Novel biomarkers for inflammatory and auto-immune diseases

Abstract

Provided herein are methods of diagnosing, monitoring and treating a disease or disorder using cathepsin K as a biomarker. The disease or disorder may be an inflammatory disease, an autoimmune disease, or sepsis. Also, provided herein are compositions for treating the disease or disorder diagnosed by the described methods.

Description

Attorney Docket No. UTSDP4458WO-1001361407TITLENOVEL BIOMARKERS FOR INFLAMMATORY AND AUTO-IMMUNE DISEASESCROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 708,938, filed October 18, 2024, and titled “NOVEL BIOMARKERS FOR INFLAMMATORY AND AUTO-IMMUNE DISEASES,” which is incorporated by reference herein in its entirety.SEQUENCE LISTING

[0002] This instant application contains a Sequence Listing which has been submitted in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 16, 2025, is named UTSD.P4458WO_SEQ_LISTING.xml and is 30,000 bytes in size.BACKGROUND1. Field

[0003] The present disclosure relates to diagnosis and medical treatments for inflammatory and auto-immune diseases.2. Discussion of Related Art

[0004] Healthcare expenditures in the United States are projected to reach unprecedented levels, with the Centers for Medicare and Medicaid Services (CMS) forecasting a total of $5.7 trillion annually by 2026. This rapid growth in healthcare spending is outpacing overall economic growth, with health expenditures expected to account for 19.7% of the US GDP by 2026. Inflammatory diseases and related syndromes are becoming increasingly prevalent in Western societies, affecting approximately 60 million people in the US. Similarly, autoimmune diseases affect a partially overlapping 50 million Americans. Currently, these conditions are estimated to cost the US healthcare system more than $90 billion annually. These conditions pose a significant challenge to the healthcare system due to their slow progression and difficult diagnosis, often leading to delayed treatment and potential disability progression. The nonspecific nature of initial symptoms can make it challenging for clinicians to identify these conditions early on.

[0005] Identification and management of inflammatory and autoimmune conditions are crucial for slowing disease progression and reducing the risk of costly comorbidities. Improving diagnostic criteria and developing innovative technologies for detection of inflammatory and autoimmune conditions could benefit all healthcare stakeholders. This approach could help address the growing burden on the healthcare system while improving patient care and1299730993Attorney Docket No. UTSDP4458WO-1001361407 outcomes.

[0006] There is an unmet need for novel diagnostic and treatment options for inflammatory and auto-immune diseases.SUMMARY

[0007] In some aspects, the current disclosure encompasses a method of diagnosing a disease or disorder in a subject, comprising: obtaining a level of cathepsin K in a biological fluid sample from the patient; comparing the level of cathepsin K in the biological fluid sample to a reference range for cathepsin K; and diagnosing the subject with the disease or disorder based on step b, wherein a level of cathepsin K is higher than the reference range. In some aspects, the current disclosure also encompasses a method of treating a disease or a disorder in a subject, comprising administering to the subject an effective amount of a cathepsin K inhibitor, or an Angiopoietin-2 cleavage product inhibitor, or both, when the level of cathepsin K in a biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range for cathepsin K. In some additional aspects, the disclosure encompasses a method of treating a disease or disorder in a subject in need thereof, comprising: obtaining a level of cathepsin K in a biological fluid sample from the patient; detecting an increase in the level of cathepsin K in the biological fluid sample of the subject compared to a reference range for cathepsin K; and administering to the subject an effective amount of a cathepsin K inhibitor or an Angiopoietin-2 cleavage product inhibitor, or both, when an increase in the level of cathepsin K is detected. The methods of treating a disease or a disorder disclosed herein can comprise administering to a subject in need thereof a cathepsin K inhibitor, which inhibits the production, secretion, or extracellular level or activity of cathepsin K. In some aspects, the cathepsin K inhibitor is odanacatib (ODN). In some aspects, the cathepsin K inhibitor is an antibody that specifically binds to cathepsin K. In some aspects, the cathepsin K inhibitor is administered parenterally.

[0008] In some aspects, the current disclosure also encompasses a method of modifying a treatment for a disease or a disorder in a subject, wherein the subject is being administered a cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor, or a combination thereof, comprising: continuing with the treatment when the level of cathepsin K in a second biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range, but lower that the level in a first biological fluid sample obtained from the subject; stopping treatment when the level of cathepsin K in the second biological fluid sample obtained from the subject is found to be the reference range; and changing the treatment when the level of cathepsin K in the second biological fluid sample obtained from the subject is found to be2299730993Attorney Docket No. UTSDP4458WO-1001361407 elevated in comparison to the level in a first biological fluid sample obtained from the subject. In some aspects, provided herein is a method for monitoring a treatment response in a subject, wherein the subject is being administered a cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor, or a combination thereof, comprising: obtaining a level of cathepsin K in a biological fluid sample from the subject; comparing the level of cathepsin K in the biological fluid sample to a reference range for cathepsin K; and determining that the subject is responsive when the level of cathepsin K in a s biological fluid sample obtained from the subject is found to be in the reference range, or lower than the level in a biological fluid sample obtained from the subject before treatment. In some aspects of the disclosed methods, the first biological fluid sample is obtained from the subject prior to the administering of cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor.

[0009] In some aspects, the current disclosure also encompasses a method of diagnosing a disease or disorder in a subject, comprising: obtaining a ratio of cathepsin K to a c-terminal fragment of ANGPT2 in a biological fluid sample from the patient; comparing the ratio of cathepsin K to a c-terminal fragment of ANGPT2 to a reference ratio range; and diagnosing the subject with the disease or disorder based on step b, wherein the ratio is higher than the reference range. In some aspects, the method further comprises treating the disease or disorder in the subject comprising administering to the subject an effective amount of a cathepsin K inhibitor, or an angiopoietin-2 cleavage product inhibitor, or both, when the level of cathepsin K in a biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range for cathepsin K.

[0010] In some aspects of the one or more methods disclosed herein, the biological fluid sample is blood, serum, saliva, urine, cellular interstitial fluid, or cerebrospinal fluid.

[0011] In some aspects of the disclosed methods, the disease or disorder comprises sepsis, inflammatory disease, or an autoimmune disease. In some aspects, the disease or disorder comprises one or more of sepsis, vascular inflammation, vascular destabilization, osteoporosis, postmenopausal osteoporosis, osteomalacia, osteitis, low bone mass, bone erosion, inflammatory bone diseases, endodontic disease, Crohn’s disease, ulcerative colitis, psoriasis, asthma, multiple sclerosis, acute kidney failure, acute respiratory stress, familial Mediterranean fever (FMF), pyrin-associated autoinflammation with neutrophilic dermatosis (PAAND), hyperimmunoglobulin D syndrome (HIDS), pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA), hyperzincemia / hypercalprotectinemia (HZ / HC), Periodic fever, immunodeficiency, and thrombocytopenia (PFIT), neonatal onset of pancytopenia, autoinflammation, rash, and episodes of hemophagocyticlymphohistiocytosis (NOCARH) syndrome, NALP3 / cryopyrin inflammasome, familial cold autoinflam matory syndrome (FCAS), Muckle-Wells syndrome (MWS), neonatal-onset multisystem inflammatory disorder3299730993Attorney Docket No. UTSDP4458WO-1001361407(NOMID), Majeed syndrome / lipin 2 (LPIN2), NLRC4 inflammasome, autoinflammation with infantile enterocolitis (AIFEC), NLRP12 inflammasome, familial cold autoinflammatory syndrome 2 (FCAS2), NLRP1 inflammasome, multiple self-healing palmoplantar carcinoma (MSPC), familial keratosis lichenoides chronica (FKLC), NLRP1-associated autoinflammation with arthritis and dyskeratosis (NAIAD), AIM2 inflammasome (none described), noncanonical inflammasome (none described), deficiency of the IL-1 receptor antagonist (DIRA), deficiency of the IL-36 receptor antagonist (DITRA), diseases of interferon production and signaling, impaired degradation or processing of endogenous nucleic acids, Aicardi-Goutieres syndrome (AGS)1 , AGS2, AGS3, AGS4, AGS5, AGS6, DNase II deficiency, polyribonucleotide nucleotidyltransferase 1 (PNPT1) - polynucleotide phosphorylase (PNPase) deficiency, enhanced nucleic acid sensing, stimulator of interferon genes (STING) associated vasculopathy with onset in infancy (SAVI), AGS7, proteasome dysfunction, chronic atypical neutrophilic dermatitis with lipodystrophy and elevated temperature (CANDLE), amplified interferon receptor signaling, ubiquitin-specific peptidase 18 (UPS18) - pseudotoxoplasmosis, other (syphilis), rubella, cytomegalovirus, herpes simplex virus (pseudo- TORCH) syndrome, ISG15 ubiquitin-like modifier (ISG15), haploinsufficiency of A20 / TNF- alpha-induced protein 3 (TNFAIP3), nucleotide-binding oligomerization domain protein 2 (NOD2) - Blau syndrome, NFkB essential modulator (NEMO), RELA haploinsufficiency, retinal dystrophy, optic nerve edema, splenomegaly, anhidrosis, and headache (ROSAH) syndrome, disorders of linear ubiquitination, OTULIN-related autoinflammatory syndrome (ORAS; ie, otulipenia), deficiency of linear ubiquitin chain assembly complex (LUBAC) - heme-oxidized IRP2 ubiquitinligase 1 (HOIL-1 L), HOIL-1 interacting protein (HOIP), vacuoles, E1 enzyme, X-linked, autoinflammatory and somatic (VEXAS), aberrant TNF activity, TNF receptor-associated periodic syndrome (TRAPS), TNF receptor-associated periodic syndrome 11 (TRAPS11) - TNF receptor superfamily member 11A (TNFRSF11A), deficiency of adenosine deaminase 2 (DADA2), coatomer protein complex subunit alpha (COPA) syndrome, PLCG2-associated antibody deficiency and immune dysregulation (PLAID) / autoinflammation, PLCG2-associated antibody deficiency and immune dysregulation (APLAID), sideroblastic anemia with B cell immunodeficiency, periodic fevers, and developmental delay (SIFD), cleavage-resistant receptor-interacting serine / threonine kinase 1 (RIPK1) induced autoinflammatory(CRIA) syndrome, Lyn kinase-associated vasculopathy and liver fibrosis (LAVLI), disorders of complement activation, Sjogren’s syndrome, systemic lupus erythematosus (Lupus, SLE), psoriatic arthritis, rheumatoid arthritis (RA), Graves’ disease, Hashimoto’s thyroiditis, Addison’s disease, dermatomyositis, psoriasis, chronic inflammatory demyelinating polyneuropathy (CIDP), Guillain-Barre syndrome, multiple sclerosis (MS), myasthenia gravis, autoimmune vasculitis, type 1 diabetes, pernicious anemia, or vasculitis, or any combination thereof.4299730993Attorney Docket No. UTSDP4458WO-1001361407

[0012] In some aspects of the one or more methods disclosed herein, the subject is undergoing an extracorporeal membrane oxygenation (ECMO) or continuous renal replacement therapy (CRRT).

[0013] In some aspects of the methods disclosed herein, the subject is a mammal, for example a bovine, feline, canine, a porcine, an equine, a primate, or a human.

[0014] In some aspects of the one or more methods disclosed herein, angiopoietin-2 cleavage product may comprise, consist essentially of, or consist of a c-terminal fragment of angiopoietin-2 lacking at least 40 to at least 270 residues of the N-terminus. In some aspects of the one or more methods disclosed herein, the method may comprise determining the ratio of cathepsin K / Angiopoietin-2 cleavage product.

[0015] Other technical features may be readily apparent to one skilled in the art from the following figures, descriptions, and claims.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. Aspects of the present disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific aspects presented herein:

[0017] FIG. 1 is a schematic showing that cathepsin K (CATK) release by activated macrophages is an essential event in promoting systemic inflammation.

[0018] FIG. 2A provides a schematic for the development of clonal CatK knockout RAW cell lines.

[0019] FIG. 2B is a western blot analysis of recombinant ANGPT2 incubated with CM- MqLPS harvested from CRISPR-mediated CatK knockout RAW264.7 clonal cell lines and isogenic Cas9 control cell lines. Results show that CM-MqLPS harvested from CRISPR- mediated CatK knockout are unable to cleave ANGPT2.

[0020] FIG. 3A provides levels of circulating CATK protein levels 24 hours after LPS (10 mg / kg) administration (n = 8 mice per group).

[0021] FIG. 3B provides relative mRNA expression levels of cathepsin K (CtsK) in LPS stimulated RAW264.7 cells (n=3).

[0022] FIG. 3C provides relative mRNA expression levels of cystatin K (Csf3) in LPS stimulated RAW264.7 cells (n=3).

[0023] FIG. 3D provides ratio of CtsK / Cst3 mRNA level in RAW264.7 cells.5299730993Attorney Docket No. UTSDP4458WO-1001361407

[0024] FIG. 3E provides the relative mRNA expression level of CtsK (cathepsin K) and Cst3 (cystatin) in lung tissues of LPS administered mice (n=10 mice per group).

[0025] FIG. 3F provides levels of circulating ANGPT2 protein levels 24 hours after LPS (10 mg / kg) administration (n = 8 mice per group).

[0026] FIG. 3G is a western blot analysis of recombinant ANGPT2 incubated with recombinant CATK. The ratio of ANGPT2 to CATK was varied from 1 :1 to 1 :0.

[0027] FIG. 3H provides a bar graph showing the total amount of ANGPT2 (ng / mL) in serum of healthy controls (healthy, n = 10), patients in the intensive care unit with a primary diagnosis of acute respiratory distress syndrome (ARDS, n = 20), patients in the intensive care unit with a primary diagnosis of ARDS and sepsis (ARDS & Sepsis, n = 10) and patients in the intensive care unit with a primary diagnosis of sepsis (Sepsis, n = 10). Kruskal-Wallis, ns > 0.051 , *p < 0.05, **p < 0.01 , ***p < 0.001.

[0028] The drawing figures do not limit the present disclosure to the specific aspects disclosed and described herein. The drawings are not necessarily to scale, emphasis instead being placed on clearly illustrating principles of certain aspects of the present disclosure.DETAILED DESCRIPTION

[0000] The following detailed description references the accompanying drawings that illustrate various aspects of the present disclosure. The drawings and description are intended to describe aspects and aspects of the present disclosure in sufficient detail to enable those skilled in the art to practice the present disclosure. Other components can be utilized and changes can be made without departing from the scope of the present disclosure. The following description is, therefore, not to be taken in a limiting sense.

[0029] The present disclosure is based, in part, on the surprising discovery that levels of cathepsin K (CATK) are greatly increased in biological fluid samples from endotoxemic mice. CATK is among a group of cysteine proteases normally localized to lysosomes and tasked with disposal of intracellular proteins. CATK and other cathepsins are released by activated immune cells both through conventional secretion as well as cell lysis arising from pyroptosis. However, the secretome of activated immune cells contains many other proteolytic enzymes.

[0030] It has been previously shown that CATK is secreted from macrophages and involved in cleaving ANGPT2 during inflammation (PCT / US2024 / 016124 the content of which is incorporated herein in its entirety for all purposes). ANGPT2 was shown to be cleaved into c- terminal fragments 25KDa (ANGPT2-25) and a 50 KDa fragment (ANGPT2-50), amongst others, by CATK. The fragments act as TIE2 antagonist leading to the detrimental effects linked to certain diseases and disorders, specifically sepsis. However, previous work was6299730993Attorney Docket No. UTSDP4458WO-1001361407 silent on whether the enhanced ANGPT2 cleavage was linked to an increase in overall CATK in the plasma. The surprising discovery that, not only is the CATK level enhanced, but the increase is so significant (by more than 200-fold) that it can easily be incorporated as a biomarker in an assay system for inflammatory and autoimmune spectrum diseases is a major breakthrough. Thus far, no reliable pan biomarker for inflammation is available. In some additional aspects, a ratio of CATK and total ANGPT2 in the plasma may be used as a biomarker in an assay system for inflammatory and autoimmune spectrum diseases.

[0031] In some aspects, the current disclosure uses the findings provided herein to develop methods for diagnosis, monitoring, and treatment of one or more inflammatory diseases and / or autoimmune disorders.I. Terminology

[0001] The phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting. For example, the use of a singular term, such as, “a” is not intended as limiting of the number of items. Also, the use of relational terms such as, but not limited to, “top,” “bottom,” “left,” “right,” “upper,” “lower,” “down,” “up,” and “side,” are used in the description for clarity in specific reference to the figures and are not intended to limit the scope of the present disclosure or the appended claims.

[0032] Any term of degree such as, but not limited to, “substantially” as used in the description and the appended claims, should be understood to include an exact, or a similar, but not exact configuration. For example, “a substantially planar surface” means having an exact planar surface or a similar, but not exact planar surface. Similarly, the terms “about” or “approximately,” as used in the description and the appended claims, should be understood to include the recited values or a value that is three times greater or one third of the recited values. For example, about 3 mm includes all values from 1 mm to 9 mm, and approximately 50 degrees includes all values from 16.6 degrees to 150 degrees. For example, they can refer to less than or equal to ± 5%, such as less than or equal to ± 2%, such as less than or equal to ± 1 %, such as less than or equal to ± 0.5%, such as less than or equal to ± 0.2%, such as less than or equal to ± 0.1%, such as less than or equal to ± 0.05%.

[0033] The terms “comprising,” “including” and “having” are used interchangeably in this disclosure. The terms “comprising,” “including” and “having” mean to include, but not necessarily be limited to the things so described.

[0034] The terms “or” and “and / or,” as used herein, are to be interpreted as inclusive or meaning any one or any combination. Therefore, “A, B or C” or “A, B and / or C” mean any of the following: “A,” “B” or “C”; “A and B”; “A and C”; “B and C”; “A, B and C.” An exception to this definition will occur only when a combination of elements, functions, steps, or acts are in7299730993Attorney Docket No. UTSDP4458WO-1001361407 some way inherently mutually exclusive.

[0035] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this disclosure belongs. The following references provide one of skill with a general definition of many of the terms used in this disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991), all of which are incorporated by reference herein. As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.

[0036] The phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting. When introducing elements of the present disclosure or the preferred aspects(s) thereof, the articles “a”, “an”, “the” and “said” are intended to mean that there are one or more of the elements. The terms “comprising”, “including” and “having” are intended to be inclusive and mean that there may be additional elements other than the listed elements. Wherever the terms “comprising” or “including” are used, it should be understood the disclosure also expressly contemplates and encompasses additional aspects “consisting of” the disclosed elements, in which additional elements other than the listed elements are not included.

[0037] The term “about” or “approximately,” as used herein, can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the given value. Where particular values are described in the application and claims, unless otherwise stated the term “about” can mean an acceptable error range for the particular value, such as 10% of the value modified by the term “about.” As used herein, the term “about,” can mean relative to the recited value, e.g., amount, dose, temperature, time, percentage, etc., ±10%, ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, ±2%, or ±1 %.

[0002] Further, as the present disclosure is susceptible to aspects of many different forms, it is intended that the present disclosure be considered as an example of the principles of the present disclosure and not intended to limit the present disclosure to the specific aspects shown and described. Any one of the features of the present disclosure may be used separately or in combination with any other feature. References to the terms “aspect,” “aspects,” and / or the like in the description mean that the feature and / or features being8299730993Attorney Docket No. UTSDP4458WO-1001361407 referred to are included in, at least, one aspect of the description. Separate references to the terms “aspect,” “aspects,” and / or the like in the description do not necessarily refer to the same aspect and are also not mutually exclusive unless so stated and / or except as will be readily apparent to those skilled in the art from the description. For example, a feature, structure, process, step, action, or the like described in one aspect may also be included in other aspects but is not necessarily included. Thus, the present disclosure may include a variety of combinations and / or integrations of the aspects described herein. Additionally, all aspects of the present disclosure, as described herein, are not essential for its practice. Likewise, other systems, methods, features, and advantages of the present disclosure will be, or become, apparent to one with skill in the art upon examination of the figures and the description. It is intended that all such additional systems, methods, features, and advantages be included within this description, be within the scope of the present disclosure, and be encompassed by the claims.

[0038] The term “nucleic acid” or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues See, e.g., Batzer et al., Nucleic Acid Res. 19:5081 (1991), the disclosure of which is incorporated in its entirety herein.

[0039] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a9299730993Attorney Docket No. UTSDP4458WO-1001361407 natural peptide, a recombinant peptide, or a combination thereof.

[0040] Within the context of the application a protein is represented by an amino acid sequence and correspondingly a nucleic acid molecule or a polynucleotide represented by a nucleic acid sequence. Identity and similarity between sequences: throughout this application, each time one refers to a specific amino acid sequence SEQ ID NO (take SEQ ID NO: Y as example), one may replace it by: a polypeptide represented by an amino acid sequence comprising a sequence that has at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: Y. Another preferred level of sequence identity or similarity is 65%. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 75%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 85%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 98%. Another preferred level of sequence identity or similarity is 99%.

[0041] Each amino acid sequence described herein by virtue of its identity or similarity percentage with a given amino acid sequence respectively has in a further preferred aspect an identity or a similarity of at least 60%, at least 61 %, at least 62%, at least 63%, at least64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% with the given nucleotide or amino acid sequence, respectively. The terms “homology”, “sequence identity” and the like are used interchangeably herein. Sequence identity is described herein as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In a preferred aspect, sequence identity is calculated based on the full length of two given SEQ ID NO’s or on a part thereof. Part thereof preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of both SEQ ID NO’s. In the art, “identity” also refers to the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. The degree of sequence identity between two sequences can be determined, for example, by comparing the two sequences using computer programs commonly employed for this purpose, such as global or local alignment algorithms. Nonlimiting examples include BLASTp, BLASTn, Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT, or another suitable method or algorithm. A Needleman and Wunsch10299730993Attorney Docket No. UTSDP4458WO-1001361407 global alignment algorithm can be used to align two sequences over their entire length or part thereof (part thereof may mean at least 50%, 60%, 70%, 80%, 90% of the length of the sequence), maximizing the number of matches and minimizes the number of gaps. Default settings can be used and preferred program is Needle for pairwise alignment (in an aspect, EMBOSS Needle 6.6.0.0, gap open penalty 10, gap extent penalty: 0.5, end gap penalty: false, end gap open penalty: 10, end gap extent penalty: 0.5 is used) and MAFFT for multiple sequence alignment ( in an aspect, MAFFT v7Default value is: BLOSUM62 [bl62], Gap Open: 1.53, Gap extension: 0.123, Order: aligned, Tree rebuilding number: 2, Guide tree output: ON [true], Max iterate: 2, Perform FFTS: none is used).

[0042] “Similarity” between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. Similar algorithms used for determination of sequence identity may be used for determination of sequence similarity. Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called conservative amino acid substitutions. As used herein, “conservative” amino acid substitutions refer to the interchangeability of residues having similar side chains.

[0043] For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gin or His; Asp to Glu; Cys to Ser or Ala; Gin to Asn; Glu to Asp; Gly to Pro; His to Asn or Gin; lie to Leu or Vai; Leu to lie or Vai; Lys to Arg; Gin or Glu; Met to Leu or lie; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Vai to lie or Leu.

[0044] An “individual” or “subject,” as used interchangeably herein, is a mammal. In certain aspects, the individual or subject is a human.

[0045] The term angiopoietin-2 or ANGPT2 refers to a polypeptide as set forth in SEQ ID.11299730993Attorney Docket No. UTSDP4458WO-1001361407NO. 1 (human) or SEQ ID. NO. 2 (mouse) or fragments thereof as well as related polypeptides which include allelic variants, splice variants, derivatives, substitution, deletions, and / or insertion variants, fusion peptides and polypeptides, and interspecies homologs. The ANGPT2 polypeptide may or may not include additional terminal residues, e.g., leader sequences, targeting sequences, amino terminal methionine, amino terminal methionine and lysine residues, and / or purification tag or fusion proteins sequences, depending on the manner in which it is prepared. As used herein, a “c-terminal fragment of ANGPT2” is a polypeptide sequence comprising an amino acid sequence that lacks at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 105, at least 110, at least 125, at least 130, at least 135, at least 140, at least 145, at least 150, at least 155, at least 160, at least 165, at least 170, at least 175, at least 180, at least 185, at least 190, at least 195, at least 200, at least 205, at least 210, at least 215, at least 220, at least 225, at least 230, at least 235, at least 240, at least 245, at least 250, at least 255, at least 260, at least 265, at least 270, at least 275, or more N-terminal residues of SEQ. ID NOS. 1 or 2. As used herein “Angpt2-25” or angiopoietin- 2-25 refers to a c-terminal fragment of ANGPT2 as provided in SEQ. ID. NO. 3 (human starting from residue E253) or SEQ ID. NO. 4 (mouse starting from residue E253) as well as related polypeptides which include allelic variants, splice variants, derivatives, substitution, deletions, and / or insertion variants, fusion peptides and polypeptides, and interspecies homologs. As used herein “Angpt2-50” or Angiopoietin-2-50 refers to a c-terminal fragment of ANGPT2 as provided in SEQ. ID. NO. 5 (human) or SEQ ID. NO. 6 (mouse) as well as related polypeptides which include allelic variants, splice variants, derivatives, substitution, deletions, and / or insertion variants, fusion peptides and polypeptides, and interspecies homologs. In some aspects, ANGPT2-50 starts from residue S55 of SEQ ID NOS: 1 or 2. In some aspects, ANGPT2-50 is the generated by cleavage of ANGPT2, sequence as provided in SEQ ID NOS: 1 or 2, at any of the sites: F45, L47, M50, S55, N63, R67 (SEQ ID NO: 7-16) by CATK. In some aspects, ANGPT2-25 and / or ANGPT2-50 is generated by the cleavage of ANGPT2 by CATK as provided in SEQ ID. NO. 17 (human) or SEQ ID. NO. 18 (mouse) or allelic variants, splice variants, derivatives, substitution, deletions, and / or insertion variants, fusion peptides and polypeptides, and interspecies homologs thereof.Table 1 : Sequences used in the current disclosure12299730993Attorney Docket No. UTSDP4458WO-100136140713299730993Attorney Docket No. UTSDP4458WO-100136140714299730993Attorney Docket No. UTSDP4458WO-100136140715299730993Attorney Docket No. UTSDP4458WO-100136140716299730993Attorney Docket No. UTSDP4458WO-1001361407

[0046] The term “inhibitor” as used herein refers to any moiety, including a chemical compound, biological molecule or complex that represses, slows, interferes, reduces, suppresses, modulates or blocks the activity of a protein or prevents a protein from engaging in a reaction. In some aspects, the inhibitor can directly or indirectly repress, slow, interfere with, reduce, suppress, modulate or block the activity of CATK or ANGPT2-25 and ANGPT2- 50. In some aspects, the inhibitor can be a small molecule. In some aspects, the inhibitor can be a macromolecule. In some aspects, the inhibitor can be a drug or a pharmaceutical composition. In some aspects, the inhibitor or pharmaceutical composition comprising the inhibitor are applicable to prevent, alleviate, improve, and / or treat various diseases including sepsis and prevent vascular inflammation and destabilization. As used herein “vascular inflammation” or “vasculitis” refers to a disease that results in enhanced adhesiveness of the luminal wall of blood vessels to leukocytes (i.e. , pro-inflammatory), increased tendency of the luminal all of blood vessels to promote coagulation (i.e., pro-coagulant), and / or increased permeability of microvessel walls to the extravasation of fluid and / or macromolecules such as proteins. The term “vascular destabilization” as used herein encompasses one or more of dysfunction of the cell lining the endothelium of the vasculature and damage to the cells of the endothelium.

[0047] By “specifically binds” it is meant that a binding molecule, e.g., an antibody or antigen-binding fragment thereof binds to an epitope via its antigen binding domain, and that17299730993Attorney Docket No. UTSDP4458WO-1001361407 the binding entails some recognition between the antigen binding domain and the epitope. According to this definition, a binding molecule is said to “specifically bind” to an epitope when it binds to that epitope, via its antigen-binding domain binds more readily than it would bind to a random, unrelated epitope. A molecule is said to exhibit “specific binding” if for example it reacts more frequently, with more avidity, more rapidly, with greater duration, and / or with greater affinity with a particular target antigen than it does with alternative targets. Specific binding can be measured, for example, by determining binding of a target molecule compared to binding of a control molecule, which generally is a molecule of similar structure that does not have binding activity.

[0048] The term “antibody,” or “antigen binding agent” as used herein, is used in the broadest sense and encompasses various antibody and antibody-like structures, including but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibody, IgG, Fv, single chain antibody, single domain antibodies, nanobodies, diabodies, multispecific antibodies (e.g., bispecific antibodies), scFv, Fab, F(ab')2, and Fab and antibody fragments so long as they exhibit the desired antigen-binding activity. The domain(s) of an antibody that is involved in binding an antigen is referred to as a “variable region” or “variable domain,” and is described in further detail below. A single variable domain may be sufficient to confer antigen-binding specificity. Preferably, but not necessarily, antibodies useful in the discovery are produced recombinantly. Antibodies may or may not be glycosylated, though glycosylated antibodies may be preferred. An “isolated” antibody is one which has been separated from a component of its natural environment. In some embodiments, an antibody is purified to greater than 95% or 99% purity as determined by methods known in the art.

[0049] The term “administration” and variants thereof (e.g., “administering” a composition) in reference to a composition of the disclosure means introducing the composition or a prodrug of the composition into the system of the subject in need of treatment. When a composition of the disclosure or prodrug thereof is provided in combination with one or more other active agents (e.g., a cytotoxic agent, etc.), “administration” and its variants are each understood to include concurrent and sequential introduction of the composition or prodrug thereof and other agents. The present disclosure includes within its scope prodrugs of the compositions of this disclosure. In general, such prodrugs will be functional derivatives of the compositions of this disclosure which are readily convertible in vivo into the required composition. Thus, in the methods of treatment of the present disclosure, the term “administering” shall encompass the treatment of the various conditions described with the composition specifically disclosed or with a composition which may not be specifically disclosed, but which converts to the specified composition in vivo after administration to the patient.

[0050] The term “therapeutically effective amount” as used herein means that amount of18299730993Attorney Docket No. UTSDP4458WO-1001361407 active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor or other clinician.

[0051] As used herein, the term “treating” refers to the application or administration of a composition including one or more active agents to a subject, who is in need of the treatment, for example, having a target disease or disorder, a symptom of the disease / disorder, or a predisposition toward the disease / disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward the disease or disorder. Alleviating a target disease / disorder includes delaying the development or progression of the disease or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, “delaying” the development of a target disease or disorder means to defer, hinder, slow, retard, stabilize, and / or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and / or individuals being treated. A method that “delays” or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and / or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.

[0052] The term “sepsis” as used herein occurs when chemicals released in the bloodstream to fight an infection trigger inflammation throughout the body. This can cause a cascade of changes that damage multiple organ systems, leading them to fail, sometimes even resulting in death. Symptoms include fever, difficulty breathing, low blood pressure, fast heart rate, and mental confusion. Sepsis can be caused by any type of infection, for example viral infections, bacterial infections, fungal infections, and other pathogens. In an aspect, the sepsis or septicemia is associated with a bacterial, viral or a fungal infection. Non-limiting examples of bacterial infection that cause sepsis include but are not limited to a Staphylococcus aureus, Escherichia coli (E. coli) or a Streptococcus infection. Non-limiting examples of viral infection that can result in sepsis include influenza virus, COVID-19, Herpes Simplex virus, Varicella-Zoster virus, cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, or dengue virus infection, or any combination thereof. In an aspect, the sepsis or septicemia may be associated with a clinical procedure, for example a surgery, extracorporeal membrane oxygenation (ECMO) or continuous renal replacement therapy (CRRT).

[0053] The term “inflammatory diseases” as used herein are characterized by excessive or19299730993Attorney Docket No. UTSDP4458WO-1001361407 prolonged inflammation in the body, occurring without an apparent beneficial purpose or continuing even after the initial trigger has been eliminated. These disorders involve the immune system attacking the body’s own tissues, leading to chronic inflammation that can cause damage to various organs and systems. Examples of inflammatory diseases include rheumatoid arthritis, inflammatory bowel diseases like Crohn’s disease and ulcerative colitis, psoriasis, asthma, multiple sclerosis, sepsis, acute kidney failure, acute respiratory stress, familial mediterranean fever (FMF), pyrin-associated autoinflammation with neutrophilic dermatosis (PAAND), hyperimmunoglobulin D syndrome (HIDS), pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA), hyperzincemia / hypercalprotectinemia (HZ / HC), periodic fever, immunodeficiency, and thrombocytopenia (PFIT), neonatal onset of pancytopenia, autoinflammation, rash, and episodes of hemophagocyticlymphohistiocytosis (NOCARH) syndrome, NALP3 / cryopyrin inflammasome, familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), neonatal-onset multisystem inflammatory disorder (NOMID), Majeed syndrome / lipin 2 (LPIN2), NLRC4 inflammasome, autoinflammation with infantile enterocolitis (AIFEC), NLRP12 inflammasome, familial cold autoinflammatory syndrome 2 (FCAS2), NLRP1 inflammasome, multiple self-healing palmoplantar carcinoma (MSPC), familial keratosis lichenoides chronica (FKLC), NLRP1- associated autoinflammation with arthritis and dyskeratosis (NAIAD), AIM2 inflammasome (none described), noncanonical inflammasome (none described), deficiency of the IL-1 receptor antagonist (DIRA), deficiency of the IL-36 receptor antagonist (DITRA), diseases of interferon production and signaling, impaired degradation or processing of endogenous nucleic acids, Aicardi-Goutieres syndrome (AGS)1 , AGS2, AGS3, AGS4, AGS5, AGS6, DNase II deficiency, polyribonucleotide nucleotidyltransferase 1 (PNPT1) - polynucleotide phosphorylase (PNPase) deficiency, enhanced nucleic acid sensing, stimulator of interferon genes (STING) associated vasculopathy with onset in infancy (SAVI), AGS7, proteasome dysfunction, chronic atypical neutrophilic dermatitis with lipodystrophy and elevated temperature (CANDLE), amplified interferon receptor signaling, ubiquitin-specific peptidase 18 (UPS18) - pseudo-toxoplasmosis, other (syphilis), rubella, cytomegalovirus, herpes simplex virus (pseudo-TORCH) syndrome, ISG15 ubiquitin-like modifier (ISG15), haploinsufficiency of A20 / TNF-alpha-induced protein 3 (TNFAIP3), nucleotide-binding oligomerization domain protein 2 (NOD2) - Blau syndrome, NFkB essential modulator (NEMO), RELA haploinsufficiency, retinal dystrophy, optic nerve edema, splenomegaly, anhidrosis, and headache (ROSAH) syndrome, disorders of linear ubiquitination, OTULIN- related autoinflammatory syndrome (ORAS; ie, otulipenia), deficiency of linear ubiquitin chain assembly complex (LUBAC) - heme-oxidized IRP2 ubiquitinligase 1 (HOIL-1 L), HOIL-1 interacting protein (HOIP), vacuoles, E1 enzyme, X-linked, autoinflammatory and somatic (VEXAS), aberrant TNF activity, TNF receptor-associated periodic syndrome (TRAPS), TNF20299730993Attorney Docket No. UTSDP4458WO-1001361407 receptor-associated periodic syndrome 11 (TRAPS11) - TNF receptor superfamily member 11A (TNFRSF11A), deficiency of adenosine deaminase 2 (DADA2), coatomer protein complex subunit alpha (COPA) syndrome, PLCG2-associated antibody deficiency and immune dysregulation (PLAID) / autoinflammation, PLCG2-associated antibody deficiency and immune dysregulation (APLAID), sideroblastic anemia with B cell immunodeficiency, periodic fevers, and developmental delay (SIFD), cleavage-resistant receptor-interacting serine / threonine kinase 1 (RIPK1) induced autoinflammatory(CRIA) syndrome, Lyn kinase- associated vasculopathy and liver fibrosis (LAVLI), disorders of complement activation. These conditions often result in symptoms such as pain, swelling, redness, and impaired function in the affected areas, and can significantly impact a person’s quality of life.

[0054] The term “autoimmune disease” as used herein are conditions in which the body’s immune system mistakenly attacks and damages healthy cells, tissues, and organs. In these disorders, the immune system fails to distinguish between foreign invaders and the body’s own cells, leading to an inappropriate immune response against self-antigens. This attack can affect various parts of the body, resulting in inflammation, tissue damage, and impaired organ function. Autoimmune diseases can manifest in many forms, with symptoms varying depending on the specific organs or systems targeted. Common examples include Sjogren’s syndrome, systemic lupus erythematosus (Lupus, SLE), psoriatic arthritis, rheumatoid arthritis (RA), Graves’ disease, Hashimoto’s thyroiditis, Addison’s disease, dermatomyositis, psoriasis, Chronic inflammatory demyelinating polyneuropathy (Cl DP), Guillain-Barre syndrome, multiple sclerosis (MS), myasthenia gravis, autoimmune vasculitis, type 1 diabetes, pernicious anemia, or vasculitis.

[0055] The term “bone disease” as used herein refers to any pathological condition affecting the structure, density, integrity, or function of bone tissue. This includes, but is not limited to: osteoporosis which characterized by systemic skeletal fragility due to reduced bone mineral density and microarchitectural deterioration; postmenopausal osteoporosis, a subtype of primary osteoporosis resulting from estrogen deficiency following menopause; osteomalacia characterized by softening and weakening of bones in adults due to impaired bone mineralization; osteitis which refers to inflammation of bone tissue, which can result from infection, trauma, or metabolic disorders; low bone mass (osteopenia), defined by a bone mineral density T-score between -1.0 and -2.5, indicating reduced bone strength and increased fracture risk; bone erosion, involving localized loss of bone tissue often associated with inflammatory or infectious processes; inflammatory bone diseases, such as osteomyelitis or bone involvement in autoimmune conditions (e.g., rheumatoid arthritis), which result in bone degradation due to chronic inflammation; and endodontic disease, including periapical periodontitis and other conditions where infection or inflammation of the dental pulp leads to21299730993Attorney Docket No. UTSDP4458WO-1001361407 bone resorption in the jaw or surrounding structures.

[0056] “Development” or “progression” of a disease means initial manifestations and / or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. “Development” includes occurrence, recurrence, and onset. As used herein “onset” or “occurrence” of a target disease or disorder includes initial onset and / or recurrence.

[0057] In an aspect, the term “standard value” or “reference range” or “reference levels” refer to predefined values or ranges of values used as benchmarks to interpret the results of an assay. These levels are crucial for distinguishing between normal and abnormal results, thereby aiding in the diagnosis of a specific condition or disease. In some aspects, the terms refer to specific values or ranges that are considered normal or typical for a given population. These levels serve as a baseline for comparison or a standard against which individual test results can be compared, facilitating the identification of deviations that may indicate a disease or condition. These values and ranges are typically obtained from studies on a healthy population to determine the normal range of values. Statistical methods are typically used to define the reference range, often encompassing the central 95% of the values obtained from the healthy population (mean ± 2 standard deviations). Age, gender, ethnicity, and other demographic factors can affect reference levels. Natural biological variability among individuals can also lead to differences in reference levels. Differences in assay methods, sensitivities, reagents, and equipment can also influence the reference levels. Reference levels are used to interpret assay results, helping clinicians determine whether a patient’s result is within the normal range or indicative of a potential health issue. Specific cut-off values may be established within the reference levels to guide clinical decisions, such as initiating further diagnostic testing or treatment. As will be appreciated in the art, once the “standard level” or “reference range” is known, it can be used repeatedly as a standard for comparison. Though typically standard value may be determined based on a population, in an aspect, a standard value may also refer to one or more values obtained from samples obtained from the subject, at a time prior to the sample being assayed.II. Method of diagnosis and monitoring diseases and conditions

[0058] In an aspect, the current disclosure encompasses a method of diagnosing a disease or disorder in a subject, comprising obtaining a level of CATK in a biological fluid sample from the patient, comparing the level of CATK in the biological fluid sample to a reference range for CATK and diagnosing the subject with the disease or disorder when the level of CATK is22299730993Attorney Docket No. UTSDP4458WO-1001361407 higher than the reference range.

[0059] In some aspects, the current disclosure encompasses methods of diagnosis of one or more of an sepsis, inflammatory disease, a bone disease, an autoimmune disease, or related conditions in a subject in need thereof. Non-limiting examples of diseases or disorders that may be effectively diagnosed using CATK as a biomarker include sepsis, vascular inflammation, vascular destabilization, acute kidney failure, acute respiratory stress, familial Mediterranean fever (FMF), pyrin-associated autoinflammation with neutrophilic dermatosis (PAAND), hyperimmunoglobulin D syndrome (HIDS), pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA), hyperzincemia / hypercalprotectinemia (HZ / HC), periodic fever, immunodeficiency, and thrombocytopenia (PFIT), neonatal onset of pancytopenia, autoinflammation, rash, and episodes of hemophagocyticlymphohistiocytosis (NOCARH) syndrome, NALP3 / cryopyrin inflammasome, familial cold autoinflam matory syndrome (FCAS), Muckle-Wells syndrome (MWS), neonatal-onset multisystem inflammatory disorder (NOMID), Majeed syndrome / lipin 2 (LPIN2), NLRC4 inflammasome, autoinflammation with infantile enterocolitis (AIFEC), NLRP12 inflammasome, Familial cold autoinflammatory syndrome 2 (FCAS2), NLRP1 inflammasome, multiple self-healing palmoplantar carcinoma (MSPC), familial keratosis lichenoides chronica (FKLC), NLRP1-associated autoinflammation with arthritis and dyskeratosis (NAIAD), AIM2 inflammasome (none described), noncanonical inflammasome (none described), deficiency of the IL-1 receptor antagonist (DIRA), deficiency of the IL-36 receptor antagonist (DITRA), diseases of interferon production and signaling, impaired degradation or processing of endogenous nucleic acids, Aicardi-Goutieres syndrome (AGS)1 , AGS2, AGS3, AGS4, AGS5, AGS6, DNase II deficiency, polyribonucleotide nucleotidyltransferase 1 (PNPT1) - polynucleotide phosphorylase (PNPase) deficiency, enhanced nucleic acid sensing, stimulator of interferon genes (STING) associated vasculopathy with onset in infancy (SAVI), AGS7, proteasome dysfunction, chronic atypical neutrophilic dermatitis with lipodystrophy and elevated temperature (CANDLE), amplified interferon receptor signaling, ubiquitin-specific peptidase 18 (UPS18) - pseudotoxoplasmosis, other (syphilis), rubella, cytomegalovirus, herpes simplex virus (pseudo- TORCH) syndrome, ISG15 ubiquitin-like modifier (ISG15), haploinsufficiency of A20 / TNF- alpha-induced protein 3 (TNFAIP3), nucleotide-binding oligomerization domain protein 2 (NOD2) - Blau syndrome, NFkB essential modulator (NEMO), RELA haploinsufficiency, retinal dystrophy, optic nerve edema, splenomegaly, anhidrosis, and headache (ROSAH) syndrome, disorders of linear ubiquitination, OTULIN-related autoinflammatory syndrome (ORAS; i.e., otulipenia), deficiency of linear ubiquitin chain assembly complex (LUBAC) - heme-oxidized IRP2 ubiquitinligase 1 (HOIL-1 L), HOIL-1 interacting protein (HOIP), vacuoles, E1 enzyme, X-linked, autoinflammatory and somatic (VEXAS), aberrant TNF activity, TNF23299730993Attorney Docket No. UTSDP4458WO-1001361407 receptor-associated periodic syndrome (TRAPS), TNF receptor-associated periodic syndrome 11 (TRAPS11) - TNF receptor superfamily member 11A (TNFRSF11A), deficiency of adenosine deaminase 2 (DADA2), coatomer protein complex subunit alpha (COPA) syndrome, PLCG2-associated antibody deficiency and immune dysregulation (PLAID) / autoinflammation, PLCG2-associated antibody deficiency and immune dysregulation (APLAID), sideroblastic anemia with B cell immunodeficiency, periodic fevers, and developmental delay (SIFD), cleavage-resistant receptor-interacting serine / threonine kinase 1 (RIPK1) induced autoinflammatory(CRIA) syndrome, Lyn kinase-associated vasculopathy and liver fibrosis (LAVLI), disorders of complement activation, Sjogren’s syndrome, systemic lupus erythematosus (Lupus, SLE), psoriatic arthritis, rheumatoid arthritis (RA), Graves’ disease, Hashimoto’s thyroiditis, Addison’s disease, dermatomyositis, psoriasis, Chronic inflammatory demyelinating polyneuropathy (CIDP), Guillain-Barre syndrome, multiple sclerosis (MS), myasthenia gravis, autoimmune vasculitis, type 1 diabetes, pernicious anemia, or vasculitis. Non-limiting examples of bone diseases that can be diagnosed and / or treated with the methods disclosed herein include, but are not restricted to osteoporosis, postmenopausal osteoporosis, osteomalacia, osteitis, low bone mass, bone erosion, inflammatory bone diseases and endodontic disease.

[0060] In some aspects, the method of diagnosis comprises measuring or obtaining the level of CATK in a biological sample obtained from a subject having or suspected of having one or more of the disease or disorder disclosed herein. In some aspects, the biological sample is a biological fluid. As referred to herein, “bodily fluid” or “biological fluid” can include any fluid obtained from a body of a subject, including, but not limited to, blood, plasma, cerebrospinal fluid, urine, bile, lymph, saliva, synovial fluid, serous fluid, pleural fluid, amniotic fluid, and the like, or any combination thereof. In some aspects, the biological sample is a cell culture, tissue or an organ sample.

[0061] In some aspects, the method of diagnosis comprises measuring or obtaining the levels of CATK, full length ANGPT2, one or more c-terminal fragments ANGPT2, or a combination thereof. In some aspects, the levels of these proteins can be measured using known methods in the art, including but not restricted to antibody-based methods, or mass spectroscopy. In some aspects, the antibody-based method comprises use of, for example a polyclonal antibody, a full-length antibody, an IgG, a VH, a VL, a CDR, a Fab, a F(ab’)2, a nanobody, a monoclonal antibody or an antigen binding fragment thereof that specifically binds to CATK, or a c-terminal fragment of ANGPT2. In some aspects, the antibody may be conjugated to the detection molecule, nonlimiting examples of which include horse-radish peroxidase (HRP), radioisotopes, haptens, fluorescent labels, phosphorescent molecules, chemiluminescent molecules, chromophores, luminescent molecules, photoaffinity molecules,24299730993Attorney Docket No. UTSDP4458WO-1001361407 colored particles and / or ligands, such as biotin, the detection molecule can then be detected by known techniques in the art. In some aspects, the methods of detection may be an immunoassay, for example an immunosorbent assay (ELISA), fluorescence-activated cell sorting (FACS), immunohistochemistry (IHC), immunoprecipitation, or western blotting.

[0062] Determining the level of CATK or its cleavage products is intended to include qualitatively or quantitatively measuring or estimating the level of the protein or variants or fragments thereof in a first sample either directly (e.g., by determining or estimating absolute protein level) or relatively (e.g., by comparing to protein level in a second sample or standard). In some aspects, the second sample may be derived from the same subject. In some aspects, the second sample may be derived from a different subject. Levels in the sample can be measured or estimated and compared to a standard protein level, the standard being determined from a second biological sample from the same subject, or from a subject that is not diseased or determined by averaging levels from a population of samples obtained from subjects without the disease or disorder. As will be appreciated in the art, a standard level may correspond to a reference range based on variations seen within a population of subjects without the disease or disorder. As will be appreciated in the art, once the “standard level” or “reference range” is known, it can be used repeatedly as a standard for comparison.

[0063] In some aspects, the method as disclosed herein, may also be used for monitoring the progression or treatment of the disease or disorder, for example sepsis, inflammatory disease, a bone disease, an autoimmune disease, or related conditions in a subject in need thereof. In some aspects, the method of monitoring comprises measuring the level of CATK in a biological sample obtained from the subject. In some aspects, the method further comprises comparing the level to a level in a second sample or standard. In some aspects, the second sample may be derived from the same subject. In some aspects, the second sample may be derived from a different subject. Levels in the sample can be measured or estimated and compared to a standard protein level, the standard being determined from a second biological sample that is not diseased or determined by averaging levels from a population of samples that are not diseased. In an aspect, the standard level may correspond to a reference range based on variations seen within a population of subjects without the disease or disorder. As will be appreciated in the art, once the “standard level” or “reference range” is known, it can be used repeatedly as a standard for comparison. In some aspects, the method further comprises determining the disease progression or recession based on the difference in the level of the second sample or standard and the first sample.

[0064] In an aspect, the method disclosed herein may also be used for modifying a treatment course as disclosed herein below for a disease or disorder (for example, an sepsis, an inflammatory disease, a bone disease, an autoimmune disease, or related conditions) in a25299730993Attorney Docket No. UTSDP4458WO-1001361407 subject in need thereof. In an aspect, the subject is being administered a CATK inhibitor or an Angiopoietin-2 cleavage product inhibitor, or a combination thereof, and the method comprises continuing with the treatment when the level of CATK in a second biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range, but lower that the level in a first biological fluid sample obtained from the subject; stopping the treatment when the level of CATK in the second biological fluid sample obtained from the subject is found to be the reference range; and changing the treatment when the level of CATK in the second biological fluid sample obtained from the subject is found to be elevated in comparison to the level in a first biological fluid sample obtained from the subject.

[0065] In an aspect, the level of CATK may also be used as an indicator of the disease progression (for example, sepsis, an inflammatory disease, a bone disease, an autoimmune disease, or related conditions), with or without treatment. In an aspect, the method encompasses, obtaining or having obtained a level of CATK in a first biological fluid sample from a subject; comparing the level of CATK in the biological fluid sample to a level in one or more biological fluid samples obtained prior to the first sample, or comparing it to a reference range for CATK, and making a determination if the disease or disorder has worsened or improved over time. In an aspect, the comparison may be further used to make a determination of treatment options.

[0066] Therefore, in an aspect, the current disclosure also encompasses treatment options that can be used based on the diagnostic assays provided herein.III. Compositions

[0067] In some aspects, the current disclosure encompasses compositions comprising an ANGPT2 cleavage inhibitor, or an ANGPT2 cleavage product inhibitor or a combination thereof, for use in the treatment of a disease or disorder diagnosed using the disclosed method (for example, sepsis, an inflammatory disease, a bone disease, an autoimmune disease, or related conditions). In some aspects, an inhibitor of ANGPT2 cleavage as disclosed herein, is a small molecule or a macromolecule that can inhibit (repress, slow, interfere, reduce, suppress, modulate or block) the cleavage of Angiopoietin-2 to c-terminal fragments, for example ANGPT2-25 and / or ANGPT2-50. In some aspects, the inhibitor is a macromolecule, for example a protein, an antibody, or a polynucleotide sequence.

[0068] Antibody inhibitors: In some aspects, the inhibitor is an antibody, an antigen binding agent, or an epitope binding fragment thereof that specifically binds or inhibits the activity of CATK or one or more c-terminal fragment of ANGPT2, for example ANGPT2-25 or ANGPT2-50. In some aspects, the antibody specifically binds to a polypeptide sequence or26299730993Attorney Docket No. UTSDP4458WO-1001361407 an epitope on CATK or one or more of ANGPT2-25 or ANGPT2-50. In some aspects, the antibody specifically binds to or inhibits or enhances the activity of another protein that impacts or modulates one or more of the expression (transcription or translation), post-translational regulation, epigenetic regulation, secretion, or activity of CATK. Non-limiting examples of such proteins include nuclear factor (NF-Y), specificity proteins, Sp1 , Sp3 and erythroblast transformation-specific (Ets) family factors for transcription initiation and regulation, proteins that impact methylation of CpG islands in the promoter region of CTSK, proteins that impact the pH of the intracellular or extracellular milieu and endogenous protein inhibitors like stefins, cystatins, or kiniogens. In certain aspects, antibodies may have a suitable binding affinity for a target antigen (e.g. CATK or a c-terminal fragment of ANGPT2, for example ANGPT2-25 or ANGPT2-50). In some aspects, an antibody described herein may have a binding affinity (KD) of at least about 1000 nM, at least about 100 nM, at least about 10 nM, at least about 1 nM, at least about 0.1 nM, or lower for an epitope of CATK or a c-terminal fragment of ANGPT2, for example ANGPT2-25 or ANGPT2-50. In some aspects, an antibody described herein may have a binding affinity (KD) between about 1000 nM to about 0.1 nM (e.g., about 1000 nM, about 750 nM, about 500 nM, about 250 nM, about 100 nM, about 75 nM, about 50 nM, about 25 nM, about 10 nM, about 5 nM, about 1 nM, about 0.75 nM, about 0.5 nM, about 0.25 nM, about 0.1 nM) for CATK or one or more of ANGPT2-25 or ANGPT2-50. In some aspects, an antibody described herein may have a binding affinity (KD) between about 50 nM to about 40 nM (e.g., about 50 nM, about 49 nM, about 48 nM, about 47 nM, about 46 nM, about 45 nM, about 44 nM, about 43 nM, about 42 nM, about 41 nM, about 40 nM) for a epitope on CATK or a c-terminal fragment of ANGPT2, for example ANGPT2-25 or ANGPT2-50. In some aspects, an antibody described herein may have a binding affinity (KD) between about 50 nM to about 40 nM (e.g., about 50 nM, about 49 nM, about 48 nM, about 47 nM, about 46 nM, about 45 nM, about 44 nM, about 43 nM, about 42 nM, about 41 nM, about 40 nM) for CATK or a c-terminal fragment of ANGPT2, for example ANGPT2-25 or ANGPT2-50. In some aspects, binding affinity (or binding specificity) can be determined by a variety of methods including equilibrium dialysis, equilibrium binding, gel filtration, ELISA, surface plasmon resonance, and / or spectroscopy (e.g., using a fluorescence assay).

[0069] Polynucleotide inhibitors: In some aspects, the inhibitor is a polynucleotide sequence that impacts one or more of the expression (transcription or translation), secretion, levels or activity of CATK. In some aspect the inhibitor is a polynucleotide sequence that impacts the levels a c-terminal fragment of ANGPT2, for example ANGPT2-25, or ANGPT2- 50. In some aspects, the polynucleotide sequence can be an RNA or a DNA sequence. In some aspects, the polynucleotide inhibitors, may be an antisense nucleic acid, an RNAi molecule (e.g., small interfering RNA (siRNA), small-hairpin RNA (shRNA), microRNA27299730993Attorney Docket No. UTSDP4458WO-1001361407(miRNA)), an aptamer and / or a ribozyme. The nucleic acid and amino acid sequences of human CATK and ANGPT2 or ANGPT2-25, or ANGPT2-50 are known or provided herein, and thus polynucleotide inhibitors for use in accordance with methods of the present disclosure may be routinely made by the skilled artisan based on the knowledge in the art and teachings provided herein.

[0070] For example, antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation. Antisense techniques are known in the art. The methods are based on binding of a polynucleotide to a complementary DNA or RNA. The antisense nucleic acids may comprise a single-stranded RNA or DNA sequence that is complementary to at least a portion of an RNA transcript of a desired gene. However, absolute complementarity, although preferred, is not required.

[0071] In some aspects, the polynucleotide inhibitor is an interfering RNA or RNAi molecule that target the expression of one or more genes for example CATK or a regulator thereof. RNAi refers to the expression of an RNA which interferes with the expression of the targeted mRNA. Specifically, RNAi silences a targeted gene via interacting with the specific mRNA through a siRNA (small interfering RNA). The ds RNA complex is then targeted for degradation by the cell. An siRNA molecule is a double-stranded RNA duplex of 10 to 50 nucleotides in length, which interferes with the expression of a target gene which is sufficiently complementary (e.g., at least 80% identity to the gene). In some embodiments not covered by the disclosure, the siRNA molecule comprises a nucleotide sequence that is at least 85, 90, 95, 96, 97, 98, 99, or 100% identical to the nucleotide sequence of the target gene.

[0072] In some aspects, the polynucleotide inhibitor includes but not limited to, a decoy DNA, a double-stranded DNA, a single-stranded DNA, a complexed DNA, an encapsulated DNA, a viral DNA, a plasmid DNA, a naked RNA, an encapsulated RNA, a viral RNA, a doublestranded RNA, a molecule capable of generating RNA interference, or combinations thereof.

[0073] In some aspects, the polynucleotide inhibitor may be aptamers. Aptamers are nucleic acid molecules, including double-stranded DNA and single-stranded RNA molecules, which bind to and form tertiary structures that specifically bind to a target molecule, such as a CATK or a c-terminal fragment of ANGPT2, for example ANGPT2-25, or ANGPT2-50. Nucleic acid aptamers are selected using methods known in the art, for example via the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) process. SELEX is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules. The generation and therapeutic use of aptamers are well established in the art.

[0074] In some aspects, the nucleic acid inhibitor of the present disclosure is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion28299730993Attorney Docket No. UTSDP4458WO-1001361407 thereof, is transcribed, producing an antisense nucleic acid (RNA) of a gene of the disclosure. Such a vector would contain a sequence encoding the desired antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding desired genes of the instant disclosure, or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region, the promoter contained in the 3’ long terminal repeat of Rous sarcoma virus, the herpes thymidine promoter, and the regulatory sequences of the metallothionein gene.

[0075] Peptide inhibitors: In some aspects, the inhibitor is a peptide inhibitor, for example a decoy peptide. In some aspects, a decoy peptide may emulate parts of the target site for cathepsin cleavage in native proteins. In some aspects, the decoy peptide may comprise chemical changes that enhance affinity and / or decrease dissociation such that the cathepsin enzymatic activity is no longer available to cleave native proteins.

[0076] Small molecule inhibitors: In some aspects, the inhibitor is a small molecule or a combination of small molecules, for example a drug that directly or indirectly inhibits one or more of the expression, secretion or activity of CATK or activity of one or more of CANGPT2- 25, or ANGPT2-50. In some aspects, the ability for a small molecule, or combination of small molecules, to inhibit CATK or cleavage of ANGPT2, or activity of a c-terminal fragment of ANGPT2, for example CANGPT2-25, or ANGPT2-50 may be determined in a cell-based assay including, for example, those described herein, or assays known in the art. In some aspects, the small molecule inhibitor can be direct or indirect inhibitors. For example, a CATK inhibitory small molecule, or combination of small molecules, may inhibit the expression (e.g., transcription, translation, cellular secretion, or combinations thereof) of at least one or more of CATK or proteins involved in expression or secretion of CATK. Alternatively, a direct CATK small molecule inhibitor may directly bind to CATK. Combinations of one or more indirect and one or more direct small molecule inhibitor may be used in accordance with the methods disclosed herein. In some aspects, a small molecule inhibitor may comprise a molecule that increase the pH of the intracellular or extracellular milieu causing inhibition of CATK.

[0077] Binding organic small molecule inhibitors may be identified and chemically synthesized using known methodology. In general, small molecule inhibitors are usually less than about 2000 Daltons in size, alternatively less than about 1500, 750, 500, 250 or 200 Daltons in size, wherein such organic small molecules that are capable of binding, preferably specifically, to a polypeptide as described herein (e.g., CATK, or a c-terminal fragment of29299730993Attorney Docket No. UTSDP4458WO-1001361407ANGPT2, for example ANGPT2-25, or ANGPT2-50). Such small molecule inhibitors may be identified without undue experimentation using well-known techniques. In this regard, it is noted that techniques for screening organic small molecule libraries for molecules that are capable of binding to a polypeptide target are well-known in the art.

[0078] Binding organic small molecules may be, for example, aldehydes, ketones, oximes, hydrazones, semicarbazones, carbazides, primary amines, secondary amines, tertiary amines, sugars, N-substituted hydrazines, hydrazides, alcohols, ethers, thiols, thioethers, disulfides, carboxylic acids, esters, amides, ureas, carbamates, carbonates, ketals, thioketals, acetals, thioacetals, aryl halides, aryl sulfonates, alkyl halides, alkyl sulfonates, aromatic compounds, heterocyclic compounds, anilines, alkenes, alkynes, diols, amino alcohols, oxazolidines, oxazolines, thiazolidines, thiazolines, enamines, sulfonamides, epoxides, aziridines, isocyanates, sulfonyl chlorides, diazo compounds, and acid chlorides.

[0079] Representative examples of CATK inhibitors are disclosed in International Publication WO03 / 075836, which is hereby incorporated by reference in its entirety. Some exemplary small molecule inhibitors are also listed in Dai et al. 2020 (Front. Cell Dev. Biol., 04 June 2020 Sec. Molecular and Cellular Pathology Volume 8 - 2020 | https: / / doi.org / 10.3389 / fcell.2020.00433) and Drake et al. (Drake MT, Clarke BL, Oursler MJ, Khosla S. CATK Inhibitors for Osteoporosis: Biology, Potential Clinical Utility, and Lessons Learned. Endocr Rev. 2017 Aug 1 ;38(4):325-350. doi: 10.1210 / er.2015-1114. PMID: 28651365; PMCID: PMC5546879.).

[0080] In some aspects the inhibitor is a small molecule, for example odanacatib (ODN), that specifically binds to CATK. “Odanacatib” or “ODN” is reported to be the INN name of (25 -N-(l-cyanocyclopropyl)-4-fluoro-4-methyl-2-[[(1S)-2,2,2-trifluoro-1-[4-(4- methylsulfonylphenyl)phenyl]ethyl]-amino]-pentanamid and is characterized by the following chemical formula (I):

[0081] Method of preparation of odanacatib can be found in International Publication WO03 / 075836, W02006 / 017455, WO 2009 / 140105, US2006-0052642, US2005-0234128, all of which are hereby incorporated by reference in their entirety. In some aspects, the term30299730993Attorney Docket No. UTSDP4458WO-1001361407“odanacatib” also encompasses modified versions of odanacatib, for instance with alkyl, alkenyl, heteroaryl, heterocycyl, hydroxyalkyl, hydroxy, alkoxy, keto, or halogenated side chains, tautomeric, enantiomeric or diastereomeric forms or other derivatives. In addition, the term “odanacatib” or “ODN” as used in the present application can refer to odanacatib in the form of the free base as well as to its pharmaceutically acceptable salts, hydrates, solvates, polymorphs and mixtures thereof.

[0082] Pharmaceutical compositions: In some aspects, the current disclosure also encompasses pharmaceutical compositions comprising at least one inhibitor or activator as disclosed herein and a pharmaceutically acceptable diluent(s), excipient(s), and / or carrier(s). As used herein, a pharmaceutically acceptable diluent, excipient, or carrier, refers to a material suitable for administration to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0083] In some aspects, pharmaceutical compositions herein may comprise stabilizers, antioxidants, colorants, other medicinal or pharmaceutical agents, carriers, adjuvants, preserving agents, stabilizing agents, wetting agents, emulsifying agents, solution promoters, salts, solubilizers, antifoaming agents, antioxidants, dispersing agents, surfactants, or any combination thereof. Techniques for formulation and administration of drugs may be found in “Remington’s Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0084] In some aspects, to prepare the pharmaceutical compositions, the one or more inhibitor or activator is mixed with a suitable pharmaceutically acceptable carrier. Upon mixing or addition of the compound(s), the resulting mixture may be a solution, suspension, emulsion, or the like. Liposomal suspensions may also be suitable as pharmaceutically acceptable carriers. The form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle. Pharmaceutical carriers or vehicles suitable for administration of the compositions provided herein include any such carriers known to be suitable for the particular mode of administration. In addition, the active materials can also be mixed with other active materials that do not impair the desired action, or with materials that supplement the desired action, or have another action. The inhibitors or activators may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients. The concentration of the one or more inhibitors or activator is effective for delivery of an amount upon administration that lessens or ameliorates at least one symptom of the disorder for which the inhibitor or activator is administered and / or that is effective in a prophylactic context.31299730993Attorney Docket No. UTSDP4458WO-1001361407

[0085] In certain aspects, pharmaceutical compositions disclosed herein may comprise agents or additives selected from a group including surface-active agents, detergents, solvents, acidifying agents, alkalizing agents, buffering agents, tonicity modifying agents, ionic additives effective to increase the ionic strength of the solution, antimicrobial agents, antibiotic agents, antifungal agents, antioxidants, preservatives, electrolytes, antifoaming agents, oils, stabilizers, enhancing agents, and the like. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% total amount of one or more agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more agents by total weight of the composition. In some aspects, one or more of these agents may be added to improve the performance, efficacy, safety, shelf-life and / or other property of the muscarinic antagonist composition of the present disclosure. In some aspects, additives may be biocompatible, without being harsh, abrasive, and / or allergenic.

[0086] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more acidifying agents. As used herein, “acidifying agents” refers to compounds used to provide an acidic medium. Such compounds include, by way of example and without limitation, acetic acid, amino acid, citric acid, fumaric acid and other alpha hydroxy acids, such as hydrochloric acid, ascorbic acid, and nitric acid and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic acid may be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more acidifying agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more acidifying agents by total weight of the composition.

[0087] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more alkalizing agents. As used herein, “alkalizing agents” are compounds used to provide alkaline medium. Such compounds include, by way of example and without limitation, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, and trolamine and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic base can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at32299730993Attorney Docket No. UTSDP4458WO-1001361407 least 50% total amount of one or more alkalizing agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more alkalizing agents by total weight of the composition.

[0088] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more antioxidants. As used herein, “antioxidants” are agents that inhibit oxidation and thus can be used to prevent the deterioration of preparations by the oxidative process. Such compounds include, by way of example and without limitation, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophophorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite and other materials known to one of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more antioxidants by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more antioxidants by total weight of the composition.

[0089] In certain aspects, pharmaceutical compositions disclosed herein may comprise a buffer system. As used herein, a “buffer system” is a composition comprised of one or more buffering agents wherein “buffering agents” are compounds used to resist change in pH upon dilution or addition of acid or alkali. Buffering agents include, by way of example and without limitation, potassium metaphosphate, potassium phosphate, monobasic sodium acetate and sodium citrate anhydrous and dihydrate and other materials known to one of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic buffer can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more buffering agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more buffering agents by total weight of the composition.

[0090] In some aspects, the amount of one or more buffering agents may depend on the desired pH level of a composition. In some aspects, pharmaceutical compositions disclosed herein may have a pH of about 6 to about 9. In some aspects, pharmaceutical compositions disclosed herein may have a pH greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6.33299730993Attorney Docket No. UTSDP4458WO-1001361407

[0091] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more preservatives. As used herein, “preservatives” refers to agents or combination of agents that inhibits, reduces or eliminates bacterial growth in a pharmaceutical dosage form. Non-limiting examples of preservatives include Nipagin, Nipasol, isopropyl alcohol and a combination thereof. In some aspects, any pharmaceutically acceptable preservative can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more preservatives by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more preservatives by total weight of the composition.

[0092] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more surface-acting reagents or detergents. In some aspects, surface-acting reagents or detergents may be synthetic, natural, or semi-synthetic. In some aspects, compositions disclosed herein may comprise anionic detergents, cationic detergents, zwitterionic detergents, ampholytic detergents, amphoteric detergents, nonionic detergents having a steroid skeleton, or a combination thereof. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more surface-acting reagents or detergents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more surface-acting reagents or detergents by total weight of the composition.

[0093] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more stabilizers. As used herein, a “stabilizer” refers to a compound used to stabilize an active agent against physical, chemical, or biochemical process that would otherwise reduce the therapeutic activity of the agent. Suitable stabilizers include, by way of example and without limitation, succinic anhydride, albumin, sialic acid, creatinine, glycine and other amino acids, niacinamide, sodium acetyltryptophonate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycols, sodium caprylate and sodium saccharin and others known to those of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more stabilizers by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more stabilizers by total weight of the34299730993Attorney Docket No. UTSDP4458WO-1001361407 composition.

[0094] In some aspects, pharmaceutical compositions disclosed herein may comprise one or more tonicity agents. As used herein, a “tonicity agents” refers to a compound that can be used to adjust the tonicity of the liquid formulation. Suitable tonicity agents include, but are not limited to, glycerin, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose and others known to those or ordinary skill in the art. Osmolarity in a composition may be expressed in milliosmoles per liter (mOsm / L). Osmolarity may be measured using methods commonly known in the art. In some aspects, a vapor pressure depression method is used to calculate the osmolarity of the compositions disclosed herein. In some aspects, the amount of one or more tonicity agents comprising a pharmaceutical composition disclosed herein may result in a composition osmolarity of about 150 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 280 mOsm / L to about 370 mOsm / L or about 250 mOsm / L to about 320 mOsm / L. In some aspects, a composition herein may have an osmolality ranging from about 100 mOsm / kg to about 1000 mOsm / kg, from about 200 mOsm / kg to about 800 mOsm / kg, from about 250 mOsm / kg to about 500 mOsm / kg, or from about 250 mOsm / kg to about 320 mOsm / kg, or from about 250 mOsm / kg to about 350 mOsm / kg or from about 280 mOsm / kg to about 320 mOsm / kg. In some aspects, a pharmaceutical composition described herein may have an osmolarity of about 100 mOsm / L to about 1000 mOsm / L, about 200 mOsm / L to about 800 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 320 mOsm / L, or about 280 mOsm / L to about 320 mOsm / L. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more tonicity modifiers by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more tonicity modifiers by total weight of the composition.

[0095] In certain aspects, pharmaceutical compositions described herein may be an aqueous suspension comprising one or more polymers as suspending agents. In some aspects, polymers that may comprise pharmaceutical compositions described herein include: water-soluble polymers such as cellulosic polymers, e.g., hydroxypropyl methylcellulose; water-insoluble polymers such as cross-linked carboxyl-containing polymers; mucoadhesive polymers, selected from, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), poly(methyl methacrylate), polyacrylamide, polycarbophil, acrylic acid / butyl acrylate copolymer, sodium alginate, and dextran; or a combination thereof. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at35299730993Attorney Docket No. UTSDP4458WO-1001361407 least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% total amount of polymers as suspending agent(s) by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of polymers as suspending agent(s) by total weight of the composition.

[0096] In certain aspects, pharmaceutical compositions disclosed herein may comprise a viscous formulation. In some aspects, viscosity of composition herein may be increased by the addition of one or more gelling or thickening agents. In some aspects, compositions disclosed herein may comprise one or more gelling or thickening agents in an amount to provide a sufficiently viscous formulation to remain on treated tissue. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% total amount of gelling or thickening agent(s) by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of gelling or thickening agent(s) by total weight of the composition. In some aspects, suitable thickening agents for use herein can be hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyvinylpyrrolidone, carboxymethyl cellulose, polyvinyl alcohol, sodium chondroitin sulfate, sodium hyaluronate. In other aspects, viscosity enhancing agents can be acacia (gum arabic), agar, aluminum magnesium silicate, sodium alginate, sodium stearate, bladderwrack, bentonite, carbomer, carrageenan, Carbopol, xanthan, cellulose, microcrystalline cellulose (MCC), ceratonia, chitin, carboxymethylated chitosan, chondrus, dextrose, furcellaran, gelatin, Ghatti gum, guar gum, hectorite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, maize starch, wheat starch, rice starch, potato starch, gelatin, sterculia gum, xanthum gum, gum tragacanth, ethyl cellulose, ethylhydroxyethyl cellulose, ethylmethyl cellulose, methyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropyl cellulose, poly(hydroxyethyl methacrylate), oxypolygelatin, pectin, polygeline, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropyl cellulose, hydroxypropylmethylcellulose (HPMC), sodium carboxymethyl-cellulose (CMC), silicon dioxide, polyvinylpyrrolidone (PVP: povidone), Splenda® (dextrose, maltodextrin and sucralose), or any combination thereof.

[0097] In some aspects, about 1 to 1000 mg of a compound or mixture of the one or more small molecule inhibitor or activator (for example, odanacatib or chondroitin sulfate) or its tautomeric, enantiomeric or diastereomeric form, derivative or a pharmaceutically acceptable salt thereof may be compounded with a physiologically acceptable vehicle, carrier, excipient,36299730993Attorney Docket No. UTSDP4458WO-1001361407 binder, preservative, stabilizer, flavor, and so forth, in a unit dosage form as called for by accepted pharmaceutical practice. The amount of active substance in those compositions or preparations is such that a suitable dosage in the range indicated is obtained. The compositions are preferably formulated in a unit dosage form, each dosage containing from about 1-1000 mg, 2-800 mg, 5-500 mg, 10-400 mg, 50-200 mg, e.g., about 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg or 1000 mg of the active ingredient. The term “unit dosage from” refers to physically discrete units suitable as unitary (i.e., single) dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient. The concentration and / or amount of the inhibitor or activator in the composition will depend on absorption, inactivation, and excretion rates of the inhibitor or activator, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.

[0098] In some exemplary aspects, the pharmaceutical composition of the present disclosure can comprise about 5 to 25 wt.% ODN, or about 7 to 20 wt.%, or about 8 to 17 wt.% or about 9 to 15 wt.% ODN, based upon the total weight of the pharmaceutical composition and based on the weight of ODN in form of the free base, i.e. as shown in formula above. In some aspects, the pharmaceutical composition of the present disclosure can comprise about 25 to 150 mg, or about 30 to 120 mg ODN. In some exemplary aspects, the present composition can comprise 25 mg, 50mg or 100mg ODN.

[0099] Dosage formulations

[0100] In certain aspects, the present disclosure provides compositions comprising one or more inhibitors disclosed herein, formulated for one or more routes of administration. Suitable routes of administration may, for example, include intravenous, intracranial, intrathecal, subcutaneous, intranasal route, cranial, transmucosal, trans-nasal, transcranial, intracerebroventricular, intestinal, and / or parenteral delivery. In some aspects, compositions herein formulated can be formulated for parenteral delivery. In some aspects, compositions herein formulated can be formulated intramuscular, subcutaneous, intramedullary, intravenous, intraperitoneal, intracranial and / or intranasal injections.

[0101] In certain aspects, pharmaceutical compositions of the present disclosure may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0102] In certain aspects, pharmaceutical compositions for use in accordance with the37299730993Attorney Docket No. UTSDP4458WO-1001361407 present disclosure thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of a pharmaceutical composition herein may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank’s solution, Ringer’s solution, physiological salt buffer, or any combination thereof.

[0103] In certain aspects, pharmaceutical compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection herein may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. In some aspects, compositions herein may be suspensions, solutions or emulsions in oily or aqueous vehicles, and / or may contain formulator agents such as suspending, stabilizing and / or dispersing agents.

[0104] In some aspects, compositions herein may comprise the active ingredient in a powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water-based solution, before use.

[0105] Pharmaceutical compositions suitable for use in context of the present disclosure may include compositions wherein the active ingredients can be contained in an amount effective to achieve the intended purpose. In some aspects, a therapeutically effective amount means an amount of active ingredients effective to prevent, slow, alleviate or ameliorate symptoms of a disorder or prolong the survival of the subject being treated. In some aspects, a therapeutically effective amount means an amount of inhibitor effective to prevent, slow, alleviate or ameliorate symptoms of sepsis, in a subject in need thereof. In some aspects, a therapeutically effective amount means an amount of effective activator to prevent, slow, alleviate or ameliorate symptoms of a cancer or tumor, in a subject in need thereof.

[0106] In some aspects, the inhibitor or activator described herein, or the pharmaceutical can be enclosed in multiple or single dose containers. The enclosed compositions can be provided in kits, for example, including component parts that can be assembled for use. For example, an inhibitor in lyophilized form and a suitable diluent may be provided as separated components for combination prior to use. A kit may include an inhibitor or activator and a second therapeutic agent for co-administration. The inhibitor or activator and second therapeutic agent may be provided as separate component parts. A kit may include a plurality of containers, each container holding one or more unit dose of the one or more active agents. The containers are preferably adapted for the desired mode of administration, including, but not limited to tablets, gel capsules, sustained-release capsules, and the like for oral38299730993Attorney Docket No. UTSDP4458WO-1001361407 administration; depot products, pre-filled syringes, ampules, vials, and the like for parenteral administration; and patches, medipads, creams, and the like for topical or transdermal administration.

[0107] The active ingredient may be administered at once or may be divided into a number of smaller doses to be administered at intervals of time. The precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test data. Concentrations and dosage values may also vary with the severity of the condition to be alleviated. For any particular subject, specific dosage regimens can be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed compositions.

[0108] If oral administration is desired, the composition can be provided in a formulation that protects it from the acidic environment of the stomach. For example, the composition can be formulated in an enteric coating that maintains its integrity in the stomach and releases the active inhibitor in the intestine. The composition may also be formulated in combination with an antacid or other such ingredient. Oral compositions generally include an inert diluent or an edible carrier and may be compressed into tablets or enclosed in gelatin capsules. For the purpose of oral therapeutic administration, the compositions can be incorporated with excipients and used in the form of tablets, capsules, or troches. Pharmaceutically compatible binding agents and adjuvant materials can be included as part of the composition.

[0109] In various aspects, the tablets, pills, capsules, troches, and the like can contain any of the following ingredients or equivalents thereof: a binder such as, but not limited to, gum tragacanth, acacia, corn starch, or gelatin; an excipient such as microcrystalline cellulose, starch, or lactose; a disintegrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, magnesium stearate; a glidant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; and a flavoring agent such as peppermint, methyl salicylate, or fruit flavoring.

[0110] When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier such as a fatty oil. In addition, dosage unit forms can contain various other materials, which modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents. The compositions can also be administered as a component of an elixir, suspension, syrup, wafer, medicated chewing gum or the like. A syrup may contain, in addition to the active compositions, sucrose as a sweetening agent and certain preservatives, dyes and colorings, and flavors.39299730993Attorney Docket No. UTSDP4458WO-1001361407

[0111] The compositions can also be mixed with other active agents that do not impair the desired action, or with materials that supplement the desired action.

[0112] Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include any of the following components: a sterile diluent such as water for injection, saline solution, fixed oil, a naturally occurring vegetable oil such as sesame oil, coconut oil, peanut oil, cottonseed oil, and the like, or a synthetic fatty vehicle such as ethyl oleate, and the like, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvent; antimicrobial agents such as benzyl alcohol and methyl parabens; antioxidants such as ascorbic acid and sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, and phosphates; and agents for the adjustment of tonicity such as sodium chloride and dextrose. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass, plastic, or other suitable material. Buffers, preservatives, antioxidants, and the like can be incorporated as required.

[0113] Suitable carriers for intravenous administration include physiological saline, phosphate buffered saline (PBS), and solutions containing thickening and solubilizing agents such as glucose, polyethylene glycol, polypropyleneglycol, and mixtures thereof. Liposomal suspensions including tissue-targeted liposomes may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known for example, as described in U.S. Pat. No. 4,522,811.

[0114] The one or more inhibitors or activators described herein may be prepared with carriers that protect them against rapid elimination from the body, such as time-release formulations or coatings. Controlled release is a mechanism of formulation to release a drug over an extended time. Use of controlled release formulation may reduce the frequency of administration, reduce fluctuations in blood concentration and protect the gastrointestinal tract from side effects. For example, the anesthetic effect of dyclonine on the mouth and sore throat, which underlies its traditional use in treating sore throats, can be reduced by use of a controlled release formulation. The active compounds may be prepared with carriers that protect the compound against rapid elimination from the body, such as time-release formulations or coating. Such carriers include controlled release formulations (also known as modified, delayed, extended or sustained release or gastric retention dosage forms, such as the Depomed GR™ system in which agents are encapsulated by polymers that swell in the stomach and are retained for about eight hours, sufficient for daily dosing of many drugs). Controlled release systems include microencapsulated delivery systems, implants and biodegradable, biocompatible polymers such as collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid, matrix-controlled release devices, osmotic controlled release devices, multiparticulate controlled release devices, ion-40299730993Attorney Docket No. UTSDP4458WO-1001361407 exchange resins, enteric coatings, multilayered coatings, microspheres, liposomes, and combinations thereof. The release rate of the active ingredient can also be modified by varying the particle size of the active ingredient(s). In some aspects, the active compound may be administered as a prodrug. Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in “Design of Prodrugs,” ed. H. Bundgaard, Elsevier, 1985, which is incorporated by reference herein in its entirety. Metabolites of these compositions include active species produced upon introduction of compositions of this disclosure into the biological milieu.IV. Method of treatment

[0115] In some aspects, methods of treatment as disclosed herein may comprise administering to a subject in need thereof a pharmaceutical composition comprising an inhibitor of CATK, wherein the subject is having, suspected of having, or exhibits symptoms of inflammatory, autoimmune diseases, sepsis or related disease or disorder.

[0116] In an aspect, current disclosure provides that inhibition of cleavage of ANGPT2 can be used to treat inflammatory, autoimmune diseases, sepsis or related disease or disorder. In an aspect, the inhibition of cleavage of ANGPT2 can be accomplished by inhibition of CATK. The current disclosure also provides that a c-terminal fragment of ANGPT2, for example ANGPT2-25 and ANGPT2-50 may enhance the development and / or progression of inflammatory, autoimmune diseases, sepsis or related disease or disorder. As such the current disclosure encompasses administration of inhibitors of one or more of expression, secretion or activity CATK or activity of ANGPT2 cleavage products lacking the N-terminal residues of ANGPT2. In some aspects, the current disclosure encompasses administration of a pharmaceutical composition as disclosed herein for the treatment of inflammatory, autoimmune diseases, sepsis or related disease or disorder. In some aspects, the method disclosed herein therefore comprises administering a pharmaceutical composition comprising one or more of antibodies, polynucleotides or a small molecule composition that inhibits CATK. In some aspects, the method comprises administering a pharmaceutical composition comprising one or more of antibodies, polynucleotides or a small molecule that inhibits a c- terminal fragment of ANGPT2, for example CANGPT2-25, or ANGPT2-50 or both. In some aspects, the method may also encompass administering ANGPT2 or enhancing expression of endogenous ANGPT2 such that the ratio of ANGPT2-25 and / or ANGPT2-50 to full-length ANGPT2 is low. In some exemplary aspects, the inhibitor is a known drug like ODN.

[0117] In some aspects, methods herein may comprise administering to a subject in need thereof an effective amount of one or more of the antibodies, polynucleotides or small molecules disclosed herein or one or more of the pharmaceutical compositions disclosed41299730993Attorney Docket No. UTSDP4458WO-1001361407 herein together with other therapeutic interventions. In some aspects, the compositions disclosed herein can be administered before, after or along with additional therapeutics and treatment methods, non-limiting examples of which include surgery, drainage, chemotherapy and radiation therapy.

[0118] As used herein, “an effective amount” refers to the amount of each active agent required to confer therapeutic effect on the subject, either alone or in combination with one or more other active agents. Determination of whether an amount of the antibodies, polynucleotides or small molecules disclosed herein has achieved a therapeutic effect would be evident to one of skill in the art. Effective amounts vary, as recognized by those skilled in the art, depending on the condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size, gender and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. In some aspects, a maximum dose of the individual components or combinations thereof may be used, that is, the highest safe dose according to sound medical judgment. In some aspects, empirical considerations, such as the half-life, generally will contribute to the determination of the dosage. In some aspects, frequency of administration may be determined and adjusted over the course of therapy, and is generally, but not necessarily, based on treatment and / or suppression and / or amelioration and / or delay of a target disease / disorder. In some aspects, sustained continuous release formulations of an antibody herein may be appropriate. Various formulations and devices for achieving sustained release are known in the art and provided herein.

[0119] In some aspects, dosages as described herein may be determined empirically in individuals who have been given one or more administration(s) of an activator or inhibitor disclosed herein. In accordance with some aspects herein, individuals can be given incremental dosages. To assess efficacy of the antibody, polynucleotide or small molecule, an indicator of the disease / disorder can be followed.

[0120] In some aspects, for administration of any of the antibodies described herein, an initial candidate dosage can be about 2 mg / kg. For the purpose of the present disclosure, a typical daily dosage may range from about any of 0.1 pg / kg to 3 pg / kg to 30 pg / kg to 300 pg / kg to 3 mg / kg, to 30 mg / kg to 100 mg / kg or more, depending on the factors mentioned above. For repeated administrations over several days or longer, depending on the condition, treatment methods of the present disclosure may be sustained until a desired suppression of symptoms occurs and / or until sufficient therapeutic levels are achieved to alleviate a target disease or disorder, or a symptom thereof. In some aspects, a dosing regimen herein may42299730993Attorney Docket No. UTSDP4458WO-1001361407 comprise administering an initial dose of about 2 mg / kg antibody, followed by a weekly maintenance dose of about 1 mg / kg of antibody, or followed by a maintenance dose of about 1 mg / kg antibody every other week. In some aspects, other dosage regimens may be useful, depending on the pattern of pharmacokinetic decay that the practitioner wishes to achieve. In accordance with some aspects herein, dosing from one-four times a week is contemplated. In some aspects, dosing ranging from about 3 pg / mg to about 2 mg / kg (such as about 3 pg / mg, about 10 pg / mg, about 30 pg / mg, about 100 pg / mg, about 300 pg / mg, about 1 mg / kg, and about 2 mg / kg) antibody may be used. In some aspects, dosing frequency may be once every week, every 2 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once every month, every 2 months, or every 3 months, or longer. In some aspects, the progress of this therapy can be easily monitored by conventional techniques and assays. In some aspects, a dosing regimen (including the disclosed antibody used) suitable for use herein can vary over time.

[0121] In some aspects, for an adult patient of normal weight, doses ranging from about 0.3 to about 5.00 mg / kg antibody may be administered. In some aspects, the dosage of the antibody described herein can be about 10 mg / kg. The particular dosage regimen, i.e., dose, timing and repetition, can depend on the particular individual and that individual’s medical history, as well as the properties of the individual agents (such as the half-life of the agent, and other considerations well known in the art).

[0122] In some aspects, the compounds disclosed herein may be administered to the subject by a variety of routes. For example, one or more of the compositions disclosed herein may be administered orally via a solid or liquid dosage form (tablet, gel cap, time release capsule powder, solution, suspension in aqueous or non-aqueous liquid), parenterally (i.e., subcutaneously, intradermally, intravenously, (i.e., as a solution, suspension, or emulsion in a carrier), and / or intramuscularly, intracranially, or intraperitoneally). In one aspect, the compounds may be administered in saline or with a pharmaceutically acceptable excipient as described above.

[0123] Suitable subjects may include, without limit, humans, as well as companion animals such as cats, dogs, rodents, and horses; research animals such as rabbits, sheep, pigs, dogs, primates, mice, rats, and other rodents; agricultural animals such as cows, cattle, pigs, goats, sheep, horses, deer, chickens, other fowl; zoo animals; and primates such as chimpanzees, monkeys, and gorillas. The subject can be of any age without limitation. In an aspect, the subject may be a human.

[0124] Generally, the composition will be administered in a therapeutically effective amount which includes prophylactic amounts or lower dosages for example, when combined with43299730993Attorney Docket No. UTSDP4458WO-1001361407 another agent. As used herein, “an effective amount” refers to doses of compound sufficient to provide circulating or local concentrations high enough to impart a beneficial effect on the recipient thereof. The precise amount to be administered can be determined by the skilled practitioner in view of desired dosages, side effects, and medical history of the patient.

[0125] In certain aspects, a compound disclosed herein may be administered to a subject intravenously at a concentration ranging from about 0.05 mg / kg to about 20 mg / kg. In some aspects, a compound disclosed herein may be administered to a subject intravenously at a concentration of about 0.05 mg / kg, about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, or about 20 mg / kg. In some aspects, a compound disclosed herein may be administered to a subject intravenously at least once a day, at least twice a day, at least three times a day or more.

[0126] In certain aspects, a compound disclosed herein may be administered to a subject orally at a concentration ranging from about 0.5 mg / kg to about 50 mg / kg. In some aspects, a compound disclosed herein may be administered to a subject orally at a concentration of about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, or about 50 mg / kg. In some aspects, a compound disclosed herein may be administered to a subject orally at least once a day, at least twice a day, at least three times a day or more.V. Kits

[0127] In some aspects, the assay methods and compositions of this disclosure can be provided in the form of a kit. In an aspect, the kits may be for analysis, drug screening, diagnosis, prognosis, for methods of disease treatment, prediction and identification of a new druggable target that reduce the level of CATK in the serum. In some aspects, the disclosure provides kits for the classification, diagnosis, prognosis, and / or prediction of an inflammatory disease, an autoimmune disease or sepsis. In some aspects, the disclosure provides kits for the classification, diagnosis, prognosis, and / or prediction of an outcome of an inflammatory disease, an autoimmune disease or sepsis in a subject, after administering a therapeutic agent. In an aspect, the kit comprises a binding agent that specifically binds CATK. In some aspects, the kit comprises one or more of the antibody for example a polyclonal antibody, a full-length antibody, an IgG, a VH, a Vi_, a CDR, a Fab, a F(ab’)2, a nanobody, a monoclonal antibody or an antigen binding fragment thereof that specifically binds to CATK, or a small molecule, peptide, or aptamer that specifically binds CATK. The kit may further comprise one44299730993Attorney Docket No. UTSDP4458WO-1001361407 or more agents that enhance the interaction of the binding agent to CATK, for example buffers and salts. The kit may further comprise control samples. In an aspect, the kit may further comprise detection reagents. In an aspect, the kit may comprise test strips, simple paperbased devices used for rapid detection of analytes in samples, lateral flow tests, rapid diagnostic tests, dipsticks, nucleic acid lateral flow test strips, urine test strip or combination thereof.

[0128] The kit may further comprise a software package for data analysis of the cellular state and its physiological status, which may include reference profiles for comparison with the test profile and comparisons to other analyses as referred to above. The kit may also include instructions for use for any of the above applications.

[0129] In an exemplary aspect the kit may comprise an antibody that specifically binds CATK, or ANGPT2 or fragments thereof as provided herein, one or more reagents to facilitate formation of the antibody-antigen complex and subjecting the complex to a chromatographic method. In some aspects, the reagents may comprise salts, buffers, detergents, or glycerol. In some aspects, the kit may further comprise means for drawing a patient sample, for example a syringe, appropriate tubing etc. The kit may further comprise instructions for use.EXAMPLES

[0130] The following examples are included to demonstrate preferred embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the present disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present disclosure.Example 1: CatK deletion results in loss of cleavage of Angiopoetin

[0131] It was previously shown in PCT / US2024 / 016124 (the contents of which are incorporated herein in their entirety), that CATK is involved in cleavage of angiopoietin2 in infection- and inflammation-associated conditions. FIG. 1 provides a schematic representation of the findings. CATK is among a group of cysteine proteases normally localized to lysosomes and tasked with disposal of intracellular proteins. CatK and other cathepsins are released by activated immune cells both through conventional secretion as well as cell lysis arising from pyroptosis. However, the secretome of activated immune cells contains many proteolytic enzymes.45299730993Attorney Docket No. UTSDP4458WO-1001361407

[0132] To further confirm that CATK is responsible for ANGPT2 cleavge a CRISPR approach was used to knockout CatK in RAW264.7 clonal lines. A schematic of the CRISPR design strategy is provided in FIG. 2A. SgRNAs were designed using Synthego design tool and a 3-guide strategy. SgRNAs (see Table 1) were incubated with recombinant spCas9 at room temperature for 10 minutes before nucleofection into 106RAW264.7 cells using the Amaxa nucleofector with the Lonza nucleofector Kit V. Cells were cultured after nucleofection in standard DM EM with 10% FBS. After 24 hours, DNA were isolated from cells using the DNAEasy Kit (Qiagen) and a 450 bp region over the mutated segment was amplified via PCR using the primer sequences provided in Table 1. The PCR product was purified using Qiagen PCR purification kit and sequenced using the Sanger sequencing core at LIT Southwestern.Table 2: SgRNA sequences and sequencing primers

[0133] The resulting sequences were analyzed using Synthego’s ICE analysis tool. Isogenic clones were made by splitting the cells into single cell populations and allowing proliferation into colonies before DNA isolation and sequencing as above. Table 2 provides the indel % and knock out score of CatK targeted cell lines.

[0134] CM-MqLPS from the knockout and control strains was incubated with ANGPT2 to test if CATK is necessary and sufficient to bring about the cleavage of ANGPT2. The CM- MqLPS from the three separate CatK KO RAW264.7 clonal cell lines did not cleave ANGPT2, while CM-MqLPS from isogenic Cas9-control RAW264.7 cells retained inducible ANGPT2 cleaving activity, thus further confirming a role of CATK in cleaving ANGPT2 (FIG. 2B).Example 2: Serum CatK levels and ANGPT2 are highly upregulated in endotoxemic mice

[0135] In order to further elucidate the in vivo mechanism of the CATK cleavage activity during inflammation, levels of circulating CATK was determined in endotoxemic mouse plasma samples. The levels of ANGPT2 were also determined in corresponding samples.46299730993Attorney Docket No. UTSDP4458WO-1001361407ANGPT2 and CATK protein level in serum was measured using AANGPT2 ELISA kit (R&D, MANG20) and CATK ELISA kit (Novus Biologicals, NBP3-00426) respectively. Surprisingly, circulating CATK (FIG. 3A) was found to be highly upregulated in the plasma of endotoxemic mice. Without being bound by theory, this upregulation likely reflects release of CATK protein rather than transcriptional upregulation. This was further confirmed by determining the levels of cathepsin K (CtsK) and Cystatin C (Cst3) mRNA in the lungs of LPS administered mice (n=10 mice per group). This upregulation likely reflects release of CATK protein rather than transcriptional upregulation in macrophages as is evident from measuring the relative ratio of Ctsk / Cst mRNA (FIG. 3B-3D) or in vivo (FIG. 3E). As seen in FIG. 3E, the overall levels of CtsK mRNA in the lungs is not significantly different in the two lung samples. The Cystatin C (Cst3) mRNA was however different in the lungs of LPS administered mice.

[0136] Next, it was sought to confirm that the levels of CATK in the plasma was sufficient to bring about the cleavage of ANGPT2 in vivo. The approximate ratio of ANGPT2 (52.7 ± 16.8 ng / mL, mean ± SD) to CATK (28.2 ± 12.6 ng / mL, mean ± SD) in the circulation was 1 to 0.5. In a reaction of recombinant proteins of ANGPT2 and CATK, ANGPT2 cleavage could be observed at ANGPT2:CATK ratios of 1 :0.1 to 1:1 (FIG. 3F), indicating that sufficient extracellular CATK accumulates during systemic inflammation to promote ANGPT2 cleavage in vivo.

[0137] Finally, it was sought to determine if, like CATK, the levels of ANGPT2 also varies between healthy controls and patients. Serum collected from healthy volunteers and from patients within 24 hours of admission to the intensive care unit (ICU) for sepsis, acute respiratory distress syndrome (ARDS), or the combination of both, was tested for levels of ANGPT2. As seen in FIG. 3G, ANGPT2 levels were higher in patients in comparison to healthy individuals.

[0138] These results indicate that CATK levels in the plasma are enhanced several folds in mouse inflammation models. The dramatic increase in the levels of CATK in endotoxemic mice indicates that CATK levels and / or the ratio of CATK / ANGPT2 can be used as effective biomarkers for detection of inflammatory diseases and further in monitoring treatment outcomes.Example 3: Methods

[0139] Sex as a biological variable. In mouse studies utilizing hydrodynamic tail vein gene transfer, we examined male FVB mice. This choice was made in order to limit experimental variation atop the manipulations of drug and plasmid injection. For Angpt2+I- mouse experiments, we examined animals of both sexes. The ratio of males to females was statistically balanced. The human study consented patients irrespective of sex.47299730993Attorney Docket No. UTSDP4458WO-1001361407

[0140] Materials. Lipopolysaccharide (LPS) and Phorbol 12-myristate 13-acetate (PMA) were purchased from Sigma-Aldrich. Recombinant TNF-a protein, mouse and human ANGPT2 were purchased from R&D Systems. CATK inhibitor Odanacatib (ODN) was purchased from SANTA-CRUZ®. Recombinant CATK was purchased from ENZO® Life Sciences. CATK activity assay kit was purchased from BioVision™. The centrifugal filter devices of AMICON® Ultra (MWCO: 10 kDa and 50 kDa) were purchased from M ILLI PORE®. Brewer thioglycollate medium was purchased from Millipore®.

[0141] Mouse studies. Male 8-10-week-old FVB mice were purchased from The Jackson Laboratory. For Angpt2+I- mouse experiments, the background strain was C57BL / 6J, and littermate wild-type controls were studied. Mice were acclimated to the animal facilities for at least 1 week before experiments. For survival experiments, mice were administered LPS E.coli serotype 0111 :B4 intraperitoneally (10mg / kg) or underwent cecal ligation and puncture (CLP) performed as previously described (64). To induce over-expression of ANGPT2 isoforms in mice, 10 pg of mammalian vector DNA dissolved in sterile saline (10 % body weight) was injected via tail vein over 8-10 seconds using a 30.5-gauge needle under isoflurane anesthesia. ODN stock solution was dissolved in DMSO at 100 mg / mL. Diluted ODN in corn oil (1 :20) was administered at 20 mg / kg 1 hour prior to LPS administration or CLP surgery. With all survival experiments, animals were examined every 2 hours after intervention and assigned a pain score based on an objective scale of animal suffering created by UT Southwestern. Once mice crossed the IACUC approved threshold, they were humanely euthanized and considered as a death endpoint in the survival analysis.

[0142] Mouse lung histology analysis. Mouse lungs were harvested from anesthetized mice, and immersion fixed in twenty-volumes of 10 % neutral-buffered formalin. Following 48 hours of constant agitation in fixative, lungs were briefly rinsed and then dehydrated, cleared, and paraffin embedded by standard histological procedures. Serial sections were obtained by rotary microtome at 5 pm thickness for regressive hematoxylin and eosin (H&E) staining. A minimum of 5 fields for each lung slide was examined and scored for pathological injury.

[0143] Cells and conditioned culture media (CM). HUVECs, human umbilical vein endothelial cells, were purchased from LONZA® and were cultured in EBM-2 media supplemented with 5 % FBS and growth factors (LONZA®) according to the manufacturer’s instructions. Only HUVECs on passage 3-6 were utilized for the experiments. RAW264.7 murine macrophage-like cells and HEK293 cells were purchased from American Type Culture Collection (ATCC, Rockville, MD) and cultured in Dulbecco’s modified Eagle’s Medium (DMEM™, Gibco) supplemented with 10 % FBS (ATLANTA biologicals). To produce conditioned culture media (CM) of LPS or vehicle stimulated RAW264.7 cells (CM-MqLPS and CM-Mqveh), confluent RAW264.7 cells were stimulated with LPS (100 ng / mL) in serum-free48299730993Attorney Docket No. UTSDP4458WO-1001361407DMEM™. One hour after stimulation, media was exchanged to serum free DMEM™ after washing cells twice with warm PBS. CM was harvested 24 hours after LPS stimulation and centrifuged at 1 ,200 rpm for 5 minutes to remove dead cells. Supernatant was stored at -80 °C until use. In the PMA activation of HLIVECs, 90 % confluent HLIVECs were stimulated with 10 ng / mL PMA in starvation media comprised of EBM-2 with 0.25 % FBS. 24 hours after PMA activation, HLIVECs were stimulated with LPS (1 pg / mL) or vehicle for 4 hours. Then, recombinant ANGPT2 (500 ng) was exogenously added.

[0144] CRIPSR. SgRNAs were designed using Synthego design tool and a 3-guide strategy SgRNAs were incubated with recombinant spCas9 at room temperature for 10 minutes before nucleofection into 106RAW264.7 cells using the Amaxa nucleofector with the Lonza nucleofector Kit V. Cells were cultured after nucleofection in standard DMEM™ with 10% FBS. After 24 hours, DNA was isolated from cells using the DNAEasy™ Kit (QIAGEN®) and a 450 bp region over the mutated segment was amplified via PCR. The PCR product was purified using QIAGEN® PCR purification kit and sequenced (Seq primer using the Sanger sequencing core at UT Southwestern). The resulting sequences were analyzed using Synthego’s ICE analysis tool (https: / / ice.synthego.eom / # / ). Isogenic clones were made by splitting the cells to single cell populations and allowing proliferation into colonies before DNA isolation and sequencing as above.

[0145] Vector construction. Primer sequences with appropriate restriction enzyme sites were used for construction of ANGPT2 expression vectors. Q5 High-Fidelity DNA polymerase (New England BioLabs®) was used to amplify ANGPT2 cDNAs. HUVECS were used to source full length ANGPT2 cDNA. PCR cycle conditions to clone full length ANGPT2 were: 98 °C for 10 seconds, 68 °C for 20 seconds, and 72 °C for 50 seconds for 30 cycles. After ANGPT2 sequence was confirmed, PCR products were digested with restriction enzymes of Kpnl and EcoRI followed by ligation into pcDNA3.1 vector (Life Technologies). Using the completed full length ANGPT2 expression vector as template DNA, overhang extension PCR technique was utilized to construct cleaved ANGPT2 expression vectors by inserting a start codon (ATG) and IL-2 signal peptide coding sequence (SEQ ID NO: 25: gcattgcactaagtcttgcacttgtcacaaacagt) in front of cleaved ANGPT2 coding sequences. For the purification of proteins, 6x His tag coding sequence was added to the 3’-end.

[0146] Preparation of mouse tissues. Animals were euthanized by exsanguination under anesthesia, followed by rapid collection of organs into liquid nitrogen for further analysis. 20 - 30 mg of mouse lung was homogenized in ice-cold non-denaturing lysis buffer (20 mM Tris- HCI pH 8.0, 137 mM NaCI, 1 % Triton X-100, 2 mM EDTA) supplemented with protease inhibitor cocktail (Sigma Aldrich) and phosphatase inhibitors (Sigma Aldrich). Lysates were sonicated and centrifuged at 8,000 x g for 15 minutes at 4 °C, and supernatant was collected.49299730993Attorney Docket No. UTSDP4458WO-1001361407

[0147] Expression and purification of recombinant ANGPT2 proteins. HEK293 cells were seeded to 6 well plates (3 x 105 cells I well). When the cells reached 70-80 % confluency, culture media was changed to serum-free DMEM™ before transfection. Using FuGENE® 6 (Promega) ANGPT2 and ANGPT2443 expression vectors were transfected to the cells according to the manufacturer’s instructions. CM was collected 48 hours post-transfection and centrifuged at 1 ,200 rpm for 5 minutes to remove dead cells. Supernatant was stored at -80 °C until use. Recombinant ANGPT2, ANGPT2-50, and ANGPT2-25 proteins were prepared using the Expi293™ Expression system (Invitrogen). 150 pg of expression vector and 480 pL of ExpiFectamin™ 293 Reagent were mixed in 17.4 mL of Opti-MEM™ (Invitrogen). The mixture was incubated at room temperature for 15 minutes then added to 3 x 106Expi293™ suspension cells in 150 mL of Expi293™ Expression Medium. 24 hours post-transfection, 0.9 mL of ExpiFectamin™ 293 Transfection Enhancer 1 , and 9 mL Enhancer 2 were added to the cell culture flask. Cells were cultured in a shaker incubator at 37°C with a humidified atmosphere of 8 % CO2 in air. Five days post-transfection harvested culture supernatants were centrifuged to remove cells and debris then stored at -80 °C until the next purification step. ANGPT2 proteins were purified by immobilized metal affinity chromatography (IMAC™) on a nickel-nitrilotriacetic acid (HisPur™ Ni-NTA Superflow Agarose, Thermo Fischer Scientific™) column. The concentration of purified proteins was measured using BCA assay kit (Pierce).

[0148] Immunoprecipitation. 500 pg of cell or tissue lysates were incubated with 3 pg of Tie2 antibody and Dynabeads™ Protein G (Thermo Fisher Scientific™) at 4°C for overnight. Immunocomplexes were washed with PBS-T (0.02 % Tween 20) four times, and immunoprecipitated proteins were eluted with glycine elution buffer (100 mM Glycine, pH 2.2) and separated by SDS-PAGE.

[0149] Western blot. Collected conditioned media (CM) was centrifuged to remove debris, and supernatants were applied to SDS-PAGE gel. Cells or organ lysates were prepared by homogenization in ice-cold lysis buffer (20 mM Tris-HCI, pH 8, 137 mM NaCI, 1 % NP-40, 2 mM EDTA) supplemented with protease inhibitor (Complete Mini, EDTA-free, Sigma Aldrich) and phosphatase inhibitor (PhosSTOP™ EASYpack, Sigma Aldrich). Lysates were sonicated and centrifuged at 8,000 x g for 15 minutes at 4°C, and supernatants were collected. Using BCA assay Kit (Pierce), protein concentrations in supernatants were measured and 10g of protein were separated by SDS-PAGE using NuPAGE™ bis-tris gels (4-12 % gradients) with MES SDS running buffer or NuPAGE™ tris-acetate gel (3-8 % gradients) with MOPS running buffer (Thermo Fisher Scientific™). The proteins were transferred to nitrocellulose membranes, blocked for 1 hour (SuperBlock™ T20, ThermoFisher Scientific™), immunoblotted with specific primary antibodies, and incubated with the appropriate secondary50299730993Attorney Docket No. UTSDP4458WO-1001361407 antibody conjugated with horseradish peroxidase. Bands were visualized using ECL kit (ThermoScientific). To investigate oligomeric status of ANGPT2, western blot was performed under nonreducing conditions without reducing agents.

[0150] RT-qPCR. Total RNA of HLIVECs was extracted using RNeasy Mini kit (QIAGEN). Total RNA of mouse tissues was extracted using TRIzol™ (Invitrogen), followed by clean-up using the RNeasy Mini Kit with on-column DNase digestion (QIAGEN) per the manufacturer’s instructions. Total RNA (1 pg) was then reverse transcribed to cDNA using SuperScript™ III Reverse Transcriptase (Invitrogen®). Quantitative PCR reactions were performed using SYBR-green™ reaction mix (Qiagen®) in duplicate using ABI QuantStudio™ 6 Flex System (Applied Biosystems®) and the appropriate primers (Supplemental Table 2). Relative expression levels were determined using the comparative threshold method.

[0151] Reaction of recombinant ANGPT2 and recombinant CATK in test tube. 200 ng of recombinant ANGPT2 was incubated with 200 ng of recombinant CATK protein in 50 pL of pH 5.5 solution (50 mM Sodium Acetate pH 5.5, 50 mM Sodium Chloride, 0.5 mM EDTA, 5 mM DTT) at 37°C for 5 minutes. Immediately after the reaction, CATK was deactivated by heating at 95°C for 5 minutes. 16 pL of the reaction mixture was applied to SDS-PAGE gel for western blot of ANGPT2.

[0152] Measurement of CATK activity. The CATK activity in mouse lung was evaluated using cathepsin K Activity Fluorometric Assay kit (BioVision™). 20-30 mg of mouse lung was homogenized in the provided lysis buffer, and 200 Dg of lung lysate was used for the assay.

[0153] Coomassie Blue Staining. CM-MqLPS was incubated with murine or human recombinant ANGPT2 at 37 °C for 24 hours. Samples were split and applied to two SDS- PAGE gels. One gel was used for Coomassie Blue staining and another gel was used for western blotting to detect the position of ANGPT2 and two cleaved ANGPT2s. Following the fixation of SDS-PAGE gel with 40 % methanol, 10 % acetic acid, and 50 % water for 1 hour, the gel was stained with Coomassie Blue solution (0.1 % Coomassie Blue R-250, 50 % Methanol, 10 % acetic acid) for 45 minutes. After the destaining, bands containing cleaved AGNPT2 fragments were dissected and trypsinized for amino acids sequencing via mass spectrometry. Intact ANGPT2 contained bands were dissected as reference controls.

[0154] Validation of circulating ANGPT2 and CATK in endotoxemia mice. ANGPT2 and CATK protein level in serum was measured using ANGPT2 ELISA kit (R&D, MANG20) and CATK ELISA kit (Novus Biologicals, NBP3-00426).

[0155] ELISA validation of AN GPT2 proteins. 100 pL of serum or 500 pL of urine was applied to Amicon® Ultra (50 kDa), and the flow through was collected after centrifugation. Concentration of ANGPT2-25 was measured by ELISA (R&D Systems, DANG20 for human51299730993Attorney Docket No. UTSDP4458WO-1001361407ANGPT2) in the flow through with the standard of serial dilutions (10,000 pg / mL to 312.5 pg / mL) of recombinant ANGPT2-25 protein. Concentration of all isoforms of ANGPT2 was measured in intact serum or urine according to the manufacture’s instruction.

[0156] Human samples. ANGPT2 and its cleaved 25 kDa product were measured in serum. The samples of the intensive care unit group were collected within 24 h of ICU admission in patients with primary ARDS (n = 20), ARDS and sepsis (n = 10), and sepsis without ARDS (n = 10). Samples were immediately aliquoted and stored at -80 °C until analyses. Clinical details are provided in Table 1. Serum was also collected from healthy controls (n = 12, mean age 30.9 ± 8.1 , 50 % female). The collection of the intensive care unit serum samples was approved according to the ethics committee of Hannover Medical School (Hannover, Germany) (MHH, EK #8146_BO_K_2018) and the collection of the control serum samples was approved by the institutional review board (IRB) of the University of Texas Southwestern Medical Center Dallas (USA). Urine was collected from a separate cohort of pediatric patients with sepsis and healthy controls (Supplemental Table 5). These samples were sent to the clinical laboratory at a tertiary care children’s hospital as part of routine care. Discarded clinical samples were collected for this study and stored at -80 °C until measurement. The collection of these samples was approved by the UT Southwestern IRB.

[0157] Total ANGPT2 was measured using the ELISA from R&D following manufacturer’s instructions. For the analysis of the 25 kDa fragment of ANGPT2, a total of 100 pL of serum or 500 pL of urine was applied to Amicon® Ultra filters (50 kDa). Following centrifugation according to the manufacturer’s instructions, concentrations of ANGPT2-25 were measured in the flow-through by ELISA using serial dilutions (10,000 pg / mL to 312.5 pg / mL) of recombinant ANGPT2-5 protein to establish standard curves.

[0158] Illustrations. Illustrations were made by using BioRender™.

[0159] Statistics. Statistical significance was evaluated using student’s t-test or one-way ANOVA unless otherwise noted. Survival data were analyzed by log-rank test and visualized by Kaplan-Meier curves. The correlation plot was done with R Statistical Environment V4.3.1 program (Vienna, Austria). All experimental results are presented as mean ± SD, and a two- tailed p value of less than 0.05 was considered to indicate statistical significance. GraphPad Prism 9.55 (La Jolla, CA) was used to depict the graphs and calculate the statistics.

[0160] Study approval. All animal experiments were approved by the Institutional Animal Care and Use Committee of University of Texas Southwestern Medical Center. Human samples were obtained under protocols approved by the Institutional Review Board at University of Texas Southwestern Medical Center and Department of Respiratory Medicine and German Centre of Lung Research (DZL), Hannover Medical School, Hannover, Germany.52299730993Attorney Docket No. UTSDP4458WO-1001361407Participants’ written informed consent was obtained.53299730993

Claims

Attorney Docket No. UTSDP4458WO-1001361407CLAIMSWhat is claimed is:

1. A method of diagnosing a disease or disorder in a subject, comprising: a) obtaining a level of cathepsin K in a biological fluid sample from the patient; b) comparing the level of cathepsin K in the biological fluid sample to a reference range for cathepsin K; and c) diagnosing the subject with the disease or disorder based on step b, wherein a level of cathepsin K is higher than the reference range.

2. A method of treating a disease or a disorder in a subject, comprising administering to the subject an effective amount of a cathepsin K inhibitor, or an angiopoietin-2 cleavage product inhibitor, or both, when the level of cathepsin K in a biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range for cathepsin K.

3. A method of treating a disease or disorder in a subject in need thereof, comprising: a) obtaining a level of cathepsin K in a biological fluid sample from the patient; b) detecting an increase in the level of cathepsin K in the biological fluid sample of the subject compared to a reference range for cathepsin K; and c) administering to the subject an effective amount of a cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor, or both, when an increase in the level of cathepsin K is detected.

4. A method of modifying a treatment for a disease or a disorder in a subject, wherein the subject is being administered a cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor, or a combination thereof, comprising: a) continuing with the treatment when the level of cathepsin K in a second biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range, but lower that the level in a first biological fluid sample obtained from the subject;54299730993Attorney Docket No. UTSDP4458WO-1001361407 b) stopping treatment when the level of cathepsin K in the second biological fluid sample obtained from the subject is found to be the reference range; and c) changing the treatment when the level of cathepsin K in the second biological fluid sample obtained from the subject is found to be elevated in comparison to the level in a first biological fluid sample obtained from the subject.

5. A method of monitoring a treatment response in a subject, wherein the subject is being administered a cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor, or a combination thereof, comprising: a) obtaining a level of cathepsin K in a biological fluid sample from the subject; b) comparing the level of cathepsin K in the biological fluid sample to a reference range for cathepsin K; and c) determining that the subject is responsive when the level of cathepsin K in a s biological fluid sample obtained from the subject is found to be in the reference range, or lower than the level in a biological fluid sample obtained from the subject before treatment.

6. The method of claim 4 or 5, wherein the first biological fluid sample is obtained from the subject prior to the administering of cathepsin K inhibitor or an angiopoietin-2 cleavage product inhibitor.

7. The method of any one of claims 1-5, wherein the disease is sepsis, inflammatory disease, bone disease, or an autoimmune disease.

8. The method of claim 7, wherein the disease or disorder is sepsis, vascular inflammation, vascular destabilization, osteoporosis, postmenopausal osteoporosis, low bone mass, bone erosion, osteomalacia, osteitis, inflammatory bone diseases, endodontic disease, Crohn’s disease, ulcerative colitis, psoriasis, asthma, multiple sclerosis, acute kidney failure, acute respiratory stress, familial Mediterranean fever (FMF), pyrin- associated autoinflammation with neutrophilic dermatosis (PAAND), hyperimmunoglobulin D syndrome (HIDS), pyogenic sterile arthritis, pyoderma gangrenosum, and acne (PAPA), hyperzincemia / hypercalprotectinemia (HZ / HC), Periodic fever, immunodeficiency, and thrombocytopenia (PFIT), neonatal onset of pancytopenia, autoinflammation, rash, and episodes of hemophagocyticlymphohistiocytosis (NOCARH) syndrome, NALP3 / cryopyrin55299730993Attorney Docket No. UTSDP4458WO-1001361407 inflammasome, familial cold autoinflammatory syndrome (FCAS), Muckle- Wei Is syndrome (MWS), neonatal-onset multisystem inflammatory disorder (NOMID), Majeed syndrome / lipin 2 (LPIN2), NLRC4 inflammasome, autoinflammation with infantile enterocolitis (AIFEC), NLRP12 inflammasome, familial cold autoinflammatory syndrome 2 (FCAS2), NLRP1 inflammasome, multiple self-healing palmoplantar carcinoma (MSPC), familial keratosis lichenoides chronica (FKLC), NLRP1-associated autoinflammation with arthritis and dyskeratosis (NAIAD), AIM2 inflammasome (none described), noncanonical inflammasome (none described), deficiency of the IL-1 receptor antagonist (DIRA), deficiency of the IL-36 receptor antagonist (DITRA), diseases of interferon production and signaling, impaired degradation or processing of endogenous nucleic acids, Aicardi- Goutieres syndrome (AGS)1 , AGS2, AGS3, AGS4, AGS5, AGS6, DNase II deficiency, polyribonucleotide nucleotidyltransferase 1 (PNPT1) - polynucleotide phosphorylase (PNPase) deficiency, enhanced nucleic acid sensing, stimulator of interferon genes (STING) associated vasculopathy with onset in infancy (SAVI), AGS7, proteasome dysfunction, chronic atypical neutrophilic dermatitis with lipodystrophy and elevated temperature (CANDLE), amplified interferon receptor signaling, ubiquitin-specific peptidase 18 (UPS18) - pseudo-toxoplasmosis, other (syphilis), rubella, cytomegalovirus, herpes simplex virus (pseudo-TORCH) syndrome, ISG15 ubiquitin-like modifier (ISG15), haploinsufficiency of A20 / TNF-alpha-induced protein 3 (TNFAIP3), nucleotide-binding oligomerization domain protein 2 (NOD2) - Blau syndrome, NFkB essential modulator (NEMO), RELA haploinsufficiency, retinal dystrophy, optic nerve edema, splenomegaly, anhidrosis, and headache (ROSAH) syndrome, disorders of linear ubiquitination, OTULIN- related autoinflammatory syndrome (ORAS; ie, otulipenia), deficiency of linear ubiquitin chain assembly complex (LUBAC) - heme-oxidized IRP2 ubiquitinligase 1 (HOIL-1 L), HOIL-1 interacting protein (HOIP), vacuoles, E1 enzyme, X-linked, autoinflammatory and somatic (VEXAS), aberrant TNF activity, TNF receptor-associated periodic syndrome (TRAPS), TNF receptor-associated periodic syndrome 11 (TRAPS11) - TNF receptor superfamily member 11A (TNFRSF11A), deficiency of adenosine deaminase 2 (DADA2), coatomer protein complex subunit alpha (COPA) syndrome, PLCG2-associated antibody deficiency and immune dysregulation (PLAID) / autoinflammation, PLCG2-associated antibody deficiency and immune dysregulation (APLAID), sideroblastic anemia with B cell immunodeficiency, periodic fevers, and developmental delay (SIFD), cleavage-resistant receptor-interacting serine / threonine kinase 1 (RIPK1) induced autoinflammatory(CRIA) syndrome, Lyn kinase-associated vasculopathy and liver fibrosis (LAVLI), disorders of complement activation, Sjogren’s syndrome, systemic lupus erythematosus (Lupus, SLE), psoriatic arthritis, rheumatoid arthritis (RA), Graves’ disease, Hashimoto’s thyroiditis, Addison’s disease, dermatomyositis, psoriasis, Chronic inflammatory demyelinating56299730993Attorney Docket No. UTSDP4458WO-1001361407 polyneuropathy (Cl DP), Guillain-Barre syndrome, multiple sclerosis (MS), myasthenia gravis, autoimmune vasculitis, type 1 diabetes, pernicious anemia, or vasculitis.

9. The method of claim 8, wherein the subject is undergoing an extracorporeal membrane oxygenation (ECMO) or continuous renal replacement therapy (CRRT).

10. The method of any one of claims 2-4, wherein the cathepsin K inhibitor inhibits the production, secretion, or extracellular level or activity of cathepsin K.

11. The method of claim 10, wherein the cathepsin K inhibitor is odanacatib (ODN).

12. The method of claim 10, wherein the cathepsin K inhibitor is an antibody that specifically binds to cathepsin K.

13. The method of any one of claims 2-5, wherein the angiopoietin-2 cleavage product is a c-terminal fragment of angiopoietin-2 lacking at least 40 to at least 270 residues of the N-terminus.

14. The method of any one of claims 2-5, wherein the cathepsin K inhibitor is administered parenterally.

15. The method of any one of claims 1-5, wherein the biological fluid sample is blood, serum, saliva, urine, cellular interstitial fluid, or cerebrospinal fluid.

16. The method of claim 1 , wherein the subject is a mammal.

17. The method of claim 16, wherein the subject is a human.

18. The method of any one of claims 1-5, further comprising determining the ratio of cathepsin K / angiopoietin-2 cleavage product.

19. A method of diagnosing a disease or disorder in a subject, comprising: a) obtaining a ratio of cathepsin K to a c-terminal fragment of ANGPT2 in a biological fluid sample from the patient; b) comparing the ratio of cathepsin K to a c-terminal fragment of ANGPT2 to a reference ratio range; and c) diagnosing the subject with the disease or disorder based on step b, wherein the ratio is higher than the reference range.57299730993Attorney Docket No. UTSDP4458WO-100136140720. The method of claim 19, further comprising treating the disease or disorder in the subject comprising administering to the subject an effective amount of a cathepsin K inhibitor, or an angiopoietin-2 cleavage product inhibitor, or both, when the level of cathepsin K in a biological fluid sample obtained from the subject is found to be elevated in comparison to a reference range for cathepsin K.58299730993

Images