Bivalent chimeric receptors or chimeric receptor systems and methods of use thereof

A dual-targeting CAR with specific antigen-binding domains for CEACAM5, CEA, CEACAM1, or CEACAM6, and TROP2, addresses the challenge of targeting solid tumors without harming normal cells, improving the efficacy of NK cell-based therapies.

WO2026085275A1PCT designated stage Publication Date: 2026-04-23SENTI BIOSCI INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/051157
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-16
Filing Date
2025-10-15
Publication Date
2026-04-23

AI Technical Summary

Technical Problem

The challenge in developing CAR therapies for solid tumors is the lack of suitable targets that can effectively target tumor cells without damaging normal cells that express the same antigen, necessitating the need for CAR-NK cell-based therapies that can selectively eliminate cancer cells while sparing normal tissues.

Method used

A chimeric antigen receptor (CAR) is designed with dual antigen-binding domains targeting CEACAM5, CEA, CEACAM1, or CEACAM6, and TROP2, along with intracellular signaling domains and a transmembrane domain, optionally incorporating a spacer and an inhibitory chimeric receptor, to enhance specificity and efficacy in treating solid tumors.

Benefits of technology

The dual-targeting CAR enhances the specificity and efficacy of NK cells in recognizing and eliminating solid tumor cells, reducing off-target effects on normal cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025051157_23042026_PF_FP_ABST
    Figure US2025051157_23042026_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are solid tumor antigen targets for chimeric receptors and chimeric inhibitory receptors. The chimeric antigen receptors (CARs) described herein include a first antigen-binding domain that binds a first antigen; a second extracellular antigen-binding domain; a transmembrane domain; and one or more intracellular signaling domains. The disclosure also provides methods of using the same, such as for the treatment of cancer.
Need to check novelty before this filing date? Find Prior Art

Description

BIVALENT CHIMERIC RECEPTORS OR CHIMERIC RECEPTOR SYSTEMS AND METHODS OF USE THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 708,171, filed October 16, 2024. The disclosure of the prior application is considered part of and is herein incorporated by reference in the disclosure of this application in its entirety.INCORPORATION OF SEQUENCE LISTING

[0002] The material in the accompanying sequence listing is hereby incorporated by reference into this application. The accompanying sequence listing xml file, name SENTI1440- 2W0.xml, was created on October 08, 2025, and is 2,283,208 bytes.BACKGROUND OF THE INVENTIONFIELD OF THE INVENTION

[0003] The present application relates generally to chimeric antigen receptors (CARs) and more specifically to solid tumor antigen targets for chimeric receptors and chimeric inhibitory receptors, and methods of using the same, such as for the treatment of cancer.BACKGROUND INFORMATION

[0004] Immunotherapies, such as chimeric antigen receptor (CAR) based adoptive cell therapies used to redirect the specificity and function of immunoresponsive cells (e.g. , T cells and Natural Killer (NK) cells) have shown efficacy in patients with malignancies, with many prior studies focused on hematological malignancies (Pule et al., Nat. Med. (14): 1264-1270 (2008); Maude et al., N Engl J Med. (371 ): 1507- 17 (2014); Brentjens et al., Sei Tr ansi Med. (5):177ra38 (2013)). For example, CAR T cells have been shown to induce complete remission in patients with CD19-expressing malignancies for whom chemotherapies have led to drug resistance and tumor progression.

[0005] Unlike T cells, natural killer (NK) cells are able to eliminate abnormal cells, such as cancer cells, without priming. NK cell activity is determined by a balance of external signals from inhibitory and activating NK cell receptors. Inhibitory receptors, such as killer immunoglobulin receptors (KIRs), interact with the major histocompatibility complex (MHC) class I antigens and protect normal cells from NK cell activity (see US20180057795A1).

[0006] One challenge to developing CAR therapy for solid tumors is a lack of suitable targets. The ability to identify appropriate CAR targets is important for effectively targeting andtreating the tumor without damaging normal cells that express the same target antigen. Thus, there remains a need for CAR-NK cell-based tumor therapies that target tumor cells without targeting normal cells or tissues.SUMMARY OF THE DISCLOSURE

[0007] Disclosed herein, in various embodiments, is a chimeric antigen receptor (CAR) comprising: (i) a first antigen-binding domain that binds a first antigen selected from the group consisting of CEACAM5, CEA, CEACAM1, and CEACAM6; (ii) a second extracellular antigen-binding domain that binds TROP2; (iii) a transmembrane domain; and (iv) one or more intracellular signaling domains. In some embodiments, the CAR comprises a spacer between the first and second antigen-binding domains and the transmembrane domain. In some embodiments, the spacer comprises an amino acid sequence selected from the amino acid sequences disclosed in Table 8. In some embodiments, the spacer comprises the amino acid sequence of the CD8 hinge disclosed in Table 8. In some embodiments, the one or more intracellular signaling domains are selected from: a CD28 intracellular signaling domain; a CD3zeta-chain intracellular signaling domain, a CD3 epsilon-chain intracellular signaling domain, a CD97 intracellular signaling domain, a CD1 la-CD18 intracellular signaling domain, a CD2 intracellular signaling domain, an ICOS intracellular signaling domain, a CD27 intracellular signaling domain, a CD 154 intracellular signaling domain, a CD8 intracellular signaling domain, an 0X40 intracellular signaling domain, a 4- IBB intracellular signaling domain, a ZAP40 intracellular signaling domain, a CD30 intracellular signaling domain, a GITR intracellular signaling domain, an HVEM intracellular signaling domain, a DAP 10 intracellular signaling domain, a DAP12 intracellular signaling domain, a MyD88 intracellular signaling domain, a 2B4 intracellular signaling domain, an NKp46 intracellular signaling domain, an NKp30 intracellular signaling domain, an NKp44 intracellular signaling domain, an NKG2D intracellular signaling domain, a CD226 intracellular signaling domain, and a CD 160 intracellular signaling domain. In some embodiments, the CAR comprises a CD28 intracellular signaling domain and a CD3zeta-chain intracellular signaling domain. In some embodiments, the transmembrane domain is selected from the group consisting of: a CD8 transmembrane domain, a CD28 transmembrane domain, a CD25 transmembrane domain, a CD7 transmembrane domain, a CD3zeta-chain transmembrane domain, a CD4 transmembrane domain, a 4- IBB transmembrane domain, an 0X40 transmembrane domain, an ICOS transmembrane domain, a CTLA-4 transmembrane domain, a LAX transmembrane domain, a LAT transmembrane domain, a PD-1 transmembrane domain, a LAG-3 transmembrane domain, a TIM3 transmembrane domain, a KIR3DS1 transmembrane domain, a KIR3DL1 transmembrane domain, an NKG2D transmembrane domain, an NKG2 A transmembranedomain, a TIGIT transmembrane domain, a 2B4 transmembrane domain, and a BTLA transmembrane domain. In some embodiments, the CAR comprises a CD28 transmembrane domain. In some embodiments, the first and second antigen binding sites each comprise a heavy chain variable domain (VH) and a light chain variable domain (VL) and are configured in a polypeptide chain having a structure selected from the group consisting of: (i) VH2-VL1-VH1- VL2; (ii) VL1-VH1-VL2-VH2; (iii) VL1-VH1-VH2-VL2; (iv) VL2-VH2-VL1-VH1; (v) VL2-VH2- VH1-VL1; (vi) VL1-VL2-VH2-VH1; (vii) VL1-VH2-VL2-VH1; and (viii) VL2-VL1-VH1-VH2; wherein VH1is the VH of the first antigen binding domain, VL1is the VL of the first antigen binding domain, VH2is the VH of the second antigen-binding domain, and VL2is the VL of the second antigen binding site, and wherein each VH or VL is joined to the adjacent VH or VL by a linker. In some embodiments, the linker comprises the amino acid sequence of GGGGSGGGGS (SEQ ID NO: 102).

[0008] Also disclosed herein, in various embodiments, is a nucleic acid sequence encoding the CAR disclosed herein.

[0009] Also disclosed herein, in various embodiments, is an engineered expression system comprising the nucleic acid sequence disclosed herein.

[0010] Also disclosed herein, in various embodiments, is an engineered expression system comprising: (i) a first nucleic acid sequence encoding a first CAR, wherein the first CAR comprises: (a) a first extracellular antigen-binding domain that binds an antigen selected from the group consisting of CEACAM5, CEA, CEACAM1, and CEACAM6; (b) a first transmembrane domain; and (c) one or more intracellular signaling domains; and (ii) a second nucleic acid sequence encoding a second CAR, wherein the second CAR comprises: (a) a second extracellular antigen-binding domain that binds TROP2; (b) a second transmembrane domain; and (c) one or more intracellular signaling domains.

[0011] In some embodiments, the first CAR comprises a first spacer between the first extracellular antigen-binding domain and the first transmembrane domain. In some embodiments, the first spacer comprises an amino acid sequence selected from the amino acid sequences disclosed in Table 8. In some embodiments, the first spacer comprises the amino acid sequence of the CD8 hinge disclosed in Table 8.

[0012] In some embodiments, the second CAR comprises a second spacer between the second extracellular antigen-binding domain and the second transmembrane domain. In some embodiments, the second spacer comprises an amino acid sequence selected from the amino acid sequences disclosed in Table 8. In some embodiments, the second spacer comprises the amino acid sequence of the CD8 hinge disclosed in Table 8. In some embodiments, the one or more intracellular signaling domains of the first CAR and / or the second CAR are independentlyselected from the group consisting of: a CD3zeta-chain intracellular signaling domain, a CD3 epsilon-chain intracellular signaling domain, a CD97 intracellular signaling domain, a CD1 la-CD18 intracellular signaling domain, a CD2 intracellular signaling domain, an ICOS intracellular signaling domain, a CD27 intracellular signaling domain, a CD 154 intracellular signaling domain, a CD8 intracellular signaling domain, an 0X40 intracellular signaling domain, a 4- IBB intracellular signaling domain, a CD28 intracellular signaling domain, a ZAP40 intracellular signaling domain, a CD30 intracellular signaling domain, a GITR intracellular signaling domain, an HVEM intracellular signaling domain, a DAP 10 intracellular signaling domain, a DAP12 intracellular signaling domain, a MyD88 intracellular signaling domain, a 2B4 intracellular signaling domain, an NKp46 intracellular signaling domain, an NKp30 intracellular signaling domain, an NKp44 intracellular signaling domain, an NKG2D intracellular signaling domain, a CD226 intracellular signaling domain, and a CD 160 intracellular signaling domain. In some embodiments, the first and second CARs each comprise a CD28 intracellular signaling domain and a CD3zeta-chain intracellular signaling domain. In some embodiments, the first transmembrane domain and second transmembrane domain are independently selected from the group consisting of: a CD8 transmembrane domain, a CD28 transmembrane domain, a CD25 transmembrane domain, a CD7 transmembrane domain, a CD3zeta-chain transmembrane domain, a CD4 transmembrane domain, a 4-1BB transmembrane domain, an 0X40 transmembrane domain, an ICOS transmembrane domain, a CTLA-4 transmembrane domain, a LAX transmembrane domain, a LAT transmembrane domain, a PD-1 transmembrane domain, a LAG-3 transmembrane domain, a TIM3 transmembrane domain, a KIR3DS1 transmembrane domain, a KIR3DLl transmembrane domain, an NKG2D transmembrane domain, an NKG2A transmembrane domain, a TIGIT transmembrane domain, a 2B4 transmembrane domain, and a BTLA transmembrane domain. In some embodiments, the first and second CARs each comprise a CD28 transmembrane domain.

[0013] In some embodiments, the engineered expression system further comprises a third nucleic acid sequence encoding an inhibitory chimeric receptor, wherein the inhibitory chimeric receptor comprises: (i) an antigen-binding domain that binds to a third antigen selected from the group consisting of: VSIG2, CPM, ITM2C, SLC26A2, SLC4A4, GPA33, PLA2G2A, ABCA8, ATP1A2, CHP2, and SLC26A3; (ii) a transmembrane domain; and (iii) one or more intracellular inhibitory domains. In some embodiments, the first and second nucleic acid sequences are comprised within a single expression vector. In some embodiments, the first nucleic acid sequence is comprised within a first expression vector and the second nucleic acid sequence is comprised within a second expression vector

[0014] In some embodiments, the first antigen-binding domain comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VH disclosed in Table 2; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VL disclosed in Table 2.

[0015] In some embodiments, the first antigen-binding domain binds CEACAM5. In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an hMN14 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an hMN14 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

[0016] In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMN14 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMN14 VL. In some embodiments, the VH comprises the amino acid sequence of an hMN14 VH, and the VL comprises the amino acid sequence of an hMN14 VL.

[0017] In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a BW431 / 26 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a BW431 / 26 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a BW431 / 26 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a BW431 / 26 VL. Insome embodiments, the VH comprises the amino acid sequence of a BW431 / 26 VH, and the VL comprises the amino acid sequence of a BW431 / 26 VL. In some embodiments, the first antigenbinding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an A5B7 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an A5B7 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an A5B7 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an A5B7 VL. In some embodiments, the VH comprises the amino acid sequence of an A5B7 VH, and the VL comprises the amino acid sequence of an A5B7 VL.

[0018] In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an MFE23 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an MFE23 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MFE23 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MFE23 VL. In some embodiments, the VH comprises the amino acid sequence of an MFE23 VH, and the VL comprises the amino acid sequence of an MFE23 VH.

[0019] In some embodiments, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an hMFE23 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an hMFE23 VL, and wherein the antibody orantigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMFE23 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMFE23 VL. In some embodiments, the VH comprises the amino acid sequence of an hMFE23 VH, and the VL comprises the amino acid sequence of an hMFE23 VL.

[0020] In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an FM4 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an FM4 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an FM4 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an FM4 VL. In some embodiments, the VH comprises the amino acid sequence of an FM4 VH, and the VL comprises the amino acid sequence of an FM4 VL.

[0021] In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a cibisatamab heavy chain (HC); wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a cibisatamab light chain (LC), and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VH of a cibisatamab HC, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VL a cibisatamab LC. In some embodiments, the VH comprises the amino acidsequence of the VH of a cibisatamab HC and the VL comprises the amino acid sequence of the VL of a cibisatamab LC.

[0022] In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a tusamitamab heavy chain (HC); wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a tusamitamab light chain (LC), and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VH of a tusamitamab HC, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VL of a tusamitamab LC. In some embodiments, the VH comprises the amino acid sequence of the VH of a tusamitamab HC, and the VL comprises the amino acid sequence of the VL of a tusamitamab LC.

[0023] In some embodiments, the first antigen-binding domain binds CECAM1. In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an MRG1 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an MRG1 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MRG1 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MRG1 VL. In some embodiments, the VH comprises the amino acid sequence of an MRG1 VH, and the VL comprises the amino acid sequence of of an MRG1 VL.

[0024] In some embodiments, the first antigen-binding domain binds CEACAM6. In some embodiments, the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarityregion 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a tinurilimab heavy chain (HC); wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a tinurilimab light chain (LC), and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VH of a tinurilimab HC, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VL of a tinurilimab LC. In some embodiments, the VH comprises the amino acid sequence of the VH of a tinurilimab HC and the VL comprises the amino acid sequence of the VL of a tinurilimab LC.

[0025] In some embodiments, the second antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an RS7 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an RS7 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an RS7 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an RS7 VL. In some embodiments, the VH comprises the amino acid sequence of an RS7 VH, and the VL comprises the amino acid sequence of an RS 7 VL.

[0026] In some embodiments, the second antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an AR52 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an AR52 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acidsequence of an AR52 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an AR52 VL. In some embodiments, the VH comprises the amino acid sequence of an AR52 VH, and the VL comprises the amino acid sequence of an AR52 VL.

[0027] In some embodiments, the second antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3)of a KM4097 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a KM4097 VL, and wherein the antibody or antigen binding fragment thereof is humanized. In some embodiments, the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a KM4097 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a KM4097 VL. In some embodiments, the VH comprises the amino acid sequence of a KM4097 VH, and the VL comprises the amino acid sequence of a KM4097 VL.

[0028] In some embodiments, the second antigen-binding domain comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VH disclosed in Table 3; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VL disclosed in Table 3.

[0029] Also disclosed herein, in various embodiments, is an isolated cell comprising: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; or (iii) the engineered expression system disclosed herein. In some embodiments, the isolated cell further comprises an inhibitory chimeric receptor, wherein the inhibitory chimeric receptor comprises (i) an antigenbinding domain that binds to a third antigen selected from the group consisting of: VSIG2, CPM, ITM2C, SLC26A2, SLC4A4, GPA33, PLA2G2A, ABCA8, ATP1A2, CHP2, and SLC26A3; (ii) a transmembrane domain; and (iii) one or more intracellular inhibitory domains.

[0030] In some embodiments, the third antigen is VSIG2. In some embodiments, the antigen binding domain that binds to VSIG2 comprises a VH comprising an amino acidsequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VH disclosed in Table 12; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VL disclosed in Table 12.

[0031] In some embodiments, the antigen binding domain that binds to VSIG2 comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VH variant 19; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VL (with parental LCDRs). In some embodiments, the antigen binding domain that binds to VSIG2 comprises a VH comprising the amino acid sequence of Humanized anti-VSIG2 VH variant 19; and a VL comprising the amino acid of Humanized anti-VSIG2 VL (with parental LCDRs). In some embodiments, the antigen binding domain that binds to VSIG2 comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VH variant 21; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VL (with parental LCDRs). In some embodiments, the antigen binding domain that binds to VSIG2 comprises a VH comprising the amino acid sequence of Humanized anti-VSIG2 VH variant 21; and a VL comprising the amino acid sequence of Humanized anti-VSIG2 VL (with parental LCDRs).

[0032] In some embodiments, the antigen binding domain that binds to VSIG2 comprises an scFv comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of an scFv disclosed in Table 13. In some embodiments, the antigen binding domain that binds to VSIG2 comprises an scFv comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 5. In some embodiments, the antigen binding domain that binds to VSIG2 comprises an scFv the amino acid sequence of anti-VSIG2 scFv 5.

[0033] In some embodiments, the antigen binding domain that binds to VSIG2 comprises an scFv comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 7. In some embodiments, the antigen binding domain that binds to VSIG2 comprises an scFv the amino acid sequence of anti-VSIG2 scFv 7.

[0034] In some embodiments, the engineered expression system further comprises: (i) a fourth nucleotide sequence encoding a first cytokine; and (ii) a fifth nucleotide sequence encoding a second cytokine. In some embodiments, at least one of the first and the second cytokines is a calibrated release cytokine. In some embodiments, the calibrated release cytokine has the formula: S - C - MT or MT - C - S, wherein S comprises a secretable effector molecule; C comprises a protease cleavage site; and MT comprises a cell membrane tethering domain. In some embodiments, the protease cleavage site is cleaved by ADAM 10 and / or ADAM17, optionally wherein the protease cleavage site comprises the amino acid sequence of PRAEALKGG (SEQ ID NO: 302) or VTPEPIFSLI (SEQ ID NO: 301). In some embodiments, the cell membrane tethering domain comprises a transmembrane domain selected from the group consisting of: PDGFR-beta, CD8, CD28, CD3zeta-chain, CD4, 4-1BB, 0X40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, LNGFR, NKG2D, EpoR, TNFR2, LIR1, B7-1, and BTLA. In some embodiments, the cell membrane tethering domain comprises a B7-1 transmembrane domain comprising the B7-1 transmembrane domain amino acid sequence set forth in Table 19.

[0035] In some embodiments, the first cytokine is IL 15. In some embodiments, the IL 15 comprises the amino acid sequence of IL 15 set forth in Table 15. In some embodiments, the IL15 is calibrated-release IL15 (crIL15). In some embodiments, the second cytokine is IL21. In some embodiments, the IL21 comprises the amino acid sequence set forth in Table 15. In some embodiments, the IL21 is calibrated-release IL21 (crIL21).

[0036] In some embodiments, the first or second cytokine comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence set forth in Table 15. In some embodiments, the first or second cytokine is encoded by a nucleic acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence set forth in Table 15.

[0037] In some embodiments, the transmembrane domain is selected from: a SIRPα transmembrane domain, a PD-1 transmembrane domain, a CTLA4 transmembrane domain, a TIGIT transmembrane domain, a BTLA transmembrane domain, a LIR1 (LILRB1)transmembrane domain, a TIM3 transmembrane domain, a KIR3DL1 transmembrane domain, a NKG2A transmembrane domain, a LAG3 transmembrane domain, a LAIR1 transmembrane domain, a KIR2DL1 transmembrane domain, a KIR2DL2 transmembrane domain, a KIR2DL3 transmembrane domain, a KIR3DL2 transmembrane domain, a KLRG-1 transmembrane domain, a CEACAM1 transmembrane domain, a LIR2 transmembrane domain, a LIR3 transmembrane domain, a LIR5 transmembrane domain, a SIGLEC-2 transmembrane domain, a SIGLEC-10 transmembrane domain, a PEC AM- 1 transmembrane domain, a CD72 transmembrane domain, a IRTA2 transmembrane domain, a IRTA4 transmembrane domain, a NKIR transmembrane domain, a TLT1 transmembrane domain, a PCDHGC3 transmembrane domain, a MPZL1 transmembrane domain, a FCGR2B transmembrane domain, a SIGLEC-6 transmembrane domain, a MPIG6B transmembrane domain, a SIGLEC-12 transmembrane domain, a LIR8 transmembrane domain, a IRTA1 transmembrane domain, a KIR2DL4 transmembrane domain, a KIR2DL5 transmembrane domain, a SIGLEC-7 transmembrane domain, and a FCRH3 transmembrane domain. In some embodiments, the inhibitory chimeric receptor comprises a spacer region between the third antigen-binding domain and the transmembrane domain. In some embodiments, the spacer region comprises an amino acid sequence selected from the amino acid sequences set forth in Table 8.

[0038] In some embodiments, the one or more intracellular inhibitory domains are selected from: a SIRPα intracellular domain, a PD-1 intracellular domain, a CTLA4 intracellular domain, a TIGIT intracellular domain, a BTLA intracellular domain, a LIR1 (LILRB1) intracellular domain, a TIM3 intracellular domain, a KIR3DL1 intracellular domain, a NKG2A intracellular domain, a LAG3 intracellular domain, a LAIR1 intracellular domain, a KIR2DL1 intracellular domain, a KIR2DL2 intracellular domain, a KIR2DL3 intracellular domain, a KIR3DL2 intracellular domain, a KLRG-1 intracellular domain, a CEACAM1 intracellular domain, a LIR2 intracellular domain, a LIR3 intracellular domain, a LIR5 intracellular domain, a SIGLEC-2 intracellular domain, a SIGLEC-10 intracellular domain, a PEC AM- 1 intracellular domain, a CD72 intracellular domain, a IRTA2 intracellular domain, a IRTA4 intracellular domain, a NKIR intracellular domain, a TLT1 intracellular domain, a PCDHGC3 intracellular domain, a MPZL1 intracellular domain, a FCGR2B intracellular domain, a SIGLEC-6 intracellular domain, a MPIG6B intracellular domain, a SIGLEC-12 intracellular domain, a LIR8 intracellular domain, a IRTA1 intracellular domain, a KIR2DL4 intracellular domain, a KIR2DL5 intracellular domain, a SIGLEC-7 intracellular domain, and a FCRH3 intracellular domain. In some embodiments, binding of the inhibitory chimeric receptor to the third antigen is capable of inhibiting the immunoresponsive cell and / or wherein binding of the first antigen-binding site to the first antigen and / or binding of the second antigen-binding site to TROP2 is capable of activating the immunoresponsive cell.

[0039] In some embodiments, the cell is an immunoresponsive cell. In some embodiments, the cell is selected from the group consisting of a T cell, a Natural Killer (NK) cell, a cytotoxic T lymphocyte (CTL), a regulatory T cell, a Natural Killer T (NKT) cell, a myeloid cell, a macrophage, a human embryonic stem cell (ESC), an ESC-derived cell, a pluripotent stem cell, and induced pluripotent stem cell (iPSC), and an iPSC-derived cell. In some embodiments, the cell is autologous. In some embodiments, the cell is allogeneic.

[0040] Also disclosed herein, in various embodiments, is a pharmaceutical composition comprising: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; or (iv) the isolated cell disclosed herein, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

[0041] Also disclosed herein, in various embodiments, is a method of treating a disease in a subject in need thereof, the method comprising administering to the subject an effective amount of: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein.

[0042] Also disclosed herein, in various embodiments, is a method of stimulating a cell- mediated immune response to a tumor cell in a subject afflicted with cancer, the method comprising administering to a subject having a tumor an effective amount of: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein.

[0043] Also disclosed herein, in various embodiments, is a method of providing an antitumor immunity in a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein.

[0044] Also disclosed herein, in various embodiments, is a method of reducing tumor burden in a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein. In some embodiments,(a) the method reduces the number of tumor cells, (b) the method reduces tumor size, (c) the method reduces tumor volume, and / or (d) the method eradicates the tumor in the subject.

[0045] Also disclosed herein, in various embodiments, is a method of treating a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein.

[0046] Also disclosed herein, in various embodiments, is a method of reducing tumor burden in a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein.

[0047] In some embodiments, the cancer is selected from colorectal cancer, lung cancer, breast cancer, bladder cancer, prostate cancer, pancreatic cancer, a gastrointestinal (GI) tract cancer, thyroid cancer, urothelial cancer, ovarian cancer, endometrial cancer, cervical cancer, optionally wherein the lung cancer is or comprises non-small cell lung cancer (NSCLC), oral squamous cell cancer, head and neck squamous cell cancer.

[0048] Also disclosed herein, in various embodiments, is a kit for treating and / or preventing a lung cancer, the kit comprising: (i) the CAR disclosed herein; (ii) the nucleic acid sequence disclosed herein; (iii) the engineered expression system disclosed herein; (iv) the isolated cell disclosed herein; or (v) the pharmaceutical composition disclosed herein. In some embodiments, the kit further comprises written instructions for using isolated cell, or pharmaceutical composition for treating and / or preventing a cancer in a subject, or the kit further comprises instructions for using the CAR, nucleic acid sequence, or system for producing one or more antigen-specific cells for treating and / or preventing a cancer in a subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0049] These and other features, aspects, and advantages of the present disclosure will become better understood with regard to the following description, and accompanying drawings.

[0050] FIG. 1 depicts a schematic representation of CEA-family members, their structure, and functions.

[0051] FIG. 2 depicts gene expression of CEACAM5 and CEACAM6 in colorectal carcinoma (CRC) and normal tissues.

[0052] FIG. 3A depicts gene expression of CEACAM5 in colorectal carcinoma (CRC) and normal tissues. FIG. 3B depicts gene expression of CEACAM6 in colorectal carcinoma (CRC) and normal tissues.

[0053] FIG. 4 depicts protein expression of CEACAM1, CEACAM5, and CEACAM6 in patient samples in a tissue microarray including both cancer and normal tissue samples.

[0054] FIGs. 5A-5D depict graphs comparing TROP2 expression with expression of other established tumor antigens in non-small cell lung cancer tumor samples. FIG. 5 A depicts comparison of TROP2 expression (vertical axis) with MSLN expression (horizontal axis). FIG. 5B depicts comparison of TROP2 expression (vertical axis) with EGFR expression (horizontal axis). FIG. 5C depicts comparison of TROP2 expression (vertical axis) with MUC16 expression (horizontal axis). FIG. 5D depicts comparison of TROP2 expression (vertical axis) with MUC1 expression (horizontal axis).

[0055] FIG. 6 depicts images of immunohistochemistry staining of TROP2 protein expression in normal and tumor tissues.

[0056] FIG. 7 depicts graph of TROP2 mRNA expression (vertical axis) and CEACAM5 mRNA expression (horizontal axis) in lung adenocarcinoma (LU AD) tissue samples rated as having low expression or negative expression of CEACAM5.

[0057] FIG. 8 A depicts a schematic of a TROP2 protein indicating locations of binding sites of indicated anti-TROP2 antibodies. FIG. 8B depicts a graph of an Incucyte assay measuring killing of DLD1 target cells by NK cells expressing indicated TROP2 CAR constructs.

[0058] FIGs. 9A-9G depict graphs of Incucyte assays measuring killing of target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs. FIG. 9A depicts killing of CEACAM5 -positive / TROP2-high DLD1 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 9B depicts killing of CEACAM5 -negative / TROP2-low H661 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 9C depicts killing of CEACAM5-positive / TROP2-negative Lsl74t cells by NK cells expressing indicated bivalent CAR constructs. FIG. 9D depicts killing of CEACAM5-positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs. FIG. 9E depicts killing of CEACAM5- negative / TROP2-low H661 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 9F depicts killing of CEACAM5-positive / TROP2-negative Lsl74t cells by NK cells expressing indicated bivalent CAR constructs. FIG. 9G depicts killing of CEACAM5- positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs.

[0059] FIG. 10 depicts a bar graph of percent cell killing of indicated target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs in Incucyte assays from FIGs. 9A-9G.

[0060] FIGs. 11A-11G depict graphs of Incucyte assays measuring killing of target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs. FIG. 11Adepicts killing of CEACAM5-positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs. FIG. 11B depicts killing of CEACAM5-negative / TROP2- low H661 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 11C depicts killing of CEACAM5-positive / TROP2-negative Lsl74t cells by NK cells expressing indicated bivalent CAR constructs. FIG. 11D depicts killing of CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 11E depicts killing of CEACAM5-negative / TROP2- low H661 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 11F depicts killing of CEACAM5-positive / TROP2-negative Ls174t cells by NK cells expressing indicated bivalent CAR constructs. FIG. 11G depicts killing of CEACAM5-positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs.

[0061] FIG. 12 depicts a bar graph of percent cell killing of indicated target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs in Incucyte assays from FIGs. 11A-11G.

[0062] FIGs. 13A-13G depict graphs of Incucyte assays measuring killing of target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs. FIG. 13A depicts killing of CEACAM5-positive / TROP2-negative Lsl74t cells by NK cells expressing indicated bivalent CAR constructs. FIG. 13B depicts killing of CEACAM5-negative / TROP2- low H661 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 13C depicts killing of CEACAM5-positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs. FIG. 13D depicts killing of CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 13E depicts killing of CEACAM5-negative / TROP2- low H661 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 13F depicts killing of CEACAM5-positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs. FIG. 13G depicts killing of CEACAM5- positive / TROP2-high DLD1 cells by NK cells expressing indicated bivalent CAR constructs.

[0063] FIG. 14 depicts a bar graph of percent cell killing of indicated target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs in Incucyte assays from FIGs. 13A-13G.

[0064] FIGs. 15A-15D depict graphs of the second round of Incucyte assays measuring killing of target cells by NK cells expressing indicated TROP2 / CEACAM5 bivalent CAR constructs. FIG. 15A depicts killing of CEACAM5-positive / TROP2-low LoVo cells by NK cells expressing indicated bivalent CAR constructs. FIG. 15B depicts killing of CEACAM5- positive / TROP2-high DLD1 cells by NK cells expressing indicated bivalent CAR constructs. FIG. 15C depicts killing of CEACAM5-positive / TROP2-negative Lsl74t cells by NK cellsexpressing indicated bivalent CAR constructs. FIG. 15D depicts killing of CEACAM5- negative / TROP2- low H661 cells by NK cells expressing indicated bivalent CAR constructs.

[0065] FIGs. 16A-16C depict graphs of Incucyte assays measuring killing of DLD1 target cells in a mixed population with or without expression of VSIG2 by NK cells expressing indicated constructs including a TROP2 / CEACAM5 bivalent aCAR and a VSIG2 iCAR. FIG. 16A depicts the percentage of VSIG2-expressing target cells over time during incubation with NK cells expressing indicated constructs. FIG. 16B depicts killing of VSIG2 -negative / CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs. FIG. 16C depicts killing of VSIG2 -positive / CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs.

[0066] FIG. 17 depicts graphs percentage of VSIG2-expressing target cells over time in an Incucyte assays measuring killing of DLD1 target cells in a mixed population with or without expression of VSIG2 by NK cells expressing indicated constructs including a TROP2 / CEACAM5 bivalent aCAR and a VSIG2 iCAR.

[0067] FIGs. 18A-18D depict flow cytometry graphs showing staining of Myc epitope tag (vertical axes) and (G4S)n(SEQ ID NO: 519) -based linker in NK cells expressing aCAR constructs. FIG. 18A depicts staining of cells expressing a CAR having a Myc epitope tag and a (G4S)n(SEQ ID NO: 519) -based linker. FIG. 18B depicts staining of cells expressing a CAR having a (G4S)n(SEQ ID NO: 519) -based linker and no Myc tag. FIG. 18C depicts staining of cells expressing a CAR having a Myc epitope tag and no (G4S)n(SEQ ID NO: 519) -based linker. FIG. 18D depicts staining of cells expressing a CAR having a Myc epitope tag and no (G4S)n(SEQ ID NO: 519) -based linker.

[0068] FIGs. 19A-19D depict flow cytometry graphs showing staining of epitope tag (vertical axes) and linkers in NK cells expressing a construct including an aCAR and an iCAR. FIG. 19A depicts flow cytometry graphs measuring staining of Myc epitope tag (vertical axes) and (G4S)n(SEQ ID NO: 519) -based linker on expressed aCARs. FIG. 19B depicts flow cytometry graphs measuring staining of V5 epitope tag (vertical axes) and Whitlow linker on expressed iCARs. FIG. 19C depicts flow cytometry graphs measuring staining of Myc epitope tag (vertical axes) and (G4S)n(SEQ ID NO: 519) -based linker on expressed aCARs. FIG. 19D depicts flow cytometry graphs measuring staining of V5 epitope tag (vertical axes) and Whitlow linker on expressed iCARs.

[0069] FIGs. 20A-20B depict graphs illustrating cell count over time and area-under-the curve (AUC) in an Incucyte assay measuring killing of target cells in a mixed population with or without expression of VSIG2 by NK cells expressing indicated constructs including aTROP2 / CEACAM5 bivalent aCAR and a VSIG2 iCAR. FIG. 20A area-under-curve (AUC) values (left panel). FIG. 20B depicts graphs of cell counts over time.

[0070] FIGs. 21A-21B depict plots of killing of VSIG2-expressing cells (vertical axes) versus VSIG2 -negative (horizontal axes) in the Incucyte assay depicted in FIG. 20. FIG. 21A depicts relative killing of NS cells. FIG. 21B depicts relative killing of PS cells.

[0071] FIGs. 22A-22B depict graphs of relative NOT gate scores in the Incucyte assay depicted in FIG. 20. FIG. 22A depicts NOT gate scores from NS cells. FIG. 22B depicts NOT gate scores from PS cells.

[0072] FIGs. 23A-23B depict graphs of cell killing of H661 expressing CEACAM5 (FIG. 23 A) or TROP2 (FIG. 23B) as measured by an Incucyte assay.

[0073] FIG. 24 depicts a schematic of an exemplary multicistronic gene circuit as disclosed here, according to an embodiment.

[0074] FIG. 25 depicts a schematic of exemplary constructs encoding multicistronic gene circuits.

[0075] FIGs. 26A-26D depict flow cytometry analysis of protein expression in NK cells expressing indicated multicistronic gene circuits. FIG. 26 A depicts measurement of aCAR expression as measured by staining of a (G4S)n(SEQ ID NO: 519) -based linker. FIG. 26B depicts measurement of aCAR expression as measured by staining of a Myc epitope tag. FIG. 26C depicts measurement of iCAR expression as measured by staining of a V5 epitope tag. FIG. 26D depicts measurement of IL 15 expression.

[0076] FIGs. 27A-27D depict graphs of cytokine secretion by NK cells expressing indicated multicistronic gene circuits. FIG. 27A depicts a graph of IL 15 secretion from NK cells expressing indicated multicistronic gene circuits. FIG. 27B depicts a graph of IL21 secretion from NK cells expressing indicated multicistronic gene circuits. FIG. 27C depicts a graph of IL 15 secretion normalized to cell count and time from NK cells expressing indicated multicistronic gene circuits. FIG. 27D depicts a graph of IL21 secretion normalized to cell count and time from NK cells expressing indicated multicistronic gene circuits.

[0077] FIGs. 28A-28B depict graphs of Incucyte assays measuring killing of DLD1 target cells in a mixed population with or without expression of VSIG2 by NK cells expressing indicated multicistronic gene circuits. FIG. 28A depicts fluorescence area of CEACAM5- positive / TROP2-high / VSIG2 -negative DLD1 cells over time in the first round of killing. FIG. 28B depicts a graph measuring percentage of killing of target cells by indicated NK cells as measured in FIG. 28A.

[0078] FIGs. 29A-29C depict graphs of Incucyte assays measuring killing of DLD1 target cells in a mixed population with or without expression of VSIG2 by NK cells expressingindicated multicistronic gene circuits. FIG. 29A depicts killing of VSIG2-negative / CEACAM5- positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs. FIG. 29B depicts killing of VSIG2 -positive / CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs. FIG. 29C depicts percentage of VSIG2-expressing target cells over time during incubation with NK cells expressing indicated constructs.

[0079] FIGs. 30A-30B depict graphs measuring killing of target cells in the Incucyte assay depicted in FIGs. 29A-29C. FIG. 30A depicts killing of VSIG2 -negative / CEACAM5- positive / TROP2-high DLD1 cells as depicted in FIG. 29A. FIG. 30B depicts killing of VSIG2- positive / CEACAM5-positive / TROP2-high DLD1 cells as depicted in FIG. 29B.

[0080] FIGs. 31A-31B depict flow cytometry analysis of protein expression in NK cells expressing multicistronic gene circuits including a TROP2 / CEACAM5 bivalent aCAR and a VSIG2 iCAR. FIG. 31 A depicts measurement of iCAR expression as measured by staining of a V5 epitope tag (horizontal axis) and aCAR / IL15 as measured by staining of a (G4S)n(SEQ ID NO: 519) -based linker (vertical axis). FIG. 31B depicts measurement of aCAR expression as measured by staining of a Myc epitope tag (horizontal axis) and IL 15 (vertical axis).

[0081] FIGs. 32A-32H depict graphs of Incucyte assays measuring killing of DLD1 target cells in a mixed population with or without expression of VSIG2 by NK cells expressing indicated multicistronic gene circuits. FIG. 32A depicts killing of VSIG2-negative / CEACAM5- positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs. FIG. 32B depicts killing of VSIG2-negative / CE AC AM5 -positive H661 cells by NK cells expressing indicated constructs. FIG. 32C depicts killing of VSIG2-negative / TROP2- low H661 cells by NK cells expressing indicated constructs. FIG. 32D depicts killing of VSIG2-negative / CEACAM5- positive H661 cells by NK cells expressing indicated constructs. FIG. 32E depicts killing of VSIG2-positive / TROP2- low H661 cells by NK cells expressing indicated constructs. FIG. 32F depicts killing of VSIG2-negative / TROP2- low H661 cells by NK cells expressing indicated constructs. FIG. 32G depicts killing of VSIG2 -negative / CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs. FIG. 32H depicts killing of VSIG2- positive / CEACAM5-positive / TROP2-high DLD1 cells by NK cells expressing indicated constructs.

[0082] FIGs. 33A-33I depict the expression of bi- and tricistronic CEA / TROP2 NOT VSIG2 gene circuits in T cells using engineered promoters. FIG. 33A depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB14351 construct. FIG. 33B depicts a contour plot illustrating the expression of IL-15 and CEA / TROP2 aCAR in T cells transduced with SB14351 construct. FIG. 33C depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transducedwith SB 14355 construct. FIG. 33D depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14355 construct. FIG. 33E depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB 14461 construct. FIG. 33F depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14461 construct. FIG. 33G depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB 14465 construct. FIG. 33H depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14465 construct. FIG. 331 depicts a table illustrating the promoter and presence of crIL-15 in the constructs.

[0083] FIGs. 34A-34I depict that CEA / TROP2 NOT VSIG2 gene circuits can be expressed in various construct gene order. FIG. 34A depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB14351 construct. FIG. 34B depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14351 construct. FIG. 34C depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB 14355 construct. FIG. 34D depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14355 construct. FIG. 34E depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB 14520 construct. FIG. 34F depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14520 construct. FIG. 34G depicts a contour plot illustrating the expression of VSIG2 iCAR and CEA / TROP2 aCAR in T cells transduced with SB 14522 construct. FIG. 34H depicts a contour plot illustrating the expression of IL- 15 and CEA / TROP2 aCAR in T cells transduced with SB 14522 construct. FIG. 341 depicts a table illustrating the genes and order in the constructs.

[0084] FIG. 35 depicts a bar graph illustrating CEA / TROP2 NOT VISG2 T cells of VSIG2- target cells killing as compared the killing of VSIG2+ target cells.

[0085] FIG.36 depicts immunofluorescence photographs illustrating the gate effect in CEA / TROP2 NOT VSIG2 T cells.

[0086] FIG. 37 depicts photographs illustrating the results of a mixed target assay.

[0087] FIGs. 38A-38B depict the calibrated release of IL- 15 enhancing durability of cytotoxicity. FIG. 38A depicts a graph illustrating target cell reduction at 72 hours in a mixed target assay with single challenge. FIG. 38B is a graph illustrating normalized target cell counts in a single target assay with multiple serial re-challenges.

[0088] FIGs. 39A-39J depicts expression durability and cytotoxicity of CEA / TROP2 NOT VSIG2 gene circuits depending on the promoters. FIG. 39A depicts a contour plotillustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter Pro.548, in the absence of crIL-15 after one 72-hours challenge. FIG. 39B depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter SFFV, in the absence of crIL-15 after one 72-hours challenge. FIG. 39C depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter SV40, in the absence of crIL-15 after one 72-hours challenge. FIG. 39D depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter EF-la, in the absence of crIL-15 after one 72-hours challenge. FIG. 39E depicts a graph illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter Pro.548, SFFV, SV40, or EF-la, with crIL-15 after serial 72-hours challenges. FIG. 39F depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter Pro.548, with crIL-15 after one 72-hours challenge. FIG. 39G depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter SFFV, with crIL-15 after one 72-hours challenge. FIG. 39H depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter SV40, with crIL-15 after one 72-hours challenge. FIG. 391 depicts a contour plot illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter EF-la, with crIL-15 after one 72-hours challenge. FIG. 39 J depicts a graph illustrating CEA / TROP2 NOT VSIG2 gene circuits expression as driven by promoter Pro.548, SFFV, SV40, or EF-la, with crIL-15 after serial 72-hours challenges.

[0089] FIG. 40 depicts a bar graph illustrating the performance of activating CAR costimulatory domains in a serial re-challenge mixed target assay.

[0090] FIGs. 41A-41B depict graphs illustrating solid tumor killing efficacy on different background and antigen expression. FIG. 41 A is a bar graph illustrating target cell reduction at 72 hours against a variety of tumor cell lines. FIG. 41B is a graph bar illustrating target cell reduction at 72 hours against H661 cells and H661 VSIG2+ cells.

[0091] FIG. 42 is a graph illustrating the effects of CEA / Trthe OP2 bivalent CAR as compared to CEA and VSIG2 monovalent CARs in a NOT gate.

[0092] FIGs. 43 A-43F depict anti-tumor efficacy of T cells expressing CAE / TROP2NOT VSIG2 gene circuit on solid tumor in vivo. FIG. 43A is a schematic representation of the experimental procedure. FIG. 43B depicts a graph illustrating percent of T cells in peripheral blood post treatment with 2.5x106T cells, 1x107T cells or 1x107T cells without IL-2. FIG. 43C depicts a graph illustrating tumor volume over time in animals treated with 2.5x106T cells. FIG. 43D depicts a graph illustrating tumor volume over time in animals treated with 1x107T cells. FIG. 43E depicts a graph illustrating tumor volume over time in animals treated 1x107T cellswithout IL-2. FIG. 43F depicts a graph illustrating tumor volume over time in animals receiving no T cells.

[0093] FIGs. 44A-44C depict ability of CEA / TROP2 NOT VSIG2 gene circuit to kill cancer cell in vivo with precision. FIG. 44A depicts a schematic of the experimental procedure. FIG. 44B depicts a graph illustrating the relative abondance of VSIG2+ cells. FIG. 44C depicts a graph illustrating the absolute count of target cells in the tissue.

[0094] FIGs. 45A-45I depict in vivo killing efficacy of different NOT gates compared. FIG. 45A is a table illustrating the gene circuits used. FIG. 45B depicts a graph illustrating tumor volume in animal treated with vehicle. FIG. 45C is a graph illustrating tumor volume in animal treated with SB14351. FIG. 45D depicts a graph illustrating tumor volume in animal treated with SB14355. FIG. 45E depicts a graph illustrating tumor volume in animal treated with SB 14422. FIG. 45F depicts a graph illustrating the comparison of average tumor volume in each group. FIG. 45G depicts a graph illustrating animal body weight during the course of the treatment. FIG. 45H depicts a graph illustrating the number of CAR+ T cells per ml peripheral blood. FIG. 451 depicts a graph illustrating a cropped Y-axis version of FIG. 45H to show details.

[0095] FIGs. 46A-46C depict in vivo selective killing and protection of different NOT gates compared. FIG. 46A depicts a schematic representation of the experimental procedure. FIG. 46B depicts a graph illustrating the relative abundance of DLD-1 CEA+ TROP2+ VSIG2+ cells as a percentage of all target cells in the excised tissue. FIG. 46C depicts a graph illustrating the absolute count of target cell types in the excised tissue.DETAILED DESCRIPTION

[0096] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of molecular biology, chemistry, biochemistry, virology, and immunology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Hepatitis C Viruses: Genomes and Molecular Biology (S.L. Tan ed., Taylor & Francis, 2006); Fundamental Virology, 3rd Edition, vol. I & II (B.N. Fields and D.M. Knipe, eds.); Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., Blackwell Scientific Publications); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).Definitions

[0097] Unless otherwise defined, all terms of art, notations and other scientific terminology used herein are intended to have the meanings commonly understood by those of skill in the art. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodologies by those skilled in the art, such as, for example, the widely utilized molecular cloning methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual 4th ed. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer-defined protocols and conditions unless otherwise noted.

[0098] As used herein, the singular forms “a,” “an,” and “the” include the plural referents unless the context clearly indicates otherwise. The terms “include,” “such as,” and the like are intended to convey inclusion without limitation, unless otherwise specifically indicated.

[0099] As used herein, the term “comprising” also specifically includes embodiments “consisting of’ and “consisting essentially of’ the recited elements, unless specifically indicated otherwise.[000100] The term “about” indicates and encompasses an indicated value and a range above and below that value. In certain embodiments, the term “about” indicates the designated value ± 10%, ± 5%, or ± 1%. In certain embodiments, where applicable, the term “about” indicates the designated value(s) ± one standard deviation of that value(s).

[0101] As used herein, the term "activating an immunoresponsive cell" refers to the induction of signal transduction or changes in protein expression in the cell that results in the initiation of an immune response. For example, when CD3 chains cluster in response to ligand binding and immunoreceptor tyrosine-based inhibition motifs (ITAMs) a signal transduction cascade is produced. In certain embodiments, when an endogenous TCR or an exogenous CAR binds antigen, a formation of an immunological synapse occurs that includes clustering of many molecules near the bound receptor (e.g. CD4 or CD8, CD3γ / δ / ε / ζ, etc.). This clustering of membrane bound signaling molecules allows for ITAM motifs contained within the CD3 chains to become phosphorylated. This phosphorylation in turn initiates a T cell activation pathway ultimately activating transcription factors, such as NF-KB and AP-1. These transcription factors induce global gene expression of the T cell to increase IL-2 production for proliferation andexpression of master regulator T cell proteins in order to initiate a T cell mediated immune response.

[0102] As used herein, the term "stimulates” or “stimulating an immune response" refers to generating a signal that results in an immune response by one or more cell types or cell populations. Immunostimulatory activity may include pro-inflammatory activity. In various embodiments, the immune response occurs after immune cell (e.g., T-cell or NK cell) activation or concomitantly mediated through receptors including, but not limited to, CD28, CD 137 (4- 1BB), 0X40, CD40 and ICOS, and their corresponding ligands, including B7-1, B7-2, OX-40L, and 4-1 BBL. Such polypeptides may be present in the tumor microenvironment and can activate immune responses to neoplastic cells. In various embodiments, promoting, stimulating, or otherwise agonizing pro-inflammatory polypeptides and / or their ligands may enhance the immune response of an immunoresponsive cell. Without being bound to a particular theory, receiving multiple stimulatory signals (e.g., co -stimulation) is important to mount a robust and long-term cell mediated immune response, such as a T cell mediated immune response where T cells can become inhibited and unresponsive to antigen (also referred to as “T cell anergy”) in the absence of co -stimulatory signals. Without receiving these stimulatory signals, T cells quickly become inhibited and unresponsive to antigen. While the effects of the variety of costimulatory signals, particularly in combination with one another, can vary and remain only partially understood, they co-stimulation generally results in increasing gene expression in order to generate long-lived, proliferative, and anti-apoptotic resistant cells, such as T cells or NK cells, that robustly respond to antigen, for example in meditating complete and / or sustained eradication of targets cells expressing a cognate antigen.

[0103] As used herein, the term "chimeric antigen receptor" or alternatively a "CAR" refers to a recombinant polypeptide construct comprising at least an extracellular antigenbinding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as "an intracellular signaling domain") comprising a functional signaling domain.

[0104] As used herein, the term "activating CAR" or “aCAR” refers to CAR constructs / architectures capable of inducing signal transduction or changes in protein expression in the activating CAR-expressing cell that initiate, activate, stimulate, or increase an immune response upon binding to a cognate aCAR ligand.

[0105] As used herein, the term "inhibitory CAR" or “iCAR” refers to CAR constructs / architectures capable of inducing signal transduction or changes in protein expression in the inhibitory CAR-expressing cell that prevent, attenuate, inhibit, reduce, decrease, inhibit, or suppress an immune response upon binding to a cognate iCAR ligand, such as reducedactivation of immunoresponsive cells receiving or having received one or more stimulatory signals, including co-stimulatory signals.

[0106] As used herein, the term “enzymatic inhibitory domain” refers to a protein domain that inhibits an intracellular signal transduction cascade, for example a native T cell activation cascade. In some embodiments, the enzymatic inhibitory domain of a chimeric inhibitory receptor of the present disclosure comprises at least a portion of an extracellular domain, a transmembrane domain, and / or an intracellular domain. In some embodiments, the enzymatic inhibitory domain comprises at least a portion of an enzyme. In some embodiments, the enzyme is selected from CSK, SHP-1, PTEN, CD45, CD148, PTP-MEG1, PTP-PEST, c- CBL, CBL-b, PTPN22, LAR, PTPH1, SHIP-1, and RasGAP (see e.g., Stanford et al., Regulation of TCR signaling by tyrosine phosphatases: from immune homeostasis to autoimmunity, Immunology, 2012 Sep; 137(1): 1-19). In some embodiments, the portion of the enzyme comprises an enzyme domain(s), an enzyme fragment(s), or a mutant(s) thereof. In some embodiments, the portion of the enzyme is a catalytic domain of the enzyme. In some embodiments, the enzyme domain(s), enzyme fragment(s), or mutants(s) thereof are selected to maximize efficacy and minimize basal inhibition.

[0107] As used herein, the term "intracellular signaling domain" refers to the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.

[0108] As used herein, the term “extracellular antigen-binding domain” or “antigenbinding domain” (ABD) refers to a polypeptide sequence or polypeptide complex that specifically recognizes or binds to a given antigen or epitope, such as the polypeptide sequence or polypeptide complex portion of the chimeric proteins described herein that provide, for example, the VSIG2-specific binding. An ABD (or antibody, antigen-binding fragment, and / or the chimeric protein including the same) is said to “recognize” the epitope (or more generally, the antigen) to which the ABD specifically binds, and the epitope is said to be the “recognition specificity” or “binding specificity” of the ABD. The ABD is said to bind to its specific antigen or epitope with a particular affinity. As described herein, “affinity” refers to the strength of interaction of non-covalent intermolecular forces between one molecule and another. The affinity, i.e., the strength of the interaction, can be expressed as a dissociation equilibrium constant (KD), wherein a lower KD value refers to a stronger interaction between molecules. KD values of antibody constructs are measured by methods well known in the art including, but not limited to, bio-layer interferometry (e.g. Octet / FORTEBIO®), surface plasmon resonance (SPR) technology (e.g. Biacore®), and cell binding assays (e.g., Flow-cytometry). Specificbinding, as assessed by affinity, can refer to a binding molecule with an affinity between an ABD and its cognate antigen or epitope in which the KD value is below 10-6M, 10-7M, 10-8M, 10-9M, or 10-10M. Specific binding can also include recognition and binding of a biological molecule of interest (e.g., a polypeptide) while not specifically recognizing and binding other molecules in a sample, for example, a biological sample, which naturally includes a polypeptide of the present disclosure. In certain embodiments, specific binding refers to binding between an ABD, antibody, or antigen-binding fragment to an epitope or antigen or antigenic determinant in such a manner that binding can be displaced or competed with a second preparation of identical or similar epitope, antigen or antigenic determinant.

[0109] An ABD can be an antibody. The term "antibody," as used herein, refers to a protein, or polypeptide sequence derived from an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural sources or from recombinant sources. Antibodies can be tetramers of immunoglobulin molecules.

[0110] An ABD can be an antigen-binding fragment of an antibody. As used herein, the term "antigen-binding fragment" refers to at least one portion of an intact antibody, or recombinant variants thereof, that is sufficient to confer recognition and specific binding of the antigen-binding fragment to a target, such as an antigen or epitope. Examples of antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv, scFv, linear antibodies, single domain antibodies such as sdAb (either VL or VH), camelid VHH domains, and multi-specific antibodies formed from antigen-binding fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody. An antigen-binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23: 1126-1 136, 2005). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3) (see U.S. Patent No. : 6,703,199, which describes fibronectin polypeptide minibodies).

[0111] The number of ABDs in a binding molecule, such as the chimeric proteins described herein, defines the “valency” of the binding molecule. A binding molecule having a single ABD is “monovalent”. A binding molecule having a plurality of ABDs is said to be “multivalent”. A multivalent binding molecule having two ABDs is “bivalent.” A multivalent binding molecule having three ABDs is “trivalent.” A multivalent binding molecule having four ABDs is “tetravalent.” In various multivalent embodiments, all of the plurality of ABDs have the same recognition specificity and can be referred to as a “monospecific multivalent” bindingmolecule. In other multivalent embodiments, at least two of the plurality of ABDs have different recognition specificities. Such binding molecules are multivalent and “multispecific.” In multivalent embodiments in which the ABDs collectively have two recognition specificities, the binding molecule is “bispecific.” In multivalent embodiments in which the ABDs collectively have three recognition specificities, the binding molecule is “trispecific.” In multivalent embodiments in which the ABDs collectively have a plurality of recognition specificities for different epitopes present on the same antigen, the binding molecule is “multiparatopic.” Multivalent embodiments in which the ABDs collectively recognize two epitopes on the same antigen are “biparatopic.”

[0112] In various multivalent embodiments, multivalency of the binding molecule improves the avidity of the binding molecule for a specific target. As described herein, “avidity” refers to the overall strength of interaction between two or more molecules, e.g. a multivalent binding molecule for a specific target, wherein the avidity is the cumulative strength of interaction provided by the affinities of multiple ABDs. Avidity can be measured by the same methods as those used to determine affinity, as described above. In certain embodiments, the avidity of a binding molecule for a specific target is such that the interaction is a specific binding interaction, wherein the avidity between two molecules has a KD value below 10-6M, 10-7M, 10-8M, 10-9M, or 10-10M. In certain embodiments, the avidity of a binding molecule for a specific target has a KD value such that the interaction is a specific binding interaction, wherein the one or more affinities of individual ABDs do not have has a KD value that qualifies as specifically binding their respective antigens or epitopes on their own. In certain embodiments, the avidity is the cumulative strength of interaction provided by the affinities of multiple ABDs for separate antigens on a shared specific target or complex, such as separate antigens found on an individual cell. In certain embodiments, the avidity is the cumulative strength of interaction provided by the affinities of multiple ABDs for separate epitopes on a shared individual antigen.

[0113] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein comprising at least one antigen-binding fragment comprising a variable region of a light chain and at least one antigen-binding fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, capable of being expressed as a single chain polypeptide, and wherein the scFv retains the specificity of the intact antibody from which it is derived. Unless specified, as used herein an scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.

[0114] As used herein, “variable region” refers to a variable sequence that arises from a recombination event, for example, following V, J, and / or D segment recombination in an immunoglobulin gene in a B cell or T cell receptor (TCR) gene in a T cell. In immunoglobulin genes, variable regions are typically defined from the antibody chain from which they are derived, e.g., VH refers to the variable region of an antibody heavy chain and VL refers to the variable region of an antibody light chain. A select VH and select VL can associate together to form an antigen-binding domain that confers antigen specificity and binding affinity.

[0115] The term "complementarity determining region" or "CDR," as used herein, refers to the sequences within antibody variable regions VH and VL which confer antigen specificity and binding affinity. For example, in general, there are three CDRs in each heavy chain variable region (e.g., HCDR1, HCDR2, and HCDR3) and three CDRs in each light chain variable region (LCDR1, LCDR2, and LCDR3). The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat" numbering scheme), ALLazikani et al, (1997) JMB 273,927-948 ("Chothia" numbering scheme), or a combination thereof. Under the Kabat numbering scheme, in some embodiments, the CDR amino acid residues in the heavy chain variable domain (VH) are numbered 31-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the light chain variable domain (VL) are numbered 24-34 (LCDR1 ), 50-56 (LCDR2), and 89-97 (LCDR3). Under the Chothia numbering scheme, in some embodiments, the CDR amino acids in the VH are numbered 26-32 (HCDR1), 52-56 (HCDR2), and 95-102 (HCDR3); and the CDR amino acid residues in the VL are numbered 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3). In a combined Kabat and Chothia numbering scheme, in some embodiments, the CDRs correspond to the amino acid residues that are part of a Kabat CDR, a Chothia CDR, or both. For instance, in some embodiments, the CDRs correspond to amino acid residues 26-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3) in a VH, e.g., a mammalian VH, e.g., a human VH; and amino acid residues 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) in a VL, e.g., a mammalian VL, e.g., a human VL. In a variety of embodiments, the CDRs are mammalian sequences, including, but not limited to, mouse, rat, hamster, rabbit, camel, donkey, goat, and human sequences. In a preferred embodiment, the CDRs are human sequences. In various embodiments, the CDRs are naturally occurring sequences.

[0116] The term "framework region" or "FR," as used herein, refers to the generally conserved sequences within antibody variable regions VH and VL that act as a scaffold for interspersed CDRs, typically in a FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 arrangement (fromN-terminus to C-terminus). In a variety of embodiments, the FRs are mammalian sequences, including, but not limited to mouse, rat, hamster, rabbit, camel, donkey, goat, and human sequences. In specific embodiments, the FRs are human sequences. In various embodiments, the FRs are naturally occurring sequences. In various embodiments, the FRs are synthesized sequences including, but not limited, rationally designed sequences.

[0117] As used herein, the term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.

[0118] As used herein, the term "antibody light chain" refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (κ) and lambda (λ) light chains refer to the two major antibody light chain isotypes.

[0119] As used herein, the term "recombinant antibody" refers to an antibody which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage or yeast expression system. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequence technology which is available and well known in the art.

[0120] As used herein, the term "antigen" or "Ag" refers to a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.

[0121] As used herein, the term "anti-tumor effect" or "anti-tumor activity" refers to a biological effect which can be manifested by various means, including but not limited to, e.g., a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, decrease in tumor cell proliferation, decrease in tumor cell survival, or amelioration of various physiological symptoms associated with the cancerous condition. An "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the present disclosure in prevention of the occurrence of tumor in the first place, such as in a prophylactic therapy or treatment.

[0122] As used herein, the term "autologous" refers to any material derived from the same subject to whom it is later to be re-introduced into the subject.

[0123] As used herein, the term "allogeneic" refers to any material derived from a different animal of the same species as the subject to whom the material is introduced. Two or more subjects are said to be allogeneic to one another when the genes at one or more loci are not identical. In some embodiments, allogeneic material from individuals of the same species may be sufficiently genetically distinct, e.g., at particular genes such as MHC alleles, to interact antigenically. In some embodiments, allogeneic material from individuals of the same species may be sufficiently genetically similar, e.g., at particular genes such as MHC alleles, to not interact antigenically.

[0124] Isolated nucleic acid molecules of the present disclosure include any nucleic acid molecule that encodes a polypeptide of the present disclosure, or fragment thereof. Such nucleic acid molecules need not be 100% homologous or identical with an endogenous nucleic acid sequence, but will typically exhibit substantial identity. Nucleic acids having "substantial identity" or "substantial homology" to an endogenous sequence are typically capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. As used herein, "hybridize" refers to pairing to form a double-stranded molecule between complementary polynucleotide sequences (e.g., a gene described herein), or portions thereof, under various conditions of stringency. For example, stringent salt concentration may be less than about 750 mM NaCl and 75 mM trisodium citrate, less than about 500 mM NaCl and 50 mM trisodium citrate, or less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide or at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30 °C, at least about 37 °C, or at least about 42 °C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency may be accomplished by combining these various conditions as needed.

[0125] By "substantially identical" or "substantially homologous" is meant a polypeptide or nucleic acid molecule exhibiting at least about 50% homologous or identical to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least about 60%, about 80%, about 85%, about 90%, about 95%, about 99%, or about 100% homologous or identical at the amino acid level or nucleic acid to the sequence used for comparison. Sequence identity is typically measured using sequence analysis software (for example, Sequence Analysis Software Package of the Genetics ComputerGroup, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. In an exemplary approach to determining the degree of identity, a BLAST program may be used, with a probability score between e-3 and e-100 indicating a closely related sequence.

[0126] As used herein, the term "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA, encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some versions contain an intron(s).

[0127] As used herein, the term "ligand" refers to a molecule that binds to a receptor. In particular, the ligand binds a receptor on another cell, allowing for cell-to-cell recognition and / or interaction.

[0128] The terms "effective amount" and "therapeutically effective amount" are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result. In some embodiments, an "effective amount" or a "therapeutically effective amount" is an amount sufficient to arrest, ameliorate, or inhibit the continued proliferation, growth, or metastasis of a disease or disorder of interest, e.g., a myeloid disorder.

[0129] As used herein, the term "immunoresponsive cell" refers to a cell that functions in an immune response (e.g., an immune effector response) or a progenitor, or progeny thereof. Examples of immune effector cells include, without limitation, alpha / beta T cells, gamma / deltaT cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid- derived phagocytes.

[0130] As used herein, the term "immune effector response" or "immune effector function" refers to a function or response, e.g., of an immunoresponsive cell, that enhances or promotes an immune attack of a target cell. For example, an immune effector function or response may refer to a property of a T cell or NK cell that promotes killing or the inhibition of growth or proliferation, of a target cell. In the case of a T cell, primary stimulation and costimulation are examples of immune effector function or response.

[0131] As used herein, the term "flexible polypeptide linker" or "linker" refers to a peptide linker that consists of amino acids such as glycine and / or serine residues used alone or in combination, to link variable heavy and variable light chain regions together. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker and comprises the amino acid sequence (Gly-Gly-Gly-Gly-Ser)n(SEQ ID NO: 519) or (Gly-Gly-Gly-Ser)n(SEQ ID NO: 520), where n is a positive integer equal to or greater than 1. For example, n=1, n=2, n=3, n=4, n=5, n=6, n=7, n=8, n=9, or n=10. In some embodiments, the flexible polypeptide linkers include, but are not limited to, Gly4Ser (SEQ ID NO: 101) or (Gly4Ser)3(SEQ ID NO: 103). In other embodiments, the linkers include multiple repeats of (Gly2Ser), (GlySer) or (Gly3Ser) (SEQ ID NO: 96). In some embodiments, the flexible polypeptide linkers include a Whitlow linker (e.g., GSTSGSGKPGSGEGSTKG) (SEQ ID NO: 106). Also included within the scope of the present disclosure are linkers described, for example, in WO2012 / 138475.

[0132] As used herein, the terms "treat", "treatment" and "treating" refer to the reduction or amelioration of the progression, severity and / or duration of a proliferative disorder (e.g., cancer), or the amelioration of one or more symptoms (preferably, one or more discernible symptoms) of a proliferative disorder resulting from the administration of one or more therapies (e.g., one or more therapeutic agents such as a CAR of the present disclosure). In some embodiments, reduction or amelioration refers to the amelioration of at least one measurable physical parameter of a proliferative disorder, such as growth of a tumor, not necessarily discernible by the patient. In other embodiments, the terms "treat", "treatment", and "treating" refer to the inhibition of the progression of a proliferative disorder, either physically by, e.g., stabilization of a discernible symptom, physiologically by, e.g., stabilization of a physical parameter, or both. In some embodiments, reduction or amelioration include reduction or stabilization of tumor size or cancerous cell count.

[0133] As used herein, the term "subject" is intended to include living organisms in which an immune response can be elicited (e.g., mammals, human).Other interpretational conventions

[0134] Ranges recited herein are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints. For example, a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50.

[0135] Unless otherwise indicated, reference to a compound that has one or more stereocenters intends each stereoisomer, and all combinations of stereoisomers, thereof.Solid tumor antigens

[0136] Certain aspects of the present disclosure relate to chimeric receptors and cells, such as immunoresponsive cells, that have been genetically modified to express one or more of such chimeric receptors that bind to an antigen of interest, and to methods of using such receptors and cells to treat and / or prevent solid malignancies, such as lung cancer, pancreatic cancer, gastrointestinal cancer, colon cancer, brain cancer, cancer of the neuronal tissue, endocrine tumors, bone cancer, cancer of the bone marrow, cancer of the immune system, muscle cancer, live cancer, gallbladder cancer, kidney cancer, urinary bladder cancer, cancer of the male reproductive organs, cancer of the female reproductive organs, adipose cancer, soft tissue cancer, and skin cancer, and other pathologies where an antigen-specific immune response is desired. Malignant cells have developed a series of mechanisms to protect themselves from immune recognition and elimination. The present disclosure provides immunogenicity within the tumor microenvironment for treating such malignant cells.

[0137] Certain aspects of the present disclosure related to chimeric receptors that specifically bind one or more antigens expressed on a myeloid cell useful for treating solid tumor malignancies, and to immunoresponsive cells genetically modified to express such chimeric receptors. Solid cancers are clonal diseases caused by genetic and epigenetic alterations that disrupt key processes such as cell proliferation and differentiation. Solid tumor malignancies can be chronic or acute.

[0138] Certain aspects of the present disclosure relate, in general, to chimeric receptors, engineered expression systems, cells, and methods of treatment for the combined targeting of a first solid tumor antigen that is a CEA family member (e.g., CEACAM5, CEA, CEACAM1, and CEACAM6) and a second solid tumor antigen that is TROP2. In various embodiments, the present disclosure relates to an OR gate for broader targeting of tumors expressing one or both of a CEA family member and TROP2.

[0139] In some embodiments, the present disclosure relates to engineered expression systems, cells, and methods of treatment comprising a bivalent chimeric receptor comprising a first antigen binding domain that binds a CEA family member (e.g., CEACAM5, CEA, CEACAM1, and CEACAM6) and a second antigen binding domain that binds TROP2. In some embodiments, the present disclosure relates to engineered expression systems, cells, and methods of treatment comprising a first chimeric receptor comprising an antigen binding domain that binds a CEA family member (e.g., CEACAM5, CEA, CEACAM1, and CEACAM6) and a second chimeric receptor comprising an antigen binding domain that binds TROP2.

[0140] In certain embodiments, the present disclosure relates to solid tumor antigens and combinations of solid tumor antigens that are suitable for use in chimeric receptors (e.g., chimeric TCRs or CARs) to increase efficacy and / or reduce off-tumor toxicity in the treatment of the solid tumor. In certain embodiments, a first solid tumor antigen is a CEA-family member. In certain embodiments, a first solid tumor antigen is a CEA-family member selected from the group consisting of CEA, CEACAM1, CEACAM5, and CEACAM6. As used herein, “CEA” refers to a family of highly related proteins (CD66 proteins), including, without limitation CEACAM1 (CD66a), CEACAM5 (CD66e), and CEACAM6 (CD66c). In certain embodiments, an antibody or antigen-binding fragment that binds CEA binds more than one CD66 protein.

[0141] Table 1 provides CEA-family antigens suitable for use in chimeric receptors described in the methods and compositions presented herein.

[0142] In some embodiments, the first solid tumor antigen is a CEACAM1 antigen.CEACAM1 is also known in the art as BGP, BGP1, BGPI, or CD66a. In some embodiments, the first solid tumor antigen is a CEACAM5 antigen. CEACAM5, was previously known in the art as CEA. At present CEACAM5 is also known as Meconium Antigen 100, Carcinoembryonic Antigen, or CD66e. In some embodiments, the first solid tumor antigen is a CEACAM6 antigen. CEACAM6 is also known in the art as CEAL, NCA, Normal Cross-Reacting Antigen, Non- Specific Crossreacting Antigen, or CD66c.

[0143] In certain embodiments, a second solid tumor antigen is a TROP2 antigen.TROP2 is encoded by the TACSTD2 gene, is known in the art as Tumor Associated Calcium Signal Transducer 2, GA733-1, EGP-1 M1S1, and GP50, and is represented by the UniProt Accession No. P09758.Chimeric receptors

[0144] Certain aspects of the present disclosure relate to chimeric receptors and nucleic acids that encode such chimeric receptors that bind to an antigen of interest. In certain embodiments, a chimeric receptor of the present invention comprises a first antigen binding domain and a second antigen binding domain (z.e., a “bivalent” chimeric receptor). In some embodiments a chimeric receptor of the present invention comprises a single antigen-binding domain.Antibodies and Antigen-binding fragments

[0145] In some embodiments, chimeric receptors comprise one or more antigen binding domains capable of binding a solid tumor antigen, e.g., a CEA-family member antigen (such as listed in Table 1). Antigen binding domains of the chimeric receptors can comprise antibody sequences, or antigen-binding fragments thereof, of the representative anti-CEA antibodies provided in Table 2. In some embodiments, the antigen-binding domains comprise the CDR sequences of an antibody or antigen-binding fragment thereof of Table 2.

[0146] In some embodiments, commercially available antibodies may be used for binding to a solid tumor antigen. The CDRs of the commercially available antibodies are readily accessible by one skilled in the art using conventional sequencing technology. Further, one skilled in the art is able to construct nucleic acids encoding scFvs and chimeric receptors (e.g., CARs and TCRs) based on the CDRs of such commercially available antibodies.

[0147] In some embodiments, a chimeric receptor comprises an antigen-binding domain that specifically binds CEA.

[0148] In some embodiments, a chimeric receptor comprises an antigen-binding domain that specifically binds CEACAM1. In some embodiments, the CEACAM1 -specific antigenbinding domain is derived from an anti-CEACAMl antibody, such as the MRG1 antibody or an antigen-binding fragment thereof. In certain embodiments, the CEACAM1 -specific antigenbinding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VH of MRG1 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of MRG1 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of MRG1 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM1 and one or more additional antigens. In some embodiments, the chimeric receptor may be specific for CEACAM1 and CEACAM5. In some embodiments, the chimeric receptor may be specific for CEACAM1 and CEACAM6. In some embodiments, the chimeric receptor may be specific for CEACAM5 and CEACAM6.

[0149] In some embodiments, a chimeric receptor comprises an antigen-binding domain that specifically binds CEACAM5. In some embodiments, the CE AC AM5 -specific antigenbinding domain is derived from an anti-CEACAM5 antibody, such as labetuzumab (i.e., hMN14) or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5- specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VHof hMN14 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of hMN14 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of hMN14 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0150] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody, such as cibisatamab or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5-specific antigen-binding domain comprises a heavy chain (HC) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the HC of cibisatamab disclosed in Table 2, and a light chain (LC) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the LC of cibisatamab disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) of the HC and LC sequences of cibisatamab disclosed in Table 2, respectively. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the HC and LC sequences of cibisatamab disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain and a heavy chain variable domain. In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0151] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody, such as tusamitamab or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5-specific antigen-binding domain comprises a heavy chain (HC) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least99%, or 100%) identical to the HC of tusamitamab disclosed in Table 2, and a light chain (LC) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the LC of tusamitamab disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) of the HC and LC sequences of tusamitamab disclosed in Table 2, respectively. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the HC and LC sequences of tusamitamab disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain and a heavy chain variable domain. In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0152] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody, such as BW431 / 26 or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g. , at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VH of BW431 / 26 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of BW431 / 26 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of BW431 / 26 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0153] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody, such as A5B7 or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g. , atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VH of A5B7 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of A5B7 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of A5B7 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0154] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody, such as MFE23 or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g. , at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VH of MFE23 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of MFE23 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of MFE23 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0155] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody, such as hMFE23 or an antigen-binding fragment thereof. In certain embodiments, the CEACAM5-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g. , at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, at least 99%, or 100%) identical to the VH of hMFE23 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of hMFE23 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of hMFE23 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0156] In some embodiments, the CEACAM5 -specific antigen-binding domain is derived from an anti-CEACAM5 antibody capable of specifically binding glycosylated CEACAM5. In some embodiments, the glycosylated CEACAM5 -specific antigen-binding domain is derived from an anti-glycosylated CEACAM5 antibody, such as FM4 (also referred to herein as “MG7”) or an antigen-binding fragment thereof. In certain embodiments, the CE AC AM5 -specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VH of FM4 disclosed in Table 2, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the VL of FM4 disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of FM4 disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM5 and one or more additional antigens.

[0157] In some embodiments, a chimeric receptor comprises an antigen-binding domain that specifically binds CEACAM6. In some embodiments, the CEACAM6-specific antigenbinding domain is derived from an anti-CEACAM6 antibody, such as tinurilimab or an antigenbinding fragment thereof. In certain embodiments, the CEACAM6-specific antigen-bindingdomain comprises a heavy chain (HC) that comprises an amino acid sequence at least 90% (e.g. , at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the HC of tinurilimab disclosed in Table 2, and a light chain (LC) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the LC of tinurilimab disclosed in Table 2. In certain embodiments, the second antigen-binding site comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) of the HC and LC sequences of tinurilimab disclosed in Table 2, respectively. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the HC and LC sequences of tinurilimab disclosed in Table 2, respectively. The antigen-binding domain may be an scFv that comprises a light chain variable domain and a heavy chain variable domain. In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for CEACAM6 and one or more additional antigens.

[0158] Certain aspects of the present disclosure relate to chimeric receptors (e.g., CAR or chimeric TCR) comprising an extracellular antigen-binding domain that binds to one or more antigens of the present disclosure. In some embodiments, the antigen-binding domains are derived from an antibody, or antigen-binding fragment thereof CDR sequences and known systems for defining them, e.g., Kabat, are discussed in detail above.

[0159] Suitable antibodies of the present disclosure include any antibody, whether natural or synthetic, full length or a fragment thereof, monoclonal or polyclonal, that binds sufficiently strongly and specifically to a solid tumor antigen, e.g., CEA, CEACAM1, CEACAM5, or CEACAM6. In some embodiments, the antibody may have a KD of at most about at most 10-6M, at most about 10-7M, at most about 10-8M, at most about 10-9M, at most about 10-10M, at most about 10-11M, or at most about 10-12M.

[0160] In some embodiments, chimeric receptors comprise one or more antigen binding domains capable of binding a TROP2 antigen. Antigen binding domains of the chimeric receptors can comprise antibody sequences, or antigen-binding fragments thereof, of the representative anti-CEA antibodies provided in Table 3. In some embodiments, the antigenbinding domains comprise the CDR sequences of an antibody or antigen-binding fragment thereof of Table 3.

[0161] In some embodiments, a chimeric receptor TROP2 is an antigen-binding domain that specifically binds TROP2. In some embodiments, the TROP2-specific antigen-binding domain is derived from an anti-TROP2 antibody, such as RS7 or an antigen-binding fragment thereof. In certain embodiments, the TROP2-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to a VH of RS7, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to a VL of RS7. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determinedunder Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of RS7. In certain embodiments, the TROP2-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to a VH of AR52, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to a VL of AR52. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of AR52. In certain embodiments, the TROP2-specific antigen-binding domain comprises a heavy chain variable domain (VH) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to a VH of KM4097, and a light chain variable domain (VL) that comprises an amino acid sequence at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to a VL of KM4097. In certain embodiments, the second antigen-binding site comprises the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3, determined under Kabat, Chothia, MacCallum, or any other CDR determination method known in the art, of the VH and VL sequences of KM4097. The antigen-binding domain may be an scFv that comprises a light chain variable domain (VL) and a heavy chain variable domain (VH). In some embodiments, the chimeric receptor may have a multispecific antigen-binding domain. For example, the chimeric receptor may be specific for TROP2 and one or more additional antigens.

[0162] In some embodiments, antibodies and derivatives thereof that may be used include, without limitation, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, human antibodies, humanized, antibodies primatized (CDR-grafted) antibodies, veneered antibodies, single-chain antibodies, phage-produced antibodies (e.g. , from phage display libraries), and functional binding fragments of antibodies. For example, antibody fragments capable of binding to a solid tumor antigen, or portions thereof, include, without limitation, Fv, Fab, Fab' and F(ab')2fragments. Such fragments can be produced by enzymatic cleavage or by recombinant techniques. For example, and not by way of limitation, papain or pepsin cleavage can generate Fab or F(ab')2fragments, respectively. Other proteases with the requisite substrate specificity can also be used to generate Fab or F(ab')2fragments. Antibodies can also be produced in a variety of truncated forms using antibody genes in which one or more stop codonshave been introduced upstream of the natural stop site. For example, a chimeric gene encoding a F(ab')2heavy chain portion can be designed to include DNA sequences encoding the CH, domain and hinge region of the heavy chain.

[0163] Methods of raising an antibody targeting a specific antigen are generally known in the art. Synthetic and engineered antibodies are described in, e.g., US4816567, EP0125023B1, US4816397, EP0120694B1, WO 86 / 01533, EP0194276B1, US5225539, EP0239400B1, EP0451216B1, EP0519596A1 and US4946778.T cell receptor (TCR)

[0164] Certain aspects of the present disclosure relate to chimeric receptors that specifically bind to an antigen expressed on a solid tumor cell. In some embodiments, the chimeric receptor is a chimeric T cell receptor (TCR). TCRs of the present disclosure are disulfide-linked heterodimeric proteins containing two variable chains expressed as part of a complex with the invariant CD3 chain molecules. TCRs are found on the surface of T cells, and are responsible for recognizing antigens as peptides bound to major histocompatibility complex (MHC) molecules. In certain embodiments, a TCR of the present disclosure comprises an alpha chain encoded by TRA and a beta chain encoded by TRB. In certain embodiments, a TCR comprises a gamma chain and a delta chain (encoded by TRG and TRD, respectively).

[0165] Each chain of a TCR is composed of two extracellular domains: a variable (V) region and a constant (C) region. The constant region is proximal to the cell membrane, followed by a transmembrane region and a short cytoplasmic tail. The variable region binds to the peptide / MHC complex. Each of the variable regions has three complementarity determining regions (CDRs).

[0166] In certain embodiments, a TCR can form a receptor complex with three dimeric signaling modules CD35 / ε, CD3γ / ε, and CD247ζ / ζ or CD247ζ / η . When a TCR complex engages with its antigen and MHC (peptide / MHC), the T cell expressing the TCR complex is activated.

[0167] In some embodiments, a TCR of the present disclosure is a recombinant TCR. In certain embodiments, the TCR is a non-naturally occurring TCR. In certain embodiments, the TCR differs from a naturally occurring TCR by at least one amino acid residue. In some embodiments, the TCR differs from a naturally occurring TCR by at least 2 amino acid residues, at least 3 amino acid residues, at least 4 amino acid residues, at least 5 amino acid residues, at least 6 amino acid residues, at least 7 amino acid residues, at least 8 amino acid residues, at least 9 amino acid residues, at least 10 amino acid residues, at least 11 amino acid residues, at least 12 amino acid residues, at least 13 amino acid residues, at least 14 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino acid residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, or more amino acid residues. In certain embodiments, the TCR is modified from a naturally occurring TCR by at least one amino acid residue. In some embodiments, the TCR is modified from a naturally occurring TCR by at least 2 amino acid residues, at least 3 amino acid residues, at least 4 amino acid residues, at least 5 amino acid residues, at least 6 amino acid residues, at least 7 amino acid residues, at least 8 amino acid residues, at least 9 amino acid residues, at least 10 amino acid residues, at least 11 amino acid residues, at least 12 amino acid residues, at least 13 amino acid residues, at least 14 amino acid residues, at least 15 amino acid residues, at least 20 amino acid residues, at least 25 amino acid residues, at least 30 amino acid residues, at least 40 amino acid residues, at least 50 amino acid residues, at least 60 amino acid residues, at least 70 amino acid residues, at least 80 amino acid residues, at least 90 amino acid residues, at least 100 amino acid residues, or more amino acid residues.Chimeric TCRs

[0168] In some embodiments, a TCR of the present disclosure comprises one or more antigen-binding domains that may be grafted to one or more constant domain of a TCR chain, for example a TCR alpha chain or TCR beta chain, to create a chimeric TCR that binds specifically to a target antigen of the present disclosure (e.g., a solid tumor antigen). Without wishing to be bound by theory, it is believed that chimeric TCRs may signal through the TCR complex upon antigen binding. For example, an antibody or antibody fragment (e.g., scFv) can be grafted to the constant domain, e.g. , at least a portion of the extracellular constant domain, the transmembrane domain and the cytoplasmic domain, of a TCR chain, such as the TCR alpha chain and / or the TCR beta chain. As another example, the CDRs of an antibody or antibody fragment may be grafted into a TCR alpha chain and / or beta chain to create a chimeric TCR that binds specifically to an antigen of the present disclosure (e.g., a solid tumor antigen). Such chimeric TCRs may be produced by methods known in the art (e.g., Willemsen RA et al., Gene Therapy 2000; 7:1369-1377; Zhang T et al., Cancer Gene Ther 2004 11: 487-496; and Aggen et al., Gene Ther. 2012 Apr; 19(4): 365-74).Chimeric antigen receptors (CARs)

[0169] Certain aspects of the present disclosure relate to chimeric receptors that specifically bind to an antigen expressed on a solid tumor, e.g., a tumor of the lung, pancreas, gastrointestinal tract, colon, brain, neuronal tissue, endocrine, bone, bone marrow, immune system, muscle, liver, gallbladder, kidney, urinary bladder, male reproductive organs, femalereproductive organs, adipose, soft tissue, or skin. In some embodiments, the chimeric receptor is a chimeric antigen receptor (CAR). In some embodiments, a CAR (or immunoresponsive cells genetically engineered to comprise one or more CARs, see below) specifically binds a CEA- family member tumor antigen, such as any of the CEA antigens of Table 1. In some embodiments, a CAR (or immunoresponsive cells genetically engineered to comprise one or more CARs, see below) specifically binds a TROP2 tumor antigen. In some embodiments, a CAR (or immunoresponsive cells genetically engineered to comprise one or more CARs) can comprise antibody sequences, or antigen-binding fragments thereof, of the representative anti- CEA antibodies provided in Table 2. In some embodiments, a CAR (or immunoresponsive cells genetically engineered to comprise one or more CARs) can comprise antibody sequences, or antigen-binding fragments thereof, of the representative anti-TROP2 antibodies provided in Table 3. In some embodiments, a CAR (or immunoresponsive cells genetically engineered to comprise one or more CARs) can comprise an scFv derived from antibodies capable of binding to a solid tumor antigen, such as the representative anti-CEA or anti-TROP2 scFvs provided in Table 4.

[0170] In some embodiments, CARs are engineered receptors that graft or confer a specificity of interest onto an immune effector cell. In certain embodiments, CARs can be used to graft the specificity of an antibody onto an immunoresponsive cell, such as a T cell. In some embodiments, CARs of the present disclosure comprise an extracellular antigen-binding domain (e.g., an scFv) fused to a transmembrane domain, fused to one or more intracellular signaling domains.

[0171] In some embodiments, binding of the chimeric antigen receptor to its cognate ligand is sufficient to induce activation of the immunoresponsive cell. In some embodiments, binding of the chimeric antigen receptor to its cognate ligand is sufficient to induce stimulation of the immunoresponsive cell. In some embodiments, activation of an immunoresponsive cell results in killing of target cells. In some embodiments, activation of an immunoresponsive cell results in cytokine or chemokine expression and / or secretion by the immunoresponsive cell. In some embodiments, stimulation of an immunoresponsive cell results in cytokine or chemokine expression and / or secretion by the immunoresponsive cell. In some embodiments, stimulation of an immunoresponsive cell induces differentiation of the immunoresponsive cell. In some embodiments, stimulation of an immunoresponsive cell induces proliferation of the immunoresponsive cell.

[0172] A CAR of the present disclosure may be a first, second, or third generation CAR. "First generation" CARs comprise a single intracellular signaling domain, generally derived from a T cell receptor chain. "First generation" CARs generally have the intracellular signalingdomain from the CD3-zeta (CD3ζ) chain, which is the primary transmitter of signals from endogenous TCRs. "First generation" CARs can provide de novo antigen recognition and cause activation of both CD4+and CD8+T cells through their CD3ζ chain signaling domain in a single fusion molecule, independent of HLA-mediated antigen presentation. "Second generation" CARs add a second intracellular signaling domain from one of various co-stimulatory molecules (e.g., CD28, 4-1BB, ICOS, 0X40) to the cytoplasmic tail of the CAR to provide additional signals to the T cell. "Second generation" CARs provide both co-stimulation (e.g., CD28 or 4- 1BB) and activation (CD3ζ). Preclinical studies have indicated that "Second Generation" CARs can improve the anti-tumor activity of immunoresponsive cell, such as a T cell. "Third generation" CARs have multiple intracellular co-stimulation signaling domains (e.g., CD28 and 4- IBB) and an intracellular activation signaling domain (CD3ζ).

[0173] In some embodiments, the extracellular antigen-binding domain of a CAR of the present disclosure binds to one or more antigens expressed on a cell, such as a solid tumor cell, with a dissociation constant (KD) of about 2 x 10-7M or less, about 1 x 10-7M or less, about 9 x 10-8M or less, about 1 x 10-8M or less, about 9 x 10-9M or less, about 5 x 10-9M or less, about 4 x 10-9M or less, about 3 x 10-9M or less, about 2 x 10-9M or less, or about 1 x 10-9M or less. In some embodiments, the KD ranges from about is about 2 x 10-7M to about 1 x 10-9M.

[0174] Binding of the extracellular antigen-binding domain of a CAR of the present disclosure can be determined by, for example, an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), FACS analysis, a bioassay (e.g., growth inhibition), or a Western Blot assay. Each of these assays generally detect the presence of protein-antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody or scFv) specific for the complex of interest. For example, the scFv can be radioactively labeled and used in an RIA assay. The radioactive isotope can be detected by such means as the use of a y counter or a scintillation counter or by autoradiography. In certain embodiments, the extracellular antigenbinding domain of the CAR is labeled with a fluorescent marker. Non-limiting examples of fluorescent markers include green fluorescent protein (GFP), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, and mKalamal), cyan fluorescent protein (e.g., ECFP, Cerulean, and CyPet), and yellow fluorescent protein (e.g., YFP, Citrine, Venus, and YPet).

[0175] In some embodiments, CARs of the present disclosure comprise an extracellular antigen-binding domain that binds to one or more antigens expressed on a solid tumor (e.g. , a tumor of the lung, pancreas, gastrointestinal tract, colon, brain, neuronal tissue, endocrine, bone, bone marrow, immune system, muscle, liver, gallbladder, kidney, urinary bladder, male reproductive organs, female reproductive organs, adipose, soft tissue, or skin) cell, a transmembrane domain, and one or more intracellular signaling domains. In some embodiments,the extracellular antigen-binding domain comprises an scFv. In some embodiments, the extracellular antigen-binding domain comprises a Fab fragment, which may be crosslinked. In certain embodiments, the extracellular binding domain is a F(ab)2fragment.Extracellular antigen-binding domain

[0176] In some embodiments, the extracellular antigen-binding domain of a CAR of the present disclosure specifically binds to one or more antigens expressed on a solid tumor cell, such as a tumor of the lung, pancreas, gastrointestinal tract, colon, brain, neuronal tissue, endocrine, bone, bone marrow, immune system, muscle, liver, gallbladder, kidney, urinary bladder, male reproductive organs, female reproductive organs, adipose, soft tissue, or skin cell. In certain embodiments, the extracellular antigen-binding domain binds to one or more antigens expressed on a solid tumor cell (solid tumor antigens). In some embodiments, the one or more solid tumor antigens are human polypeptides.

[0177] Antigen-binding domains of the present disclosure can include any domain that binds to the antigen including, without limitation, a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a bispecific antibody, a conjugated antibody, a human antibody, a humanized antibody, and a functional fragment thereof, including but not limited to a singledomain antibody (sdAb) such as a heavy chain variable domain (VH), a light chain variable domain (VL) and a variable domain (VHH) of camelid derived nanobody, and to an alternative scaffold known in the art to function as antigen-binding domain, such as a recombinant fibronectin domain, a T cell receptor (TCR), a recombinant TCR with enhanced affinity, or a fragment thereof, e.g., single chain TCR, and the like. In some instances, it is beneficial for the antigen-binding domain to be derived from the same species in which the CAR will ultimately be used in. For example, for use in humans, it may be beneficial for the antigen-binding domain of the CAR to comprise human or humanized residues for the antigen-binding domain of an antibody or antibody fragment.

[0178] In some embodiments, the extracellular antigen-binding domain comprises an antibody. In certain embodiments, the antibody is a human antibody. In certain embodiments, the antibody is a humanized antibody. In certain embodiments, the antibody is a chimeric antibody. In some embodiments, the extracellular antigen-binding domain comprises an antigenbinding fragment of an antibody.

[0179] In some embodiments, the extracellular antigen-binding domain comprises a F(ab) fragment. In certain embodiments, the extracellular antigen-binding domain comprises a F(ab') fragment.

[0180] In some embodiments, the extracellular antigen-binding domain comprises an scFv.

[0181] Various scFvs derived from antibodies capable of binding to a CEA antigen are provided in Table 4. Various scFvs derived from antibodies capable of binding to a TROP2 antigen are provided in Table 5. In some embodiments, the extracellular antigen-binding domain comprises an scFv as provided in Table 4 or Table 5 or an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an scFv as provided in Table 4 or Table 5.

[0182] In some embodiments, the extracellular antigen-binding domain comprises two single chain variable fragments (scFvs). In some embodiments, each of the two scFvs binds to a distinct epitope on the same antigen. In some embodiments, the extracellular antigen-binding domain comprises a first scFv and a second scFv. In some embodiments, the first scFv and the second scFv bind distinct epitopes on the same antigen. In certain embodiments, the scFv is a human scFv. In certain embodiments, the scFv is a humanized scFv. In certain embodiments, the scFv is a chimeric scFv. In certain embodiments, the scFv comprises a heavy chain variable domain (VH) and a light chain variable domain (VL). In certain embodiments, the VH and VL are separated by a peptide linker. In some embodiments, the peptide linker comprises an amino acid sequence as shown in Table 6.

[0183] In certain embodiments, the peptide linker is encoded by a nucleic acid comprising the sequence of GGCGGAGGCGGATCAGGTGGCGGAGGAAGTGGCGGCGGAGGATCT (SEQ ID NO: 109).

[0184] In certain embodiments, the scFv comprises the structure VH-L-VL or VL-L-VH, wherein VH is the heavy chain variable domain, L is the peptide linker, and VL is the light chain variable domain.

[0185] In some embodiments, each of the one or more scFvs comprises the structure VH-L-VL or VL-L-VH, wherein VH is the heavy chain variable domain, L is the peptide linker, and VL is the light chain variable domain. When there are two or more scFv linked together, each scFv can be linked to the next scFv with a peptide linker. In some embodiments, each of the one or more scFvs is separated by a peptide linker. In some embodiments, the peptide linker separating each of the scFvs comprises an amino acid sequence as shown in Table 6.

[0186] In some embodiments, the peptide linker comprises an amino acid sequence of GGS. In some embodiments, the peptide linker comprises an amino acid sequence of GGSGGS (SEQ ID NO: 92). In some embodiments, the peptide linker comprises an amino acid sequence of GGSGGSGGS (SEQ ID NO: 93). In some embodiments, the peptide linker comprises an amino acid sequence of GGSGGSGGSGGS (SEQ ID NO: 94). In some embodiments, the peptide linker comprises an amino acid sequence of GGSGGSGGSGGSGGS (SEQ ID NO: 95). In some embodiments, the peptide linker comprises an amino acid sequence of GGGS (SEQ IDNO: 96). In some embodiments, the peptide linker comprises an amino acid sequence of GGGSGGGS (SEQ ID NO: 97). In some embodiments, the peptide linker comprises an amino acid sequence of GGGSGGGSGGGS (SEQ ID NO: 98). In some embodiments, the peptide linker comprises an amino acid sequence of GGGSGGGSGGGSGGGS (SEQ ID NO: 99). In some embodiments, the peptide linker comprises an amino acid sequence of GGGSGGGSGGGSGGGSGGGS (SEQ ID NO: 100). In some embodiments, the peptide linker comprises an amino acid sequence of GGGGS (SEQ ID NO: 101). In some embodiments, the peptide linker comprises an amino acid sequence of GGGGSGGGGS (SEQ ID NO: 102). In some embodiments, the peptide linker comprises an amino acid sequence of GGGGSGGGGSGGGGS (SEQ ID NO: 103). In some embodiments, the peptide linker comprises an amino acid sequence of GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 104). In some embodiments, the peptide linker comprises an amino acid sequence of GGGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 105). In some embodiments, the peptide linker comprises an amino acid sequence of GSTSGSGKPGSGEGSTKG (SEQ ID NO: 106). In some embodiments, the peptide linker comprises an amino acid sequence of EAAAI<EAAAI<EAAAI<EAAAI< (SEQ IDN NO: 107). In some embodiments, the peptide linker comprises an amino acid sequence of GGSGSGGSGSGGSGS (SEQ ID NO: 108).

[0187] In some embodiments, the CAR comprises a plurality of antigen binding domains. In some embodiments, the CAR comprises a first and a second antigen-binding domain. In some embodiments, the each antigen binding domain comprises a VH and a VL. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having a structure selected from the group consisting of: VH2- VL1-VH1-VL2; VL1-VH1-VL2-VH2; VL1-VH1-VH2-VL2; VL2-VH2-VL1-VH1; VL2-VH2-VH1- VLi; VL1-VL2-VH2-VH1; VL1-VH2-VL2-VH1; and VL2-VL1-VH1-VH2; wherein VH1is the VH of the first antigen binding domain, VL1is the VL of the first antigen binding domain, VH2is the VH of the second antigen-binding domain, and VL2is the VL of the second antigen binding site, and wherein each VH or VL is joined to the adjacent VH or VL by a linker. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VH2-VL1-VH1-VL2. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL1-VH1-VL2-VH2. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL1-VH1-VH2-VL2. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL2-VH2-VL1-VH1. In someembodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL2-VH2-VH1-VL1. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL1-VL2-VH2-VH1. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL1-VH2-VL2-VH1. In some embodiments, the VH and the VL of the first and second antigen-binding domains are configured in a polypeptide chain having the structure of VL2-VL1-VH1-VH2.

[0188] In some embodiments, the cell comprises a first chimeric receptor and a second chimeric receptor. The antigen binding domain of the first chimeric receptor and the antigen binding domain of the second chimeric receptor can be an appropriate antigen biding domain described herein or known in the art. For example, the first or second antigen binding domain can be one or more antibodies, antigen-binding fragments of an antibody, F(ab) fragments, F(ab') fragments, single chain variable fragments (scFvs), or single-domain antibodies (sdAbs). In some embodiments, the antigen-binding domain of the first chimeric receptor and / or the second chimeric receptor comprises two single chain variable fragments (scFvs). In some embodiments, each of the two scFvs binds to a distinct epitope on the same antigen.

[0189] In some embodiments, the extracellular antigen-binding domain comprises a single-domain antibody (sdAb). In certain embodiments, the sdAb is a humanized sdAb. In certain embodiments, the sdAb is a chimeric sdAb.

[0190] In some embodiments, a CAR of the present disclosure may comprise two or more antigen-binding domains, three or more antigen-binding domains, four or more antigenbinding domains, five or more antigen-binding domains, six or more antigen-binding domains, seven or more antigen-binding domains, eight or more antigen-binding domains, nine or more antigen-binding domains, or ten or more antigen-binding domains. In some embodiments, each of the two or more antigen-binding domains binds the same antigen. In some embodiments, each of the two or more antigen-binding domains binds a different epitope of the same antigen. In some embodiments, each of the two or more antigen-binding domains binds a different antigen. In some embodiments, the two or more antigen-binding domains provide the CAR with logic gating, such as OR logic gating.

[0191] In some embodiments, the CAR comprises two antigen-binding domains. In some embodiments, the two antigen-binding domains are attached to one another via a flexible linker. In some embodiments, each of the two-antigen-binding domains may be independently selected from an antibody, an antigen-binding fragment of an antibody, an scFv, a sdAb, a recombinant fibronectin domain, a T cell receptor (TCR), a recombinant TCR with enhancedaffinity, and a single chain TCR. In some embodiments, the CAR comprising two antigenbinding domains is a bispecific CAR or a tandem CAR (tanCAR).

[0192] In certain embodiments, the bispecific CAR or tanCAR comprises an antigenbinding domain comprising a bispecific antibody or antibody fragment (e.g., scFv). In some embodiments, within each antibody or antibody fragment (e.g., scFv) of a bispecific antibody molecule, the VH can be upstream or downstream of the VL. In some embodiments, the upstream antibody or antibody fragment (e.g., scFv) is arranged with its VH (VH1) upstream of its VL (VL1) and the downstream antibody or antibody fragment (e.g., scFv) is arranged with its VL (VL2) upstream of its VH (VH2), such that the overall bispecific antibody molecule has the arrangement VH1-VL1-VL2-VH2. In other embodiments, the upstream antibody or antibody fragment (e.g., scFv) is arranged with its VL (VL1) upstream of its VH (VH1) and the downstream antibody or antibody fragment (e.g., scFv) is arranged with its VH (VH2) upstream of its VL (VL2), such that the overall bispecific antibody molecule has the arrangement VL1VH1-VH2-VL2. In some embodiments, a linker is disposed between the two antibodies or antibody fragments (e.g., scFvs), for example, between VL1and VL2if the construct is arranged as VH1-VL1-VL2-VH2, or between VH1and VH2if the construct is arranged as VL1-VH1-VH2- VL2. The linker may be a linker as described herein, e.g., a (Gly4-Ser)n(SEQ ID NO: 521) linker, wherein n is 1 , 2, 3, 4, 5, or 6. In general, the linker between the two scFvs should be long enough to avoid mispairing between the domains of the two scFvs. In some embodiments, a linker is disposed between the VL and VH of the first scFv. In some embodiments, a linker is disposed between the VL and VH of the second scFv. In constructs that have multiple linkers, any two or more of the linkers may be the same or different. Accordingly, in some embodiments, a bispecific CAR or tanCAR comprises VLs, VHs, and may further comprise one or more linkers in an arrangement as described herein.

[0193] In some embodiments, the bivalent receptor comprises a TROP2 antigen-binding domain and a CEA antigen-binding domain. In some embodiments, the bivalent receptor comprises a TROP2 antigen-binding domain and a CEACAM1 antigen-binding domain. TROP2 antigen-binding domain and a CEACAM5 antigen-binding domain. TROP2 antigen-binding domain and a CEACAM6 antigen-binding domain.

[0194] In some embodiments, the bivalent chimeric receptor comprises a CAR with an antigen binding domain targeting TROP2 and an antigen binding domain targeting any antigen provided in Table 1. In some embodiments, the bivalent chimeric receptor comprises a CAR with an antigen binding domain derived from an antibody as provided in Table 2 and an additional antigen binding domain derived from an antibody as provided in Table 3. In some embodiments, the bivalent chimeric receptor comprises a CAR with an antigen binding domainincluding an scFv as provided in Table 4 and / or an scFv as provided in Table 5. In some embodiments, the bivalent chimeric antigen receptor comprises a CAR with any combination of two or more antigen binding domains as described herein.

[0195] In some embodiments, chimeric receptors comprise a bicistronic chimeric antigen receptor system, e.g. , a chimeric antigen receptor system that comprises an activating CAR and an inhibitory CAR. In some embodiments, the bicistronic chimeric antigen receptor system comprises a bivalent CAR with an antigen binding domain targeting TROP2 and an antigen binding domain targeting any antigen provided in Table 1 and an inhibitory CAR, e.g., with an antigen binding domain targeting any antigen provided in Table 11. In some embodiments, the bicistronic chimeric antigen receptor system comprises a CAR with an antigen binding domain derived from an antibody as provided in Table 2 and an additional antigen binding domain derived from an antibody as provided in Table 3 and an inhibitory CAR, e.g., with an antigen binding domain targeting any antigen provided in Table 11. In some embodiments, the bicistronic chimeric antigen receptor system comprises a CAR with any combination of two or more antigen binding domains as described herein, wherein at least one antigen binding domain is an activating CAR, and at least one antigen binding domain is an inhibitory CAR.Transmembrane domain

[0196] In some embodiments, the transmembrane domain of a CAR of the present disclosure comprises a hydrophobic alpha helix that spans at least a portion of a cell membrane. It has been shown that different transmembrane domains can result in different receptor stability. After antigen recognition, receptors cluster and a signal is transmitted to the cell. In some embodiments, the transmembrane domain of a CAR of the present disclosure can comprise the transmembrane domain of a CD8 polypeptide, a CD28 polypeptide, a CD25 polypeptide, a CD7 polypeptide, a CD3-zeta polypeptide, a CD4 polypeptide, a 4- IBB polypeptide, an 0X40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a LAX polypeptide, a LAT polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a TIM3 polypeptide, a KIR3DS1 polypeptide, a KIR3DL1 polypeptide, an NKG2D polypeptide, an NKG2A polypeptide, a TIGIT polypeptide, a 2B4 polypeptide, a BTLA polypeptide, a LIR-1 (LILRB1) polypeptide, or can be a synthetic peptide, or any combination thereof.

[0197] In some embodiments, the transmembrane domain is derived from a CD8 polypeptide. Any suitable CD8 polypeptide may be used. Exemplary CD8 polypeptides include, without limitation, NCBI Reference Nos. NP_001139345 and AAA92533.1. In some embodiments, the transmembrane domain is derived from a CD28 polypeptide. Any suitable CD28 polypeptide may be used. Exemplary CD28 polypeptides include, without limitation,NCBI Reference Nos. NP 006130.1 and NP 031668.3. In some embodiments, the transmembrane domain is derived from a CD3-zeta polypeptide. Any suitable CD3-zeta polypeptide may be used. Exemplary CD3-zeta polypeptides include, without limitation, NCBI Reference Nos. NP 932170.1 and NP 001106862.1. In some embodiments, the transmembrane domain is derived from a CD4 polypeptide. Any suitable CD4 polypeptide may be used. Exemplary CD4 polypeptides include, without limitation, NCBI Reference Nos. NP 000607.1 and NP 038516.1. In some embodiments, the transmembrane domain is derived from a 4-1BB polypeptide. Any suitable 4- IBB polypeptide may be used. Exemplary 4- IBB polypeptides include, without limitation, NCBI Reference Nos. NP 001552.2 and NP 001070977.1. In some embodiments, the transmembrane domain is derived from an 0X40 polypeptide. Any suitable 0X40 polypeptide may be used. Exemplary 0X40 polypeptides include, without limitation, NCBI Reference Nos. NP_003318.1 and NP_035789.1. In some embodiments, the transmembrane domain is derived from an ICOS polypeptide. Any suitable ICOS polypeptide may be used. Exemplary ICOS polypeptides include, without limitation, NCBI Reference Nos. NP 036224 and NP 059508. In some embodiments, the transmembrane domain is derived from a CTLA-4 polypeptide. Any suitable CTLA-4 polypeptide may be used. Exemplary CTLA-4 polypeptides include, without limitation, NCBI Reference Nos. NP_005205.2 and NP_033973.2. In some embodiments, the transmembrane domain is derived from a PD-1 polypeptide. Any suitable PD-1 polypeptide may be used. Exemplary PD-1 polypeptides include, without limitation, NCBI Reference Nos. NP 005009 and NP 032824. In some embodiments, the transmembrane domain is derived from a LAG-3 polypeptide. Any suitable LAG-3 polypeptide may be used. Exemplary LAG-3 polypeptides include, without limitation, NCBI Reference Nos. NP 002277.4 and NP_032505.1. In some embodiments, the transmembrane domain is derived from a 2B4 polypeptide. Any suitable 2B4 polypeptide may be used. Exemplary 2B4 polypeptides include, without limitation, NCBI Reference Nos. NP 057466.1 and NP 061199.2. In some embodiments, the transmembrane domain is derived from a BTLA polypeptide. Any suitable BTLA polypeptide may be used. Exemplary BTLA polypeptides include, without limitation, NCBI Reference Nos. NP_861445.4 and NP_001032808.2. Any suitable LIR-1 (LILRB1) polypeptide may be used. Exemplary LIR-1 (LILRB1) polypeptides include, without limitation, NCBI Reference Nos. NP OO 1075106.2 and NP_001075107.2.

[0198] In some embodiments, the transmembrane domain comprises a polypeptide comprising an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% homologous to the sequence of NCBI Reference No. NP_001139345, AAA92533.1, NP_006130.1, NP_031668.3, NP_932170.1, NP 001106862.1, NP 000607.1, NP_038516.1,NP_001552.2, NP_OO 1070977.1, NP_003318.1, NP_035789.1, NP_036224, NP_059508, NP_005205.2, NP_033973.2, NP_005009, NP_032824, NP_002277.4, NP_032505.1, NP 057466.1, NP 061199.2, NP_861445.4, or NP_001032808.2, or fragments thereof. In some embodiments, the homology may be determined using standard software such as BLAST or FASTA. In some embodiments, the polypeptide may comprise one conservative amino acid substitution, up to two conservative amino acid substitutions, or up to three conservative amino acid substitutions. In some embodiments, the polypeptide can have an amino acid sequence that is a consecutive portion of NCBI Reference No. NP_001139345, AAA92533.1, NP_006130.1, NP_031668.3, NP_932170.1, NP 001106862.1, NP 000607.1, NP_038516.1, NP_001552.2, NP_001070977.1, NP_003318.1, NP_035789.1, NP_036224, NP_059508, NP_005205.2, NP_033973.2, NP_005009, NP_032824, NP_002277.4, NP_032505.1, NP_057466.1, NP 061199.2, NP_861445.4, or NP_001032808.2 that is at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, or at least 240 amino acids in length.

[0199] Further examples of suitable polypeptides from which a transmembrane domain may be derived include, without limitation, the transmembrane region(s) of the alpha, beta or zeta chain of the T-cell receptor, CD27, CD3 epsilon, CD45, CD5, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, KIRDS2, CD2, CD27, LFA-1 (CDl la, CD 18), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7Ra, ITGA1, VLA1 , CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDl ld, ITGAE, CD103, ITGAL, CDl la, LFA-1, ITGAM, CDl lb, ITGAX, CDl lc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD 150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, PAG / Cbp, NKG2D, and NG2C. In some embodiments, a transmembrane domain may comprise any of the amino acid sequences listed in Table 7, or an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any of the amino acid sequences listed in Table 7.Spacer region

[0200] In some embodiments, a CAR of the present disclosure can also comprise a spacer region that links the extracellular antigen-binding domain to the transmembrane domain. The spacer region may be flexible enough to allow the antigen-binding domain to orient in different directions to facilitate antigen recognition. In some embodiments, the spacer region may be a hinge from a human protein. For example, the spacer (also referred to herein as “hinge”) may be a human Ig (immunoglobulin) hinge, including without limitation an IgG4 hinge, an IgG2 hinge, a CD8a hinge, or an IgD hinge. In some embodiments, the spacer region may comprise an IgG4 hinge, an IgG2 hinge, an IgD hinge, a CD28 hinge, a KIR2DS2 hinge, an LNGFR hinge, or a PDGFR-beta extracellular linker. In some embodiments, the spacer region is localized between the antigen-binding domain and the transmembrane domain. In some embodiments, a spacer region may comprise any of the amino acid sequences listed in Table 8, or an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any of the amino acid sequences listed in Table 8. In some embodiments, nucleic acids encoding any of the spacer regions of the present disclosure may comprise any of the nucleic acid sequences listed in Table 8, or a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any of the nucleic acid sequences listed in Table 9.

[0201] In some embodiments, the spacer region comprises the CD28 hinge sequence shown in Table 8. In some embodiments, the spacer region comprises the CD8 hinge sequence shown in Table 8. In some embodiments, the spacer region comprises the IgG4 minimal hinge sequence shown in Table 8. In some embodiments, the spacer region comprises the IgG4minimal hinge, no disulfides sequence shown in Table 8. In some embodiments, the spacer region comprises the IgG4 S228P minimal hinge, enhanced disulfide formation sequence shown in Table 8. In some embodiments, the spacer region comprises the IgGl minimal hinge sequence shown in Table 8. In some embodiments, the spacer region comprises the Extended CD8a hinge sequence shown in Table 8. In some embodiments, the spacer region comprises the LNGFR hinge sequence shown in Table 8. In some embodiments, the spacer region comprises the Truncated LNGFR hinge (TNFR-Cys1) sequence shown in Table 8. In some embodiments, the spacer region comprises the PDGFR-beta extracellular linker sequence shown in Table 8.

[0202] In some embodiments, a CAR of the present disclosure may further include a short oligopeptide or polypeptide linker that is between 2 amino acid residues and 10 amino acid residues in length, and that may form the linkage between the transmembrane domain and the cytoplasmic region of the CAR. A non-limiting example of a suitable linker is a glycine-serine doublet. In some embodiments, the linker comprises the amino acid sequence of GGCKJSGGCKJS (SEQ ID NO: 134).Intracellular signaling domains

[0203] In some embodiments, a CAR of the present disclosure comprises one or more cytoplasmic domains or regions. The cytoplasmic domain or region of the CAR may include an intracellular signaling domain. An intracellular signaling domain is typically responsible for activation of one or more effector functions of an immune cell (e.g. , a T cell or an NK cell) that has been engineered to express a CAR of the present disclosure. For example, an effector function of a T cell may be cytolytic activity or helper activity, such as the secretion of cytokines. Accordingly, in some embodiments the term "intracellular signaling domain" refers to the portion of a protein which transduces an effector function signal and directs the cell to perform a specialized function. While the entire intracellular signaling domain may be employed, in many instances it is not necessary to use the entire chain. In embodiments where a truncated portion of the intracellular signaling domain is used, such a truncated portion may be used in place of the corresponding intact chain as long as the truncated portion transduces the effector function signal.

[0204] Examples of suitable intracellular signaling domains that may be used in CARs of the present disclosure include, without limitation, cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability.

[0205] Without wishing to be bound by theory, it is believed that signals generated through the TCR alone are insufficient for full activation of the T cell and that a secondary and / or costimulatory signal is thus also required for full activation. Accordingly, T cell activation may be mediated by two distinct classes of cytoplasmic signaling sequences, those that initiate antigen-dependent primary activation through the TCR (primary intracellular signaling domains) and those that act in an antigen-independent manner to provide a secondary or costimulatory signal (secondary cytoplasmic domain, e.g., a costimulatory domain).

[0206] In some embodiments, a primary signaling domain regulates primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way. Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs (IT AMs). Examples of suitable ITAM-containing primary intracellular signaling domains that that may be used in the CARs of the present disclosure include, without limitation, those of CD3-zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), FCERI, DAP10, DAP12, and CD66d.

[0207] In some embodiments, a CAR of the present disclosure comprises an intracellular signaling domain, e.g., a primary signaling domain of CD3-zeta polypeptide. A CD3-zeta polypeptide of the present disclosure may have an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% homologous to the sequence of NCBI Reference No. NP 932170 or NP 001106864.2, or fragments thereof. In some embodiments, the CD3-zeta polypeptide may comprise one conservative amino acid substitution, up to two conservative amino acid substitutions, or up to three conservative amino acid substitutions. In some embodiments, the polypeptide can have an amino acid sequence that is a consecutive portion of NCBI Reference No. NP_932170 or NP 001106864.2 that is at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, or at least 160, at least 170, or at least 180 amino acids in length.

[0208] In other embodiments, a primary signaling domain comprises a modified IT AM domain, e.g., a mutated ITAM domain which has altered (e.g., increased or decreased) activity as compared to the native ITAM domain. In one embodiment, a primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, e.g., an optimized and / or truncated ITAM-containing primary intracellular signaling domain. In one embodiment, a primary signaling domain comprises one, two, three, four or more ITAM motifs.

[0209] In some embodiments, the intracellular signaling domain of a CAR of the present disclosure can comprise the CD3-zeta signaling domain by itself or it can be combined with any other desired intracellular signaling domain(s) useful in the context of a CAR of the present disclosure. For example, the intracellular signaling domain of the CAR can comprise a CD3-zeta chain portion and a costimulatory signaling domain. The costimulatory signaling domain may refer to a portion of the CAR comprising the intracellular domain of a costimulatory molecule. A costimulatory molecule of the present disclosure is a cell surface molecule other than an antigen receptor or its ligands that may be required for an efficient response of lymphocytes to an antigen. Examples of suitable costimulatory molecules include, without limitation, CD97, CD2, ICOS, CD27, CD154, CD8, 0X40, 4-1BB, CD28, ZAP40, CD30, GITR, HVEM, DAP10, DAP12, MyD88, 2B4, CD40, PD-1, lymphocyte function-associated antigen-1 (LFA-1), CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, an MHC class I molecule, a TNF receptor protein, an Immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocytic activation molecule (SLAM protein), an activating NK cell receptor, BTLA, a Toll ligand receptor, CDS, ICAM-1, (CD1 la / CD18), BAFFR, KIRD3S1, KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDl ld, ITGAE, CD103, ITGAL, CDl la, ITGAM, CDl lb, ITGAX, CDl lc, ITGB1, CD29, ITGB2, CD 18, ITGB7, NKG2D, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD 160 (BY55), PSGL1, CD 100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD 150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, CD 19a, and the like.

[0210] Non-limiting examples of activating intracellular signaling domains (ICDs) are provided in Table 10A.Table 10A

[0211] In some embodiments, the intracellular signaling sequences within the cytoplasmic portion of a CAR of the present disclosure may be linked to each other in a random or specified order. In some embodiments, a short oligopeptide or polypeptide linker, for example, between 2 amino acids and 10 amino acids (e.g., 2 amino acids, 3 amino acids, 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, 8 amino acids, 9 amino acids, or 10 amino acids) in length may form the linkage between intracellular signaling sequences. In one embodiment, a glycine-serine doublet can be used as a suitable linker. In one embodiment, a single amino acid, e.g., an alanine or a glycine, can be used as a suitable linker.

[0212] In some embodiments, the intracellular signaling domain comprises two or more costimulatory signaling domains, e.g. , two costimulatory signaling domains, three costimulatory signaling domains, four costimulatory signaling domains, five costimulatory signaling domains, six costimulatory signaling domains, seven costimulatory signaling domains, eight costimulatory signaling domains, nine costimulatory signaling domains, 10 costimulatory signaling domains, or more costimulatory signaling domains. In one embodiment, the intracellular signaling domain comprises two costimulatory signaling domains. In some embodiments, the two or more costimulatory signaling domains are separated by a linker of the present disclosure. In one embodiment, the linker is a glycine residue. In another embodiment, the linker is an alanine residue.

[0213] In some embodiments, a CAR of the present disclosure further includes an epitope tag. An epitope tag is a polypeptide sequence included within a polypeptide as a label that can be detected, for example, by a monoclonal antibody. Examples of epitope tags include a FLAG tag, a strep tag, an HA tag, a V5 tag, and a myc tag. An exemplary epitope tag is a myc tag of amino acid sequence EQKLISEEDL (SEQ ID NO: 153).

[0214] In some embodiments, a cell of the present disclosure expresses a CAR that includes an antigen-binding domain that binds a target antigen of the present disclosure, a transmembrane domain of the present disclosure, a primary signaling domain, and one or more costimulatory signaling domains.Natural killer CARs (NK CARs)

[0215] In some embodiments, a CAR of the present disclosure comprises one or more components of a natural killer (NK) cell, thereby forming an NK CAR. The NK component may be a transmembrane domain, a hinge domain, or a cytoplasmic domain from any suitable natural killer cell receptor, including without limitation, a killer cell immunoglobulin-like receptor (KIR), such as KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, DIR2DS5, KIR3DL1, KIR3DS1, KIR3DL2, KIR3DL3, KIR2DP1, and KIRS DPI; a natural cytotoxicity receptor (NCR), such as NKp30, NKp44, NKp46; a signaling lymphocyte activation molecule (SLAM) family of immune cell receptor, such as CD48, CD229, 2B4, CD84, NTB-A, CRACC, BLAME, and CD2F-10; an Fc receptor (FcR), such as CD16, and CD64; and an Ly49 receptor, such as LY49A and LY49C. In some embodiments, the NK-CAR may interact with an adaptor molecule or intracellular signaling domain, such as DAP 12. The structural components as described above of a CAR are also applicable to the structure of an NK CAR.

[0216] Exemplary configurations and sequences of CARs comprising NK receptor components are described in International Patent Publication WO2014 / 145252, published September 18, 2014.

[0217] One advantage of CAR NK cell therapy relative to CAR T therapy is the significantly decreased risk of inducing graft versus host disease (GvHD). Accordingly, as no severe toxicities are observed or expected to occur with CAR NK cells, treatment can be administered without requiring hospitalization, significantly reducing the huge indirect costs associated with CAR-T cell-based therapy due to hospitalization post-treatment (Oberschmidt et al. (2017), Front Immunol, 8:654).Chimeric inhibitory receptors

[0218] Certain aspects of the present disclosure relate to chimeric inhibitory receptors. Chimeric inhibitory receptors are useful, for example, as NOT logic gates for controlling cell activity, such as immune cell activity. In some embodiments, chimeric inhibitory receptors of the present disclosure specifically bind to one or more antigens that are expressed on normal cells but not on tumor cells.

[0219] In some embodiments, the chimeric inhibitory receptor comprises an antigenbinding domain, a transmembrane domain of the present disclosure (e.g., any suitable transmembrane domain used in conjunction with a chimeric receptor of the present disclosure), and an intracellular domain. In some embodiments, the chimeric inhibitory receptor may inhibit one or more activities of a cell, such as an immunoresponsive cell.

[0220] In some embodiments, the chimeric inhibitory receptor may comprise an enzymatic inhibitory domain. When the chimeric inhibitory receptor is located proximal to a receptor, such as an immune receptor in a cell membrane, binding of a cognate antigen to the antigen-binding domain activates the enzymatic inhibitory domain to inhibit activation of the receptor. As used herein, the term “enzymatic inhibitory domain” refers to a protein domain that inhibits an intracellular signal transduction cascade, for example a native T cell activation cascade. The disclosed chimeric inhibitory receptors thus can be engineered to contain appropriate antigen-binding domains that will reduce, for example, immune responses in the presence of the cognate antigen. Uses of chimeric inhibitory receptors of the present disclosure include, but are not limited to, reducing immune responses, controlling T cell activation, and controlling CAR-NK or CAR-T responses.

[0221] In some embodiments, the enzymatic inhibitory domain of a chimeric inhibitory receptor of the present disclosure comprises at least a portion of an extracellular domain, a transmembrane domain, and / or an intracellular domain. In some embodiments, the enzymatic inhibitory domain comprises at least a portion of an enzyme. In some embodiments, the enzymeis selected from CSK, SHP-1, PTEN, CD45, CD148, PTP-MEG1, PTP-PEST, c-CBL, CBL-b, PTPN22, LAR, PTPH1, SHIP-1, and RasGAP (see e.g., Stanford et al., Regulation of TCR signaling by tyrosine phosphatases: from immune homeostasis to autoimmunity, Immunology, 2012 Sep; 137(1): 1-19). In some embodiments, the portion of the enzyme comprises an enzyme domain(s), an enzyme fragment(s), or a mutant(s) thereof. In some embodiments, the portion of the enzyme is a catalytic domain of the enzyme. In some embodiments, the enzyme domain(s), enzyme fragment(s), or mutants(s) thereof are selected to maximize efficacy and minimize basal inhibition.

[0222] In some embodiments, the enzymatic inhibitory domain comprises one or more modifications that modulate basal inhibition. Examples of modifications include, but are not limited to, truncation mutation(s), amino acid substitution(s), introduction of locations for post- translational modification (examples of which are known to those having skill in the art), and addition of new functional groups. In some embodiments, the enzyme domain(s), enzyme fragment(s), or mutants(s) thereof are selected to maximize efficacy and minimize basal inhibition. In some embodiments, the one or more modifications reduce basal inhibition. In other embodiments, the one or more modifications increase basal inhibition.

[0223] In some embodiments, the enzymatic inhibitory domain inhibits, for example, immune receptor activation upon recruitment of a chimeric inhibitory receptor of the present disclosure proximal to an immune receptor. In some embodiments, the immune receptor is a naturally occurring immune receptor. In some embodiments, the immune receptor is a naturally occurring antigen receptor. In some embodiments, the immune receptor is selected from a T cell receptor, a pattern recognition receptor (PRR), a NOD-like receptor (NLR), a Toll-like receptor (TLR), a killer activated receptor (KAR), a killer inhibitor receptor (KIR), a complement receptor, an Fc receptor, a B cell receptor, and a cytokine receptor. In some embodiments, the immune receptor is a T cell receptor. In some embodiments, the immune receptor is a chimeric immune receptor. In some embodiments, the chimeric immune receptor is a chimeric TCR or a CAR.

[0224] In some embodiments, a chimeric inhibitory receptor of the present disclosure may also comprise one or more intracellular inhibitory co-signaling domains. In some embodiments, the intracellular inhibitory co-signaling domains comprise an inhibitory domain. In some embodiments, the one or more intracellular inhibitory co-signaling domains comprise one or more ITIM-containing protein, or fragment(s) thereof. ITIMs are conserved amino acid sequences found in cytoplasmic tails of many inhibitory immune receptors. In some embodiments, the one or more ITIM-containing proteins, or fragments thereof, are selected from PD-1, CTLA4, TIGIT, and LAIR1. In some embodiments, the one or more intracellularinhibitory co-signaling domains comprise one or more non-ITIM scaffold proteins, or a fragment(s) thereof. In some embodiments, the one or more non-ITIM scaffold proteins, or fragments thereof, are selected from GRB-2, Dok-1, Dok-2, SLAP, LAG3, HAVR, BTLA, GITR, and PD-L1. Further examples suitable intracellular inhibitory co-signaling domains include, without limitation, PD-L1, SIRPα, TIM3, LIR1, NKG2A, VISTA, CD 160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, KIR3DL1, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGF beta. Non-limiting examples of inhibitory intracellular domains are provided in Table 10B.Table 10B

[0225] In some embodiments, the inhibitory chimeric receptor binds an antigen that is expressed on a non- tumor cell. Exemplary antigens for use in a chimeric inhibitory receptor are described in Table 11.

[0226] In some embodiments, the chimeric inhibitory receptor binds a VSIG2 antigen. In some embodiments, the chimeric inhibitory receptor binds a CPM antigen. In some embodiments, the chimeric inhibitory receptor binds an ITM2C antigen. In some embodiments, the chimeric inhibitory receptor binds a SLC26A2 antigen. In some embodiments, the chimeric inhibitory receptor binds a SLC4A4 antigen. In some embodiments, the chimeric inhibitory receptor binds a GPA33 antigen. In some embodiments, the chimeric inhibitory receptor binds a PLA2G2A antigen. In some embodiments, the chimeric inhibitory receptor binds an ABCA8 antigen. In some embodiments, the chimeric inhibitory receptor binds an ATP1A2 antigen. In some embodiments, the chimeric inhibitory receptor binds a CHP2 antigen. In some embodiments, the chimeric inhibitory receptor binds an SLC26A3.

[0227] In some embodiments, the chimeric inhibitory receptor is a multispecific receptor comprising two or more antigen-binding domains, such that the chimeric inhibitory receptor can bind two or more antigens. Alternatively, a cell can be edited to express two or more chimeric inhibitory receptors that bind to different antigens.V-set and Immunoglobulin Domain Containing 2 (VSIG2)-Specific Antigen-binding Domains

[0228] The present disclosure provides chimeric proteins, and polynucleotides that encode such chimeric proteins, that bind to V-set and immunoglobulin domain-containing protein 2 (VSIG2). In some embodiments, VSIG2-specific chimeric proteins bind to human VSIG2 (e.g., Uniprot Q96IQ7, herein incorporated by reference for all purposes) or an epitope fragment thereof. VSIG2 can be expressed on epithelial cells. VSIG2 can be expressed on cells generally considered to be healthy, such as healthy epithelial cells. Examples of VSIG2-specific antibodies include OTI2D8 (also known as “2D8” and referred to herein as Ab) and OTI5A10 (also known as “5A10”).

[0229] The present disclosure provides chimeric proteins, and polynucleotides that encode such chimeric proteins, that include a VSIG2-specific antigen-binding domain having one or more of the amino acid sequences listed in Table 12.Table 12: Anti-VSIG2 Antibody (Ab) Sequences

[0230] In some embodiments, the VSIG2-specific antigen-binding domain has a heavy chain variable (VH) region and a light chain variable (VL) region selected from Table 12, Tn some embodiments, the VSIG2-specific antigen-binding domain has a heavy chain variable (VH) region and a light chain variable (VL) region, and the VH comprises a heavy chain complementarity determining region 3 (HCDR3) having the amino acid sequence of QGVRPFFDY (SEQ ID NO: 161). In some embodiments, the VSIG2-specific antigen-binding domain has a VH region comprising an HCDR3 having one or more amino acid substitutions relative to QGVRPFFDY (SEQ ID NO: 161). In some embodiments, the VSIG2-specific antigen-binding domain has a VH region comprising an HCDR3 having the amino acid sequence of QGVX1X2FFDY (SEQ ID NO: 162) where: X1is an amino acid selected from R, A, G, L, M, F, W, K, Q, E, S, P, V, I, C, Y, N, and D; and X2is an amino acid selected from P and A. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region comprising an HCDR3 having the amino acid sequence of QGVXPFFDY (SEQ ID NO: 163), where X is an amino acid selected from R, A, G, L, M, F, W, K, Q, E, S, P, V, I, C, Y, N, and D. In some embodiments, the VSIG2-specific antigen binding domain has an HCDR3 sequence having the amino acid sequence of HCDR3 contained within any one of humanized anti-VSIG2 VL variants 1-27. In some embodiments, the VH further includes a heavy chain complementarity determining region 1 (HCDR1), and a heavy chain complementarity determining region 2 (HCDR2) having the amino acid sequences of HCDR1 and HCDR2 contained within the VH region amino acid sequence of the murine anti-VSIG2 antibody VH region. In some embodiments, the VSIG2-specific antigen-binding domain includes an HCDR1 having the amino acid sequence of GFTFSNS (SEQ ID NO: 159), an HCDR2 having the amino acid sequence of SDGGLY (SEQ ID NO: 160), and an HCDR3 having the amino acid sequence of QGVRPFFDY (SEQ ID NO: 161); QGVX1X2FFDY (SEQ ID NO: 162), where: X1is an amino acid selected from R, A, G, L, M, F, W, K, Q, E, S, P, V, I, C, Y, N, and D; and X2is an amino acid selected from P and A, annotated according to the Chothia scheme; or QGVXPFFDY (SEQ ID NO: 163), where X is an amino acid selected from R, A, G, L, M, F, W, K, Q, E, S, P, V, I, C, Y, N, and D. In some embodiments, the VSIG2-specific antigen-binding domain includes an HCDR1 having the amino acid sequence of NSGMS (SEQ ID NO: 164), an HCDR2 having the amino acid sequence of SISDGGLYTHYPDSVKG (SEQ ID NO: 165) , and an HCDR3 having the amino acid sequence of QGVRPFFDY (SEQ ID NO: 161), or a sequencehaving one or more amino acid substitutions relative to the amino acid sequence of QGVRPFFDY (SEQ ID NO: 161); QGVX1X2FFDY, where: X1is an amino acid selected from R, A, G, L, M, F, W, K, Q, E, S, P, V, I, C, Y, N, and D; and X2is an amino acid selected from P and A, annotated according to the Chothia scheme; or QGVXPFFDY (SEQ ID NO: 163), where X is an amino acid selected from R, A, G, L, M, F, W, K, Q, E, S, P, V, I, C, Y, N, and D, annotated according to the Kabat scheme.

[0231] In some embodiments, the VSIG2-specific antigen-binding domain further includes a light chain complementarity determining region 1 (LCDR1), a light chain complementarity determining region 2 (LCDR2), and a light chain complementarity determining region 3 (LCDR3), wherein the amino acid sequences of LCDR1, LCDR2, and LCDR3 are contained within the VL region amino acid sequence of murine anti-VSIG2 antibody VL region, version 1 or murine anti-VSIG2 antibody VL region, version 2. In some embodiments, the VSIG2-specific antigen-binding domain includes an LCDR1 having the amino acid sequence of RASENIYSYLA (SEQ ID NO: 199) or RASENLYSYLA (SEQ ID NO: 200), an LCDR2 having the amino acid sequence of NAETLPE (SEQ ID NO: 201), and an LCDR3 having the amino acid sequence of QHHYVIPWT (SEQ ID NO: 202).

[0232] In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of murine anti-VSIG2 VH disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of murine anti-VSIG2 VH disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of murine anti-VSIG2 VL, version 1 or version 2 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of murine anti-VSIG2 VL, version 1 or version 2 disclosed in Table 12.

[0233] In some embodiments, the VSIG2-specific antigen-binding domain is a humanized antigen-binding domain. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH disclosed in Table 12.In some embodiments, the VSIG2-specific antigen-binding domain is a humanized antigenbinding domain. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 1 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 1 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 2 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 2 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 3 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 3 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti- VSIG2 VH variant 4 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 4 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 5 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 5 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 6 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%identity to the amino acid sequence of humanized anti-VSIG2 VH variant 6 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 7 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 7 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 8 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 8 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 9 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 9 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti- VSIG2 VH variant 10 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 10 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 11 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 11 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 12 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, atleast 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 12 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 13 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 13 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 14 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 14 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 15 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 15 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 16 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 16 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti- VSIG2 VH variant 17 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 17 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 18 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 18 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 19 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 19 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 20 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 20 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 21 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 21 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 22 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 22 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 23 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 23 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti- VSIG2 VH variant 24 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 24 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 25 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 25 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 26 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 26 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including the amino acid sequence of humanized anti-VSIG2 VH variant 27 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VH variant 27 disclosed in Table 12.

[0234] In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of humanized anti-VSIG2 VL disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VL disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of humanized anti-VSIG2 VL variant 1 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VL variant 1 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of humanized anti-VSIG2 VL variant 2 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence withat least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VL variant 2 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of humanized anti- VSIG2 VL variant 3 disclosed in Table 12. In some embodiments, the VSIG2-specific antigenbinding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VL variant 3 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of humanized anti-VSIG2 VL variant 4 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VL variant 4 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VL region including the amino acid sequence of humanized anti-VSIG2 VL variant 4 disclosed in Table 12. In some embodiments, the VSIG2-specific antigen-binding domain has a VH region including an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of humanized anti-VSIG2 VL variant 4 disclosed in Table 12.

[0235] The VSIG2-specific antigen-binding domain can be in any of the formats described herein, such as a Fab, Fab', F(ab')2, Fv, scFv, linear antibody, single domain antibody such as sdAb (either VL or VH), camelid VHH, and multi-specific formats. In some embodiments, the VSIG2-specific antigen-binding domain is in a F(ab) format. In some embodiments, the VSIG2-specific antigen-binding domain is in a F(ab') format.

[0236] In some embodiments, the VSIG2-specific antigen-binding domain is in a single chain variable fragment (scFv) format, including scFv formats having any of the peptide linkers described herein (e.g., see Table 13). In some embodiments, the VSIG2-specific antigenbinding domain has the structure VH-L-VL or VL-L-VH, where L is the peptide linker. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv comprising an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to and amino acid sequence set forth in Table 13.Table 13. Anti-VSIG2 scFv Sequences

[0237] In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 1 disclosed in Table 13.1n some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acidsequence of anti-VSIG2 scFv 1 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 2 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 2 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 3 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 3 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 4 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 4 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 5 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 5 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 6 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 6 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 7 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 7 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 8 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain isan scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 8 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 9 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 9 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 10 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 10 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 11 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 11 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 12 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 12 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 13 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 13 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 14 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 14 disclosed in Table 13. In someembodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 15 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 15 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 16 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 16 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 17 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 17 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 18 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 18 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 19 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 19 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 20 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 20 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 21 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, atleast 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 21 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 22 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 22 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 23 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 23 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 24 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 24 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 25 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 25 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 26 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 26 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 27 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 27 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is anscFv having the amino acid sequence of anti-VSIG2 scFv 28 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 28 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 29 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 29 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 30 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 30 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 31 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 31 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 32 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 32 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 33 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 33 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 34 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 34 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 35 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 35 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 36 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 36 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 37 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 37 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 38 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 38 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 39 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 39 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv 40 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 40 disclosed in Table 13. In some embodiments, the VSIG2- specific antigen-binding domain is an scFv having the amino acid sequence of anti-VSIG2 scFv41 disclosed in Table 13. In some embodiments, the VSIG2-specific antigen-binding domain is an scFv having an amino acid sequence with at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 41 disclosed in Table 13.Multicistronic Expression Systems

[0238] Provided herein, in various embodiments, are multicistronic expression systems. In some embodiments, the multicistronic expression system comprises: (a) an exogenous polynucleotide encoding a first cytokine; (b) an exogenous polynucleotide encoding a second cytokine; and (c) an exogenous polynucleotide encoding a chimeric antigen receptor (CAR). In certain embodiments, the multicistronic expression system comprises an activating CAR (aCAR) and an inhibitory CAR (iCAR).

[0239] Also provided herein, in various embodiments, are immunoresponsive cells engineered to have the following:

[0240] (a) an exogenous polynucleotide encoding a first cytokine; (b) an exogenous polynucleotide encoding a second cytokine; and (c) an exogenous polynucleotide encoding a chimeric antigen receptor (CAR).

[0241] The multicistronic expression system or immunoresponsive cells disclosed herein can include an activation-control polypeptide. The ACP can include a synthetic transcription factor. A synthetic transcription factor is a non-naturally occurring protein that includes a DNA- binding domain and a transcriptional effector domain and is capable of modulating (i.e., activating or repressing) transcription through binding to a cognate promoter recognized by the DNA-binding domain (an ACP-responsive promoter). In some embodiments, the ACP is a transcriptional repressor. In some embodiments, the ACP is a transcriptional activator.

[0242] The membrane-cleavable chimeric protein can be engineered such that secretion of the effector molecule can be regulated in a protease-dependent manner. Specifically, the membrane-cleavable chimeric protein can be engineered such that secretion of the effector molecule can be regulated as part of a “Membrane-Cleavable” system, where incorporation of a protease cleavage site (“C”) and a cell membrane tethering domain (“MT”) allow for regulated secretion of an effector molecule in a protease-dependent manner. Without wishing to be bound by theory, the components of the Membrane-Cleavable system present in the membrane- cleavable chimeric protein generally regulate secretion through the below cellular processes:MT : The cell membrane tethering domain contains a transmembrane domain (or a transmembrane-intracellular domain) that directs cellular-trafficking of the chimeric protein such that the protein is inserted into, or otherwise associated with, a cell membrane (“tethered”)C: Following expression and localization of the chimeric protein into the cell membrane, the protease cleavage site directs cleavage of the chimeric protein such that the effector molecule is released (“secreted”) into the extracellular space. Generally, the protease cleavage site is protease-specific, including sites engineered to be protease-specific. The protease cleavage site can be selected or engineered to achieve optimal protein expression, cell-type specific cleavage, cell-state specific cleavage, and / or cleavage and release of the payload at desired kinetics (e.g., ratio of membrane-bound to secreted chimeric protein levels)

[0243] In some aspects, membrane-cleavable chimeric proteins (or engineered nucleic acids encoding the membrane-cleavable chimeric proteins) are provided for herein having a protein of interest (e.g., any of the effector molecules described herein), a protease cleavage site, and a cell membrane tethering domain.

[0244] An “effector molecule,” refers to a molecule (e.g., a nucleic acid such as DNA or RNA, or a protein (polypeptide) or peptide) that binds to another molecule and modulates the biological activity of that molecule to which it binds. For example, an effector molecule may act as a ligand to increase or decrease enzymatic activity, gene expression, or cell signaling. Thus, in some embodiments, an effector molecule modulates (activates or inhibits) different immunomodulatory mechanisms. By directly binding to and modulating a molecule, an effector molecule may also indirectly modulate a second, downstream molecule.

[0245] In general, for all membrane-cleavable chimeric proteins described herein, an effector molecule is a cytokine or active fragment thereof (the secretable effector molecule referred to as “S” in the formula S - C - MT or MT - C - S) that includes a cytokine or active fragments thereof.

[0246] The term “modulate” encompasses maintenance of a biological activity, inhibition (partial or complete) of a biological activity, and stimulation / activation (partial or complete) of a biological activity. The term also encompasses decreasing or increasing (e.g. , enhancing) a biological activity. Two different effector molecules are considered to “modulate different tumor-mediated immunosuppressive mechanisms” when one effector molecule modulates a tumor-mediated immunosuppressive mechanism (e.g., stimulates T cell signaling) that is different from the tumor-mediated immunosuppressive mechanism modulated by the other effector molecule (e.g., stimulates antigen presentation and / or processing).

[0247] Modulation by an effector molecule may be direct or indirect. Direct modulation occurs when an effector molecule binds to another molecule and modulates activity of that molecule. Indirect modulation occurs when an effector molecule binds to another molecule,modulates activity of that molecule, and as a result of that modulation, the activity of yet another molecule (to which the effector molecule is not bound) is modulated.

[0248] In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism by at least one effector molecule results in an increase in an immunostimulatory and / or anti-tumor immune response (e.g. , systemically or in the tumor microenvironment) by at least 10% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 200%). For example, modulation of a tumor-mediated immunosuppressive mechanism may result in an increase in an immunostimulatory and / or anti-tumor immune response by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%. In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism results in an increase in an immunostimulatory and / or anti-tumor immune response 10-20%, 10- 30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-100%, 10-200%, 20-30%, 20- 40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-100%, 20-200%, 50-60%, 50-70%, 50- 80%, 50-90%, 50-100%, or 50-200%. It should be understood that “an increase” in an immunostimulatory and / or anti-tumor immune response, for example, systemically or in a tumor microenvironment, is relative to the immunostimulatory and / or anti-tumor immune response that would otherwise occur, in the absence of the effector molecule(s).

[0249] In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism by at least one effector molecule results in an increase in an immunostimulatory and / or anti-tumor immune response (e.g. , systemically or in the tumor microenvironment) by at least 2 fold (e.g., 2, 3, 4, 5, 10, 25, 20, 25, 50, or 100 fold). For example, modulation of a tumor- mediated immunosuppressive mechanism may result in an increase in an immunostimulatory and / or anti-tumor immune response by at least 3 fold, at least 5 fold, at least 10 fold, at least 20 fold, at least 50 fold, or at least 100 fold. In some embodiments, modulation of a tumor- mediated immunosuppressive mechanism results in an increase in an immunostimulatory and / or anti-tumor immune response by 2-10, 2-20, 2-30, 2-40, 2-50, 2-60, 2-70, 2-80, 2-90, or 2-100 fold.

[0250] Non-limiting examples of immunostimulatory and / or anti-tumor immune mechanisms include T cell signaling, activity and / or recruitment, antigen presentation and / or processing, natural killer cell-mediated cytotoxic signaling, activity and / or recruitment, dendritic cell differentiation and / or maturation, immune cell recruitment, pro -inflammatory macrophage signaling, activity and / or recruitment, stroma degradation, immunostimulatory metabolite production, stimulator of interferon genes (STING) signaling (which increases the secretion of IFN and Thl polarization, promoting an anti-tumor immune response), and / or Type I interferon signaling. An effector molecule may stimulate at least one (one or more) of the foregoingimmunostimulatory mechanisms, thus resulting in an increase in an immunostimulatory response. Changes in the foregoing immunostimulatory and / or anti-tumor immune mechanisms may be assessed, for example, using in vitro assays for T cell proliferation or cytotoxicity, in vitro antigen presentation assays, expression assays (e.g., of particular markers), and / or cell secretion assays (e.g., of cytokines).

[0251] In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism by at least one effector molecule results in a decrease in an immunosuppressive response (e.g., systemically or in the tumor microenvironment) by at least 10% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 200%). For example, modulation of a tumor- mediated immunosuppressive mechanism may result in a decrease in an immunosuppressive response by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%. In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism results in a decrease in an immunosuppressive response 10- 20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-100%, 10-200%, 20- 30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-100%, 20-200%, 50-60%, 50- 70%, 50-80%, 50-90%, 50-100%, or 50-200%. It should be understood that “a decrease” in an immunosuppressive response, for example, systemically or in a tumor microenvironment, is relative to the immunosuppressive response that would otherwise occur, in the absence of the effector molecule(s).

[0252] In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism by at least one effector molecule results in a decrease in an immunosuppressive response (e.g., systemically or in the tumor microenvironment) by at least 2 fold (e.g., 2, 3, 4, 5, 10, 25, 20, 25, 50, or 100 fold). For example, modulation of a tumor-mediated immunosuppressive mechanism may result in a decrease in an immunosuppressive response by at least 3 fold, at least 5 fold, at least 10 fold, at least 20 fold, at least 50 fold, or at least 100 fold. In some embodiments, modulation of a tumor-mediated immunosuppressive mechanism results in a decrease in an immunosuppressive response by 2-10, 2-20, 2-30, 2-40, 2-50, 2-60, 2- 70, 2-80, 2-90, or 2-100 fold.

[0253] Non-limiting examples of immunosuppressive mechanisms include negative costimulatory signaling, pro-apoptotic signaling of cytotoxic cells (e.g., T cells and / or NK cells), T regulatory (Treg) cell signaling, tumor checkpoint molecule production / maintenance, myeloid-derived suppressor cell signaling, activity and / or recruitment, immunosuppressive factor / metabolite production, and / or vascular endothelial growth factor signaling. An effector molecule may inhibit at least one (one or more) of the foregoing immunosuppressive mechanisms, thus resulting in a decrease in an immunosuppressive response. Changes in theforegoing immunosuppressive mechanisms may be assessed, for example, by assaying for an increase in T cell proliferation and / or an increase in IFNγ production (negative co-stimulatory signaling, Tregcell signaling and / or MDSC); Annexin V / PI flow staining (pro-apoptotic signaling); flow staining for expression, e.g., PDL1 expression (tumor checkpoint molecule production / maintenance); ELISA, LUMINEX®, RNA via qPCR, enzymatic assays, e.g., IDO tryptophan catabolism (immunosuppressive factor / metabolite production); and phosphorylation of PI3K, Akt, p38 (VEGF signaling).

[0254] In some embodiments, effector molecules function additively: the effect of two effector molecules, for example, may be equal to the sum of the effect of the two effector molecules functioning separately. In other embodiments, effector molecules function synergistically: the effect of two effector molecules, for example, may be greater than the combined function of the two effector molecules.

[0255] Effector molecules that modulate tumor-mediated immunosuppressive mechanisms and / or modify tumor microenvironments may be any of the cytokines described herein.

[0256] In some embodiments, at least one of the effector molecules stimulates an immunostimulatory mechanism in the tumor microenvironment and / or inhibits an immunosuppressive mechanism in the tumor microenvironment.

[0257] In some embodiments, at least one of the effector molecules (a) stimulates T cell signaling, activity and / or recruitment, (b) stimulates antigen presentation and / or processing, (c) stimulates natural killer cell-mediated cytotoxic signaling, activity and / or recruitment, (d) stimulates dendritic cell differentiation and / or maturation, (e) stimulates immune cell recruitment, (f) stimulates pro-inflammatory macrophage signaling, activity and / or recruitment or inhibits anti-inflammatory macrophage signaling, activity and / or recruitment, (g) stimulates stroma degradation, (h) stimulates immunostimulatory metabolite production, (i) stimulates Type I interferon signaling, (j) inhibits negative costimulatory signaling, (k) inhibits pro- apoptotic signaling of anti-tumor immune cells, (1) inhibits T regulatory (Treg) cell signaling, activity and / or recruitment, (m) inhibits tumor checkpoint molecules, (n) stimulates stimulator of interferon genes (STING) signaling, (o) inhibits myeloid-derived suppressor cell signaling, activity and / or recruitment, (p) degrades immunosuppressive factors / metabolites, (q) inhibits vascular endothelial growth factor signaling, and / or (r) directly kills tumor cells.

[0258] Non-limiting examples of cytokines are listed in Table 1 and specific sequences encoding exemplary effector molecules are listed in Table 2. Effector molecules can be human, such as those listed in Table 1 or Table 2 or human equivalents of murine effector molecules listed in Table 14 or Table 15. Effector molecules can be human-derived, such as theendogenous human effector molecule or an effector molecule modified and / or optimized for function, e.g., codon optimized to improve expression, modified to improve stability, or modified at its signal sequence (see below). Various programs and algorithms for optimizing function are known to those skilled in the art and can be selected based on the improvement desired, such as codon optimization for a specific species (e.g., human, mouse, bacteria, etc.).Table 14. Exemplary Effector MoleculesTable 15: Sequences of exemplary effector molecules

[0259] The first engineered nucleic acid can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence provided in Table 15. The first engineered nucleic acid can include a nucleotide sequence having a sequence provided in Table 15.

[0260] The first engineered nucleic acid can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of human IL15. The first engineered nucleic acid can include a nucleotide sequence having a sequence of human IL15.

[0261] The second engineered nucleic acid can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence provided in Table 15. The second engineered nucleic acid can include a nucleotide sequence having a sequence provided in Table 15.

[0262] The second engineered nucleic acid can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of human IL21. The second engineered nucleic acid can include a nucleotide sequence having a sequence of human IL21.

[0263] The first engineered nucleic acid can include a nucleotide sequence having a first sequence provided in Table 15; and (b) the second engineered nucleic acid can include a nucleotide sequence having a sequence provided in Table 15.

[0264] The first engineered nucleic acid can include a nucleotide sequence having a first sequence of human IL 15; and (b) the second engineered nucleic acid can include a nucleotide sequence having a sequence of human IL21.

[0265] Immunoresponsive cells provided for herein can include any one of the engineered nucleic acids described herein. Immunoresponsive cells provided for herein can include combinations of any one of the engineered nucleic acids described herein.Immunoresponsive cells provided for herein can include two or more of any one of the engineered nucleic acids described herein.

[0266] Immunoresponsive cells provided for herein can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence provided in Table 15.Immunoresponsive cells provided for herein can include a nucleotide sequence having a sequence provided in Table 15.

[0267] Immunoresponsive cells provided for herein can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of human IL15.Immunoresponsive cells provided for herein can include a nucleotide sequence having a sequence of human IL15.

[0268] Immunoresponsive cells provided for herein can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of human IL21.Immunoresponsive cells provided for herein can include a nucleotide sequence having a sequence of human IL21.

[0269] Immunoresponsive cells provided for herein can include a nucleotide sequence having a first sequence provided in Table 15; and (b) a second engineered nucleic acid including a nucleotide sequence having a sequence provided in Table 15.

[0270] Immunoresponsive cells provided for herein can include a nucleotide sequence having a first sequence of human IL 15; and (b) a second engineered nucleic acid including a nucleotide sequence having a sequence of human IL 15.

[0271] Expression vectors provided for herein can include any one of the engineered nucleic acids described herein. Expression vectors provided for herein can include combinationsof any one of the engineered nucleic acids described herein. Expression vectors provided for herein can include two or more of any one of the engineered nucleic acids described herein.

[0272] Expression vectors provided for herein can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence provided in Table 15. Expression vectors provided for herein can include a nucleotide sequence having a sequence provided in Table 15.

[0273] Expression vectors provided for herein can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of human IL15. Expression vectors provided for herein can include a nucleotide sequence having a sequence of human IL15.

[0274] Expression vectors provided for herein can include a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a sequence of human IL21. Expression vectors provided for herein can include a nucleotide sequence having a sequence of human IL21.

[0275] Expression vectors provided for herein can include a nucleotide sequence having a first sequence provided in Table 15; and (b) a second engineered nucleic acid including a nucleotide sequence having a sequence provided in Table 15.

[0276] Expression vectors provided for herein can include a nucleotide sequence having a first sequence of human IL 15; and (b) a second engineered nucleic acid including a nucleotide sequence having a sequence of human IL21.

[0277] In various embodiments, a first cytokine and / or a second cytokine of a multicistronic expression system disclosed herein is a calibrated release cytokine. As used herein, the terms “membrane-cleavable,” “controlled release,” and “calibrated release” are used interchangeably. In certain embodiments, the cytokine is membrane cleavable. In certain embodiments, the cytokine is a calibrated release (cr) cytokine. In certain embodiments, the calibrated release cytokine comprises a B7-1 transmembrane domain. In certain embodiments, the B7-1 transmembrane domain comprises the amino acid sequence of a B7-1 transmembrane domain disclosed in Table 19. In certain embodiments, the calibrated release cytokine comprises a “slow” protease cleavage site comprising the amino acid sequence of VTPEPIFSLI (SEQ ID NO: 301). In certain embodiments, the calibrated release cytokine comprises a “fast” protease cleavage site comprising the amino acid sequence of PRAEALKGG (SEQ ID NO: 302).

[0278] In some embodiments, the cytokine is a calibrated release IL15 (crIL15). In some embodiments, the crIL15 comprises the “slow” protease cleavage site. In certain embodiments,the crIL15 comprising the “slow” protease cleavage site comprises the amino acid sequence of crIL15 - “slow” protease cleavage site disclosed in Table 15. An exemplary nucleic acid sequence encoding the crIL15 comprising the “slow” protease cleavage site is disclosed in Table 15. In certain embodiments, a nucleic acid encoding crIL15 comprising the “slow” protease cleavage site comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of crIL15 comprising the “slow” protease cleavage site disclosed in Table 15.

[0279] In some embodiments, the crIL15 comprising the “slow” protease cleavage site also comprises a furin cleavage site. The crIL15 comprising the “slow” protease cleavage site and the furin cleavage site may comprise the amino acid sequence of crIL15 “slow” protease cleavage site and furin cleavage site disclosed in Table 15. An exemplary nucleic acid sequence encoding crIL15 comprising the “slow” protease cleavage site and the furin cleavage site is disclosed in Table 15. In certain embodiments, a nucleic acid encoding crIL15 comprising the “slow” protease cleavage site and the furin cleavage site comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of crIL15 “slow” protease cleavage site and furin cleavage site disclosed in Table 15.

[0280] In certain embodiments, the crIL15 comprises the “fast” protease cleavage site. In certain embodiments, the crIL15 comprising the “fast” protease cleavage site comprises the amino acid sequence of crIL15 - “fast” protease cleavage site disclosed in Table 15. An exemplary nucleic acid sequence encoding crIL15 comprising the “fast” protease cleavage site is disclosed in Table 15. In certain embodiments, a nucleic acid encoding crIL15 comprising the “fast” protease cleavage site comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of crIL15 - “fast” protease cleavage site disclosed in Table 15.

[0281] In certain embodiments, the crIL15 comprises the amino acid sequence of crIL15 disclosed in Table 15. An exemplary nucleic acid sequence encoding crIL15 is disclosed in Table 15. In certain embodiments, a nucleic acid encoding crIL15 comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of crIL15 disclosed in Table 15.

[0282] In certain embodiments, the crIL15 comprises a sushi domain. In certain embodiments the crIL15 comprises an IgE leader sequence. In certain embodiments, the crIL15comprises a sushi domain and an IgE leader sequence. In certain embodiments, the crIL15 comprises the amino acid sequence of crIL15 - sushi domain and IgE leader sequence disclosed in Table 15. An exemplary nucleic acid sequence encoding crIL15 comprising a sushi domain and an IgE leader sequence is disclosed in Table 15. In certain embodiments, a nucleic acid encoding crIL15 comprising a sushi domain and an IgE leader sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of crIL15 provided in Table 15.

[0283] In certain embodiments, the chimeric IL 15 comprises a sushi domain. In certain embodiments the chimeric IL 15 comprises an IgE leader sequence. In certain embodiments, the chimeric IL 15 comprises a sushi domain and an IgE leader sequence. In certain embodiments, the chimeric IL 15 comprises the amino acid sequence of chimeric IL 15 - sushi domain and IgE leader sequence disclosed in Table 15. An exemplary nucleic acid sequence encoding chimeric IL 15 comprising a sushi domain and an IgE leader sequence is disclosed in Table 15. In certain embodiments, a nucleic acid encoding chimeric IL 15 comprising a sushi domain and an IgE leader sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of chimeric IL 15 - sushi domain and IgE leader sequence disclosed in Table 15.

[0284] In certain embodiments, the IL 15 is a membrane -bound IL 15 (mbIL15). In certain embodiments, the mbIL15 comprises the amino acid sequence of mbIL15 disclosed in Table 15. An exemplary nucleic acid sequence encoding mbIL15 is disclosed in Table 15. In certain embodiments, a nucleic acid encoding mbIL15 comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of mbIL15 disclosed in Table 15.

[0285] In certain embodiments, the IL21 comprises the amino acid sequence of IL21 disclosed in Table 15. An exemplary nucleic acid sequence encoding IL21 is disclosed in Table 15. In certain embodiments, a nucleic acid encoding IL21 comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of IL21 disclosed in Table 15.

[0286] In certain embodiments, the IL21 comprises a codon-optimized IL21 leader sequence. In certain embodiments, the IL21 comprises the amino acid sequence of IL21 - codon- optimized leader sequence disclosed in Table 15. Two exemplary nucleic acid sequencesencoding IL21 comprising a codon-optimized IL21 leader sequence are provided in Table 15. In certain embodiments, a nucleic acid encoding IL21 comprising a codon-optimized IL21 leader sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of IL21 - codon-optimized leader sequence - 1. In certain embodiments, a nucleic acid encoding IL21 comprising a codon-optimized IL21 leader sequence comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of IL21 - codon-optimized leader sequence - 2.

[0287] In some embodiments, the IL21 comprises a furin cleavage site. In certain embodiments, the IL21 comprises the amino acid sequence of IL21 - furin cleavage sequence disclosed in Table 15. An exemplary nucleic acid sequence encoding IL21 comprising a furin cleavage site is provided in Table 15. In certain embodiments, a nucleic acid encoding IL21 comprising a furin cleavage site comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of IL21 - furin cleavage sequence disclosed in Table 15.

[0288] In certain embodiments, the IL7 comprises the amino acid sequence of IL7 disclosed in Table 15. An exemplary nucleic acid sequence encoding IL7 is disclosed in Table 15. In certain embodiments, a nucleic acid encoding IL7 comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of IL 7 disclosed in Table 15.

[0289] In certain embodiments, the IL12p70 comprises the amino acid sequence of IL12p70. An exemplary nucleic acid sequence encoding IL12p70 is disclosed in Table 15. In certain embodiments, a nucleic acid encoding IL12p70 comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence of IL12p70 disclosed in Table 15.Secretion Signals and Signal-Anchors

[0290] The one or more effector molecules (e.g. , any of the cytokines described herein) of the membrane-cleavable chimeric proteins provided for herein are in general secretable effector molecules having a secretion signal peptide (also referred to as a signal peptide or signal sequence) at the chimeric protein’s N-terminus (e.g., an effector molecule’s N-terminus for S -C - MT) that direct newly synthesized proteins destined for secretion or membrane localization (also referred to as membrane insertion) to the proper protein processing pathways. For chimeric proteins having the formula MT - C - S, a membrane tethering domain generally has a signalanchor sequence (e.g., signal-anchor sequences of a Type II transmembrane protein) that direct newly synthesized proteins destined for membrane localization to the proper protein processing pathways. For chimeric proteins having the formula S - C - MT, a membrane tethering domain having a reverse signal-anchor sequence (e.g., signal-anchor sequences of certain Type III transmembrane proteins) can be used, generally without a separate secretion signal peptide, that direct newly synthesized proteins destined for membrane localization to the proper protein processing pathways.

[0291] In general, for all membrane-cleavable chimeric proteins described herein, the one or more effector molecules are secretable effector molecules (referred to as “S” in the formula S - C - MT or MT - C - S). In embodiments with two or more chimeric proteins, each chimeric protein can comprise a secretion signal. In embodiments with two or more chimeric proteins, each chimeric protein can comprise a secretion signal such that each effector molecule is capable of secretion from an engineered cell following cleavage of the protease cleavage site.

[0292] The secretion signal peptide operably associated with an effector molecule can be a native secretion signal peptide (e.g., the secretion signal peptide generally endogenously associated with the given effector molecule, such as a cytokine’s endogenous secretion signal peptide). The secretion signal peptide operably associated with an effector molecule can be a non-native secretion signal peptide native secretion signal peptide. Non-native secretion signal peptides can promote improved expression and function, such as maintained secretion, in particular environments, such as tumor microenvironments. Non-limiting examples of non- native secretion signal peptide are shown in Table 16.Table 16. Exemplary Signal Secretion PeptidesProtease Cleavage Site

[0293] In general, all membrane-cleavable chimeric proteins described herein contain a protease cleavage site (referred to as “C” in the formula S - C - MT or MT - C - S). In general, the protease cleavage site can be any amino acid sequence motif capable of being cleaved by a protease. Examples of protease cleavage sites include, but are not limited to, a Type 1 transmembrane protease cleavage site, a Type II transmembrane protease cleavage site, a GPI anchored protease cleavage site, an ADAM8 protease cleavage site, an ADAM9 protease cleavage site, an ADAM 10 protease cleavage site, an ADAM 12 protease cleavage site, an ADAM 15 protease cleavage site, an ADAM17 protease cleavage site, an ADAM 19 protease cleavage site, an ADAM20 protease cleavage site, an ADAM21 protease cleavage site, an ADAM28 protease cleavage site, an ADAM30 protease cleavage site, an ADAM33 protease cleavage site, a BACE1 protease cleavage site, a BACE2 protease cleavage site, a SIP protease cleavage site, an MT1-MMP protease cleavage site, an MT3-MMP protease cleavage site, an MT5-MMP protease cleavage site, a furin protease cleavage site, a PCSK7 protease cleavagesite, a matriptase protease cleavage site, a matriptase-2 protease cleavage site, an MMP9 protease cleavage site, or an NS3 protease cleavage site.

[0294] One example of a protease cleavage site is a hepatitis C virus (HCV) nonstructural protein 3 (NS3) protease cleavage site, including, but not limited to, a NS3 / NS4A, a NS4A / NS4B, a NS4B / NS5A, or a NS5A / NS5B cleavage site. For a description ofNS3 protease and representative sequences of its cleavage sites for various strains of HCV, see, e.g., Hepatitis C Viruses: Genomes and Molecular Biology (S.L. Tan ed., Taylor & Francis, 2006), Chapter 6, pp. 163-206; herein incorporated by reference in its entirety. For example, the sequences of HCV NS4A / 4B protease cleavage site; HCV NS5A / 5B protease cleavage site; C- terminal degron with NS4A / 4B protease cleavage site; N-terminal degron with HCV NS5A / 5B protease cleavage site are provided. Representative NS3 sequences are listed in the National Center for Biotechnology Information (NCBI) database. See, for example, NCBI entries: Accession Nos. YP_001491553, YP 001469631, YP_001469632, NP_803144, NP_671491, YP 001469634, YP 001469630, YP 001469633, ADA68311, ADA68307, AFP99000, AFP98987, ADA68322, AFP99033, ADA68330, AFP99056, AFP99041, CBF60982, CBF60817, AHH29575, AIZ00747, AIZ00744, ABI36969, ABN05226, KF516075, KF516074, KF516056, AB826684, AB826683, JX171009, JX171008, JX171000, EU847455, EF154714, GU085487, JX171065, JX171063; all of which sequences (as entered by the date of fding of this application) are herein incorporated by reference.

[0295] Another example of a protease cleavage site is an ADAM17-specific protease (also referred to as Tumor Necrosis Factor-a Converting Enzyme [TACE]) cleavage site. An ADAM17-specific protease cleavage site can be an endogenous sequence of a substrate naturally cleaved by ADAM17. An ADAM17-specific protease cleavage site can be an engineered sequence capable of being cleaved by ADAM17. An engineered ADAM17-specific protease cleavage site can be an engineered for specific desired properties including, but not limited to, optimal expression of the chimeric proteins, specificity for ADAM17, rate-of- cleavage by ADAM17, ratio of secreted and membrane-bound chimeric protein levels, and cleavage in different cell states. A protease cleavage site can be selected for specific cleavage by ADAM17. For example, certain protease cleavage sites capable of being cleaved by ADAM 17 are also capable of cleavage by additional ADAM family proteases, such as ADAM 10. Accordingly, an ADAM17-specific protease cleavage site can be selected and / or engineered such that cleavage by other proteases, such as ADAM 10, is reduced or eliminated. A protease cleavage site can be selected for rate-of-cleavage by ADAM17. For example, it can be desirable to select a protease cleavage site demonstrating a specific rate-of-cleavage by ADAM 17, such as reduced cleavage kinetics relative to an endogenous sequence of a substrate naturally cleaved byADAM17. In such cases, in general, a specific rate-of-cleavage can be selected to regulate the rate of processing of the chimeric protein, which in turn regulates the rate of release / secretion of the payload effector molecule. Accordingly, an ADAM17-specific protease cleavage site can be selected and / or engineered such that the sequence demonstrates a desired rate-of-cleavage by ADAM17. A protease cleavage site can be selected for both specific cleavage by ADAM17 and rate-of-cleavage by ADAM17. Exemplary ADAM17-specific protease cleavage sites, including those demonstrating particular specificity and rate-of-cleavage kinetics, are shown in Table 17 below with reference to the site of cleavage (P5-P1: N-terminal; P1’-P5': C-terminal). Further details of ADAM17 and ADAM 10, including expression and protease cleavage sites, are described in Sharma, et al. (J Immunol October 15, 2017, 199 (8) 2865-2872), Pham et al. (Anticancer Res. 2017 Oct;37(10):5507-5513), Caescu et al. (Biochem J. 2009 Oct 23; 424(1): 79-88), and Tucher et al. (J. Proteome Res. 2014, 13, 4, 2205-2214), each herein incorporated by reference for purposes.Table 17 - Potential ADAM17 Protease Cleavage Site Sequences

[0296] In some embodiments, the protease cleavage site comprises a first region having the amino acid sequence of PRAE. In some embodiments, the protease cleavage site comprises a second region having the amino acid sequence of KGG. In some embodiments, the first region is located N-terminal to the second region. In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEX1X2KGG (SEQ ID NO: 375), wherein X1is A, Y, P, S, or F, and wherein X2is V, L, S, I, Y, T, or A. In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEAVKGG (SEQ ID NO: 364). In someembodiments, the protease cleavage site comprises the amino acid sequence of PRAEALKGG (SEQ ID NO: 302). In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEYSKGG (SEQ ID NO: 365). In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEPIKGG (SEQ ID NO: 366). In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEAYKGG (SEQ ID NO: 367). In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAESSKGG (SEQ ID NO: 368). In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEFTKGG (SEQ ID NO: 369). In some embodiments, the protease cleavage site comprises the amino acid sequence of PRAEAAKGG (SEQ ID NO: 374). In some embodiments, the protease cleavage site comprises the amino acid sequence of DEPHYSQRR (SEQ ID NO: 370). In some embodiments, the protease cleavage site comprises the amino acid sequence of PPLGPIFNPG (SEQ ID NO: 371). In some embodiments, the protease cleavage site comprises the amino acid sequence of PLAQAYRSS (SEQ ID NO: 372). In some embodiments, the protease cleavage site comprises the amino acid sequence of TPIDSSFNPD (SEQ ID NO: 373). In some embodiments, the protease cleavage site comprises the amino acid sequence of VTPEPIFSLI (SEQ ID NO: 301).

[0297] In certain embodiments, a cleavage site comprises a linker sequence. A cleavage site may be flanked on the N terminal and / or C terminal sides by a linker sequence. For example and without limitation, the cleavage site may be flanked on both the N terminal and C terminal sides by a partial glycine-serine (GS) linker sequence. Upon cleavage, the N terminal partial GS linker, and C terminal partial GS linker, join to form a GS linker sequence, such as the amino acid sequence of SGGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 376).

[0298] In certain embodiments, the cleavage site and linker comprise the amino acid sequence of SGGGGSGGGGSGVTPEPIFSLIGGGSGGGGSGGGSLQ (SEQ ID NO: 377). An exemplary nucleic acid sequence encoding SGGGGSGGGGSGVTPEPIFSLIGGGSGGGGSGGGSLQ (SEQ ID NO: 377) is TCTGGCGGCGGAGGATCTGGCGGAGGTGGAAGCGGAGTTACACCCGAGCCTATCTT CAGCCTGATCGGAGGCGGTAGCGGAGGCGGAGGAAGTGGTGGCGGATCTCTGCAA (SEQ ID NO: 378). In some embodiments, nucleic acids encoding SGGGGSGGGGSGVTPEPIFSLIGGGSGGGGSGGGSLQ (SEQ ID NO: 377) may comprise TCTGGCGGCGGAGGATCTGGCGGAGGTGGAAGCGGAGTTACACCCGAGCCTATCTT CAGCCTGATCGGAGGCGGTAGCGGAGGCGGAGGAAGTGGTGGCGGATCTCTGCAA (SEQ ID NO: 378), or a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0299] In certain embodiments, the protease cleavage site is N-terminal to a linker. In certain embodiments, the protease cleavage site and linker comprise the amino acid sequence of PRAEALKGGSGGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 379). An exemplary nucleic acid sequence encoding PRAEALKGGSGGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 379) is CCCAGAGCCGAGGCTCTGAAAGGCGGATCAGGCGGCGGTGGTAGTGGAGGCGGAG GCTCAGGCGGCGGAGGTTCCGGAGGTGGCGGTTCCGGCGGAGGATCTCTTCAAT (SEQ ID NO: 380). In some embodiments, nucleic acids encoding PRAEALKGGSGGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 379) may comprise CCCAGAGCCGAGGCTCTGAAAGGCGGATCAGGCGGCGGTGGTAGTGGAGGCGGAG GCTCAGGCGGCGGAGGTTCCGGAGGTGGCGGTTCCGGCGGAGGATCTCTTCAAT (SEQ ID NO: 380), or a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0300] In some embodiments, the protease cleavage site comprises the amino acid sequence of ITQGLAVSTISSFF (SEQ ID NO: 381), which is a cleavage site that is native to CD16 and is cleavable by ADAM17. In certain embodiments, ITQGLAVSTISSFF (SEQ ID NO: 381) is comprised within a linker. In certain embodiments, the linker comprises the amino acid sequence of SGGGGSGGGGSGITQGLAVSTISSFFGGGSGGGGSGGGSLQ (SEQ ID NO: 382) (. An exemplary nucleic acid sequence encoding SGGGGSGGGGSGITQGLAVSTISSFFGGGSGGGGSGGGSLQ (SEQ ID NO: 382) is AGCGGCGGAGGTGGTAGCGGAGGCGGAGGATCTGGAATTACACAGGGACTCGCCG TGTCTACAATCTCCAGCTTCTTTGGTGGCGGTAGTGGCGGCGGTGGCAGTGGCGGTG GATCTCTTCAA (SEQ ID NO: 383). In some embodiments, nucleic acids encoding SGGGGSGGGGSGITQGLAVSTISSFFGGGSGGGGSGGGSLQ (SEQ ID NO: 382) may comprise AGCGGCGGAGGTGGTAGCGGAGGCGGAGGATCTGGAATTACACAGGGACTCGCCG TGTCTACAATCTCCAGCTTCTTTGGTGGCGGTAGTGGCGGCGGTGGCAGTGGCGGTG GATCTCTTCAA (SEQ ID NO: 383), or a nucleic acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0301] The protease cleavage site can be C-terminal of the secretable effector molecule.The protease cleavage site can be N-terminal of the secretable effector molecule. In general, for all membrane-cleavable chimeric proteins described herein, the protease cleavage site is either: (1) C-terminal of the secretable effector molecule and N-terminal of the cell membrane tetheringdomain (in other words, the protease cleavage site is in between the secretable effector molecule and the cell membrane tethering domain); or (2) N-terminal of the secretable effector molecule and C-terminal of the cell membrane tethering domain (also between the secretable effector molecule and the cell membrane tethering domain with domain orientation inverted). The protease cleavage site can be connected to the secretable effector molecule by a polypeptide linker, i.e., a polypeptide sequence not generally considered to be part of the effector molecule or protease cleavage site. The protease cleavage site can be connected to the cell membrane tethering domain by a polypeptide linker, i.e., a polypeptide sequence not generally considered to be part of the cell membrane tethering domain or protease cleavage site. A polypeptide linker can be any amino acid sequence that connects a first polypeptide sequence and a second polypeptide sequence. A polypeptide linker can be a flexible linker (e.g., a Gly-Ser-Gly sequence). Examples of polypeptide linkers include, but are not limited to, GSG linkers (e.g., [GS]4GG) (SEQ ID NO: 384), A(EAAAK)3A (SEQ ID NO: 385), and Whitlow linkers (e.g., a “KEGS” (SEQ ID NO: 386) linker such as the amino acid sequence KESGSVSSEQLAQFRSLD (SEQ ID NO: 387), an eGK linker such as the amino acid sequence EGKSSGSGSESKST (SEQ ID NO: 388), an LR1 linker such as the amino acid sequence SGGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 376), and linkers described in more detail in Issued U.S. Pat. No. 5,990,275 herein incorporated by reference). Additional exemplary polypeptide linkers include SGGGGSGGGGSG (SEQ ID NO: 389), TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD (SEQ ID NO: 390), and GGGSGGGGSGGGSLQ (SEQ ID NO: 391). Other polypeptide linkers may be selected based on desired properties (e.g., length, flexibility, amino acid composition, etc.) and are known to those skilled in the art. An exemplary nucleic acid sequence encoding TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD (SEQ ID NO: 390) is ACCACCACACCAGCTCCTCGGCCACCAACTCCAGCTCCAACAATTGCCAGCCAGCC TCTGTCTCTGAGGCCCGAAGCTTGTAGACCTGCTGCAGGCGGAGCCGTGCATACAA GAGGACTGGATTTCGCCTGCGAC (SEQ ID NO: 505). In certain embodiments, a nucleic acid encoding TTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACD (SEQ ID NO: 390) comprises a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to ACCACCACACCAGCTCCTCGGCCACCAACTCCAGCTCCAACAATTGCCAGCCAGCC TCTGTCTCTGAGGCCCGAAGCTTGTAGACCTGCTGCAGGCGGAGCCGTGCATACAA GAGGACTGGATTTCGCCTGCGAC (SEQ ID NO: 505).

[0302] In the Membrane-Cleavable system, following expression and localization of the chimeric protein into the cell membrane, the protease cleavage site directs cleavage of thechimeric protein such that the effector molecule is released (“secreted”) into the extracellular space of a cell.

[0303] In general, a protease that cleaves the protease cleavage site is a protease specific for that specific protease cleavage site. For example, in the case of a disintegrin and metalloproteinase (“ADAM”) family protease, the protease that cleaves a specific ADAM protease cleavage site is generally limited to the ADAM protease(s) that specifically recognize the specific ADAM protease cleavage site motif. A protease cleavage site can be selected and / or engineered such that cleavage by undesired proteases is reduced or eliminated. Proteases can be membrane-bound or membrane-associated. Proteases can be secreted, e.g., secreted in a specific cellular environment, such as a tumor microenvironment (“TME”).

[0304] A protease that cleaves the protease cleavage site of the chimeric protein can be expressed in the same cell that expresses the chimeric protein. A protease that cleaves the protease cleavage site of the chimeric protein can be endogenous to a cell expressing the chimeric protein. In other words, a cell engineered to express the chimeric protein can endogenously express the protease specific for the protease cleavage site present in the chimeric protein. Endogenous expression of the protease refers to both expression under generally homeostatic conditions (e.g., a cell generally considered to be healthy), and also to differential expression under non-homeostatic conditions (e.g., upregulated expression in a tumor cell). The protease cleavage site can be selected based on the known proteases endogenously expressed by a desired cell population. In such cases, in general, the cleavage of the protease cleavage site (and thus release / secretion of a payload) can be restricted to only those cells of interest due to the cell-restricted protease needing to come in contact with the protease cleavage site of chimeric protein expressed in the same cell. For example, and without wishing to be bound by theory, ADAM17 is believed to be restricted in its endogenous expression to NK cell and T cells. Thus, selection of an ADAM17-specific protease cleavage site may restrict the cleavage of the protease cleavage site to NK cell and T cells co-expressing the chimeric protein. In other examples, a protease cleavage site can be selected for a specific tumor-associated protease known to be expressed in a particular tumor population of interest (e.g. , in a specific tumor cell engineered to express the chimeric protein). Protease and / or expression databases can be used to select an appropriate protease cleavage site, such as selecting a protease cleavage site cleaved by a tumor-associated proteases through consulting Oncomine (www.oncomine.org), the European Bioinformatic Institute (www.ebi.ac.uk) in particular (www.ebi.ac.uk / gxa), , ExPASy Peptide Cutter (ca.expasy.org / tools / peptide cutter) and, each of which is incorporated by reference for all purposes.

[0305] A protease that cleaves the protease cleavage site of the chimeric protein can be heterologous to a cell expressing the chimeric protein. For example, a cell engineered to express the chimeric protein can also be engineered to express a protease not generally expressed by the cell that is specific for the protease cleavage site present in the chimeric protein. A cell engineered to express both the chimeric protein and the protease can be engineered to express each from separate engineered nucleic acids or from a multicistronic systems (multicistronic and multi-promoter systems are described in greater detail in the Section herein titled “Multicistronic and Multiple Promoter Systems”). Heterologous proteases and their corresponding protease cleavage site can be selected as described above with reference to endogenous proteases.

[0306] A protease that cleaves the protease cleavage site of the chimeric protein can be expressed on a separate distinct cell than the cell that expresses the chimeric protein. For example, the protease can be generally expressed in a specific cellular environment, such as a tumor microenvironment. In such cases, in general, the cleavage of the protease cleavage site can be restricted to only those cellular environments of interest (e.g., a tumor microenvironment) due to the environment-restricted protease needing to come in contact with the protease cleavage site. In embodiments having membrane-cleavable chimeric proteins, in general, the secretion of the effector molecule can be restricted to only those cellular environments of interest (e.g., a tumor microenvironment) due to the environment-restricted protease needing to come in contact with the protease cleavage site. A protease that cleaves the protease cleavage site of the chimeric protein can be endogenous to the separate distinct cell. A protease that cleaves the protease cleavage site of the chimeric protein can be heterologous to the separate distinct cell. For example, the separate distinct cell can be engineered to express a protease not generally expressed by the separate distinct cell.

[0307] Proteases include, but are not limited to, a Type 1 transmembrane protease, a Type II transmembrane protease, a GPI anchored protease, an ADAM8 protease, an ADAM9 protease, an ADAM 10 protease, an ADAM 12 protease, an ADAM 15 protease, an ADAM17 protease, an ADAM 19 protease, an ADAM20 protease, an ADAM21 protease, an ADAM28 protease, an ADAM30 protease, an ADAM33 protease, a BACE1 protease, a BACE2 protease, a SIP protease, an MT1-MMP protease, an MT3-MMP protease, an MT5-MMP protease, a furin protease, a PCSK7 protease, a matriptase protease, a matriptase-2 protease, and an MMP9 protease. A protease can be an NS3 protease. A protease can be an ADAM17 protease.

[0308] Proteases can be tumor associated proteases, such as, a cathepsin, a cysteine protease, an aspartyl protease, a serine protease, or a metalloprotease. Specific examples of tumor associated proteases include Cathepsin B, Cathepsin L, Cathepsin S, Cathepsin D, Cathepsin E, Cathepsin A, Cathepsin G, Thrombin, Plasmin, Urokinase, Tissue PlasminogenActivator, Metalloproteinase 1 (MMP1), MMP2, MMP3, MMP4, MMP7, MMP8, MMP9, MMP10, MMP11, MMP12, MMP13, MMP14, MMP15, MMP16, MMP17, MMP20, MMP21, MMP23, MMP24, MMP25, MMP26, MMP28, ADAM, AD AMTS, CD10 (CALLA), or prostate specific antigen. Proteases can also include, but are not limited to, proteases listed inTable 18 below. Exemplary cognate protease cleavage sites for certain proteases are also listed in Table 18.Table 18: Exemplary Proteases with Cognate Cleavage Sites and Inhibitors

[0309] A protease can be any of the following human proteases (MEROPS peptidase database number provided in parentheses; Rawlings N. D., Morton F. R., Kok, C. Y., Kong, J. & Barrett A. J. (2008) MEROPS: the peptidase database. Nucleic Acids Res. 36 Database issue,D320-325; herein incorporated by reference for all purposes): pepsin A (MER000885), gastricsin (MER000894), memapsin-2 (MER005870), renin (MER000917), cathepsin D (MER000911), cathepsin E (MER000944), memapsin-1 (MER005534), napsin A (MER004981), Mername-AA034 peptidase (MER014038), pepsin A4 (MER037290), pepsin A5 (Homo sapiens) (MER037291), hCG1733572 (Homo sapiens)-type putative peptidase (MER107386), napsin B pseudogene (MER004982), CYMP g.p. (Homo sapiens) (MER002929), subfamily Al A unassigned peptidases (MER181559), mouse mammary tumor virus retropepsin (MER048030), rabbit endogenous retrovirus endopeptidase (MER043650), S71 -related human endogenous retropepsin (MER001812), RTVL-H-type putative peptidase (MER047117), RTVL-H-type putative peptidase (MER047133), RTVL-H-type putative peptidase (MER047160), RTVL-H-type putative peptidase (MER047206), RTVL-H-type putative peptidase (MER047253), RTVL-H-type putative peptidase (MER047260), RTVL-H- type putative peptidase (MER047291), RTVL-H-type putative peptidase (MER047418), RTVL- H-type putative peptidase (MER047440), RTVL-H-type putative peptidase (MER047479), RTVL-H-type putative peptidase (MER047559), RTVL-H-type putative peptidase (MER047583), RTVL-H-type putative peptidase (MER015446), human endogenous retrovirus retropepsin homologue 1 (MERO 15479), human endogenous retrovirus retropepsin homologue 2 (MERO 15481), endogenous retrovirus retropepsin pseudogene 1 (Homo sapiens chromosome 14) (MER029977), endogenous retrovirus retropepsin pseudogene 2 (Homo sapiens chromosome 8) (MER029665), endogenous retrovirus retropepsin pseudogene 3 (Homo sapiens chromosome 17) (MER002660), endogenous retrovirus retropepsin pseudogene 3 (Homo sapiens chromosome 17) (MER030286), endogenous retrovirus retropepsin pseudogene 3 (Homo sapiens chromosome 17) (MER047144), endogenous retrovirus retropepsin pseudogene 5 (Homo sapiens chromosome 12) (MER029664), endogenous retrovirus retropepsin pseudogene 6 (Homo sapiens chromosome 7) (MER002094), endogenous retrovirus retropepsin pseudogene 7 (Homo sapiens chromosome 6) (MER029776), endogenous retrovirus retropepsin pseudogene 8 (Homo sapiens chromosome Y) (MER030291), endogenous retrovirus retropepsin pseudogene 9 (Homo sapiens chromosome 19) (MER029680), endogenous retrovirus retropepsin pseudogene 10 (Homo sapiens chromosome 12) (MER002848), endogenous retrovirus retropepsin pseudogene 11 (Homo sapiens chromosome 17) (MER004378), endogenous retrovirus retropepsin pseudogene 12 (Homo sapiens chromosome 11) (MER003344), endogenous retrovirus retropepsin pseudogene 13 (Homo sapiens chromosome 2 and similar) (MER029779), endogenous retrovirus retropepsin pseudogene 14 (Homo sapiens chromosome 2) (MER029778), endogenous retrovirus retropepsin pseudogene 15 (Homo sapiens chromosome 4) (MER047158), endogenous retrovirus retropepsin pseudogene 15(Homo sapiens chromosome 4) (MER047332), endogenous retrovirus retropepsin pseudogene 15 (Homo sapiens chromosome 4) (MER003182), endogenous retrovirus retropepsin pseudogene 16 (MER047165), endogenous retrovirus retropepsin pseudogene 16 (MER047178), endogenous retrovirus retropepsin pseudogene 16 (MER047200), endogenous retrovirus retropepsin pseudogene 16 (MER047315), endogenous retrovirus retropepsin pseudogene 16 (MER047405), endogenous retrovirus retropepsin pseudogene 16 (MER030292), endogenous retrovirus retropepsin pseudogene 17 (Homo sapiens chromosome 8) (MER005305), endogenous retrovirus retropepsin pseudogene 18 (Homo sapiens chromosome 4) (MER030288), endogenous retrovirus retropepsin pseudogene 19 (Homo sapiens chromosome 16) (MER001740), endogenous retrovirus retropepsin pseudogene 21 (Homo sapiens) (MER047222), endogenous retrovirus retropepsin pseudogene 21 (Homo sapiens) (MER047454), endogenous retrovirus retropepsin pseudogene 21 (Homo sapiens) (MER047477), endogenous retrovirus retropepsin pseudogene 21 (Homo sapiens) (MER004403), endogenous retrovirus retropepsin pseudogene 22 (Homo sapiens chromosome X) (MER030287), subfamily A2A non-peptidase homologues (MER047046), subfamily A2A non-peptidase homologues (MER047052), subfamily A2A non-peptidase homologues (MER047076), subfamily A2A non-peptidase homologues (MER047080), subfamily A2A non- peptidase homologues (MER047088), subfamily A2A non-peptidase homologues (MER047089), subfamily A2A non-peptidase homologues (MER047091), subfamily A2A non- peptidase homologues (MER047092), subfamily A2A non-peptidase homologues (MER047093), subfamily A2A non-peptidase homologues (MER047094), subfamily A2A non- peptidase homologues (MER047097), subfamily A2A non-peptidase homologues (MER047099), subfamily A2A non-peptidase homologues MER047101), subfamily A2A non- peptidase homologues (MER047102), subfamily A2A non-peptidase homologues (MER047107), subfamily A2A non-peptidase homologues (MER047108), subfamily A2A non- peptidase homologues (MER047109), subfamily A2A non-peptidase homologues(MER047110), subfamily A2A non-peptidase homologues MER047111), subfamily A2A non- peptidase homologues (MER047114), subfamily A2A non-peptidase homologues(MER047118), subfamily A2A non-peptidase homologues (MER047121), subfamily A2A non- peptidase homologues (MER047122), subfamily A2A non-peptidase homologues (MER047126), subfamily A2A non-peptidase homologues (MER047129), subfamily A2A non- peptidase homologues (MER047130), subfamily A2A non-peptidase homologues (MER047134), subfamily A2A non-peptidase homologues (MER047135), subfamily A2A non- peptidase homologues (MER047137), subfamily A2A non-peptidase homologues (MER047140), subfamily A2A non-peptidase homologues (MER047141), subfamily A2A nonpeptidase homologues (MER047142), subfamily A2A non-peptidase homologues (MER047148), subfamily A2A non-peptidase homologues (MER047149), subfamily A2A non- peptidase homologues (MER047151), subfamily A2A non-peptidase homologues(MER047154), subfamily A2A non-peptidase homologues (MER047155), subfamily A2A non- peptidase homologues (MER047156), subfamily A2A non-peptidase homologues(MER047157), subfamily A2A non-peptidase homologues (MER047159), subfamily A2A non- peptidase homologues (MER047161), subfamily A2A non-peptidase homologues(MER047163), subfamily A2A non-peptidase homologues (MER047166), subfamily A2A non- peptidase homologues (MER047171), subfamily A2A non-peptidase homologues(MER047173), subfamily A2A non-peptidase homologues (MER047174), subfamily A2A non- peptidase homologues (MER047179), subfamily A2A non-peptidase homologues(MER047183), subfamily A2A non-peptidase homologues (MER047186), subfamily A2A non- peptidase homologues (MER047190), subfamily A2A non-peptidase homologues(MER047191), subfamily A2A non-peptidase homologues (MER047196), subfamily A2A non- peptidase homologues (MER047198), subfamily A2A non-peptidase homologues(MER047199), subfamily A2A non-peptidase homologues (MER047201), subfamily A2A non- peptidase homologues (MER047202), subfamily A2A non-peptidase homologues(MER047203), subfamily A2A non-peptidase homologues (MER047204), subfamily A2A non- peptidase homologues (MER047205), subfamily A2A non-peptidase homologues(MER047207), subfamily A2A non-peptidase homologues (MER047208), subfamily A2A non- peptidase homologues (MER047210), subfamily A2A non-peptidase homologues(MER047211), subfamily A2A non-peptidase homologues (MER047212), subfamily A2A non- peptidase homologues (MER047213), subfamily A2A non-peptidase homologues(MER047215), subfamily A2A non-peptidase homologues (MER047216), subfamily A2A non- peptidase homologues (MER047218), subfamily A2A non-peptidase homologues(MER047219), subfamily A2A non-peptidase homologues (MER047221), subfamily A2A non- peptidase homologues (MER047224), subfamily A2A non-peptidase homologues(MER047225), subfamily A2A non-peptidase homologues (MER047226), subfamily A2A non- peptidase homologues (MER047227), subfamily A2A non-peptidase homologues(MER047230), subfamily A2A non-peptidase homologues (MER047232), subfamily A2A non- peptidase homologues (MER047233), subfamily A2A non-peptidase homologues(MER047234), subfamily A2A non-peptidase homologues (MER047236), subfamily A2A non- peptidase homologues (MER047238), subfamily A2A non-peptidase homologues(MER047239), subfamily A2A non-peptidase homologues (MER047240), subfamily A2A non- peptidase homologues (MER047242), subfamily A2A non-peptidase homologues(MER047243), subfamily A2A non-peptidase homologues (MER047249), subfamily A2A nonpeptidase homologues (MER047251), subfamily A2A non-peptidase homologues(MER047252), subfamily A2A non-peptidase homologues (MER047254), subfamily A2A non- peptidase homologues (MER047255), subfamily A2A non-peptidase homologues(MER047263), subfamily A2A non-peptidase homologues (MER047265), subfamily A2A non- peptidase homologues (MER047266), subfamily A2A non-peptidase homologues(MER047267), subfamily A2A non-peptidase homologues (MER047268), subfamily A2A non- peptidase homologues (MER047269), subfamily A2A non-peptidase homologues(MER047272), subfamily A2A non-peptidase homologues (MER047273), subfamily A2A non- peptidase homologues (MER047274), subfamily A2A non-peptidase homologues(MER047275), subfamily A2A non-peptidase homologues (MER047276), subfamily A2A non- peptidase homologues (MER047279), subfamily A2A non-peptidase homologues(MER047280), subfamily A2A non-peptidase homologues (MER047281), subfamily A2A non- peptidase homologues (MER047282), subfamily A2A non-peptidase homologues(MER047284), subfamily A2A non-peptidase homologues (MER047285), subfamily A2A non- peptidase homologues (MER047289), subfamily A2A non-peptidase homologues(MER047290), subfamily A2A non-peptidase homologues (MER047294), subfamily A2A non- peptidase homologues (MER047295), subfamily A2A non-peptidase homologues(MER047298), subfamily A2A non-peptidase homologues (MER047300), subfamily A2A non- peptidase homologues (MER047302), subfamily A2A non-peptidase homologues(MER047304), subfamily A2A non-peptidase homologues (MER047305), subfamily A2A non- peptidase homologues (MER047306), subfamily A2A non-peptidase homologues(MER047307), subfamily A2A non-peptidase homologues (MER047310), subfamily A2A non- peptidase homologues (MER047311), subfamily A2A non-peptidase homologues(MER047314), subfamily A2A non-peptidase homologues (MER047318), subfamily A2A non- peptidase homologues (MER047320), subfamily A2A non-peptidase homologues(MER047321), subfamily A2A non-peptidase homologues (MER047322), subfamily A2A non- peptidase homologues (MER047326), subfamily A2A non-peptidase homologues(MER047327), subfamily A2A non-peptidase homologues (MER047330), subfamily A2A non- peptidase homologues (MER047333), subfamily A2A non-peptidase homologues(MER047362), subfamily A2A non-peptidase homologues (MER047366), subfamily A2A non- peptidase homologues (MER047369), subfamily A2A non-peptidase homologues(MER047370), subfamily A2A non-peptidase homologues (MER047371), subfamily A2A non- peptidase homologues (MER047375), subfamily A2A non-peptidase homologues(MER047376), subfamily A2A non-peptidase homologues (MER047381), subfamily A2A non-peptidase homologues (MER047383), subfamily A2A non-peptidase homologues (MER047384), subfamily A2A non-peptidase homologues (MER047385), subfamily A2A non- peptidase homologues (MER047388), subfamily A2A non-peptidase homologues(MER047389), subfamily A2A non-peptidase homologues (MER047391), subfamily A2A non- peptidase homologues (MER047394), subfamily A2A non-peptidase homologues(MER047396), subfamily A2A non-peptidase homologues (MER047400), subfamily A2A non- peptidase homologues (MER047401), subfamily A2A non-peptidase homologues(MER047403), subfamily A2A non-peptidase homologues (MER047406), subfamily A2A non- peptidase homologues (MER047407), subfamily A2A non-peptidase homologues(MER047410), subfamily A2A non-peptidase homologues (MER047411), subfamily A2A non- peptidase homologues (MER047413), subfamily A2A non-peptidase homologues(MER047414), subfamily A2A non-peptidase homologues (MER047416), subfamily A2A non- peptidase homologues (MER047417), subfamily A2A non-peptidase homologues(MER047420), subfamily A2A non-peptidase homologues (MER047423), subfamily A2A non- peptidase homologues (MER047424), subfamily A2A non-peptidase homologues(MER047428), subfamily A2A non-peptidase homologues (MER047429), subfamily A2A non- peptidase homologues (MER047431), subfamily A2A non-peptidase homologues(MER047434), subfamily A2A non-peptidase homologues (MER047439), subfamily A2A non- peptidase homologues (MER047442), subfamily A2A non-peptidase homologues(MER047445), subfamily A2A non-peptidase homologues (MER047449), subfamily A2A non- peptidase homologues (MER047450), subfamily A2A non-peptidase homologues(MER047452), subfamily A2A non-peptidase homologues (MER047455), subfamily A2A non- peptidase homologues (MER047457), subfamily A2A non-peptidase homologues(MER047458), subfamily A2A non-peptidase homologues (MER047459), subfamily A2A non- peptidase homologues (MER047463), subfamily A2A non-peptidase homologues(MER047468), subfamily A2A non-peptidase homologues (MER047469), subfamily A2A non- peptidase homologues (MER047470), subfamily A2A non-peptidase homologues(MER047476), subfamily A2A non-peptidase homologues (MER047478), subfamily A2A non- peptidase homologues (MER047483), subfamily A2A non-peptidase homologues(MER047488), subfamily A2A non-peptidase homologues (MER047489), subfamily A2A non- peptidase homologues (MER047490), subfamily A2A non-peptidase homologues(MER047493), subfamily A2A non-peptidase homologues (MER047494), subfamily A2A non- peptidase homologues (MER047495), subfamily A2A non-peptidase homologues(MER047496), subfamily A2A non-peptidase homologues (MER047497), subfamily A2A non- peptidase homologues (MER047499), subfamily A2A non-peptidase homologues(MER047502), subfamily A2A non-peptidase homologues (MER047504), subfamily A2A nonpeptidase homologues (MER047511), subfamily A2A non-peptidase homologues (MER047513), subfamily A2A non-peptidase homologues (MER047514), subfamily A2A non- peptidase homologues (MER047515), subfamily A2A non-peptidase homologues (MER047516), subfamily A2A non-peptidase homologues (MER047520), subfamily A2A non- peptidase homologues (MER047533), subfamily A2A non-peptidase homologues (MER047537), subfamily A2A non-peptidase homologues (MER047569), subfamily A2A non- peptidase homologues (MER047570), subfamily A2A non-peptidase homologues (MER047584), subfamily A2A non-peptidase homologues (MER047603), subfamily A2A non- peptidase homologues (MER047604), subfamily A2A non-peptidase homologues (MER047606), subfamily A2A non-peptidase homologues (MER047609), subfamily A2A non- peptidase homologues (MER047616), subfamily A2A non-peptidase homologues (MER047619), subfamily A2A non-peptidase homologues (MER047648), subfamily A2A non- peptidase homologues (MER047649), subfamily A2A non-peptidase homologues (MER047662), subfamily A2A non-peptidase homologues (MER048004), subfamily A2A non- peptidase homologues (MER048018), subfamily A2A non-peptidase homologues (MER048019), subfamily A2A non-peptidase homologues (MER048023), subfamily A2A non- peptidase homologues (MER048037), subfamily A2A unassigned peptidases (MER047164), subfamily A2A unassigned peptidases (MER047231), subfamily A2A unassigned peptidases (MER047386), skin aspartic protease (MER057097), presenilin 1 (MER005221), presenilin 2 (MER005223), impas 1 peptidase (MER019701), impas 1 peptidase (MER184722), impas 4 peptidase (MER019715), impas 2 peptidase (MER019708), impas 5 peptidase (MER019712), impas 3 peptidase (MERO 19711), possible family A22 pseudogene (Homo sapiens chromosome 18) (MER029974), possible family A22 pseudogene (Homo sapiens chromosome 11) (MER023159), cathepsin V (MER004437), cathepsin X (MER004508), cathepsin F (MER004980), cathepsin L (MER000622), cathepsin S (MER000633), cathepsin O (MER001690), cathepsin K (MER000644), cathepsin W (MER003756), cathepsin H (MER000629), cathepsin B (MER000686), dipeptidyl-peptidase I (MER001937), bleomycin hydrolase (animal) (MER002481), tubulointerstitial nephritis antigen (MER016137), tubulointerstitial nephritis antigen-related protein (MER021799), cathepsin L-like pseudogene 1 (Homo sapiens) (MER002789), cathepsin B-like pseudogene (chromosome 4, Homo sapiens) (MER029469), cathepsin B-like pseudogene (chromosome 1, Homo sapiens) (MER029457), CTSLL2 g.p. (Homo sapiens) (MER005210), CTSLL3 g.p. (Homo sapiens) (MER005209), calpain-1 (MER000770), calpain-2 (MER000964), calpain-3 (MER001446), calpain-9 (MER004042), calpain-8 (MER021474), calpain-15 (MER004745), calpain-5 (MER002939),calpain-11 (MER005844), calpain-12 (MER029889), calpain-10 (MER013510), calpain-13 (MER020139), calpain-14 (MER029744), Mername-AA253 peptidase (MER005537), calpamodulin (MER000718), hypothetical protein 940251 (MER003201), ubiquitinyl hydrolase- L1 (MER000832), ubiquitinyl hydrolase-L3 (MER000836), ubiquitinyl hydrolase-BAP1 (MER003989), ubiquitinyl hydrolase-UCH37 (MER005539), ubiquitin-specific peptidase 5 (MER002066), ubiquitin-specific peptidase 6 (MER000863), ubiquitin-specific peptidase 4 (MER001795), ubiquitin-specific peptidase 8 (MER001884), ubiquitin-specific peptidase 13 (MER002627), ubiquitin-specific peptidase 2 (MER004834), ubiquitin-specific peptidase 11 (MER002693), ubiquitin-specific peptidase 14 (MER002667), ubiquitin-specific peptidase 7 (MER002896), ubiquitin-specific peptidase 9X (MER005877), ubiquitin-specific peptidase 10 (MER004439), ubiquitin-specific peptidase 1 (MER004978), ubiquitin-specific peptidase 12 (MER005454), ubiquitin-specific peptidase 16 (MER005493), ubiquitin-specific peptidase 15 (MER005427), ubiquitin-specific peptidase 17 (MER002900), ubiquitin-specific peptidase 19 (MER005428), ubiquitin-specific peptidase 20 (MER005494), ubiquitin-specific peptidase 3 (MER005513), ubiquitin-specific peptidase 9Y (MER004314), ubiquitin-specific peptidase 18 (MER005641), ubiquitin-specific peptidase 21 (MER006258), ubiquitin-specific peptidase 22 (MER012130), ubiquitin-specific peptidase 33 (MER014335), ubiquitin-specific peptidase 29 (MER012093), ubiquitin-specific peptidase 25 (MER011115), ubiquitin-specific peptidase 36 (MER014033), ubiquitin-specific peptidase 32 (MER014290), ubiquitin-specific peptidase 26 (Homo sapiens-type) (MERO 14292), ubiquitin-specific peptidase 24 (MER005706), ubiquitinspecific peptidase 42 (MERO 11852), ubiquitin-specific peptidase 46 (MERO 14629), ubiquitinspecific peptidase 37 (MER014633), ubiquitin-specific peptidase 28 (MER014634), ubiquitinspecific peptidase 47 (MER014636), ubiquitin-specific peptidase 38 (MER014637), ubiquitinspecific peptidase 44 (MER014638), ubiquitin-specific peptidase 50 (MER030315), ubiquitinspecific peptidase 35 (MER014646), ubiquitin-specific peptidase 30 (MER014649), Mername- AA091 peptidase (MER014743), ubiquitin-specific peptidase 45 (MER030314), ubiquitinspecific peptidase 51 (MER014769), ubiquitin-specific peptidase 34 (MER014780), ubiquitinspecific peptidase 48 (MER064620), ubiquitin-specific peptidase 40 (MERO 15483), ubiquitinspecific peptidase 41 (MER045268), ubiquitin-specific peptidase 31 (MERO 15493), Mername- AA129 peptidase (MER016485), ubiquitin-specific peptidase 49 (MER016486), Memame- AA187 peptidase (MER052579), USP17-like peptidase (MER030192), ubiquitin-specific peptidase 54 (MER028714), ubiquitin-specific peptidase 53 (MER027329), ubiquitin-specific endopeptidase 39 [misleading] (MER064621), Memame-AA090 non-peptidase homologue (MER014739), ubiquitin-specific peptidase 43 [misleading] (MER030140), ubiquitin-specific peptidase 52 [misleading] (MER030317), NEK2 pseudogene (MER014736), C19 pseudogene(Homo sapiens: chromosome 5) (MER029972), Mername-AA088 peptidase (MER014750), autophagin-2 (MER013564), autophagin-1 (MER013561), autophagin-3 (MER014316), autophagin-4 (MER064622), Cezanne deubiquitinylating peptidase (MER029042), Cezanne-2 peptidase (MER029044), tumor necrosis factor alpha-induced protein 3 (MER029050), trabid peptidase (MER029052), VCIP135 deubiquitinating peptidase (MER152304), otubain-1 (MER029056), otubain-2 (MER029061), CylD protein (MER030104), UfSP1 peptidase (MER042724), UfSP2 peptidase (MER060306), DUBA deubiquitinylating enzyme (MER086098), KIAA0459 (Homo sapiens)-like protein (MER122467), Otudl protein (MER125457), glycosyltransferase 28 domain containing 1, isoform CRA_c (Homo sapiens)- like (MER123606), hinlL g.p. (Homo sapiens) (MER139816), ataxin-3 (MER099998), ATXN3L putative peptidase (MER115261), Josephin domain containing 1 (Homo sapiens) (MER125334), Josephin domain containing 2 (Homo sapiens) (MER124068), YOD1 peptidase (MER116559), legumain (plant alpha form) (MER044591), legumain (MER001800), glycosylphosphatidylinositol:protein transamidase (MER00247...

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A chimeric antigen receptor (CAR) comprising: i) a first antigen-binding domain that binds a first antigen selected from the group consisting of CEACAM5, CEA, CEACAM1, and CEACAM6; ii) a second extracellular antigen-binding domain that binds TROP2; iii) a transmembrane domain; and iv) one or more intracellular signaling domains.

2. The CAR of claim 1, wherein the CAR comprises a spacer between the first and second antigen-binding domains and the transmembrane domain.

3. The CAR of claim 2, wherein the spacer comprises an amino acid sequence selected from the amino acid sequences disclosed in Table 8.

4. The CAR of claim 2 or 3, wherein the spacer comprises the amino acid sequence of the CD8 hinge disclosed in Table 8.

5. The CAR of any one of claims 1-4, wherein the one or more intracellular signaling domains are selected from: a CD28 intracellular signaling domain; a CD3zeta-chain intracellular signaling domain, a CD3 epsilon-chain intracellular signaling domain, a CD97 intracellular signaling domain, a CD1 la-CD18 intracellular signaling domain, a CD2 intracellular signaling domain, an ICOS intracellular signaling domain, a CD27 intracellular signaling domain, aCD 154 intracellular signaling domain, a CD8 intracellular signaling domain, an 0X40 intracellular signaling domain, a 4-1BB intracellular signaling domain, , a ZAP40 intracellular signaling domain, a CD30 intracellular signaling domain, a GITR intracellular signaling domain, an HVEM intracellular signaling domain, a DAP 10 intracellular signaling domain, a DAP 12 intracellular signaling domain, a MyD88 intracellular signaling domain, a 2B4 intracellular signaling domain, an NKp46 intracellular signaling domain, an NKp30 intracellular signaling domain, an NKp44 intracellular signaling domain, an NKG2D intracellular signaling domain, a CD226 intracellular signaling domain, and a CD 160 intracellular signaling domain.

6. The CAR of any one of claims 1-5, wherein the CAR comprises a CD28 intracellular signaling domain and a CD3zeta-chain intracellular signaling domain.

7. The CAR of any one of claims 1-6, wherein the transmembrane domain is selected from the group consisting of: a CD8 transmembrane domain, a CD28 transmembrane domain, a CD25 transmembrane domain, a CD7 transmembrane domain, a CD3zeta-chain transmembranedomain, a CD4 transmembrane domain, a 4- IBB transmembrane domain, an 0X40 transmembrane domain, an ICOS transmembrane domain, a CTLA-4 transmembrane domain, a LAX transmembrane domain, a LAT transmembrane domain, a PD-1 transmembrane domain, a LAG-3 transmembrane domain, a TIM3 transmembrane domain, a KIR3DS 1 transmembrane domain, a KIR3DL1 transmembrane domain, an NKG2D transmembrane domain, an NKG2A transmembrane domain, a TIGIT transmembrane domain, a 2B4 transmembrane domain, and a BTLA transmembrane domain.

8. The CAR of any one of claims 1-7, wherein the CAR comprises a CD28 transmembrane domain.

9. The CAR of any one of claims 1-8, wherein the first and second antigen binding sites each comprise a heavy chain variable domain (VH) and a light chain variable domain (VL) and are configured in a polypeptide chain having a structure selected from the group consisting of: i) VH2-VL1-VH1-VL2; ii) VL1-VH1-VL2-VH2; iii) VL1-VH1-VH2-VL2; iv) VL2-VH2-VL1-VH1; v) VL2-VH2-VH1-VL1; vi) VL1-VL2-VH2-VH1; vii) VL1-VH2-VL2-VH1; and viii) VL2-VL1-VH1-VH2; wherein VH1is the VH of the first antigen binding domain, VL1is the VL of the first antigen binding domain, VH2is the VH of the second antigen-binding domain, and VL2is the VL of the second antigen binding site, and wherein each VH or VL is joined to the adjacent VH or VL by a linker.

10. The CAR of claim 9, wherein the linker comprises the amino acid sequence of GGGGSGGGGS (SEQ ID NO: 102).

11. A nucleic acid sequence encoding the CAR of any one of claims 1-10.

12. An engineered expression system comprising the nucleic acid sequence of claim 11.

13. An engineered expression system comprising: i) a first nucleic acid sequence encoding a first CAR, wherein the first CAR comprises:(a) a first extracellular antigen-binding domain that binds an antigen selected from the group consisting of CEACAM5, CEA, CEACAM1, and CEACAM6;(b) a first transmembrane domain; and(c) one or more intracellular signaling domains; and ii) a second nucleic acid sequence encoding a second CAR, wherein the second CAR comprises:(d) a second extracellular antigen-binding domain that binds TROP2;(e) a second transmembrane domain; and(f) one or more intracellular signaling domains.

14. The engineered expression system of claim 13, wherein the first CAR comprises a first spacer between the first extracellular antigen-binding domain and the first transmembrane domain.

15. The engineered expression system of claim 14, wherein the first spacer comprises an amino acid sequence selected from the amino acid sequences disclosed in Table 8.

16. The engineered expression system of claim 14 or 15, wherein the first spacer comprises the amino acid sequence of the CD8 hinge disclosed in Table 8.

17. The engineered expression system of any one of claims 13-16, wherein the second CAR comprises a second spacer between the second extracellular antigen-binding domain and the second transmembrane domain.

18. The engineered expression system of claim 17, wherein the second spacer comprises an amino acid sequence selected from the amino acid sequences disclosed in Table 8.

19. The engineered expression system of claim 17 or 18, wherein the second spacer comprises the amino acid sequence of the CD8 hinge disclosed in Table 8.

20. The engineered expression system of any one of claims 12-19, wherein the one or more intracellular signaling domains of the first CAR and / or the second CAR are independently selected from the group consisting of: a CD3zeta-chain intracellular signaling domain, aCD3 epsilon-chain intracellular signaling domain, a CD97 intracellular signaling domain, a CD1 la-CD18 intracellular signaling domain, a CD2 intracellular signaling domain, an ICOS intracellular signaling domain, a CD27 intracellular signaling domain, a CD 154 intracellular signaling domain, a CD8 intracellular signaling domain, an 0X40 intracellular signalingdomain, a 4- IBB intracellular signaling domain, a CD28 intracellular signaling domain, a ZAP40 intracellular signaling domain, a CD30 intracellular signaling domain, a GITR intracellular signaling domain, an HVEM intracellular signaling domain, a DAP 10 intracellular signaling domain, a DAP12 intracellular signaling domain, a MyD88 intracellular signaling domain, a 2B4 intracellular signaling domain, an NKp46 intracellular signaling domain, an NKp30 intracellular signaling domain, an NKp44 intracellular signaling domain, an NKG2D intracellular signaling domain, a CD226 intracellular signaling domain, and a CD 160 intracellular signaling domain.

21. The engineered expression system of any one of claims 13-20, wherein the first and second CARs each comprise a CD28 intracellular signaling domain and a CD3zeta-chain intracellular signaling domain.

22. The engineered expression system of any one of claims 13-21, wherein the first transmembrane domain and second transmembrane domain are independently selected from the group consisting of: a CD8 transmembrane domain, a CD28 transmembrane domain, a CD25 transmembrane domain, a CD7 transmembrane domain, a CD3zeta-chain transmembrane domain, a CD4 transmembrane domain, a 4- IBB transmembrane domain, an 0X40 transmembrane domain, an ICOS transmembrane domain, a CTLA-4 transmembrane domain, a LAX transmembrane domain, a LAT transmembrane domain, a PD-1 transmembrane domain, a LAG-3 transmembrane domain, a TIM3 transmembrane domain, a KIR3DS 1 transmembrane domain, a KIR3DL1 transmembrane domain, an NKG2D transmembrane domain, an NKG2A transmembrane domain, a TIGIT transmembrane domain, a 2B4 transmembrane domain, and a BTLA transmembrane domain.

23. The engineered expression system of any one of claims 13-22, wherein the first and second CARs each comprise a CD28 transmembrane domain.

24. The engineered expression system of any one of claims 12-23, further comprising a third nucleic acid sequence encoding an inhibitory chimeric receptor, wherein the inhibitory chimeric receptor comprises: i) an antigen-binding domain that binds to a third antigen selected from the group consisting of: VSIG2, CPM, ITM2C, SLC26A2, SLC4A4, GPA33, PLA2G2A, ABCA8, ATP1A2, CHP2, and SLC26A3; ii) a transmembrane domain; and iii) one or more intracellular inhibitory domains.

25. The engineered expression system of any one of claims 13-24, wherein the first and second nucleic acid sequences are comprised within a single expression vector.

26. The engineered expression system of any one of claims 13-25, wherein the first nucleic acid sequence is comprised within a first expression vector and the second nucleic acid sequence is comprised within a second expression vector.

27. The CAR of any one of claims 1-10, the nucleic acid sequence of claim 11, or the engineered expression system of any one of claims 12-26, wherein the first antigen-binding domain comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VH disclosed in Table 2; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VL disclosed in Table 2.

28. The CAR of any one of claims 1-10 and 27, the nucleic acid sequence of claim 11 or 27, or the engineered expression system of any one of claims 12-26, wherein the first antigenbinding domain binds CEACAM5.

29. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1) , a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an hMN14 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an hMN14 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

30. The CAR, nucleic acid sequence, or engineered expression system of claim 29, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMN14 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMN 14 VL.

31. The CAR, nucleic acid sequence, or engineered expression system of claim 29 or 30, wherein the VH comprises the amino acid sequence of an hMN 14 VH, and the VL comprises the amino acid sequence of an hMN 14 VL.

32. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a BW431 / 26 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a BW431 / 26 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

33. The CAR, nucleic acid sequence, or engineered expression system of claim 32, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a BW431 / 26 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a BW431 / 26 VL.

34. The CAR, nucleic acid sequence, or engineered expression system of claim 32 or 33, wherein the VH comprises the amino acid sequence of a BW431 / 26 VH, and the VL comprises the amino acid sequence of a BW431 / 26 VL.

35. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an A5B7 VH;wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an A5B7 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

36. The CAR, nucleic acid sequence, or engineered expression system of claim 35, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an A5B7 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an A5B7 VL.

37. The CAR, nucleic acid sequence, or engineered expression system of claim 35 or 36, wherein the VH comprises the amino acid sequence of an A5B7 VH, and the VL comprises the amino acid sequence of an A5B7 VL.

38. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an MFE23 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an MFE23 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

39. The CAR, nucleic acid sequence, or engineered expression system of claim 38, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MFE23 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MFE23 VL.

40. The CAR, nucleic acid sequence, or engineered expression system of claim 38 or 39, wherein the VH comprises the amino acid sequence of an MFE23 VH, and the VL comprises the amino acid sequence of an MFE23 VH.

41. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an hMFE23 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an hMFE23 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

42. The CAR, nucleic acid sequence, or engineered expression system of claim 41, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMFE23 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an hMFE23 VL.

43. The CAR, nucleic acid sequence, or engineered expression system of claim 41 or 42, wherein the VH comprises the amino acid sequence of an hMFE23 VH, and the VL comprises the amino acid sequence of an hMFE23 VL.

44. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an FM4 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an FM4 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

45. The CAR, nucleic acid sequence, or engineered expression system of claim 44, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an FM4 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an FM4 VL.

46. The CAR, nucleic acid sequence, or engineered expression system of claim 44 or 45, wherein the VH comprises the amino acid sequence of an FM4 VH, and the VL comprises the amino acid sequence of an FM4 VL.

47. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a cibisatamab heavy chain (HC); wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a cibisatamab light chain (LC), and wherein the antibody or antigen binding fragment thereof is humanized.

48. The CAR, nucleic acid sequence, or engineered expression system of claim 47, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VH of a cibisatamab HC, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VL a cibisatamab LC.

49. The CAR, nucleic acid sequence, or engineered expression system of claim 47 or 48, wherein the VH comprises the amino acid sequence of the VH of a cibisatamab HC and the VL comprises the amino acid sequence of the VL of a cibisatamab LC.

50. The CAR, nucleic acid sequence, or engineered expression system of claim 28, wherein the first antigen-binding domain comprises a a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a tusamitamab heavy chain (HC); wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a tusamitamab light chain (LC), and wherein the antibody or antigen binding fragment thereof is humanized.

51. The CAR, nucleic acid sequence, or engineered expression system of claim 47, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VH of a tusamitamab HC, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence the VL of a tusamitamab LC.

52. The CAR, nucleic acid sequence, or engineered expression system of claim 47 or 48, wherein the VH comprises the amino acid sequence of the VH of a tusamitamab HC, and the VL comprises the amino acid sequence of the VL of a tusamitamab LC.

53. The CAR, nucleic acid sequence, of any one of claims 1-10 or the engineered expression system of any one of claims 13-26, wherein the first antigen-binding domain binds CECAM1.

54. The CAR, nucleic acid sequence, or engineered expression system of claim 53, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an MRG1 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an MRG1 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

55. The CAR, nucleic acid sequence, or engineered expression system of claim 54, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MRG1 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an MRG1 VL.

56. The CAR, nucleic acid sequence, or engineered expression system of claim 54 or 55, wherein the VH comprises the amino acid sequence of an MRG1 VH, and the VL comprises the amino acid sequence of an MRG1 VL.

57. The CAR of any one of claims 1-10 and 27, the nucleic acid sequence of claim 11 or 27, or the engineered expression system of any one of claims 13-27, wherein the first antigenbinding domain binds CEACAM6.

58. The CAR, nucleic acid sequence, or engineered expression system of claim 57, wherein the first antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of a tinurilimab heavy chain (HC); wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a tinurilimab light chain (LC), and wherein the antibody or antigen binding fragment thereof is humanized.

59. The CAR, nucleic acid sequence, or engineered expression system of claim 58, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VH of a tinurilimab HC, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of the VL of a tinurilimab LC.

60. The CAR or engineered expression system of claim 58 or 59, wherein the VH comprises the amino acid sequence of the VH of a tinurilimab HC and the VL comprises the amino acid sequence of the VL of a tinurilimab LC.

61. The CAR of any one of claims 1-10 and 28-60, the nucleic acid sequence of any one of claims 11 and 27-60, or the engineered expression system of any one of claims 12-60, wherein the second antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3) of an RS7 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an RS7 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

62. The CAR, nucleic acid sequence, or engineered expression system of claim 61, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an RS7 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an RS7 VL.

63. The CAR, nucleic acid sequence, or engineered expression system of claim 61 or 62, wherein the VH comprises the amino acid sequence of an RS7 VH, and the VL comprises the amino acid sequence of an RS7 VL.

64. The CAR of any one of claims 1-10 and 28-60, the nucleic acid sequence of any one of claims 11 and 27-60, or the engineered expression system of any one of claims 12-60, wherein the second antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3)of an AR52 VH;wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of an AR52 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

65. The CAR, nucleic acid sequence, or engineered expression system of claim 64, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an AR52 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of an AR52 VL.

66. The CAR, nucleic acid sequence, or engineered expression system of claim 64 or 65, wherein the VH comprises the amino acid sequence of an AR52 VH, and the VL comprises the amino acid sequence of an AR52 VL.

67. The CAR of any one of claims 1-10 and 28-60, the nucleic acid sequence of any one of claims 11 and 27-60, or the engineered expression system of any one of claims 12-60, wherein the second antigen-binding domain comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH comprises a VH complementarity region 1 (CDRH1), a VH complementarity region 2 (CDRH2), and a VH complementarity region 3 (CDRH3)of a KM4097 VH; wherein the VL comprises a VL complementarity region 1 (CDRL1), a VL complementarity region 2 (CDRL2), and a VL complementarity region 3 (CDRL3) of a KM4097 VL, and wherein the antibody or antigen binding fragment thereof is humanized.

68. The CAR, nucleic acid sequence, or engineered expression system of claim 67, wherein the VH comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a KM4097 VH, and the VL comprises an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the amino acid sequence of a KM4097 VL.

69. The CAR, nucleic acid sequence, or engineered expression system of claim 67 or 68, wherein the VH comprises the amino acid sequence of a KM4097 VH, and the VL comprises the amino acid sequence of a KM4097 VL.

70. The CAR of any one of claims 1-10 and 28-69, the nucleic acid sequence of any one of claims 11 and 27-69, or the engineered expression system of any one of claims 13-69, wherein the second antigen-binding domain comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VH disclosed in Table 3; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least98%, at least 99%, or 100% identity to the amino acid sequence of a VL disclosed in Table 3.

71. An isolated cell comprising: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; or iii) the engineered expression system of any one of claims 12-70.

72. The isolated cell of claim 71, further comprising an inhibitory chimeric receptor, wherein the inhibitory chimeric receptor comprises: i) an antigen-binding domain that binds to a third antigen selected from the group consisting of: VSIG2, CPM, ITM2C, SLC26A2, SLC4A4, GPA33, PLA2G2A, ABCA8, ATP1A2, CHP2, and SLC26A3; ii) a transmembrane domain; and iii) one or more intracellular inhibitory domains.

73. The engineered expression system of any one of claims 24-70 or the isolated cell of claim 72, wherein the third antigen is VSIG2.

74. The engineered expression system or isolated cell of claim 73, wherein the antigen binding domain that binds to VSIG2 comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VH disclosed in Table 12; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of a VL disclosed in Table 12.

75. The engineered expression system or isolated cell of claim 73 or 74, wherein the antigen binding domain that binds to VSIG2 comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VH variant 19; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VL (with parental LCDRs).

76. The engineered expression system or isolated cell of any one of claims 73-75, wherein the antigen binding domain that binds to VSIG2 comprises a VH comprising the amino acid sequence of Humanized anti-VSIG2 VH variant 19; and a VL comprising the amino acid of Humanized anti-VSIG2 VL (with parental LCDRs).

77. The engineered expression system or isolated cell of claim 73 or 74, wherein the antigen binding domain that binds to VSIG2 comprises a VH comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VH variant 21; and a VL comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of Humanized anti-VSIG2 VL (with parental LCDRs).

78. The engineered expression system or isolated cell of claim 73, 74, or 77, wherein the antigen binding domain that binds to VSIG2 comprises a VH comprising the amino acid sequence of Humanized anti-VSIG2 VH variant 21; and a VL comprising the amino acid sequence of Humanized anti-VSIG2 VL (with parental LCDRs).

79. The engineered expression system or isolated cell of claim 73 or 74, wherein the antigen binding domain that binds to VSIG2 comprises an scFv comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of an scFv disclosed in Table 13.

80. The engineered expression system or isolated cell of claim 73, 74, or 79, wherein the antigen binding domain that binds to VSIG2 comprises an scFv comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 5.

81. The engineered expression system or isolated cell of claim 73, 74, 79, or 80, wherein the antigen binding domain that binds to VSIG2 comprises an scFv the amino acid sequence of anti- VSIG2 scFv 5.

82. The engineered expression system or isolated cell of claim 73, 74, or 79, wherein the antigen binding domain that binds to VSIG2 comprises an scFv comprising an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to the amino acid sequence of anti-VSIG2 scFv 7.

83. The engineered expression system or isolated cell of claim 73, 74, 79, or 82, wherein the antigen binding domain that binds to VSIG2 comprises an scFv the amino acid sequence of anti- VSIG2 scFv 7.

84. The engineered expression system of any one of claims 12-70 and 72-83 or the isolated cell of any one of claims 72-83, further comprising: i) a fourth nucleotide sequence encoding a first cytokine; and ii) a fifth nucleotide sequence encoding a second cytokine.

85. The engineered expression system of any one of claims 12-80, wherein at least one of the first and the second cytokines is a calibrated release cytokine.

86. The engineered expression system of any one of claims 12-85 or the isolated cell of any one of claims 72-74, wherein the calibrated release cytokine has the formula:S - C - MT or MT - C - S, whereinS comprises a secretable effector molecule;C comprises a protease cleavage site; andMT comprises a cell membrane tethering domain; optionally wherein the protease cleavage site is cleaved by ADAM 10 and / or ADAM 17, optionally wherein the protease cleavage site comprises the amino acid sequence of PRAEALKGG (SEQ ID NO: 302) or VTPEPIFSLI (SEQ ID NO: 301), optionally wherein the cell membrane tethering domain comprises a transmembrane domain selected from the group consisting of: PDGFR-beta, CD8, CD28, CD3zeta-chain, CD4,4-1BB, 0X40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, LNGFR, NKG2D, EpoR, TNFR2, LIR1, B7-1, and BTLA, optionally wherein the cell membrane tethering domain comprises a B7-1 transmembrane domain comprising the B7-1 transmembrane domain amino acid sequence set forth in Table 19.

87. The engineered expression system of any one of claims 12-86 or the isolated cell of any one of claims 72-75, wherein the first cytokine is IL15, optionally wherein the IL15 comprises the amino acid sequence of IL 15 set forth in Table 15.

88. The engineered expression system of any one of claims 12-87 or the isolated cell of any one of claims 72-76, wherein the IL15 is calibrated-release IL15 (crIL15).

89. The engineered expression system of any one of claims 12-88 or the isolated cell of any one of claims 72-77, wherein the second cytokine is IL21, optionally wherein the IL21 comprises the amino acid sequence set forth in Table 15, optionally wherein the IL21 is calibrated-release IL21 (crIL21).

90. The engineered expression system of any one of claims 12-89 or the isolated cell of any one of claims 72-78, wherein the first or second cytokine comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to an amino acid sequence set forth in Table 15.

91. The engineered expression system of any one of claims 12-90 or the isolated cell of any one of claims 72-79, wherein the first or second cytokine is encoded by a nucleic acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleic acid sequence set forth in Table 15.

92. The engineered expression system of any one of claims 24-70, the isolated cell of claim 72, or the engineered expression system or isolated cell of any one of claims 73-91, wherein the transmembrane domain is selected from: a SIRPα transmembrane domain, a PD-1 transmembrane domain, a CTLA4 transmembrane domain, a TIGIT transmembrane domain, a BTLA transmembrane domain, a LIR1 (LILRB1) transmembrane domain, a TIM3 transmembrane domain, a KIR3DL1 transmembrane domain, a NKG2A transmembrane domain, a LAG3 transmembrane domain, a LAIR1 transmembrane domain, a KIR2DL1 transmembrane domain, a KIR2DL2 transmembrane domain, a KIR2DL3 transmembranedomain, a KIR3DL2 transmembrane domain, a KLRG-1 transmembrane domain, a CEACAM1 transmembrane domain, a LIR2 transmembrane domain, a LIR3 transmembrane domain, a LIR5 transmembrane domain, a SIGLEC-2 transmembrane domain, a SIGLEC-10 transmembrane domain, a PECAM-1 transmembrane domain, a CD72 transmembrane domain, a IRTA2 transmembrane domain, a IRTA4 transmembrane domain, a NKIR transmembrane domain, a TLT1 transmembrane domain, a PCDHGC3 transmembrane domain, a MPZL1 transmembrane domain, a FCGR2B transmembrane domain, a SIGLEC-6 transmembrane domain, a MPIG6B transmembrane domain, a SIGLEC-12 transmembrane domain, a LIR8 transmembrane domain, a IRTA1 transmembrane domain, a KIR2DL4 transmembrane domain, a KIR2DL5 transmembrane domain, a SIGLEC-7 transmembrane domain, and a FCRH3 transmembrane domain.

93. The engineered expression system of any one of claims 24-70, the isolated cell of claim 72, or the engineered expression system or isolated cell of any one of claims 73-92, wherein the inhibitory chimeric receptor comprises a spacer region between the third antigen-binding domain and the transmembrane domain.

94. The engineered expression system or isolated cell of claim 93, wherein the spacer region comprises an amino acid sequence selected from the amino acid sequences set forth in Table 8.

95. The engineered expression system of any one of claims 24-70, the isolated cell of claim 72, or the engineered expression system or isolated cell of any one of claims 73-94, wherein the one or more intracellular inhibitory domains are selected from: a SIRPα intracellular domain, a PD-1 intracellular domain, a CTLA4 intracellular domain, a TIGIT intracellular domain, a BTLA intracellular domain, a LIR1 (LILRB1) intracellular domain, a TIM3 intracellular domain, a KIR3DL1 intracellular domain, a NKG2A intracellular domain, a LAG3 intracellular domain, a LAIR1 intracellular domain, a KIR2DL1 intracellular domain, a KIR2DL2 intracellular domain, a KIR2DL3 intracellular domain, a KIR3DL2 intracellular domain, a KLRG-1 intracellular domain, a CEACAM1 intracellular domain, a LIR2 intracellular domain, a LIR3 intracellular domain, a LIR5 intracellular domain, a SIGLEC-2 intracellular domain, a SIGLEC-10 intracellular domain, a PECAM-1 intracellular domain, a CD72 intracellular domain, a IRTA2 intracellular domain, a IRTA4 intracellular domain, a NKIR intracellular domain, a TLT1 intracellular domain, a PCDHGC3 intracellular domain, a MPZL1 intracellular domain, a FCGR2B intracellular domain, a SIGLEC-6 intracellular domain, a MPIG6B intracellular domain, a SIGLEC-12 intracellular domain, a LIR8 intracellular domain, a IRTA1intracellular domain, a KIR2DL4 intracellular domain, a KIR2DL5 intracellular domain, a SIGLEC-7 intracellular domain, and a FCRH3 intracellular domain.

96. The isolated cell of any one of claims 71-95, wherein binding of the inhibitory chimeric receptor to the third antigen is capable of inhibiting the immunoresponsive cell and / or wherein binding of the first antigen-binding site to the first antigen and / or binding of the second antigenbinding site to TROP2 is capable of activating the immunoresponsive cell.

97. The isolated cell of any one of claims 71-96, wherein the cell is an immunoresponsive cell.

98. The isolated cell of any one of claims 71-97, wherein the cell is selected from the group consisting of a T cell, a Natural Killer (NK) cell, a cytotoxic T lymphocyte (CTL), a regulatory T cell, a Natural Killer T (NKT) cell, a myeloid cell, a macrophage, a human embryonic stem cell (ESC), an ESC-derived cell, a pluripotent stem cell, and induced pluripotent stem cell (iPSC), and an iPSC-derived cell.

99. The isolated cell of any one of claims 71-98, wherein the cell is autologous.

100. The isolated cell of any one of claims 71-98, wherein the cell is allogeneic.

101. A pharmaceutical composition comprising: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; iii) the engineered expression system of any one of claims 12-70 and 73-95; or iv) the isolated cell of any one of claims 71-100, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

102. A method of treating a disease in a subject in need thereof, the method comprising administering to the subject an effective amount of: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; or v) the pharmaceutical composition of claim 101.

103. A method of stimulating a cell-mediated immune response to a tumor cell in a subject afflicted with cancer, the method comprising administering to a subject having a tumor an effective amount of: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; or iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; or v) the pharmaceutical composition of claim 101.

104. A method of providing an anti-tumor immunity in a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; or v) the pharmaceutical composition of claim 101.

105. A method of reducing tumor burden in a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; or iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; or v) the pharmaceutical composition of claim 101, optionally wherein:(a) the method reduces the number of tumor cells,(b) the method reduces tumor size,(c) the method reduces tumor volume, and / or(d) the method eradicates the tumor in the subject.

106. A method of treating a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; or iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; orv) the pharmaceutical composition of claim 101.

107. A method of reducing tumor burden in a subject afflicted with cancer, the method comprising administering to a subject in need thereof an effective amount of: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; or iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; or v) the pharmaceutical composition of claim 101.

108. The method of any one of claims 103-107, wherein the cancer is selected from colorectal cancer, lung cancer, breast cancer, bladder cancer, prostate cancer, pancreatic cancer, a gastrointestinal (GI) tract cancer, thyroid cancer, urothelial cancer, ovarian cancer, endometrial cancer, cervical cancer, optionally wherein the lung cancer is or comprises non-small cell lung cancer (NSCLC), oral squamous cell cancer, head and neck squamous cell cancer.

109. A kit for treating and / or preventing a lung cancer, the kit comprising: i) the CAR of any one of claims 1-10 and 27-70; ii) the nucleic acid sequence of any one of claims 11 and 27-70; or iii) the engineered expression system of any one of claims 12-70 and 73-95; iv) the isolated cell of any one of claims 71-100; or v) the pharmaceutical composition of claim 101, optionally wherein the kit further comprises written instructions for using isolated cell, or pharmaceutical composition for treating and / or preventing a cancer in a subject, or the kit further comprises instructions for using the CAR, nucleic acid sequence, or system for producing one or more antigen-specific cells for treating and / or preventing a cancer in a subject.