficiency. A nucleic acid comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5' UTR or 3' UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.

[0360] Natural 5' UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. 5' UTRs also have been known to form secondary structures that are involved in elongation factor binding.

[0361] By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a nucleic acid. For example, introduction of 5' UTR of liver-expressed mRN / X, such as albumin, serum amyloid A, Apolipoprotein A / B / E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of nucleic acids in hepatic cell lines or liver. Likewise, use of 5' UTRs from other tissuespecific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1 , CD36), for myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, GDI lb, MSR, Fr-1, i-NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin), and for lung epithelial cells (e.g., SP-A / B / C / D).

[0362] In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature, or property. For example, an encoded polypeptide can belong to a family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new nucleic acid. Attorney Docket No. 131986-71 1 1

[0363] In some embodiments, the 5' UTR and the 3' UTR can be heterologous. In some embodiments, the 5' UTR can be derived from a different species than the 3' UTR. In some embodiments, the 3' UTR can be derived from a different species than the 5' UTR.

[0364] International Patent Application No. PCT / US2014 / 021522 (Publ. No. WO2014 / 164253) provides a listing of exemplary UTRs that may be utilized in the nucleic acids as flanking regions to an ORF. This publication is incorporated by reference herein for this purpose.

[0365] Additional exemplary UTRs that may be utilized in the nucleic acids include, but are not limited to, one or more 5' UTRs and / or 3' UTRs derived from the nucleic acid sequence of: a globin, such as an a- or 0-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 a polypeptide); an albumin (e.g, human albumin); aHSD17B4 (hydroxysteroid (17-0) dehydrogenase); a virus (e.g, a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV, e.g., CMV immediate early 1 (IE1)), a hepatitis vims (e.g., hepatitis B virus), a sindbis vims, or a PAV barley yellow dwarf vims); a heat shock protein (e.g, hsp70); a translation initiation factor (e.g, elF4G); a glucose transporter (e.g, hGLUTl (human glucose transporter 1)); an actin (e.g, human a or p actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g, a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g, human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g, ATP5A1 or the 0 subunit of mitochondrial H -ATP synthase); a growth hormone (e.g, bovine (bGH) or human (hGH)); an elongation factor (e.g, elongation factor 1 al (EEF1A1)); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a 0-Fl-ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g, collagen type I, alpha 2 (CollA2), collagen type I, alpha 1 (CollAl), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (C0I6AI)); a ribophorin (e.g, ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g, LRP1); a cardiotrophin-like cytokine factor (e.g, Nntl); calreticulin (Calr); a procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plodl); and a nucleobindin (e.g, Nucbl).

[0366] In some embodiments, the 5' UTR is selected from the group consisting of a 0-globin 5' UTR; a 5' UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 a polypeptide (CYBA) 5' UTR; a hydroxysteroid (17-0) dehydrogenase (HSD17B4) 5' UTR; a Tobacco etch vims (TEV) 5' UTR; a Venezuelan equine encephalitis vims (VEEV) 5' UTR; a 5' proximal open reading frame of rubella vims (RV) RNA encoding nonstructural proteins; a Attorney Docket No. 131986-711 1

[0367] Dengue vims (DEN) 5' UTR; a heat shock protein 70 (Hsp70) 5' UTR; a eIF4G 5' UTR; a GLUT1 5' UTR; functional fragments thereof and any combination thereof

[0368] In some embodiments, the 3' UTR is selected from the group consisting of a P-globin 3' UTR; a CYBA 3' UTR; an albumin 3' UTR; a growth hormone (GH) 3' UTR; a VEEV 3' UTR; a hepatitis B virus (HBV) 3' UTR; a-globin 3' UTR; a DEN 3' UTR; a PAV barley yellow dwarf vims (BYDV-PAV) 3' UTR; an elongation factor 1 cd (EEF1 Al) 3' UTR; a manganese superoxide dismutase (MnSOD) 3' UTR; a p subunit of mitochondrial H(+)-ATP synthase (P-mRNA) 3' UTR; a GLUT1 3' UTR; a MEF2A 3' UTR; a P-Fl-ATPase 3' UTR; functional fragments thereof and combinations thereof. In some embodiments, the 5' UTR comprises a sequence provided in Table C below or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5' UTR sequence provided in the following Table, or a variant or a fragment thereof.

[0369] UTR-1. 5' UTR sequences Attorney Docket No. 131986-711 1 Attorney Docket No. 131986-71 1 1

[0370] In some embodiments, the 3' UTR comprises a sequence provided in the following table or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3' UTR sequence provided in Table UTR-2 below, or a variant or a fragment thereof

[0371] UTR-2. 3’ UTR sequences (stop cassette is italicized; miR binding sites are boldened) Attorney Docket No. 131986-71 1 1

[0372] In some embodiments, the polynucleotide comprises a stop element and 3’-UTR, wherein the sequence is (stop element is italicized): U71X4GCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCA GCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAG UGGGCGGC (SEQ ID NO:32) or a variant or fragment thereof (e.g., a fragment that lacks the first one, two, three, four, five, six, or more nucleotides of nucleotides of SEQ ID NO:32.

[0373] Wild-type UTRs derived from any gene or mRNA can be incorporated into the nucleic acids of the disclosure. In some embodiments, a LTTR can be altered relative to a wild type or native UTR to produce a valiant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5' or 3' UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR.

[0374] Additionally, one or more synthetic UTRs can be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, and sequences available at addgene.org / Derrick_Rossi / , the contents of each are incorporated herein by reference in their entirety. UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5' and / or 3' UTR can be inverted, shortened, lengthened, or combined with one or more other 5' UTRs or 3' UTRs.

[0375] In some embodiments, the nucleic acid may comprise multiple UTRs, e.g., a double, atriple or a quadruple 5' UTR or 3' UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3' UTR can be used (see, for example, US Patent Application Publication No. US2010 / 0129877, the contents of which are incorporated herein by reference for this purpose).

[0376] The nucleic acids of the disclosure can comprise combinations of features. For example, the ORF can be flanked by a 5' UTR that comprises a strong Kozak translational initiation signal and / or a 3' UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5' UTR can comprise a first nucleic acid fragment and a second nucleic acid fragment from the same Attorney Docket No. 131986-71 1 1 and / or different UTRs (see, e.g., US Patent Application Publication No. US2010 / 0293625, herein incorporated by reference in its entirety for this purpose).

[0377] Other non-UTR sequences can be used as regions or subregions within the nucleic acids of the disclosure. For example, introns or portions of intron sequences can be incorporated into the nucleic acids of the disclosure. Incorporation of intronic sequences can increase protein production as well as nucleic acid expression levels. In some embodiments, the nucleic acid of the disclosure comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1): 189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the nucleic acid comprises an IRES instead of a 5' UTR sequence. In some embodiments, the nucleic acid comprises an ORF and a viral capsid sequence. In some embodiments, the nucleic acid comprises a synthetic 5' UTR in combination with a non-synthetic 3' UTR.

[0378] In some embodiments, the UTR can also include at least one translation enhancer nucleic acid, translation enhancer element, or translational enhancer elements (collectively, “TEE,” which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can include those described in US Patent Application Publication No. US2009 / 0226470, incorporated herein by reference in its entirety for this purpose, and others known in the art. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5' UTR comprises a TEE. In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation. In one non-limiting example, the TEE comprises the TEE sequence in the 5 '-leader of the Gtx homeodomain protein. See Chappell et al., PNAS 2004 101 :9590-9594, incorporated herein by reference in its entirety for this purpose.

[0379] The terms “translational enhancer polynucleotide” or “translation enhancer polynucleotide sequence” refer to a nucleic acid that includes one or more of the TEE provided herein and / or known in the art (see, e.g., US PatentNos. US6310197, US6849405, US7456273, and US7183395; US Patent Application Publication Nos. US2009 / 0226470, US2007 / 0048776, US2011 / 0124100, US2009 / 0093049, and US2013 / 0177581; International Patent Application Publication Nos. W02009 / 075886, W02007 / 025008, WO2012 / 009644, W02001 / 055371, and WO1999 / 024595; and European Patent Application Publication Nos, EP2610341A1, and EP2610340A1; the contents of each of which are incorporated herein by reference in their entirety for this purpose), or their variants, homologs, or functional derivatives. In some embodiments, the nucleic acid of the disclosure comprises one or multiple copies of a TEE. The TEE in a translational enhancer Attorney Docket No. 131986-71 1 1 nucleic acid can be organized in one or more sequence segments. A sequence segment can harbor one or more of the TEEs provided herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translational enhancer nucleic acid, they can be homogenous or heterogeneous. Thus, the multiple sequence segments in a translational enhancer nucleic acid can harbor identical or different types of the TEE provided herein, identical or different number of copies of each of the TEE, and / or identical or different organization of the TEE within each sequence segment. In some embodiments, the nucleic acid of the disclosure comprises a translational enhancer nucleic acid sequence.

[0380] In some embodiments, a 5' UTR and / or 3' UTR comprising at least one TEE described herein can be incorporated in a monocistronic sequence such as, but not limited to, a vector system or a nucleic acid vector. In some embodiments, a 5' UTR and / or 3' UTR of a polynucleotide of the disclosure comprises a TEE or portion thereof described herein. In some embodiments, the TEEs in the 3' UTR can be the same and / or different from the TEE located in the 5' UTR.

[0381] In some embodiments, a 5' UTR and / or 3' UTR of a nucleic acid of the disclosure can include at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at. least 40, at least 45, at least 50, at. least 55, or more than 60 TEE sequences. In some embodiments, the 5' UTR of a nucleic acid of the disclosure can include 1-60, 1-55, 1-50, 1-45, 1- 40, 1-35, 1-30, 1-25, 1-20, 1-15, 1 -10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 TEE sequences. The TEE sequences in the 5' UTR of the nucleic acid of the disclosure can be the same or different TEE sequences. A combination of different TEE sequences in the 5' UTR of the nucleic acid of the disclosure can include combinations in which more than one copy of any of the different TEE sequences are incorporated.

[0382] In some embodiments, the 5' UTR and / or 3' UTR comprises a spacer to separate two TEE sequences. As a non-limiting example, the spacer can be a 15 nucleotide spacer and / or other spacers known in the art (e.g., in multiples of three nucleotides). As another non-limiting example, the 5' UTR and / or 3' UTR comprises a TEE sequence-spacer module repeated at least once, at least twice, at. least 3 times, at. least 4 times, at. least. 5 times, at. least. 6 times, at least. 7 times, at least 8 times, at least 9 times, at least 10 times, or more than 10 times in the 5' UTR and / or 3' UTR, respectively. In some embodiments, the 5' UTR and / or 3' UTR comprises a TEE sequence-spacer module repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. Attorney Docket No. 131986-71 1 1

[0383] 3' UTR and the AU Rich Elements

[0384] In certain embodiments, a nucleic acid (e.g., a nucleic acid encoding a neoepitope of the disclosure) further comprises a 3' UTR.

[0385] A 3'-UTR is the section of mRNA that immediately follows the translation termination codon and often contains regulatory regions that post-transcriptionally influence gene expression. Regulatory regions within the 3 ’-UTR can influence polyadenylation, translation efficiency, localization, and stability of the mRNA. In some embodiments, the 3'-UTR useful for the disclosure comprises a binding site for regulatory proteins or microRNAs. In some embodiments, the 3'-UTR has a silencer region, which binds to repressor proteins and inhibits the expression of the mRNA. In other embodiments, the 3'-UTR comprises an AU-rich element (AREs). Proteins bind AREs to affect the stability or decay rate of transcripts in a localized manner or affect translation initiation. In other embodiments, the 3'-UTR comprises the sequence A AU AAA that directs addition of several hundred adenine residues called the poly(A) tail to the end of the mRNA transcript.

[0386] Natural or wild type 3' UTRs are known to have stretches of Adenosines and Uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al., 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of / AREs include GM-CSF and TNF-a. Class III ARES do not contain an AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

[0387] Introduction, removal or modification of 3' UTR AU rich elements (AREs) can be used to modulate the stability of nucleic acids of the disclosure. When engineering specific nucleic acids, one or more copies of an ARE can be introduced to make nucleic acids of the disclosure less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein. Transfection experiments can be conducted in relevant cell lines, using nucleic acids of the disclosure and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE- Attorney Docket No. 131986-71 1 1 engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hour, 12 hour, 24 hour, 48 hour, and 7 days post-transfection.

[0388] Regions having a 5' Cap

[0389] The nucleic acid individualized neoantigen vaccine described herein may be an mRNA individualized neoantigen vaccine comprising one or more mRNA having open reading frames that encode neoepitopes. Each of these mRNA may have a 5' Cap.

[0390] The 5' cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5' proximal introns during mRNA splicing.

[0391] Endogenous mRNA molecules can be 5 '-end capped generating a 5 '-ppp-5 '-triphosphate linkage between a terminal guanosine cap residue and the 5 '-terminal transcribed sense nucleotide of the mRNA molecule (cap). This 5 '-guanylate cap can then be methylated to generate an N7- methyl-guanylate residue (cap-0). The ribose sugars of the terminal and / or anteterminal transcribed nucleotides of the 5' end of the mRNA can optionally also be 2'-O-methylated (e.g., with a 2'- hydroxy group on the first ribose sugar (cap-1); or with a 2'-hydroxy group on the first two ribose sugars (cap-2)). 5 '-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation.

[0392] In some embodiments, nucleic acids (e.g., a nucleic acid encoding a neoepitope) incorporate a cap moiety'.

[0393] In some embodiments, nucleic acids (e.g., a nucleic acid encoding a neoepitope) comprise a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5 '-ppp-5' phosphodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with a-thio-guanosine nucleotides according to the manufacturer’s instructions to create a phosphorothioate linkage in the 5 '-ppp-5' cap. Additional modified guanosine nucleotides can be used such as a-methyl-phosphonate and seleno-phosphate nucleotides.

[0394] Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugars of 5 '-terminal and / or 5 '-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2'-hydroxyl group of the sugar ring. Multiple distinct 5'-cap structures can be used to generate the 5 '-cap of a nucleic acid molecule, such as a polynucleotide that functions as an Attorney Docket No. 131986-71 1 1 mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (z'.e., endogenous, wild-type or physiological) 5'-caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and / or linked to the polynucleotides of the disclosure.

[0395] For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5 '-5 '-tri phosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-O- methyl group (z.e., N7,3'-O-dimethyl-guanosine-5 '-triphosphate-5 '-guanosine (m7G-3'mppp-G; which can equivalently be designated 3' O-Me-m7G(5')ppp(5')G). The 3'-0 atom of the other, unmodified, guanine becomes linked to the 5'-terminal nucleotide of the capped polynucleotide. The N7- and 3'-O-methlyated guanine provides the terminal moiety of the capped polynucleotide.

[0396] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on guanosine (z.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).

[0397] In some embodiments, the cap is a dinucleotide cap analog. ?\s a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phophorosel enoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety for this purpose.

[0398] In some embodiments, the cap is a cap analog is a N7-(4-chlorophenoxyethyl) substituted dicucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of a N7-(4-chlorophenoxyethyl ) substituted dicucleotide form of a cap analog include a N7-(4- chlorophenoxyethyl)-G(5')ppp(5')G and a N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analog (see, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21 :4570-4574; the contents of which are herein incorporated by reference in its entirety for this purpose). In some embodiments, a cap analog is a 4-chloro / bromophenoxyethyl analog.

[0399] While cap analogs allow for the concomitant capping of a polynucleotide or a region thereof, in an in vitro transcription reaction, up to 20% of transcripts can remain uncapped. This, as well as the structural differences of a cap analog from an endogenous 5'-cap structures of nucleic acids produced by the endogenous, cellular transcription machinery, can lead to reduced translational competency and reduced cellular stability.

[0400] Nucleic acids of the disclosure (e.g., nucleic acids encoding neoepitopes) can also be capped post-manufacture (e.g., through IVT or chemical synthesis), using enzymes, in order to generate more authentic 5'-cap structures. As used herein, the phrase “more authentic” refers to a Attorney Docket No. 131986-71 1 1 feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a “more authentic” feature is better representative of an endogenous, wildtype, natural or physiological cellular function and / or structure as compared to synthetic features or analogs, etc., or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5'cap structures are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5' endonucleases and / or reduced 5'decapping, as compared to synthetic 5'cap structures known in the art (or to a wild-type, natural or physiological 5'cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'- O-methyltransf erase enzyme can create a canonical 5 '-5 '-triphosphate linkage between the 5'- terminal nucleotide of a polynucleotide and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is termed the cap-1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5'cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (cap-0), 7mG(5')ppp(5')NlmpNp (cap-1), and 7mG(5')- ppp(5')NlmpN2mp (cap-2).

[0401] As a non-limiting example, capping chimeric nucleic acids post-manufacture can be more efficient as nearly 100% of the chimeric nucleic acids can be capped. This is in contrast to -80% when a cap analog is linked to a chimeric nucleic acid in the course of an in vitro transcription reaction.

[0402] According to the present disclosure, 5' terminal caps can include endogenous caps or cap analogs. According to the present disclosure, a 5' terminal cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, Nl-methyl-guanosine, 2'fluoro- guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2- azido-guanosine.

[0403] Poty-A Tails

[0404] In some embodiments, the nucleic acids (e.g., a nucleic acid encoding neoepitopes) further comprise a poly-A tail. In further embodiments, terminal groups on the poly- A tail can be incorporated for stabilization. In other embodiments, a poly-A tail comprises des-3' hydroxyl tails.

[0405] During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a nucleic acid such as an mRNA molecule in order to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to free a 3' hydroxyl. Then poly-A Attorney Docket No. 131986-71 1 1 polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues long. In some embodiments, the poly A tail comprises about 100 nucleotides.

[0406] Poly A tails can also be added after the construct is exported from the nucleus.

[0407] According to the present disclosure, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides can include des-3 ' hydroxyl tails. They can also include structural moieties or 2'-O-methyl modifications as taught by Junjie Li, et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in its entirety for this purpose).

[0408] The nucleic acids can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury', “[t]erminal uridylation has also been detected on human replication-dependent histone mRNAs The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3' poly(A) tail, the function of which is instead assumed by a stable stem-loop structure and its cognate stem-loop binding protein (SL.BP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs” (Norbury, “Cytoplasmic RNA: a case of the tail wagging the dog,” Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi: 10.1038 / nrm3645) the contents of which are incorporated herein by reference in its entirety for this purpose.

[0409] Unique poly-A tail lengths provide certain advantages to the nucleic acids. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In some embodiments, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1 ,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, or 3,000 nucleotides).

[0410] In some embodiments, the nucleic acid or region thereof includes from about 15 to about 3,000 nucleotides (e.g., from 15 to 50, 15 to 100, 15 to 200, 15 to 300, 15 to 400, 15 to 500, 15 to 600, 15 to 700, 15 to 800, 15 to 900, 15 to 1000, 15 to 1200, 15 to 1400, 15 to 1500, 15 to 1800, 15 to 2000, 15 to 2500, 15 to 3000, 50 to 100, 50 to 200, 50 to 300, 50 to 400, 50 to 500, 50 to 600, 50 to 700, 50 to 800, 50 to 900, 50 to 1000, 50 to 1200, 50 to 1400, 50 to 1500, 50 to 1800, 50 to 2000, 50 to 2500, 50 to 3000, 100 to 200, 100 to 300, 100 to 400, 100 to 500, 100 to 600, Attorney Docket No. 131986-71 1 1

[0411] 100 to 700, 100 to 800, 100 to 900, 100 to 1000, 100 to 1200, 100 to 1400, 100 to 1500, 100 to 1800, 100 to 2000, 100 to 2500, 100 to 3000, 200 to 300, 200 to 400, 200 to 500, 200 to 600, 200 to 700, 200, to 800, 200 to 900, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 2500, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 2500, 1000 to 3000, 1500 to 3000, 2500 to 3000, or 2000 to 3000 nucleotides).

[0412] In some embodiments, the poly-A tail is designed relative to the length of the overall nucleic acid or the length of a particular region of the nucleic acid. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the nucleic acids.

[0413] In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the nucleic acid or feature thereof The poly-A tail can also be designed as a fraction of the nucleic acid to which it belongs. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of nucleic acids for Poly-A binding protein can enhance expression.

[0414] Additionally, multiple distinct nucleic acids can be linked together via the PABP (Poly-A binding protein) through the 3 '-end using modified nucleotides at the 3 '-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines at and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 hours, 72 hours, and / or day 7 post-transfection.

[0415] In some embodiments, the nucleic acids are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In these embodiments, the G-quartet is incorporated at the end of the poly-A tail. The resultant nucleic acid is assayed for stability, protein production, and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone (e.g., SEQ ID NO: 55).

[0416] Start Codon and Stop Codon Regions

[0417] The disclosure also includes a nucleic acid that comprises both a start codon region and the nucleic acid described herein (e.g., a nucleic acid comprising a nucleotide sequence encoding neoepitopes). In some embodiments, the nucleic acids can have regions that are analogous to or function like a start codon region.

[0418] In some embodiments, the translation of a nucleic acid can initiate on a codon that is not the start codon / AUG. Translation of the nucleic acid can initiate on an alternative start codon such Attorney Docket No. 131986-71 1 1 as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of each of which are herein incorporated by reference in its entirety for this purpose).

[0419] As a non-limiting example, the translation of a nucleic acid begins on the alternative start codon ACG. As another non-limiting example, nucleic acid translation begins on the alternative start codon CTG or CUG. As yet another non-limiting example, the translation of a nucleic acid begins on the alternative start codon GTG or GUG.

[0420] Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and / or the structure of the nucleic acid. (See, e.g., Matsuda and Mauro PLoS ONE, 2010 5 : 11 ; the contents of which are herein incorporated by reference in its entirety for this purpose). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, translation efficiency, length, and / or structure of a polynucleotide.

[0421] The disclosure also includes a nucleic acid that comprises both a stop codon region and the nucleic acid described herein (e.g, a nucleic acid encoding neoepitopes). In some embodiments, the nucleic acids can include at least two stop codons before the 3' untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the nucleic acids include the stop codon TGA in the case of DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In some embodiments, the addition stop codon can be TAA or UAA. In some embodiments, the nucleic acids include three consecutive stop codons, four stop codons, or more.

[0422] Insertions and Substitutions

[0423] The disclosure also includes a nucleic acid that further comprises insertions and / or substitutions.

[0424] In some embodiments, the 5' UTR of the nucleic acid can be replaced by the insertion of at least one region and / or string of nucleosides of the same base. The region and / or string of nucleotides can include, but is not limited to, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 nucleotides and the nucleotides can be natural and / or unnatural. As a non-limiting example, the group of nucleotides can include 5-8 adenine, cytosine, thymine, a string of any of the other nucleotides disclosed herein and / or combinations thereof.

[0425] In some embodiments, the 5' UTR of the nucleic acid can be replaced by the insertion of at least two regions and / or strings of nucleotides of two different bases such as, but not limited to, Attorney Docket No. 131986-71 1 1 adenine, cytosine, thymine, any of the other nucleotides disclosed herein, and / or combinations thereof. For example, the 5' UTR can be replaced by inserting 5-8 adenine bases followed by the insertion of 5-8 cytosine bases. In another example, the 5' UTR can be replaced by inserting 5-8 cytosine bases followed by the insertion of 5-8 adenine bases.

[0426] In some embodiments, the nucleic acid can include at least one substitution and / or insertion downstream of the transcription start site that can be recognized by an RNA polymerase. As a nonlimiting example, at least one substitution and / or insertion can occur downstream of the transcription start site by substituting at least one nucleic acid in the region just downstream of the transcription start site (such as, but not limited to, +1 to +6). Changes to region of nucleotides just downstream of the transcription start site can affect initiation rates, increase apparent nucleotide triphosphate (NTP) reaction constant values, and increase the dissociation of short transcripts from the transcription complex curing initial transcription (Brieba et al. Biochemistry (2002) 41 : 5144- 5149; herein incorporated by reference in its entirety for this purpose). The modification, substitution, and / or insertion of at least one nucleoside can cause a silent mutation of the sequence or can cause a mutation in the amino acid sequence.

[0427] In some embodiments, the nucleic acid can include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 guanine bases downstream of the transcription start site.

[0428] In some embodiments, the nucleic acid can include the substitution of at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 guanine bases in the region just downstream of the transcription start site. As a non-limiting example, if the nucleotides in the region are GGGAGA, the guanine bases can be substituted by at least 1, at least 2, at least 3, or at least 4 adenine nucleotides. In another non-limiting example, if the nucleotides in the region are GGGAGA the guanine bases can be substituted by at least 1, at least 2, at least 3, or at least 4 cytosine bases. In another non-limiting example, if the nucleotides in the region are GGGAGA the guanine bases can be substituted by at least 1, at least 2, at least 3, or at least 4 thymine, and / or any of the nucleotides described herein.

[0429] In some embodiments, the nucleic acid can include at least one substitution and / or insertion upstream of the start codon. For the purpose of clarity, one of skill in the art would appreciate that the start codon is the first codon of the protein coding region whereas the transcription start site is the site where transcription begins. The nucleic acid can include, but is not limited to, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 substitutions and / or insertions of nucleotide bases. The nucleotide bases can be inserted or substituted at 1, at least 1, at least 2, at least 3, at least 4, or at least 5 locations upstream of the start codon. The nucleotides inserted Attorney Docket No. 131986-71 1 1 and / or substituted can be the same base (e.g, all A, or all C, or all T, or all G), two different bases (e.g., A and C, A and T, or C and T), three different bases (e.g., A, C and T, or A, C and T) or at least four different bases.

[0430] As a non-limiting example, the guanine base upstream of the coding region in the nucleic acid can be substituted with adenine, cytosine, thymine, or any of the nucleotides described herein. In another non-limiting example, the substitution of guanine bases in the nucleic acid can be designed so as to leave one guanine base in the region downstream of the transcription start site and before the start codon (see Esvelt et al. Nature (2011) 472(7344): 499-503; the contents of which is herein incorporated by reference in its entirety for this purpose). As a non-limiting example, at least 5 nucleotides can be inserted at 1 location downstream of the transcription start site but upstream of the start codon and the at least 5 nucleotides can be the same base type.

[0431] According to the present disclosure, two regions or parts of a chimeric nucleic acid may be joined or ligated, for example, using triphosphate chemi stry. In some embodiments, a first region or part of 100 nucleotides or less is chemically synthesized with a 5 '-monophosphate and terminal 3'-desOH or blocked OH. If the region is longer than 80 nucleotides, it may be synthesized as two or more strands that will subsequently be chemically linked by ligation. If the first region or part is synthesized as a non-positionally modified region or part using IVT, conversion to the 5'- monophosphate with subsequent capping of the 3 '-terminus may follow. Monophosphate protecting groups may be selected from any of those known in the art. A second region or part of the chimeric nucleic acid may be synthesized using either chemical synthesis or IVT methods, e.g., as described herein. IVT methods may include use of an RNA polymerase that can utilize a primer with a modified cap. Alternatively, a cap may be chemically synthesized and coupled to the IVT region or part.

[0432] It is noted that for ligation methods, ligation with DNA T4 ligase followed by DNAse treatment (to eliminate the DN A splint required for DNA T4 Ligase activity) should readily prevent the undesirable formation of concatenation products.

[0433] The entire chimeric polynucleotide need not be manufactured with a phosphate-sugar backbone. If one of the regions or parts encodes a polypeptide, then it is preferable that such region or part comprise a phosphate-sugar backbone.

[0434] Ligation may be performed using any appropriate technique, such as enzymatic ligation, click chemistry', orthoclick chemistry', solulink, or other bioconjugate chemistries known to those in the art. In some embodiments, the ligation is directed by a complementary oligonucleotide splint. In some embodiments, the ligation is performed without a complementary' oligonucleotide splint. Attorney Docket No. 131986-71 1 1

[0435] Individualized Neoantigen mRNA Vaccines

[0436] As discussed above, the disclosure, in some aspects, provides individualized neoantigen mRN / X vaccines comprising an mRN / X comprising an (at least one) open reading frame encoding an (at least one) neoepitope. The mRNA, in some embodiments, comprises a 5’ untranslated region (UTR), an open reading frame, and a 3’ UTR. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, and the poly(A) tail comprises 105 adenosine nucleotides (e.g., SEQ ID NO: 56). In some embodiments, the mRNA comprises a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail, and the poly(A) tail consists of 105 adenosine nucleotides. In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3’ UTR, and a poly (A) tail. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ cap, a 5’ untranslated region (UTR), an open reading frame, a 3 ’ UTR, and a poly(A) tail. In some embodiments, the mRNA comprises a 5’ cap, the 5’ cap comprises 5'7MeGpppG2'OMe-, a 5’ UTR, an open reading frame, a 3’ UTR, and a poly (A) tail, and the poly(A) tail comprises 105 adenosine nucleotides. In some embodiments, the mRNA comprises a 5' cap, wherein the 5’ cap comprises 5'7MeGpppG2'OMe~, a 5’ UTR, an open reading ...

Claims

Attorney Docket No. 131986-71 1 1CLAIMSWhat is claimed is:

1. A method of treating urothelial or bladder cancer in a subject, the method comprising: administering to the subject an effective amount of one or both of a neoadjuvant therapy and an adjuvant therapy that comprises administering (i) an immune checkpoint inhibitor, (ii) optionally, enfortumab vedotin, and (iii) an individualized neoantigen therapy, wherein the individualized neoantigen therapy comprises an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes expressed in a tumor in the subject formulated in a lipid delivery vehicle, wherein the neoadjuvant therapy is administered prior to surgical resection of the tumor of the subject and the adjuvant therapy is administered after surgical resection of the tumor.

2. The method of claim 1, wherein the method comprises:(a) identifying a subject with urothelial or bladder cancer that has received a neoadjuvant therapy prior to undergoing surgical resection of the tumor; and(b) administering to the subject an effective amount of the adjuvant therapy after the surgical resection of the tumor, wherein the adjuvant therapy comprises administering an immune checkpoint inhibitor and the individualized neoantigen therapy.

3. The method of claim 1, wherein the method comprises:(a) identifying a subject with the urothelial or bladder cancer that has received a neoadjuvant therapy prior to undergoing surgical resection of the tumor; and(b) administering to the subject an effective amount of the adjuvant therapy after the surgical resection of the tumor, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor, enfortumab vedotin, and the individualized neoantigen therapy.

4. The method of claim 1, wherein the method comprises:(a) administering to the subject the neoadjuvant therapy prior to the surgical resection of the tumor in the subject; and(b) administering to the subject an effective amount of the adjuvant therapy after the surgical resection, wherein the adjuvant therapy comprises administering the individualized neoantigen therapy, the immune checkpoint inhibitor, and, optionally, enfortumab vedotin.Attorney Docket No. 131986-71 1 15. The method of any one of claims 1-4, wherein the urothelial or bladder cancer is a muscle-invasive bladder cancer (MIBC).

6. The method of any one of claims 1-4, wherein the urothelial or bladder cancer is a muscle-invasive urothelial carcinoma (MIUC).

7. The method of any one of claims 1-6, wherein the subject is ineligible to receive cisplatin.

8. The method of any one of claims 1-7, wherein the subject has an Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 2.

9. The method of claim 8, wherein the ECOG score was determined within about 7 days of beginning neoadjuvant therapy or undergoing surgical resection.

10. The method of any one of claims 1-9, wherein the neoadjuvant therapy is administered at three-week intervals, optionally wherein the neoadjuvant therapy is administered for about two to six three-week cycles.

11. The method of any one of claims 1-10, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor and enfortumab vedotin.

12. The method of any one of claims 1-11, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor, enfortumab vedotin, and the individualized neoantigen therapy.

13. The method of any one of claims 1-12, wherein the method further comprises the surgical resection and the surgical resection is performed within about 15 weeks of administering a first dose of the neoadjuvant therapy and within about 6 weeks after administering a last dose of the neoadjuvant therapy.

14. The method of any one of claims 1-13, wherein the surgical resection is an RO resection or an R1 resection.Attorney Docket No. 131986-71 1 115. The method of any one of claims 1-14, wherein the surgical resection is a radical cystectomy (RC) plus pelvic lymph node dissection (PLND).

16. The method of any one of claims 1-15, wherein the subject has not achieved a pathological complete response (pCR) following the surgical resection.

17. The method of any one of claims 1-16, wherein the subject does not have apparent disease in an image taken after the surgical resection.

18. The method of any one of claims 1-17, wherein the immune checkpoint inhibitor is an anti-PD-1 antibody, optionally wherein the anti-PD-1 antibody comprises:(i) light chain complementarity determining regions (CDRs) comprising a sequence of amino acids as set forth in SEQ ID NOs: 43, 44 and 45 and heavy chain CDRs comprising a sequence of amino acids as set forth in SEQ ID NOs: 48, 49 and 50;(ii) a light chain variable region comprising SEQ ID NO: 46 and a heavy chain variable region comprising SEQ ID NO: 51; and / or(iii) a light chain comprising SEQ ID NO: 47 and a heavy chain comprising SEQ ID NO: 52.

19. The method of claim 18, wherein the immune checkpoint inhibitor is pembrolizumab.

20. The method of any one of claims 1-19, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 100-300 mg per administration, optionally intravenously.

21. The method of claim 20, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 200 mg per admini stration, optionally intravenously.

22. The method of any one of claims 1-19, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 280-420 mg per administration, optionally subcutaneously.Attorney Docket No. 131986-71 1 123. The method of claim 22, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 380 mg per administration, optionally subcutaneously.

24. The method of any one of claims 20-23, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor every three weeks.

25. The method of any one of claims 1-19, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 300-500 mg per administration, optionally intravenously.

26. The method of claim 25, wherein the neoadjuvant therapy administering the immune checkpoint inhibitor to the subject at a dose of about 400 nig per administration, optionally intravenously.

27. The method of any one of claims 1-19, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 700- 800 mg per administration, optionally subcutaneously.

28. The method of claim 27, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 790 mg per administration, optionally subcutaneously.

29. The method of any one of claims 25-28, wherein the neoadjuvant therapy comprises administering the immune checkpoint inhibitor every six weeks.

30. The method of any one of claims 1-29, wherein the neoadjuvant therapy comprises administering enfortumab vedotin twice every three weeks.

31. The method of claim 30, wherein the neoadjuvant therapy comprises administering enfortumab vedotin on Day 1 and Day 8 of a three-week cycle.

32. The method of claim 30 or 31, wherein the neoadjuvant therapy comprises administering about 1.25 mg / kg enfortumab vedotin per administration, optionally intravenously.Attorney Docket No. 131986-71 1 133. The method of any one of claims 1-32, wherein the neoadjuvant therapy comprises administering an amount of the individualized neoantigen therapy that administers about 1 mg of the mRNA every three weeks, optionally intramuscularly.

34. The method of any one of claims 1-33, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 100-300 mg per administration, optionally intravenously.

35. The method of claim 34, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 200 mg per administration, optionally intravenously.

36. The method of any one of claims 1-33, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 280-420 mg per administration, optionally subcutaneously.

37. The method of claim 36, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 380 mg per administration, opti on all y sub cutan eousl y .

38. The method of any one of claims 34-37, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor every three weeks.

39. The method of any one of claims 1-33, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 300-500 mg per administration, optionally intravenously.

40. The method of claim 39, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 400 mg per administration optionally intravenously.Attorney Docket No. 131986-71 1 141 . The method of any one of claims 1-33, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 700-800 mg per administration, optionally subcutaneously.

42. The method of claim 41, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor to the subject at a dose of about 790 mg per administration, opti on all y sub cutan eousl y .

43. The method of any one of claims 39-42, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor every six weeks.

44. The method of any one of claims 1-43, wherein the adjuvant therapy comprises administering enfortumab vedotin twice every three weeks.

45. The method of any one of claims 1-44, wherein the adjuvant therapy comprises administering enfortumab vedotin on Day 1 and Day 8 of a three-week cycle.

46. The method of claim 44 or 45, wherein the adjuvant therapy comprises admini stering about 1.25 mg / kg enfortumab vedotin per administration, optionally intravenously.

47. The method of any one of claims 1-46, wherein the adjuvant therapy comprises administering an amount of the individualized neoantigen therapy that administers about 1 nig of the mRNA eveiy three weeks.

48. The method of claim 11 or claim 12, wherein the neoadjuvant therapy comprises(i) administering the immune checkpoint inhibitor eveiy three weeks for up to four three-week cycles, and administering enfortumab vedotin on Days 1 and 8 of every three-week cycle, for up to four three-week cycles; and (ii) administering the individualized neoantigen therapy eveiy three weeks for one to four three-week cycles, optionally beginning on Day 1 of a third three- week cycle of step (i), or beginning on a day selected from Day 1 of a second three-week cycle of step (i) through the day after a last day of a fourth three-week cycle of step (i).Attorney Docket No. 131986-71 1 149. The method of claim 48, wherein the immune checkpoint inhibitor is administered at a dose of about 200 nig per administration, optionally intravenously, or is administered at a dose of about 380 mg per administration, optionally subcutaneously.

50. The method of claim 11 or 12, wherein the neoadjuvant therapy comprises(i) administering the immune checkpoint inhibitor every six weeks for up to two six-week cycles, and enfortumab vedotin on Days 1 and 8 of a three-week cycle for up to four three-week cycles; and (ii) administering the individualized neoantigen therapy every three weeks for one to four three-week cycles, optionally beginning on Day 1 of a third three-week cycle of step (i), or beginning on a day selected from Day 1 of a second three-week cycle of step (i) through the day after a last day of a fourth three-week cycle of step (i).

51. The method of claim 50, wherein the immune checkpoint inhibitor is administered at a dose of about 400 mg per administration, optionally intravenously, or is administered at a dose of about 790 mg per administration, optionally subcutaneously.

52. The method of any one of claims 39-51, wherein enfortumab veodtin is administered at a dose of about 1 .25 mg / kg per admini stration, optionally intravenously.

53. The method of any one of claims 39-52, wherein the individualized neoantigen therapy is administered at an amount of the individualized neoantigen therapy that administers about 1 mg mRNA per administration, optionally intramuscularly.

54. The method of any one of claims 1-53, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor for about 5-15 cycles, optionally for about 9 cycles, further optionally for about 13 cycles, further optionally for about 13 cycles when the subject is not administered an immune checkpoint inhibitor in a neoadjuvant therapy.

55. The method of any one of claims 1-53, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor for about 10-20 cycles, optionally wherein the subject is not administered an immune checkpoint inhibitor in a neoadjuvant therapy.

56. The method of any one of claims 1-55, wherein the adjuvant therapy comprises administering the individualized neoantigen therapy to the subject every three weeks.Attorney Docket No. 131986-71 1 157. The method of any one of claims 1-56, wherein a total of about 5-15 doses of the individualized neoantigen therapy are administered to the subject, optionally wherein a total of about 9 doses of the individualized neoantigen therapy are administered to the subject.

58. The method of claim 6, wherein the method comprises:(a) identifying a subject with MIUC that has undergone radical cystectomy; and(b) administering to the subject an effective amount of the adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab on Day 1 of a six-week cycle and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks starting on Day 22 of the six-week cycle.

59. The method of claim 6, wherein the method comprises:(a) identifying a subject with MIUC that has undergone radical cystectomy; and(b) administering to the subject an effective amount of the adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises subcutaneously administering 790 mg of pembrolizumab on Day 1 of a six-week cycle and intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks starting on Day 22 of the six-week cycle.

60. The method of claim 6, wherein the method comprises:(a) identifying a subject with MIUC that has undergone radical cystectomy; and(b) administering to the subject an effective amount of the adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab on Day 1 of a three-week cycle and intramuscularly administering the individualized neoantigen vaccine in an amount that administers 1 mg of the mRNA every three weeks starting on Day 1 of the three-week cycle.

61. The method of claim 6, wherein the method comprises:(a) identifying a subject with MIUC that has undergone radical cystectomy; and(b) administering to the subject an effective amount of the adjuvant therapy after the radical cystectomy, wherein the adjuvant therapy comprises subcutaneously administering 380 mg of pembrolizumab on Day I of a three-week cycle and intramuscularly administering theAttorney Docket No. 131986-71 1 1 individualized neoantigen vaccine in an amount that administers 1 mg of the mRN / X every three weeks starting on Day 1 of the three-week cycle.

62. The method of any one of claims 58-61, wherein the pembrolizumab is administered for up to 9 cycles.

63. The method of any one of claims 58-62, wherein the individualized neoantigen therapy is administered for up to 9 cycles.

64. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising intravenously administering 200 mg of pembrolizumab every three weeks for up to four three-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to four cycles;(b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for 1-4 cycles, optionally beginning on Day 1 of a third three-week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through the day after a last day of a fourth three-week cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 200 mg of pembrolizumab every three weeks for up to 13 three-week cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

65. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 380 mg of pembrolizumab every three weeks for up to four three-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles;Attorney Docket No. 131986-71 1 1(b) prior to (c), administering to the subject a neoadjuvant therapy comprising intramuscularly administering an individualized neoantigen therapy in an amount that administers 1 nig of the mRN / X every three weeks for one to four cycles, optionally beginning on Day 1 of a third three- week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through the day after a last day of a fourth three-week cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of an adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 380 mg of pembrolizumab every three weeks for up to 13 three-week cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for up to a total of 9 cycles in step(b) and step (d) combined.

66. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising intravenously administering 400 mg of pembrolizumab every six weeks for up to two six-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles;(b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for one to four cycles, optionally beginning on Day 1 of a third three- week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through the day after a last day of a fourth three-week cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of the adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab every six weeks for up to 7 six-week cycles, intravenously administering 1 .25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.Attorney Docket No. 131986-71 1 167. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 790 mg of pembrolizumab every six weeks for up to two six-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles;(b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for one to four cycles, optionally beginning on Day 1 of a third three- week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through the day after a last day of a fourth three-week cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of the adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 790 mg of pembrolizumab every six weeks for up to 7 six-week cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

68. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising intravenously administering 400 mg of pembrolizumab every six weeks for up to two six-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles;(b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA evety three weeks for one to four cycles, optionally beginning on Day 1 of a third three- week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through the day after a last day of a fourth three-week cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of the adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 200Attorney Docket No. 131986-71 1 1 mg of pembrolizumab every three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the niRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

69. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 790 mg of pembrolizumab every six weeks for up to two six-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 4 cycles;(b) prior to (c), administering to the subject the neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for one to four cycles, optionally beginning on Day 1 of a third three- week cycle of step (a), or beginning on a day selected from Day 1 of a second three-week cycle of step (a) through the day after a last day of a fourth three-week cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of the adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 380 mg of pembrolizumab every three weeks for up to 13 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 nig of the mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

70. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising intravenously administering 200 mg of pembrolizumab every three weeks for up to four three-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles;(b) prior to (c), administering to the subject the neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for one to four cycles, optionally beginning on Day 1 of a third cycleAttorney Docket No. 131986-71 1 1 of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through the day after a last day of a fourth cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of the adjuvant therapy, wherein the adjuvant therapy comprises intravenously administering 400 mg of pembrolizumab every six weeks for up to 7 cycles, intravenously administering 1 .25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.

71. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising subcutaneously administering 380 mg of pembrolizumab every three weeks for up to four three-week cycles and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of every three-week cycle for up to 4 cycles;(b) prior to (c), administering to the subject neoadjuvant therapy comprising intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for one to four cycles, optionally beginning on Day 1 of a third cycle of step (a), or beginning on a day selected from Day 1 of a second cycle of step (a) through the day after a last day of a fourth cycle of step (a);(c) within about 6 weeks of the last dose of the neoadjuvant therapy, administering to the subject radical cystectomy (RC) plus pelvic lymph node dissection (PLND) surgery'; and(d) within about 8 weeks of RC plus PLND, administering to the subject an effective amount of the adjuvant therapy, wherein the adjuvant therapy comprises subcutaneously administering 790 mg of pembrolizumab every six weeks for up to 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for up to 5 cycles, and intramuscularly administering the individualized neoantigen therapy in an amount that administers 1 mg of mRNA every three weeks for up to a total of 9 cycles in step (b) and step (d) combined.Attorney Docket No. 131986-71 1 172. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising intravenously administering about 200 mg of pembrolizumab every three weeks for at least two cycles or about 400 mg of pembrolizumab every six weeks for at least one cycle, and intravenously administering 1.25 mg / kg of enfortumab v edotin on Day 1 and Day 8 of a three-week cycle for at least two cycles;(b) administering to the subject neoadjuvant therapy comprising intravenously administering about 200 mg of pembrolizumab every three weeks for at least two cycles or about 400 mg of pembrolizumab every six weeks for at least one cycle, intravenously administering1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for at least one cycle prior to surgical resection of the tumor in the subject; and(c) administering to the subject an effective amount of the adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises intravenously administering about 200 mg pembrolizumab every three weeks for at least 13 cycles or about 400 mg of pembrolizumab every six weeks for at least 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for at least five cycles, wherein the lipid delivery vehicle of the individualized neoantigen therapy comprises a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG- modified lipid.

73. The method of claim 5, wherein the method comprises:(a) administering to the subject neoadjuvant therapy comprising subcutaneously administering about 380 mg of pembrolizumab every three weeks for at least two cycles or about 790 mg of pembrolizumab every six weeks for at least one cycle, and intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles;(b) administering to the subject neoadjuvant therapy comprising subcutaneously administering about 380 mg of pembrolizumab every three weeks for at least two cycles or about 790 mg of pembrolizumab every' six weeks for at least one cycle, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least twoAttorney Docket No. 131986-71 1 1 cycles, and administering the individualized neoantigen therapy in an amount that administers 1 nig of the mRNA every' three weeks for at least one cycle prior to surgical resection of the tumor in the subject; and(c) administering to the subject an effective amount of the adjuvant therapy after the surgical resection of the tumor in the subject, wherein the adjuvant therapy comprises subcutaneously administering about 380 mg pembrolizumab every three weeks for at least 13 cycles or about 790 mg of pembrolizumab every six weeks for at least 7 cycles, intravenously administering 1.25 mg / kg of enfortumab vedotin on Day 1 and Day 8 of a three-week cycle for at least two cycles, and administering the individualized neoantigen therapy in an amount that administers 1 mg of the mRNA every three weeks for at least five cycles, wherein the lipid delivery vehicle of the individualized neoantigen therapy comprises a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG- modified lipid.

74. The method of any one of claims 1-9, wherein the method comprises administering to the subject an effective amount of the adjuvant therapy after the surgical resection of the tumor, wherein the adjuvant therapy comprises administering the immune checkpoint inhibitor and administering the individualized neoantigen therapy.

75. The method of claim 74, wherein administering the immune checkpoint inhibitor of the adjuvant therapy comprises administering about 400 mg of the immune checkpoint inhibitor every' six weeks, optionally intravenously.

76. The method of claim 74, wherein administering the immune checkpoint inhibitor of the adjuvant therapy comprises administering about 790 mg of the immune checkpoint inhibitor every six weeks, optionally subcutaneously.

77. The method of claim 74, wherein administering the immune checkpoint inhibitor of the adjuvant therapy comprises administering about 200 mg of the immune checkpoint inhibitor every three weeks, optionally intravenously.

78. The method of claim 74, wherein administering the immune checkpoint inhibitor of the adjuvant therapy comprises administering about 380 mg of the immune checkpoint inhibitor every three weeks, optionally subcutaneously.Attorney Docket No. 131986-71 1 179. The method of any one of claims 74-78, wherein administering the individualized neoantigen therapy comprises administering an amount of the individualized neoantigen therapy that administers about 1 mg of the mRNA every three weeks.

80. The method of any one of claims 1-79, wherein the individualized neoantigen therapy, enfortumab vedotin, and / or the immune checkpoint inhibitor of the adjuvant therapy and / or neoadjuvant therapy are each administered separately and are each independently administered via an intradermal, intramuscular, intravascular, intratumoral, and / or subcutaneous route.

81. The method of claim 80, wherein: the individualized neoantigen therapy is administered intramuscularly, the immune checkpoint inhibitor is administered intravenously, and the enfortumab vedotin is administered intravenously; or the individualized neoantigen therapy is administered intramuscularly, the immune checkpoint inhibitor is administered subcutaneously, and the enfortumab vedotin is administered intravenously; the individualized neoantigen therapy is administered intramuscularly, the immune checkpoint inhibitor is administered subcutaneously or intravenously, and the enfortumab vedotin is administered intravenously.

82. The method of any one of claims 1-80 comprising administration of pembrolizumab, wherein the pembrolizumab is formulated as a liquid medicament that comprises about 7% (w / v) sucrose, about 0.02% (w / v) polysorbate 80, about 10 mM histidine buffer, optionally at a pH of about 5.5.

83. The method of any one of claims 1-80 comprising intravenous administration of pembrolizumab, wherein the pembrolizumab is formulated as a liquid medicament that comprises about 25 mg / ml pembrolizumab, about 7% (w / v) sucrose, about 0.02% (w / v) polysorbate 80, about 10 mM histidine buffer, optionally at a pH of about 5.5, optionally wherein the pembrolizumab is formulated as a liquid medicament that comprises 25 mg / ml pembrolizumab, 7% (w / v) sucrose, 0.02% (w / v) polysorbate 80, 10 mM histidine buffer, at pH 5.5.Attorney Docket No. 131986-71 1 184. The method of any one of claims 1-80 comprising subcutaneous administration of pembrolizumab, wherein the pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5, optionally wherein the pembrolizumab is formulated as a liquid medicament that comprises about 125 to about 175 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 7% (w / v) sucrose, and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5.

85. The method of any one of claims 1-80 or 84 comprising subcutaneous administration of pembrolizumab, wherein the method comprises co-administering the pembrolizumab with a human hyaluronidase.

86. The method of claim 85, wherein the pembrolizumab and human hyaluronidase are formulated in the same composition, further optionally wherein the composition is formulated as a liquid medicament that comprises about 125 to about 200 mg / mL of pembrolizumab, about 10 mM histidine buffer, about 10 mM L-methionine or a pharmaceutically acceptable salt thereof, about 2000 U / ml of a human hyaluronidase, about 7% (w / v) sucrose; and about 0.02 % (w / v) polysorbate 80, optionally at a pH of about 5.5.

87. The method of claim 85 or claim 86, wherein the human hyaluronidase is selected from rHuPH20 and berahyaluronidase alfa, optionally wherein the human hyaluronidase is berahyaluronidase alfa.

88. The method of claim 85 or claim 86, wherein one or both of the neoadjuvant therapy and the adjuvant therapy comprises subcutaneously administering pembrolizumab at a dose of 395 mg every three weeks with 4800 Units of berahyaluronidase alfa .

89. The method of claim 85 or claim 86, wherein one or both of the neoadjuvant therapy and the adjuvant therapy comprises subcutaneously administering pembrolizumab at a dose of 790 mg every six weeks with 9600 Units of berahyaluronidase alfa.Attorney Docket No. 131986-71 1 190. The method of any one of claims 1-89, wherein the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting ofN1 -methylpseudouridine, adenosine, guanosine, and cytidine.91 . The method of any one of claims 1-90, wherein, in the individualized neoantigen therapy comprising an mRNA polynucleotide comprising an open reading frame encoding at least two neoepitopes:(a) at least one of the neoepitopes are MHC class I epitopes;(b) at least 10% of the n eoepitopes are MHC class I epi topes;(c) at least 50% of the neoepitopes are MHC class I epitopes;(d) at least 70% of the neoepitopes are MHC class I epitopes;(e) at least one of the neoepitopes are MHC class II epitope;(f) at least 30% of the neoepitopes are MHC class II epitopes;(g) each of the neoepitopes is 20-50 amino acids in length;(h) each of the neoepitopes comprises 25-35 amino acids,(i) the neoepitopes are T cell epitopes;(j) each of the neoepitopes comprises an antigenic region and an MHC stabilizing region;(k) two or more of the neoepitopes are connected di rectly to one another;(l) two or more of the neoepitopes are connected to one another through a linker that is not a cleavage sensitive site;(m) each of the neoepitopes includes a centrally located mutation encoded by a single nucleotide polymorphism (SNP);(n) the mRNA polynucleotide comprises at least 30 neoepitopes; and / or(o) the open reading frame of the mRNA polynucleotide comprises nucleosides selected from the group consisting of Nl-methylpseudouridine, adenosine, guanosine, and cytidine.

92. The method of any one of claims 1-91 , wherein the lipid delivery vehicle comprises a lipid nanoparticle, a liposome, or a lipoplex.

93. The method of any one of claims 1-92, wherein the lipid delivery vehicle comprises a lipid nanoparticle comprising an ionizable amino lipid, a neutral lipid, a sterol, and a PEG- modified lipid.Attorney Docket No. 131986-71 1 194. The method of claim 93, wherein the ionizable amino lipid comprises a compound of Formula (I):whereinRi is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, and -R"M'R';R2 and R3 are independently selected from the group consisting of Cj-14 alkyl and C2-14 alkenyl;R4 is -(CH2)nQ, wherein Q is -OR, and 11 is selected from 1, 2, 3, 4, and 5; each Rs is H; each Re is H;M and M!are independently selected from -C(O)O- and -OC(O)-;R7 is H;R is H;R' is selected from the group consisting of C1-is alkyl and C2-18 alkenyl;R" is selected from the group consisting of C3-14 alkyl and C3-14 alkenyl; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

95. The method of claim 94, wherein the compound of Formula (I) comprises Compound (1-25):(Compound 1-25).

96. The method of any one of claims 93-95, wherein the neutral lipid comprises 1,2- distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol comprises cholesterol, and the PEG- modified lipid comprises 1,2-dimyristoyl-sn-glycerol methoxypoly ethylene glycol (PEG-DMG).

97. The method of any one of claims 93-96, wherein the lipid nanoparticle comprises 20-60 mol% ionizable cationic lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid; optionally wherein the lipid nanoparticle comprises about 45-55 mol% ionizable cationic lipid, about 5-15 mol% non-cationic lipid, about 35-40 mol% sterol, andAttorney Docket No. 131986-71 1 1 about 1-2 mol% PEG-modified lipid; further optionally wherein the lipid nanoparticle comprises about 50 mol% ionizable cationic lipid, about 10 mol% non-cationic lipid, about 38.5 niol% sterol, and about 1.5 mol% PEG-modified lipid.