Targeting the rhoa signaling pathway to correct disrupted retromer-dependent trafficking

Abstract

Compounds and methods for treating neurodegenerative disease in subjects.

Description

Dkt. 93597 / 7386 92531-A-PCTTARGETING THE RHOA SIGNALING PATHWAY TO CORRECT DISRUPTED RETROMER-DEPENDENT TRAFFICKING

[0001] Throughout this application, various publications are referenced, including referenced in parenthesis. The disclosures of all publications mentioned in this application in their entireties are hereby incorporated by reference into this application in order to provide additional description of the art to which this invention pertains and of the features in the art which can be employed with this invention.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 708,437, filed October 17, 2024, the contents of which are hereby incorporated by reference.REFERENCE TO SEQUENCE LISTING

[0003] This application incorporates-by-reference nucleotide and / or amino acid sequences which are present in the file named “93597-7386_92531-A-PCT_Sequence_Listing_AWG.xml”, which is 90,582 bytes in size, and which was created on October 17, 2025 in the IBM-PC machine format, having an operating system compatibility with MS-Windows, which is contained in the XML file filed October 17, 2025 as part of this application.BACKGROUND OF THE INVENTION

[0004] Retromer-dependent endosomal recycling has been implicated as a pathogenic pathway in the common late-onset form of Alzheimer’s disease (AD) by an integration of genetics, observations in postmortem patient brains, and by studies in model systems, showing that pathway disruptions can lead to accelerated A|3 production and tau accumulation1.

[0005] The pathway is regulated by a dedicated trafficking machine whose core is the retromer heterotrimeric complex that coats the endosome’s outer surface2. At endosomal membranes, the complex binds the sortilin-related receptor SORL13’4, a transmembrane protein enriched in the brain whose dual functions are required for pathway function1. Via its cytoplasmic domain, SORL1 anchors the complex to endosomal membranes, thereby stabilizing endosomal tubules, fragile trafficking vesicles unique to endosomal recycling routes. Via its intralumenal domains,14903-6636-5555v.lS0RL1 also acts as an adaptor, interconnecting retromer to cargo destined for recycling. Besides receptors and other transmembrane proteins vital for synaptic function and neuronal survival5'9, SORL1 connects retromer to APP, whose recycling restricts the production of A0, and to lysosomal protease receptors whose recycling is required for tau degradation10. The SORL1- retromer interaction at endosomal membranes can thus be considered the functional ‘crux’ of the retromer-dependent endosomal recycling pathway in neurons1.

[0006] Studies suggest that enhancing endosomal SORL1 -retromer improves pathway function4-7’8 11 12. Human genetics validate that reducing SORLl’s dimerization while in endosomes, required for its retromer interaction13, or reducing SORLl’s delivery to endosomes is pathogenic14. With an eye towards therapeutics, therefore, we set out to identify a pharmacological intervention that will enhance endosomal SORL1 -retromer. We accordingly focus on SORLl’s 55-residue cytoplasmic tail because among its multiple binding domains, one binds GGA1 which initiates the active transport of SORL1 from the trans-Golgi network to endosomal membranes15, and another binds the retromer protein VPS26 so that once in endosomes SORL1 can interact with retromer4.

[0007] Previous studies have provided evidence suggesting that the cytoplasmic tail might also contain potential binding domains to activated ‘Rho-associated kinase 2’ (ROCK2)16 17. Nevertheless, because of the challenge synthesizing and expressing SORLl’s relatively large and complex cytosolic tail in vitro, the precise binding domains of ROCK2 and their functional consequences have remained poorly understood.24903-6636-5555v.lBRIEF SUMMARY OF THE INVENTION

[0008] A method of treating a neurodegenerative disease in a subject comprising administering to the subject an amount a compound having the following structure:

[0009] wherein

[0010] X is CH, O, orN;

[0011] Y is C orN;

[0012] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0013] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0014] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0015] K is a bond, -CH2-, or -C(O)-;

[0016] L is -CH2- or a bond;

[0017]

[0018] a and P are bonds that are absent or present;

[0019]

[0020] when a is present:

[0021] p is absent,

[0022] X is O, and

[0023] Y is C;

[0024] 4903-6636-5555v.l

[0025] when P is present:

[0026] a is absent,

[0027] X is CH2or N, and

[0028] Y is N;

[0029] or

[0030] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0031] effective to treat a neurodegenerative disease in a subject.

[0032]

[0033] A method of reducing development of a neurodegenerative disease in a subject comprising administering to the subject amount of the compound having the following structure:

[0034] wherein

[0035] X is CH, O, orN;

[0036] Y is C orN;

[0037] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0038] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0039] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0040] K is a bond, -CH2-, or -C(O)-;

[0041] L is -CH2- or a bond;4903-6636-5555v.l

[0042]

[0043] a and P are bonds that are absent or present;

[0044]

[0045] when a is present:

[0046] p is absent,

[0047] X is O, and

[0048] Y is C;

[0049]

[0050] when P is present:

[0051] a is absent,

[0052] X is CH2or N, and

[0053] Y is N;

[0054] or

[0055] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0056] effective to reduce development of a neurodegenerative disease in a subject.

[0057]

[0058] A method of reducing of A 40 and / or AP42 secretion in a brain cell comprising contacting the brain cell with an amount of the compound having the following structure:4903-6636-5555v.l

[0060] X is CH, O, or N;

[0061] Y is C or N;

[0062] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0063] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0064] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0065] K is a bond, -CH2-, or -C(O)-;

[0066] L is -CH2- or a bond;

[0067]

[0068] a and are bonds that are absent or present;

[0069]

[0070] when a is present:

[0071] 3 is absent,

[0072] X is O, and

[0073] Y is C;

[0074]

[0075] when P is present:

[0076] a is absent,

[0077] X is CH2or N, and

[0078] Y is N;

[0079] or

[0080] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0081] effective to reduce brain cell AP40 and / or AP42 secretion.

[0082] 64903-6636-5555v.l

[0083] A method of reducing of phospho-tau and / or total tau levels in a brain cell comprising contacting the brain cell with an amount of the compound having the following structure:

[0084] wherein

[0085] X is CH, O, orN;

[0086] Y is C orN;

[0087] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0088] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0089] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0090] K is a bond, -CH2-, or -C(O)-;

[0091] L is -CH2- or a bond;

[0092]

[0093] a and P are bonds that are absent or present;

[0094]

[0095] when a is present:

[0096] p is absent,

[0097] X is O, and

[0098] Y is C;

[0099]

[0100] when P is present:74903-6636-5555v.l

[0101] a is absent,

[0102] X is CH2or N, and

[0103] Y is N;

[0104] or

[0105] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0106] effective to reduce phospho-tau and / or total tau levels in a brain cell.

[0107]

[0108] A method of inhibiting RhoGEF12 in a subject comprising administering to the subject an amount of the compound having the following structure:

[0109] wherein

[0110] X is CH, O, or N;

[0111] Y is C or N;

[0112] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0113] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0114] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0115] K is a bond, -CH2-, or -C(O)-;

[0116] L is -CH2- or a bond;

[0117] 4903-6636-5555v.l

[0118] a and P are bonds that are absent or present;

[0119]

[0120] when a is present:

[0121] p is absent,

[0122] X is O, and

[0123] Y is C;

[0124]

[0125] when P is present:

[0126] a is absent,

[0127] X is CH2or N, and

[0128] Y is N;

[0129] or

[0130] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0131] effective to inhibit RhoGEF 12 in a subj ect.

[0132] A method of upregulating endosomal recycling in a subject comprising administering to the subject an amount of the compound having the following structure:

[0133] wherein

[0134] X is CH, O, orN;

[0135] Y is C or N;4903-6636-5555v.l

[0136] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0137] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0138] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0139] K is a bond, -CH2-, or -C(O)-;

[0140] L is -CH2- or a bond;

[0141]

[0142] a and p are bonds that are absent or present;

[0143]

[0144] when a is present:

[0145] is absent,

[0146] X is O, and

[0147] Y is C;

[0148]

[0149] when P is present:

[0150] a is absent,

[0151] X is CH2or N, and

[0152] Y is N;

[0153] or

[0154] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0155] effective to upregulate endosomal recycling in a subject.

[0156] An inhibitory molecule comprising an interfering nucleotide sequence portion configured to hybridize to a nucleotide sequence encoding ARHGEF12 gene.104903-6636-5555v.l

[0157] A method of reducing ARHGEF12 gene expression, presence, and / or activity in a cell, tissue, or organism, the method comprising introducing an inhibitory molecule described herein the cell, tissue, or organism.

[0158] A method of reducing ROCK2 gene expression, presence, and / or activity in a cell, tissue, or organism, the method comprising introducing an inhibitory molecule described herein the cell, tissue, or organism.

[0159] A method of treating a neurodegenerative disease in a subject, the method comprising administering introducing an inhibitory molecule described herein to the subject.

[0160] A method of reducing development of a neurodegenerative disease, the method comprising administering introducing an inhibitory molecule described herein to the subject.

[0161] A method of reducing of phospho-tau and / or total tau levels in a brain cell or of reducing of A04O and / or A042 secretion in a brain cell, the method comprising introducing an inhibitory molecule described herein to the cell.

[0162] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of a small molecule or a nucleic acid which inhibits expression of, or inhibits activity of, RhoGEF12 so as to reduce development of, or treat, a neurodegenerative disease in a subject.

[0163] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of a small molecule or a nucleic acid which inhibits expression of, or inhibits activity of, ROCK2 so as to reduce development of, or treat, a neurodegenerative disease in a subject.

[0164] A method of treating or preventing a neurodegenerative disease in a subj ect comprising administering to the subject an amount of a compound having the structure below or a pharmaceutically acceptable salt or hydrate thereof:114903-6636-5555v.l

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172] A compound having the following structure:124903-6636-5555v.l

[0173] wherein

[0174] Xis CH, O, orN;

[0175] YisCorN;

[0176] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0177] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0178] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0179] K is a bond, -CH2-, or -C(O)-;

[0180] L is -CH2- or a bond;

[0181]

[0182] a and p are bonds that are absent or present;

[0183]

[0184] when a is present:

[0185] is absent,

[0186] XisO, and

[0187] YisC;

[0188]

[0189] when P is present:

[0190] a is absent,

[0191] XisCH2orN, and134903-6636-5555v.l

[0192] Y is N;

[0193] or

[0194] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof.

[0195] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of an inhibitory nucleic acid comprising a sequence set forth in any one of SEQ ID NOS:7-13 so as to reduce development of, or treat, a neurodegenerative disease in a subject.

[0196] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of an inhibitory nucleic acid comprising a sequence set forth in any one of SEQ ID NOS: 18-35 so as to reduce development of, or treat, a neurodegenerative disease in a subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0197] FIG. 1 : Activated ROCK2 binding of SORLl’s cytosolic tail sterically hinders GGA1 and VPS26 binding.

[0198] FIGS. 2A-2C: RhoGEF12 Inhibition increases endosomal SORLl-Retromer. A. soluble v membrane fraction on Tau, APP CTFS and GLUR; B. Effect on soluble v membrane fraction VPS35 of compound Y16 v control; C. VPS35 and SORL-1 endosomal staining - Y16 v control.

[0199] FIGS. 3A-3E: RhoGEF12 Inhibition reduces A|3 secretion in a SORL1 -dependent manner A. Using RhoGEF12 inhibitor (Y16), a dose dependent reduction in A[34O and A042 was observed in IPSC-derived human neurons expressing a pathogenic SORL1 mutation; B. a pathogenic APP mutation; C.and ‘wildtype’ neurons; D. a dose dependent reduction in A04O and A042 was observed in all IPSC-derived human neurons expressing SORE: E. while no effect was observed in IPSC-derived human neurons is which SORL1 was depleted.

[0200] FIGS. 4A-4E: RhoGEF12 Inhibition reduces phospho-Tau accumulation in a SORL1- dependent manner. A. Using a RhoGEF12 inhibitor (Y16), a dose dependent reduction in pTau144903-6636-5555v.laccumulation was observed in IPSC-derived human neurons expressing a pathogenic SORL1 mutation; B. a pathogenic APP mutation, and C. ‘wildtype’ neurons; D. A dose dependent reduction in pTau accumulation was observed in all IPSC-derived human neurons expressing SORL1; E. while no effect was observed in IPSC-derived human neurons is which SORL1 was depleted.

[0201] FIGS. 5A - 5B: RhoGEF12 inhibition reduces tau accumulation in disease-associated tau mutations. A. Using a RhoGEF12 inhibitor, a dose dependent reduction in pTau-181 (left panel) and total tau (right panel) was observed in iNeurons expressing the FTLD-causal P301S MAPT mutation. B. Using the same inhibitor, a reduction in p-Tau-181 (two left panels) and total tau (right panel) was observed in iNeurons expressing the pathogenic V337M MAPT mutation.

[0202] FIG. 6: SORE1 deficiency leads to an elevation of ROCK2 in the mouse brain.

[0203] FIG. 7: A mechanistic illustration for how inhibiting RhoGEF12 reduces Abeta product! on / secreti on and tau accumulation. By downregulating ROCK2 activity, RhoGEF12 inhibition reduces Abeta and tau by a concatenation of two events: First, by disengaging ROCK2 from SORLl’s cytoplasmic tail, RhoGEF12 inhibition enhances SORLl’s transport from the trans-Golgi network to endosomes, where it dimerizes. Second, by disengaging ROCK2 from SORLl’s cytoplasmic tail, RhoGEF12 inhibition enhances SORLl’s retromer binding.

[0204] FIG. 8: SORL1 is highly expressed in endosomes: Mouse neurons; iNeurons in which SORL1 is overexpressed via viral vectors; A postmortem human hippocampus in a healthy control.

[0205] FIGS. 9A-9B: A. Co-localization of EEA1, SORL1 & Hoechst dye for compound Y16 v control; B. Co-localization of EEA1, VPS35 & Hoechst dye for compound Y16 v control.

[0206] FIG. 10: iNeuron models of Alzheimer’s disease (AD) treated with different doses of YPT1085866.

[0207] FIG. 11 : shRNA constructs for RhoGEF12.

[0208] FIG. 12: shRNA against RhoGEF12 works in mouse brain.DETAILED DESCRIPTION OF THE INVENTION

[0209] A method of treating a neurodegenerative disease in a subj ect comprising administering to the subject an amount of a compound having the following structure:154903-6636-5555v.l

[0210] wherein

[0211] X is CH, O, or N;

[0212] Y is C or N;

[0213] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0214] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0215] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0216] K is a bond, -CH2-, or -C(O)-;

[0217] L is -CH2- or a bond;

[0218]

[0219] a and p are bonds that are absent or present;

[0220]

[0221] when a is present:

[0222] is absent,

[0223] X is O, and

[0224] Y is C;

[0225]

[0226] when P is present:

[0227] a is absent,

[0228] X is CH2or N, and164903-6636-5555v.l

[0229] Y is N;

[0230] or

[0231] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0232] effective to treat a neurodegenerative disease in a subject.

[0233] A method of reducing development of a neurodegenerative disease in a subject comprising administering to the subject amount of the compound having the following structure:

[0234] wherein

[0235] X is CH, O, or N;

[0236] Y is C or N;

[0237] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0238] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0239] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0240] K is a bond, -CH2-, or -C(O)-;

[0241] L is -CH2- or a bond;

[0242]

[0243] a and are bonds that are absent or present;

[0244]

[0245] when a is present:4903-6636-5555v.l

[0246] p is absent,

[0247] X is O, and

[0248] Y is C;

[0249]

[0250] when P is present:

[0251] a is absent,

[0252] X is CH2or N, and

[0253] Y is N;

[0254] or

[0255] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0256] effective to reduce development of a neurodegenerative disease in a subject.

[0257]

[0258] A method of reducing of A 40 and / or AP42 secretion in a brain cell comprising contacting the brain cell with an amount of the compound having the following structure:

[0259] wherein

[0260] X is CH, O, orN;

[0261] Y is C orN;

[0262] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;4903-6636-5555v.l

[0263] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0264] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0265] K is a bond, -CH2-, or -C(O)-;

[0266] L is -CH2- or a bond;

[0267]

[0268] a and p are bonds that are absent or present;

[0269]

[0270] when a is present:

[0271] is absent,

[0272] X is O, and

[0273] Y is C;

[0274]

[0275] when P is present:

[0276] a is absent,

[0277] X is CH2or N, and

[0278] Y is N;

[0279] or

[0280] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0281] effective to reduce brain cell A 40 and / or A 42 secretion.

[0282] A method of reducing of phospho-tau and / or total tau levels in a brain cell comprising contacting the brain cell with an amount of the compound having the following structure:194903-6636-5555v.l

[0283] wherein

[0284] X is CH, O, or N;

[0285] Y is C or N;

[0286] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0287] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0288] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0289] K is a bond, -CH2-, or -C(O)-;

[0290] L is -CH2- or a bond;

[0291]

[0292] a and p are bonds that are absent or present;

[0293]

[0294] when a is present:

[0295] is absent,

[0296] X is O, and

[0297] Y is C;

[0298]

[0299] when P is present:

[0300] a is absent,

[0301] X is CH2or N, and204903-6636-5555v.l

[0302] Y is N;

[0303] or

[0304] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0305] effective to reduce phospho-tau and / or total tau levels in a brain cell.

[0306] A method of inhibiting RhoGEF12 in a subject comprising administering to the subject an amount of the compound having the following structure:

[0307] wherein

[0308] X is CH, O, or N;

[0309] Y is C or N;

[0310] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0311] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0312] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0313] K is a bond, -CH2-, or -C(O)-;

[0314] L is -CH2- or a bond;

[0315]

[0316] a and are bonds that are absent or present;

[0317]

[0318] when a is present:4903-6636-5555v.l

[0319] p is absent,

[0320] X is O, and

[0321] Y is C;

[0322]

[0323] when P is present:

[0324] a is absent,

[0325] X is CH2or N, and

[0326] Y is N;

[0327] or

[0328] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0329] effective to inhibit RhoGEF12 in a subject.

[0330] A method of upregulating endosomal recycling in a subject comprising administering to the subject an amount of the compound having the following structure:

[0331] wherein

[0332] X is CH, O, orN;

[0333] Y is C orN;

[0334] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0335] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;4903-6636-5555v.l

[0336] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0337] K is a bond, -CH2-, or -C(O)-;

[0338] L is -CH2- or a bond;

[0339]

[0340] a and P are bonds that are absent or present;

[0341]

[0342] when a is present:

[0343] p is absent,

[0344] X is O, and

[0345] Y is C;

[0346]

[0347] when P is present:

[0348] a is absent,

[0349] X is CH2or N, and

[0350] Y is N;

[0351] or

[0352] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof,

[0353] effective to upregulate endosomal recycling in a subject.

[0354] A compound having the following structure:4903-6636-5555v.l

[0355] wherein

[0356] X is CH, O, or N;

[0357] Y is C orN;

[0358] A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;

[0359] E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;

[0360] G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;

[0361] K is a bond, -CH2-, or -C(O)-;

[0362] L is -CH2- or a bond;

[0363]

[0364] a and [3 are bonds that are absent or present;

[0365]

[0366] when a is present:

[0367] p is absent,

[0368] X is O, and

[0369] Y is C;

[0370]

[0371] when P is present:

[0372] a is absent,

[0373] X is CH2or N, and

[0374] Y is N;

[0375] or

[0376] a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof.244903-6636-5555v.l

[0377] In some embodiments of the methods or compounds herein, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is optionally substituted in addition to G with one or more selected from halo, alkyl, alkenyl, alkynyl, amino, -OH, oxo, amino alkyl, alkyl-OH, alkylamino, alkoxy, cycloalkyl, aromatic, or alkylaromatic.

[0378] In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, E halo, alkyl, alkenyl, alkynyl, amino, -OH, oxo, amino alkyl, alkyl-OH, alkylamino, alkoxy, cycloalkyl, aromatic, or alkylaromatic.

[0379] In some embodiments of the methods or compounds herein, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, a is present. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, X is O. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, Y is C. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a heterocycle. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a heterocycle comprising at least one nitrogen atom. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a 6-membered heterocycle comprising at least one nitrogen atom. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a 6-membered heterocycle comprising 1-3 nitrogen atoms.

[0380] In some embodiments of the methods or compounds herein, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is substituted with G such that L and G have a 1,3 positional relationship. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6-membered heterocycle comprising 1-3 nitrogen atoms. In some embodiments, in the compound or pharmaceutically acceptable salt254903-6636-5555v.lor pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6- membered heterocycle which is substituted with one or more alkyl groups. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6-membered heterocycle which is substituted with one or more oxo groups. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is an optionally substituted reduced 6-membered nucleobase. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6-membered heterocycle comprising 1-3 nitrogen atoms which is N-substituted at one or more positions. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6-membered heterocycle comprising 1-3 nitrogen atoms which is N- substituted with an alkyl group at one or more positions. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6-membered heterocycle comprising 1-3 nitrogen atoms which is N-substituted with a methyl group at one or more positions. In some embodiments, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, A is a non-aromatic 6-membered heterocycle comprising 3 nitrogen atoms which is N-substituted with a methyl group at one or more positions.

[0381] In some embodiments of the methods or compounds herein, in the compound or pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, the compound has the structure:

[0382] An inhibitory molecule comprising an interfering nucleotide sequence portion configured to hybridize to a nucleotide sequence encoding ARHGEF12 gene. In some embodiments, the ARHGEF12 is human. In some embodiments, the ARHGEF12 has a sequence264903-6636-5555v.lset forth in NCBI reference sequence NM_015313.3 (SEQ ID N0:4), NM_001 198665.2 (SEQ ID N0:5), or NM_001301084.2 (SEQ ID NO:6).

[0383] An inhibitory molecule comprising an interfering nucleotide sequence portion configured to hybridize to a nucleotide sequence encoding ROCK2 gene. In some embodiments, the ROCK2 is human. In some embodiments, the ROCK22 has a sequence set forth in NCBI reference sequence NM_001321643.2 (SEQ ID NO: 15), NM_004850 (SEQ ID NO: 16), or NM_009072 (SEQ ID NO: 17).

[0384] In some embodiments, the inhibitory molecule comprises RNA, DNA, and / or modified nucleotides.

[0385] In some embodiments, the inhibitory molecule is an siRNA, miRNA, antisense oligonucleotide, or shRNA molecule.

[0386] In some embodiments, the interfering nucleotide sequence portion shares at least 80%- 100%, 85-100%, 90-100%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with a reverse complement of a portion of a nucleotide sequence encoding ARHGEF12 gene, transcript (e.g., NM_O15313.3, NM_001198665.2, or NM_001301084.2), or polypeptide (e g., SEQ ID NO:3), preferably wherein the interfering nucleotide sequence portion is 15-50 nucleotides in length, preferably 18-30 nucleotides in length.

[0387] In some embodiments, the ARHGEF12 has a sequence set forth in NCBI reference sequence NM_015313.3, NM_001198665.2, or NM_001301084.2.

[0388] In some embodiments, the inhibitory molecule comprises SEQ ID NO: 1.

[0389] In some embodiments, the inhibitory molecule comprises SEQ ID NO:2 or any one of SEQ ID NOs:7-13. Preferably the inhibitory molecule further comprises the reverse complement of SEQ ID NO: 2, or any one of SEQ ID NOs:7-13.

[0390] In some embodiments, the interfering nucleotide sequence portion shares at least 80%- 100%, 85-100%, 90-100%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with a reverse complement of a portion of a nucleotide sequence encoding a ROCK2 gene, transcript (e g., NM_001321643.2, NM_004850, or NM_009072), or polypeptide (SEQ ID NO: 14), preferably wherein the interfering nucleotide sequence portion is 15-50 nucleotides in length, preferably 18-30 nucleotides in length.274903-6636-5555v.l

[0391] In some embodiments, the ROCK2 has a sequence set forth in NCBT reference sequence NM_001321643.2, NM_004850, or NM_009072.

[0392] In some embodiments, the inhibitory molecule comprises any one of SEQ ID NOs: 18- 35. Preferably the inhibitory molecule further comprises the reverse complement of any one of SEQ ID NOs: 18-35.

[0393] Also provided is a DNA polynucleotide molecule encoding any one of the inhibitory molecules described herein.

[0394] A method of reducing A RHGEF12 gene expression, presence, and / or activity in a cell, tissue, or organism, the method comprising introducing an inhibitory molecule described herein the cell, tissue, or organism.

[0395] A method of reducing R0CK2 gene expression, presence, and / or activity in a cell, tissue, or organism, the method comprising introducing an inhibitory molecule described herein the cell, tissue, or organism.

[0396] Generally, RNA interference (RNAi) is useful for specifically inhibiting the production of a particular protein. This technology relies on the presence of a dsRNA molecule (such as the double-stranded portion of a hairpin RNA) that contains a sequence that is essentially identical to a targeted mRNA sequence of the gene of interest or part thereof and a sequence that is complementary thereto. The dsRNA can be produced from a single promoter in a recombinant vector or host cell, where the sense and anti-sense sequences are covalently joined by a sequence, preferably an unrelated sequence, which enables the sense and anti-sense sequences in the corresponding transcript to hybridize to form the dsRNA molecule with the joining sequence forming a loop structure, although a sequence with identity to the target RNA or its complement can form the loop structure. The dsRNA may be encoded by a double-stranded DNA construct which has sense and antisense sequences in an inverted repeat structure, arranged as an interrupted palindrome, where the repeated sequences are transcribed to produce the hybridizing sequences in the dsRNA molecule, and the interrupting sequence is transcribed to form the loop in the dsRNA molecule.

[0397] Hairpin RNAs are a type of RNA molecule and have been used extensively to reduce gene expression in cells. As indicated above, the hairpin RNA has complementary sense and284903-6636-5555v.lantisense sequences which hybridize to form a double-stranded RNA (dsRNA) region joined by a loop sequence. Such dsRNA structures are processed by endogenous silencing machineries in cells to form small RNA molecules (about 19-25 nucleotides in length) corresponding in sequence to the gene to be reduced in activity. These small RNAs can form complexes with endogenous proteins that specifically silence the gene of interest. Such silencing can occur at the transcriptional level, mediated by DNA methylation of parts of the target gene, at the post-transcriptional level by degradation of the target mRNA, or by binding to the mRNAs to inhibit its translation and thereby reduce protein synthesis encoded by the gene. Additional discussion on shRNAs may be found, for example, in Moore et al. “Short hairpin RNA (shRNA): design, delivery, and assessment of gene knockdown” Methods Mol Biol. 2010; 629:141-58; and Sheng et al. “Short Hairpin RNAs for strand-specific small interfering RNA production” Front. Bioeng. Biotechnol., 2020, Volume 8, Article 940.

[0398] In some embodiments, a hairpin RNA (hpRNA) structure comprises a 5’ end, a sense ribonucleotide sequence which is at least 19 nucleotides in length, an antisense ribonucleotide sequence which is fully base paired with the sense ribonucleotide sequence, an intervening loop sequence, and a 3’ end. The RNA molecule may comprise a 5’-leader sequence and / or a 3’-trailer sequence, e.g., to enhance stability. The order 5’ to 3’ may be the sense ribonucleotide sequence and then the antisense ribonucleotide sequence, or vice versa. In an embodiment of the two above aspects, the antisense RNA sequence is less than 100% identical, or between about 80% and 99.9% identical, or between about 90% and 98% identical, or between about 95% and 98% identical, in sequence to the complement of a region of the target RNA molecule. In an embodiment of the two above aspects, the antisense RNA sequence is 100% identical in sequence to a region of the target RNA molecule.

[0399] A short hairpin RNA (shRNA) molecule comprising: a first nucleic acid sequence of 19-29 nucleotides at the 5' end of the molecule; a second nucleic acid sequence of 4-11 nucleotides contiguous with the first sequence; a third nucleic acid sequence of 19-29 nucleotides contiguous with the second sequence; and a fourth nucleic acid sequence of 2 nucleotides contiguous with the third sequence, wherein294903-6636-5555v.lthe first nucleic acid sequence and the third nucleic acid sequence comprise the same number of nucleotides; the third nucleic acid sequence is the reverse-complement of the first nucleic acid sequence; the third nucleic acid sequence is complementary to contiguous nucleotides of a Rho associated coiled-coil containing protein kinase 2 (R0CK2) nucleic acid sequence selected from the group consisting of NCBI Reference Sequence NM_004850, NM_001321643, and NM_009072; or the third nucleic acid sequence is complementary to contiguous nucleotides of a ARHGEF12 having a sequence set forth in NCBI reference sequence NM_O15313.3, NM_001198665.2, or NM_001301084.2; and wherein the first nucleic acid sequence base pairs with the third nucleic acid sequence to form a stem, the second nucleic acid sequence forms a loop and the fourth nucleic acid forms a 3' overhang.

[0400] A vector comprising the shRNA described herein. In some embodiments, the vector is an adeno-associated virus (AAV). In some embodiments, the vector further comprises a fifth nucleic acid sequence comprising a first AAV2 inverted terminal repeat (ITR); a sixth nucleic acid sequence comprising a U6 promoter; and a seventh nucleic sequence comprising a second AAV2 ITRA method of treating a neurodegenerative disease in a subject, the method comprising administering introducing an inhibitory molecule described herein to the subject.

[0401] A method of reducing development of a neurodegenerative disease, the method comprising administering introducing an inhibitory molecule described herein to the subject.

[0402] A method of reducing of phospho-tau and / or total tau levels in a brain cell or of reducing of A04O and / or A042 secretion in a brain cell, the method comprising introducing an inhibitory molecule described herein to the cell.

[0403] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of a small molecule or a nucleic acid which inhibits expression of, or inhibits activity of, RhoGEF12 so as to reduce development of, or treat, a neurodegenerative disease in a subject.304903-6636-5555v.l

[0404] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of a small molecule or a nucleic acid which inhibits expression of, or inhibits activity of, ROCK2 so as to reduce development of, or treat, a neurodegenerative disease in a subject.

[0405] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of an inhibitory nucleic acid comprising a sequence set forth in any one of SEQ ID NOS:7-13 so as to reduce development of, or treat, a neurodegenerative disease in a subject.

[0406] A method of reducing development of, or treating, a neurodegenerative disease in a subject comprising administering to the subject an amount of an inhibitory nucleic acid comprising a sequence set forth in any one of SEQ ID NOS: 18-35 so as to reduce development of, or treat, a neurodegenerative disease in a subject.

[0407] A method of treating or preventing a neurodegenerative disease in a subj ect comprising administering to the subject an amount of a compound having the structure below or a pharmaceutically acceptable salt or hydrate thereof:314903-6636-5555v.l

[0415] In some embodiments, the compound is

[0417] In some embodiments of the methods, the neurodegenerative disease is a dementia.

[0418] In some embodiments of the methods, the neurodegenerative disease is AmyotrophicLateral Sclerosis (ALS), Frontotemporal Dementia (FTD), or Alzheimer's Disease (AD).

[0419] In some embodiments of the methods, the neurodegenerative disease is an amyloid pathology or is a tau pathology.

[0420] In some embodiments of the methods, the neurodegenerative disease is an alpha synuclein pathology or is a TDP-43 pathology.

[0421] In some embodiments of the methods, the subject has a SORL1 mutation.324903-6636-5555v.l

[0422] In some embodiments of the methods, the brain cell is a neuron.

[0423] In some embodiments of the methods, the neuron is a hippocampal neuron.

[0424] In some embodiments of the methods, the subject is human.Definitions

[0425] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0426] As used herein, a predetermined or predefined control level or amount is a value decided or obtained, usually beforehand, as a control for baseline comparison. The concept of a control is well-established in the field, and can be determined, in a non-limiting example, empirically from non-afflicted subjects (versus afflicted subjects, including afflicted subjects having different grades of the relevant affliction), and may be normalized as desired (in nonlimiting examples, for volume, mass, age, location, gender) to negate the effect of one or more variables. In some embodiments, the non-affiliated subject is a subject of the same species who does not have schizophrenia or pre-schizophrenia. In some embodiments, the non-affiliated subject is gender-matched. In some embodiments, the non-affiliated subject is age-matched to the subject being tested or treated.

[0427] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. In some embodiments, about means within a standard deviation using measurements generally acceptable in the art. In some embodiments, about means a range extending to + / - 10% of the specified value. In some embodiments, about includes the specified value. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of and any combination of items it conjoins.334903-6636-5555v.l

[0428] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.

[0429] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0430] In the description and claims of the present application, each of the verbs, “comprise,” “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb. Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0431] Neurodegenerative diseases are well known in the art. To treat a neurodegenerative disease means to improve one or more measurable or observable symptoms thereof. To reduce development of a neurodegenerative disease means to reduce in extent of or rate of development one or more measurable or observable symptoms thereof.

[0432] The term “substituent” means an atom or group that replaces a hydrogen atom. The phrase “substituted” or “substituted by” is taken to have the same meaning.

[0433] The term “alkyl” or “alkyl group” refers to a mono- or multivalent, e.g., a mono- or bivalent, linear or branched saturated hydrocarbon group of 1 to 6 carbon atoms (“Ci-Ce -alkyl”), e.g., 1, 2, 3, 4, 5, or 6 carbon atoms. Some non-limiting examples of alkyl include methyl (Me), ethyl (Et), propyl, 2- propyl (isopropyl), / / -butyl, iso-butyl, sec-butyl, tert-butyl, and 2,2- dimethylpropyl.344903-6636-5555v.l

[0434] The term “alkoxy” or “alkoxy group” refers to an alkyl group, as previously defined, attached to the parent molecular moiety via an oxygen atom. Unless otherwise specified, the alkoxy group contains 1 to 6 carbon atoms (“Ci-Ce alkoxy”). Some non-limiting examples of alkoxy groups include methoxy, ethoxy, w-propoxy, isopropoxy, / / -butoxy, isobutoxy and tertbutoxy.

[0435] The terms “asymmetric carbon atom” and “asymmetric center” mean a carbon atom with four different atoms and / or groups bound thereto. According to the Cahn-lngold-Prelog Convention, an asymmetric carbon atom can be of the “R” or “S” configuration.

[0436] The term “hydroxy” or “hydroxy group” refers to a group composed of divalent oxygen atom bound to a hydrogen atom: -OH.

[0437] The terms “halogen atom” or “halo”, alone or in combination, denote a fluorine atom, a chlorine atom, a bromine atom, or an iodine and particularly a fluorine atom or a chlorine atom. The term “halo”, in combination with another group, denotes the substitution of said group with at least one halogen atom.

[0438] The term “haloalkyl” refers to an alkyl group, as previously defined, wherein at least one of the hydrogen atoms of the alkyl group has been replaced by a halogen atom.

[0439] The term “haloalkoxy” refers to an alkoxy group, wherein at least one of the hydrogen atoms of the alkoxy group has been replaced by a halogen atom.

[0440] The term “cyano” or “cyano group” refers to a group composed of carbon atom with a triple bond to a nitrogen: a -CN group.

[0441] The term “unsaturated” refers to atoms whose valence is satisfied by having a 7t-bond in place of a H atom. Unsaturation occurs in the form of multiple bonds between two atoms whose valence allows for these bonds. Atoms with either double and triple bonds are both instances of unsaturation.

[0442] The term “saturated” refers to atoms whose valence is satisfied by having single bonds to all atoms they are bound to, including H atoms.

[0443] The term “carbocyclic ring” or “carbocycle” refers to an unsaturated, saturated, or partly unsaturated monocyclic or bicyclic ring system of 3 to 12 ring atoms wherein all of said ring atoms are carbon. “Bicyclic carbocyclic ring” refers to carbocyclic moieties consisting of two 354903-6636-5555v.lcycles having two ring atoms in common, i.e., the bridge separating the two rings is either a single bond or a chain of one or two ring atoms, and two spirocyclic moi eties, i.e., the two rings are connected via one common ring atom.

[0444] The term “heterocyclic ring” or “heterocycle” refers to an unsaturated, saturated, or partly unsaturated monocyclic or bicyclic ring system of 3 to 12 ring atoms, wherein 1 to 8 of said ring atoms are heteroatoms selected from N, O, and S, the remaining ring atoms being carbon. “Bicyclic heterocyclic ring” refers to heterocyclic moieties consisting of two cycles having two ring atoms in common, i.e., the bridge separating the two rings is either a single bond or a chain of one or two ring atoms, and two spirocyclic moieties, i.e., the two rings are connected via one common ring atom. Some non-limiting examples of heterocyclic rings include azetidin-3-yl, azetidin-2-yl, oxetan-3-yl, oxetan-2-yl, 2-oxopyrrolidin-l-yl, 2- oxopyrrolidin-3-yl, 5- oxopyrrolidin-2-yl, 5-oxopyrrolidin-3-yl, 2-oxo-l -piperidyl, 2-oxo-3- piperidyl, 2-oxo-4- piperidyl, 6-oxo-2-piperidyl, 6 -oxo-3 -piperidyl, 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4- piperidinyl, morpholino, morpholin-2-yl, morpholin-3-yl, pyrrolidinyl (e.g., pyrrolidin-3-yl), 3- azabicyclo[3.1.0]hexan-6-yl, or 2, 5-diazabicyclo[2.2.1]heptan-2-yl.

[0445] The term “aromatic”, “aromatic ring”, “aryl”, or “aryl ring” refers to a monocyclic or bicyclic ring system, wherein the monocyclic ring system has a conjugated 7r-electron system and a total of 5 or 6 ring atoms, wherein the bicyclic ring system has a total of 9 to 12 ring atoms having a conjugated 7t-electron system. When the term “aromatic ring” is used to refer to a bicyclic system, at least one or both of the constituent rings has a conjugated 7t-electron system. “Bicyclic aromatic ring” refers to aromatic moieties consisting of two cycles having two ring atoms in common.

[0446] The term “heteroaromatic”, “heteroaromatic ring”, “heteroaryl”, or “heteroaryl ring” refers to a mono- or multivalent, monocyclic or bicyclic ring, having a total of 5 to 12 ring atoms, wherein at least one ring in the system has a conjugated n-electron system, and at least one ring in the system contains one or more heteroatoms selected from N, O, and S, the remaining ring atoms being carbon.

[0447] Some non-limiting examples of heteroaromatic rings include 2-pyridyl, 3-pyridyl, 4- pyridyl, indol-l-yl, l / 7-indol-2-yl, 17T-indol-3-yl, l / / -indol-4-yl, 17f-indol-5-yl, l / / -indol-6-yl, l / / -indol-7-yl, l,2-benzoxazol-3-yl, l,2-benzoxazol-4-yl, l,2-benzoxazol-5-yl, l,2-benzoxazol-6- yl, l,2-benzoxazol-7-yl, 17 / -indazol-3-yl, l / / -indazol-4-yl, l / / -indazol-5-yl, l / 7-indazol-6-yl, 1H-364903-6636-5555v.lindazol-7-yl, pyrazol-l-yl, l / / -pyrazol-3-yl, \H- pyrazol-4-yl, I H-pyrazol-5-yl, imidazol-l-yl, \H- imidazol-2-yl, l / / -imidazol-4-yl, 17 / -imidazol-5-yl, oxazol-2-yl, oxazol-4-yl, oxazol-5-yl, thiazol- 4-yl, and l,2,4-oxadiazol-3-yl.

[0448] As used herein, “tautomer” and “tautomeric” refer to alternate forms of a compound disclosed herein that differ in the position of a proton. Non-limiting examples include enol-keto and imine-enamine tautomers, or the tautomeric forms of heteroaryl groups containing a ring atom attached to both a ring -NH- moiety and a ring =N- moiety such as pyrazoles, imidazoles, benzimidazoles, triazoles, and tetrazoles.

[0449] It is understood that isotopes may be present in the compounds described herein. Each chemical element as represented in a compound structure may include any isotope of said element. For example, in a compound described herein a hydrogen atom can be any isotope of hydrogen, including but not limited to hydrogen- 1 (protium) and hydrogen-2 (deuterium). Thus, reference herein to a compound encompasses all potential isotopic forms unless the context clearly dictates otherwise.

[0450] As used herein, the term “pharmaceutically active agent” means any substance or compound suitable for administration to a subject and furnishes biological activity or other direct effect in the treatment, cure, mitigation, diagnosis, or prevention of disease, or affects the structure or any function of the subject. Pharmaceutically active agents include, but are not limited to, substances and compounds described in the Physicians’ Desk Reference (PDR Network, LLC; 64th edition; November 15, 2009) and “Approved Drug Products with Therapeutic Equivalence Evaluations” (U.S. Department Of Health And Human Services, 30th edition, 2010), which are hereby incorporated by reference.

[0451] As used herein, “pharmaceutically acceptable salt” refers to a salt of a compound that does not abrogate the biological activity and properties of the compound. Pharmaceutical salts can be obtained by reaction of a compound disclosed herein with an acid or base. Base-formed salts include, without limitation, ammonium salt (NH ); alkali metal, such as, without limitation, sodium or potassium, salts; alkaline earth, such as, without limitation, calcium or magnesium, salts; salts of organic bases such as, without limitation, dicyclohexylamine, piperidine, piperazine, methylpiperazine, A-methyl-D-glucamine, diethylamine, ethylenediamine, tris(hydroxymethyl)- methylamine; and salts with the amino group of amino acids such as, without limitation, arginine374903-6636-5555v.land lysine. Useful acid-based salts include, without limitation, acetates, adipates, aspartates, ascorbates, benzoates, butyrates, caprate, caproate, caprylate, camsylates, citrates, decanoates, formates, fumarates, gluconates, glutarate, glycolates, hexanoates, laurates, lactates, maleates, nitrates, oleates, oxalates, octanoates, propanoates, palmitates, phosphates, sebacates, succinates, stearates, sulfates, sulfonates, such as methanesulfonates, ethanesulfonates, / i-toluenesulfonates, salicylates, tartrates, and tosylates.

[0452] Acid addition salts can be formed by mixing with a solution of a pharmaceutically acceptable non-toxic acid such as hydrochloric acid, fumaric acid, maleic acid, succinic acid, acetic acid, citric acid, tartaric acid, carbonic acid, phosphoric acid, oxalic acid, dichloroacetic acid, or the like. Basic salts can be formed by mixing with a solution of a pharmaceutically acceptable nontoxic base such as sodium hydroxide, potassium hydroxide, choline hydroxide, sodium carbonate and the like. Suitable pharmaceutically acceptable salts can be composed of a compound with one or more counterions, e.g., a dichloride, or with a fraction of a counterion, e.g., a hemitartrate.

[0453] Pharmaceutically acceptable solvates and hydrates are complexes of a compound with one or more solvent or water molecules, or a fraction thereof, for example from 1 to about 100, or 1 to about 10, or 1 to about 2, 3 or 4, solvent or water molecules, or, alternatively, 14 to 14 of a solvent or water molecule.

[0454] As used herein, a “subject” refers to an animal that is the object of treatment, observation and / or experiment. “Animal” includes cold- and warm-blooded vertebrates and invertebrates such as birds, fish, shellfish, reptiles and, in particular, mammals. “Mammal” includes, without limitation, mice; rats; rabbits; guinea pigs; dogs; cats; sheep; goats; cows; horses; primates, such as monkeys, chimpanzees, and apes, and, in particular, humans.

[0455] As used herein, a “patient” refers to a subject that is being treated by a medical professional such as an M.D. or a D.V.M. to attempt to cure, or at least ameliorate the effects of, a particular disease or condition or to prevent the disease or condition from occurring in the first place.

[0456] As used herein, a “pharmaceutically acceptable excipient” refers to an inert substance that is added to a pharmaceutical composition to provide, without limitation, bulk, consistency, stability, binding ability, lubrication, disintegrating ability, etc., to the composition and that does not abrogate the biological activity and properties of the active ingredient.384903-6636-5555v.l

[0457] When used herein, “prevent / preventing” should not be construed to mean that a condition and / or a disease never might occur again after use of a compound or pharmaceutical composition according to embodiments disclosed herein to achieve prevention. Further, the term should neither be construed to mean that a condition might not occur, at least to some extent, after such use to prevent said condition. Rather, “prevent / preventing” is intended to mean that the condition to be prevented, if occurring despite such use, will be less severe than without such use.

[0458] As used herein, the term “about” includes the recited number ±0.5 of the last digit thereof. Thus, “about 1” means 0.5 to 1.5 and “about 0.1” means 0.05 to 0.15.

[0459] The compounds used in the method of the present invention may be prepared by techniques known in organic synthesis and familiar to a practitioner ordinarily skilled in the art. However, these may not be the only means by which to synthesize or obtain the desired compounds.

[0460] Compounds used in the method of the present invention may be prepared by techniques described in Vogel’s Textbook of Practical Organic Chemistry, A. I. Vogel, A.R. Tatchell, B.S. Furnis, A.J. Hannaford, P.W.G. Smith, (Prentice Hall) 5th Edition (1996), March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, Michael B. Smith, Jerry March, (Wiley-Interscience) 5th Edition (2007), and references therein, which are incorporated by reference herein. However, these may not be the only means by which to synthesize or obtain the desired compounds.

[0461] It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.

[0462] The various R groups attached to the aromatic rings of the compounds disclosed herein may be added to the rings by standard procedures, for example those set forth in Advanced Organic Chemistry: Part B: Reaction and Synthesis, Francis Carey and Richard Sundberg, (Springer) 5th ed. Edition. (2007), the content of which is hereby incorporated by reference.394903-6636-5555v.l

[0463] The compounds of the present invention include all hydrates, solvates, and complexes of the compounds used by this invention. If a chiral center or another form of an isomeric center is present in a compound of the present invention, all forms of such isomer or isomers, including enantiomers and diastereomers, are intended to be covered herein. Compounds containing a chiral center may be used as a racemic mixture, an enantiomerically enriched mixture, or the racemic mixture may be separated using well-known techniques and an individual enantiomer may be used alone. The compounds described in the present invention are in racemic form or as individual enantiomers. The enantiomers can be separated using known techniques, such as those described in Pure and Applied Chemistry 69, 1469-1474, (1997) IUPAC. In cases in which compounds have unsaturated carbon-carbon double bonds, both the cis (Z) and trans (E) isomers are within the scope of this invention. In cases wherein compounds may exist in tautomeric forms, such as ketoenol tautomers, each tautomeric form is contemplated as being included within this invention whether existing in equilibrium or predominantly in one form.

[0464] The compounds used in the method of the present invention may be administered in various forms, including those detailed herein. The treatment with the compound may be a component of a combination therapy or an adjunct therapy, i.e. the subject or patient in need of the drug is treated or given another drug for the disease in conjunction with one or more of the instant compounds. This combination therapy can be sequential therapy where the patient is treated first with one drug and then the other or the two drugs are given simultaneously. These can be administered independently by the same route or by two or more different routes of administration depending on the dosage forms employed.

[0465] A dosage unit of the compounds used in the method of the present invention may comprise a single compound or mixtures thereof with additional agents. The compounds can be administered in oral dosage forms as tablets, capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups, and emulsions. The compounds may also be administered in intravenous (bolus or infusion), intraperitoneal, subcutaneous, or intramuscular form, or introduced directly, e.g. by injection, topical application, or other methods, into or onto a site of infection, all using dosage forms well known to those of ordinary skill in the pharmaceutical arts.

[0466] The dosage of the compounds administered in treatment will vary depending upon factors such as the pharmacodynamic characteristics of a specific chemotherapeutic agent and its404903-6636-5555v.lmode and route of administration; the age, sex, metabolic rate, absorptive efficiency, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment being administered; the frequency of treatment with; and the desired therapeutic effect.

[0467] Administration can be auricular, buccal, conjunctival, cutaneous, subcutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, via hemodialysis, interstitial, intrabdominal, intraamniotic, intra-arterial, intra-articular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebral, intracisternal, intracorneal, intracoronary, intradermal, intradiscal, intraductal, intraepidermal, intraesophagus, intragastric, intravaginal, intragingival, intraileal, intraluminal, intralesional, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intraepicardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intraventricular, intravesical, intravitreal, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, rectal, inhalationally, retrobulbar, subarachnoid, subconjuctival, sublingual, submucosal, topically, transdermal, transmucosal, transplacental, transtracheal, ureteral, uretheral, and vaginal. In some embodiments, the nucleic acids described herein can be administered by known methods in the art, including via viral vectors such as lentiviral vectors and AAV, or targeted exosomses (for example, human RVG-EVs) or liposomes, e.g., targeted for CNS delivery.General

[0468] For the foregoing embodiments, each embodiment disclosed herein is contemplated as being applicable to each of the other disclosed embodiments.

[0469] As used herein, all headings are simply for organization and are not intended to limit the disclosure in any manner. The content of any individual section may be equally applicable to all sections. All combinations of the various elements disclosed herein are within the scope of the invention.

[0470] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which414903-6636-5555v.lare not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.

[0471] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

[0472] Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only.

[0473] Retromer-dependent endosomal recycling, a pathway pathogenically disrupted in Alzheimer’s disease, is regulated by the sortilin-related receptor SORL1 interacting with the retromer complex at endosomal membranes. This interaction is dictated by binding domains in SORLl’s cytoplasmic tail, which studies suggest might also bind activated ‘Rho-associated kinase 2’ (ROCK2). Herein are disclosed studies to biochemically establish that activated ROCK2 does bind not one but two tail domains, whose precise positioning is predicted to conspire against SORLl-retromer’s endosomal interaction. In neuronal culture, deactivating ROCK2 with a pharmacological inhibitor of brain-enriched ‘Rho guanine nucleotide exchange factors 12’ (RhoGEFs). Moreover, in human iPSC-derived neuronal models of Alzheimer’s disease (AD) we show that RhoGEF12 inhibition reduces both A0 secretion and phospho-tau accumulation in a SORL1 -dependent manner and that its inhibitory effect on reducing tau accumulation is even more pronounced in iPSC-derived neuronal models of primary tauopathy. Together, these findings establish RhoA / ROCK2 as a key modulator of retromer-dependent endosomal recycling in the brain and validate RhoGEF12 as a therapeutic target for AD and related neurodegenerative disorders.424903-6636-5555v.l

[0474] RESULTS

[0475] Activated ROCK2 binding of SORLl’s cytosolic tail structurally impedes SORLl’s endosomal transport:

[0476] Most attempts to synthesize SORL1’ s tail have failed because the tail tends to aggregate in vitro. We have recently overcome this technical limitation. Two 11-residue peptides were synthesized as substrate candidates: SORL1CT (residues Met2201-Met2211, which contains the ROCK2 phosphorylation target Ser2206 and 5-5 flanking residues; see Fig. 1), and the LIMK2 known ROCK2 phosphorylation site as a positive control. Phosphorylation rates were measured using the ADP-Glo Kinase Assay kit. We used 3 ROCK2 enzyme concentrations (lx, 5x and 25x dilutions from their stock). The peptide concentrations were set at 150 pM and the concentration of ATP at 100 pM. The two peptide substrates were measured in parallel using a third, negative control where no peptide was in the reaction mix, to measure the base ATPase rate alone. The LIMK2 peptide was used as a positive control based on previous results, and on the fact that this substrate was shown as one of the best synthetic substrates for ROCK2. The SORL1CT peptide could be completely phosphorylated by ROCK2, albeit at a slower rate than the LIMK2 peptide, which is a potent substrate.

[0477] These experimental results confirm that Ser2206 of SORL1 is a ROCK2 phosphorylation site and that, when ROCK2 is activated, it binds the SORL1 cytoplasmic tail (CT) MITGFSDDVPM (SEQ ID NO:36) sequence (phosphorylated Ser2206 shown in Fig. 1; ROCK2 substrates typically are about 11 residues in length, and affinity and specificity are conferred largely by the residues on either side of the Ser or Thr that is phosphorylated). More importantly, the highlighted part of the sequence (DDVPMV (SEQ ID NO:37) in Fig. 1) also represents the canonical GGA1 (‘Golgi Associated, Gamma Adaptin Ear Containing, ARF Binding Protein 1’) binding motif. By binding SORL1 at the trans-Golgi network (TGN), GGA1 relays SORL1 to API, which then packages SORL1 into clathrin coated vesicles for endosomal delivery26.

[0478] By sterically blocking GGA1 binding, activating ROCK2 will impede TGN-to- endosome SORL1 transport. Informatively, one of SORLl’s loss-of-function pathogenic mutations, D2207G, localizes to the GGA1 binding domain27. Although this particular mutation is extremely rare, it nevertheless acts to pathogenically validate ROCK2’s impeding effect.

[0479] RhoGEF12 Inhibition increases endosomal SORLl-Retromer:434903-6636-5555v.l

[0480] Even though SORL1 is highly enriched in neuronal endosomes, the in vitro analysis predicts that deactivating ROCK2 by inhibiting RhoGEF12 should increase endosomal SORL1- retomer. Y16 has been identified as a selective pharmacological inhibitor of RhoGEF12 that safely deactivates ROCK219. After conducting a dose-titration study in mouse neurons, 5 pM of Y16 proved non-toxic and we used this does for further investigation in these neurons.

[0481] 5uM Y16 was applied to mouse cultured neurons for 72 hours and we utilized an optimized and validated membrane fraction protocol to assess localization of cytosolic retromer proteins that are stabilized at endosomes by interacting with endosomal SORL1. Confirming the prediction, RhoGEF12 inhibition resulted in an increase in retromer core protein VPS35 in the membrane fraction (Fig. 2A).

[0482] While the membrane fraction does not specifically isolate endosomal membranes, previous studies have shown that the retromer core is only found in endosomal membranes4. Nevertheless, to confirm this inference we replicated the Y16 experiment, and showed by immunocytochemistry that RhoGEF12 inhibition resulted in a subtle but reliable increase in endosomal SORL1 -retromer (Fig. 2B).

[0483] Collectively, while SORL1 is highly expressed in neuronal endosomes, our results confirm that by deactivating ROCK2, RhoGEF12 inhibition reliably increases endosomal SORL1, where it dimerizes and binds retromer.

[0484] RhoGEF12 Inhibition reduces A0 secretion and p-tau accumulation in a SORL1- dependent manner:

[0485] We next used Y16 in human iPSC-derived neurons to test the therapeutic hypothesis that RhoGEF12 inhibition will reduce A04O and A042 secretion and phospho-tau accumulation, AD-associated readouts known to reflect retromer-dependent endosomal recycling. With an eye towards AD therapeutics, we tested Y16 in a purposefully diverse collection of human iPSC- derived neurons to test specific predictions and the potential generalizability of RhoGEF12 inhibition across different forms of AD: A) To model patients carrying SORL1 pathogenic mutations, we CRISPR-engineered neurons expressing the pathogenic SORL1G511Rvariant which retains SORLl’s ability to be endosomally delivered and to bind retromer, but by inhibiting SORLl’s adaptor function results in elevated Ap secretion and phospho-tau accumulation26. B) To model patients carrying APP pathogenic mutations, we CRISPR-engineered neurons expressing 444903-6636-5555v.lthe Swedish APP mutation (SORL1APP), which accelerates endosomal APP processing. C) To test the prediction that enhancing pathway function will be potentially beneficial in ‘sporadic’ AD, namely those without clear genetic drivers, we generated isogenic “wild-type” parental neurons. D) To test the mechanistic prediction that any observed benefit is dependent on SORL1, we generated SORL1 knockout (SORIA’ ’) neurons.

[0486] Y16 was administered for 72 hours at three ascending doses to this collection of human neurons. ELISA was used to assay cultured media A04O and A042 from and for phospho-Tau Thr231 from the lysates. A dose-dependent reduction in both forms of A|3 (Figs. 3A-3C) and, to a lesser extent, pTau231 accumulation (Figs. 4A-4E) was observed in all SORL1 expressing neurons— ‘wildtype’ neurons and neurons expressing APP and SORL1 mutations— but not in SORL1 depleted neurons. No evidence of toxicity was observed at any dose.

[0487] While in the current experimental conditions the effect sizes are small the reliability of the effects and their observed SORL1 -dependency on RhoGEF12 inhibition supports the interpretation that retromer-dependent endosomal recycling mediates the downregulation of A0 production and tau accumulation. Moreover, the fact that the effects were similar in WT neurons and in neurons expressing APP and SORL1 pathogenic mutations suggests that deactivating ROCK2 via RhoGEF12 inhibition might generalize to both monogenic and ‘sporadic’ forms of AD.

[0488] RhoGEF12 inhibition reduces tau accumulation in disease-associated tau mutations:

[0489] When the retromer-dependent endosomal recycling pathway’s ‘retrograde’ route slows its recycling of lysosomal protease receptors to the trans-Golgi network, the lysosomal proteases become trapped in the TGN, impairing the lysosomes' degradative capacity10. Tau is actively transported into the endosomes for lysosomal and autophagosome degradation28,29, and by downregulating or upregulating retromer-dependent recycling, studies have established that the pathway can act to maintain normal intracellular tau levels and that it can do so independent of AP11,27,30.

[0490] Accordingly, given the subtle effects we observed in the AD neuronal models, we turned to two hiPSC neuronal lines derived from patients with more aggressive tauopathies to determine if RhoGEF12 inhibition would have a more dramatic effect on reducing tau454903-6636-5555v.laccumulation. One line was generated from a patient expressing the P3O1 S MAPT mutation31, which has been linked to both FTD and PSP, and one from a patient carrying the FTD-associated V337M MAPT mutation32.

[0491] Y16 was administered at ascending doses to P301S and V337M hiPSC neurons for 72 hours. Cell lysates were assayed for total tau and for pTau-181 by immunoblotting. Lysosomal size was evaluated by confocal imaging. As shown in Figs. 5A-5B, compared to isogenic controls, Y16 reduced intracellular total tau and pTau-181 in a dose-dependent manner in both lines, now with a greater effect than observed in the AD lines investigated above. In addition, Y16 administration was found to reduce the abnormally enlarged lysosomes characteristic of both pathological tau mutant neuronal cell lines. No evidence of toxicity was observed at any dose.

[0492] While in these ‘primary tauopathy’ models we have not formally tested whether the benefit of RhoGEF12 on tau accumulation is SORL1 dependent, previous studies have shown that retromer regulates the lysosomal clearance of pathological tau27and have explained how retromer- dependent endosomal recycling is essential for the health of the neuronal lysosome- autophagasome33. In any case, the results support the conclusion that deactivating ROCK2 might generalize from AD to other neurodegen erative disorders.

[0493] SORL1 deficiency leads to a co-elevation of ROCK2 in the mouse brain:

[0494] A genetic association study first found that, among retromer-related proteins, SORL1 is the one with the strongest genetic linkage to late-onset AD34and subsequent large-scale GWAS studies have established that SORL1 is one of the most common genes implicated in late-onset AD33. More recent genetic studies have established that SORL1 deficiency36and loss of endosomal SORL114are causally pathogenic while SORL1 overexpression appears protective in late-onset AD37. Concordantly, numerous postmortem studies have reported that SORL1 is deficient in the brains of late-onset AD patients38'41. Independent studies have suggested that ROCK242are elevated in sporadic AD.

[0495] To investigate whether SORL1 reductions in the brain might be linked to ROCK2 elevations, we probed the cortex of mice expressing a targeted gene deletion of the 5' region of SORLTs exon4 resulting in SORL1 deficiency. By immunoblotting, we found that, compared to wildtype littermates, ROCK2 is elevated in the SORL1 deficient mice (Fig. 6).464903-6636-5555v.l

[0496] While the findings suggest that SORL1 deficiency can drive the ROCK2 elevations observed in AD brains the precise mechanism remains unknown. Since cellular stress have shown to increase ROCK2 levels43we speculate stress-induced increase mediated by SORL1 deficiency.

[0497] Inhibiting via shRNA is also effective, as set forth in Fig. 11 and Fig. 12. An exemplary shRNA sequence for the RhoGEF12 (ARHGEF12) is set forth below.

[0498] Hairpin Sequence:5'-CCGG-CCTCAGTCTCATTCACTGAAT-CTCGAG-ATTCAGTGAATGAGACTGAGG-TTTTTG-31(SEQ ID NO: 1). Other hairpins can be designed similarly. For example, a different hairpin may be designed by replacing the CCTCAGTCTCATTCACTGAAT (SEQ ID NO:2) sense sequence shown in SEQ ID NO: 1 with a different sense sequence (e.g., CCTCAGTCTCATTCACTGAGT (SEQ ID NO: 13), or any one of SEQ ID NOs:7-12), followed by an intervening loop sequence, followed by the reverse complement of the sense sequence. The hairpin may include the same or different leader, intervening loop, and trailer sequences as shown in SEQ ID NO: 1 e.g., to improve stability.DISCUSSION

[0499] Previous proteomic screening has found that ROCK2 is one of SORLl’s top binding partners17. Our results can explain why, showing that SORL1 is endowed with multiple ROCK2 binding domains, and that the binding affinity to one site is among the highest reported for ROCK2. Functionally, each of SORLl’s binding sites for activated ROCK2 are strategically placed so that, when bound, ROCK2 conspires to reduce endosomal SORLl-retromer. Since the synaptic enriched RhoGEF12 activates ROCK2, in a series of cellular studies and relying on established disease-associated readouts, we use a RhoGEF12 pharmacological inhibitor to confirm that ROCK2 deactivation enhances retromer-dependent endosomal recycling. Collectively, the fact that both ROCK2 and SORL1 are enriched in the brain, taken together with the distinctly strong and functionally impactful SORL1 binding, allows the conclusion that ROCK2 is a dominant modulator of retromer-dependent endosomal recycling in the brain and that inhibiting RhoGEF12 is a therapeutic target for AD and related neurodegenerative disorders (Fig. 7).474903-6636-5555v.l

[0500] While retromer-dependent endosomal recycling functions at early endosomes, its positioning as the first compartment of the downstream endolysosomal system, together with its regulation of both the endosome-to-cell surface and the endosome-to-TGN trafficking routes, explains why the pathway is endowed with a unique neuroprotective role. It protects lysosomeautophagosome health33’44’45, which explains why pathway dysfunction accelerates A0 production and tau accumulation. However, by recycling synaptic surface proteins, such as neurotropic factor receptors7,9'46'48and adhesion molecules7’8’49, the pathway also protects synaptic and neuronal integrity.

[0501] When the pathway’s dual routes are ultimately affected it should initiate a chronically progressive loss of synapses and neurons, the defining feature of neurodegenerative disorders.

[0502] In a recent we report, we validate that SORL1 deficient mice, modelling SORL1 causative mutations, gradually develop age-dependent neurodegeneration in AD’s vulnerable brain regions and that viral vector overexpression of VPS26b both normalized SORL1 deficiency and rescued the neurodegenerative process. The therapeutic goal for any neurodegenerative disease is obviously ameliorating the neurodegenerative process, the cause of the debilitating cognitive impairments that afflicts patients and something that has hitherto eluded existing therapies.

[0503] The therapeutic benefit of overexpressing VPS26b in SORL1 deficient mice was interpreted in the context of how endosomal SORLl-VPS26b represents the crux of the retromer machinery in neurons1. Notably, RhoGEF12 inhibitors can be considered to have a similar mechanism of action as VPS26b overexpression. Thus, here we test RhoGEF 12 inhibitors in acute cell culture systems relying on Ap and tau as readouts of pathway function.

[0504] Our RhoGEF 12 inhibition results in wildtype neurons and in those expressing AD- associated mutations, as well as neurons harboring primary tauopathy MAPT mutations, supports the generalizability of targeting RhoGEF 12 for the multiple proteinopathies that typify the most common neurodegenerative disorders. Indeed, besides its link to amyloid and tau pathology, by protection lysosome-autophagosome health, retromer-dependent endosomal recycling disruptions also been linked to alpha synuclein pathology50and some studies are beginning to link it to TDP- 43 pathology51. This might explain a recent observation that patients carrying a pathogenic SORL1 mutation that results in loss of endosomal SORL1 are found to have a mix of all four pathologies14.484903-6636-5555v.lIt is now known, in fact, that an admixture of these pathologies is commonly found even in ‘sporadic’ late-onset AD patients52.In conclusion, the studies have identified a pharmacological approach for enhancing retromer- dependent endosomal recycling, a pathway commonly disrupted in late-onset AD and one that is linked to multiple proteinopathies that typifies the disease52. Moreover, drugs inhibiting RhoGEF12 are thought to extend beyond AD to other related neurodegenerative disorders, including FTD / ALS and Parkinson’s disease.494903-6636-5555v.lReferencesYoung, J. E., Holstege, H., Andersen, O. M., Petsko, G. A. & Small, S. A. On the causal role of retromer-dependent endosomal recycling in Alzheimer's disease. Nat Cell Biol (2023). world wide web at doi.org / 10.1038 / s41556-023-01245-2Kovtun, O. et al. Structure of the membrane-assembled retromer coat determined by cryoelectron tomography. Nature 561, 561-564 (2018). world wide web at doi.org / 10.1038 / s41586-018-0526-zFjorback, A. W. et al. Retromer binds the FANSHY sorting motif in SorLA to regulate amyloid precursor protein sorting and processing. JNeurosci 32, 1467-1480 (2012). world wide web at doi.org / 10.1523 / JNEUROSCI.2272-11.2012Jensen, A. M. G. et al. Dimerization of the Alzheimer's disease pathogenic receptor SORLA regulates its association with retromer. Proc Natl Acad Set U S A 120, e2212180120 (2023). world wide web at doi.org / 10.1073 / pnas.2212180120Park, M. et al. Plasticity-induced growth of dendritic spines by exocytic trafficking from recycling endosomes. Neuron 52, 817-830 (2006). world wide web at doi . org / 10.1016 / j . neuron.2006.09.040Park, M., Penick, E. C., Edwards, J. G., Kauer, J. A. & Ehlers, M. D. Recycling endosomes supply AMPA receptors for LTP. Science 305, 1972-1975 (2004). world wide web at doi . org / 10.1126 / science.1102026Mishra, S. et al. The Alzheimer's gene SORL1 is a regulator of endosomal traffic and recycling in human neurons. Cell Mol Life Sci 79, 162 (2022). world wide web at doi .org / 10.1007 / s00018-022-04182-9Lee, H. et al. Cell-type-specific regulation of APOE and CLU levels in human neurons by the Alzheimer's disease risk gene SORL1. Cell Rep 42, 112994 (2023). world wide web at doi . org / 10.1016 / j . celrep .2023.112994Rohe, M., Hartl, D., Fjorback, A. N., Klose, J. & Willnow, T. E. SORLA-mediated trafficking of TrkB enhances the response of neurons to BDNF. PLoS One 8, e72164 (2013). world wide web at doi.org / 10.1371 / journal.pone.0072164Small, S. A. & Petsko, G. A. Retromer in Alzheimer disease, Parkinson disease and other neurological disorders. Nat Rev Neurosci 16, 126-132 (2015). world wide web at doi . org / 10.1038 / nrn3896Young, J. E. et al. Stabilizing the Retromer Complex in a Human Stem Cell Model of Alzheimer's Disease Reduces TAU Phosphorylation Independently of Amyloid Precursor Protein. Stem Cell Reports 10, 1046-1058 (2018). world wide web at doi.org / 10.1016 / j. stemcr.2018.01.031504903-6636-5555v.l12 Knupp, A. et al. Depletion of the AD Risk Gene SORL1 Selectively Impairs Neuronal Endosomal Traffic Independent of Amyloidogenic APP Processing. Cell Rep 31, 107719 (2020). world wide web at doi.org / 10.1016 / j.celrep.2020.10771913 Jensen, A. M. G. et al. The SORL1 p.Y1816C variant causes impaired endosomal dimerization and autosomal dominant Alzheimer's disease. Proc Natl Acad Set USA 121, e2408262121 (2024). world wide web at doi.org / 10.1073 / pnas.240826212114 Fazeli, E. etal. N familial missense variant in the Alzheimer's disease gene SORL1 impairs its maturation and endosomal sorting. Acta Neuropathol 147, 20 (2024). world wide web at doi . org / 10.1007 / s00401-023-02670-115 Jacobsen, L. et al. The sorLA cytoplasmic domain interacts with GGA1 and -2 and defines minimum requirements for GGA binding. FEBS Lett 511, 155-158 (2002). world wide web at doi.org / 10.1016 / s0014-5793(01)03299-916 Lane, R. F., Gatson, J. W ., Small, S. A., Ehrlich, M. E. & Gandy, S. Protein kinase C and rho activated coiled coil protein kinase 2 (ROCK2) modulate Alzheimer's APP metabolism and phosphorylation of the VpslO-domain protein, SorLl. Mol Neurodegener 5, 62 (2010). world wide web at doi.org / 10.1186 / 1750-1326-5-6217 Herskowitz, J. H. et al. Rho kinase II phosphorylation of the lipoprotein receptor LR11 / SORLA alters amyloid-beta production. J Biol Chem 286, 6117-6127 (2011). world wide web at doi.org / 10.1074 / jbc.Ml 10.16723918 Jaffe, A. B. & Hall, A. Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol 21, 247-269 (2005). world wide web at doi.org / 10.1146 / annurev. cellbio.21 .020604.15072119 Shang, X. et al. Small-molecule inhibitors targeting G-protein-coupled Rho guanine nucleotide exchange factors. Proc Natl Acad Sci U SA 110, 3155-3160 (2013). world wide web at doi.org / 10.1073 / pnas.121232411020 Wilkinson, B., Li, J. & Coba, M. P. Synaptic GAP and GEF Complexes Cluster Proteins Essential for GTP Signaling. Sci Rep 7 , 5272 (2017). world wide web at doi.org / 10.1038 / s41598-017-05588-321 Small, S. A. et al. Model-guided microarray implicates the retromer complex in Alzheimer's disease. Ann Neurol 58, 909-919 (2005). world wide web at doi . org / 10.1002 / ana.2066722 Wirth, A. etal. G12-G13-LARG-mediated signaling in vascular smooth muscle is required for salt-induced hypertension. Nat Med 14, 64-68 (2008). world wide web at doi.org / 10.1038 / nml66623 Fong, V. et al. Arhgefl2 drives IL17A-induced airway contractility and airway hyperresponsiveness in mice. JCI Insight 3 (2018). world wide web at doi.org / 10.1172 / j ci. insight.123578514903-6636-5555v.l24 Yang, J. Q., Kalim, K. W., Li, Y., Zheng, Y. & Guo, F. Ablation of RhoA impairs Thl7 cell differentiation and alleviates house dust mite-triggered allergic airway inflammation. J Leukoc Biol 106, 1139-1151 (2019). world wide web at doi.org / 10.1002 / JLB.3A0119- 025RRR25 Ning, Y. et al. RhoA-ROCK2 signaling possesses complex pathophysiological functions in cancer progression and shows promising therapeutic potential. Cancer Cell Ini 24, 339 (2024). world wide web at doi.org / 10.1186 / sl2935-024-03519-726 Mishra, S. et al. Pharmacologic enhancement of retromer rescues endosomal pathology induced by defects in the Alzheimer's gene SORL1. Stem Cell Reports (2023). world wide web at doi.org / 10.1016 / j.stemcr.2023.10.01127 Carosi, J. M. et al. Retromer regulates the lysosomal clearance of MAPT / tau. Autophagy, 1-21 (2020). world wide web at doi.org / 10.1080 / 15548627.2020.182154528 Caballero, B. et al. Interplay of pathogenic forms of human tau with different autophagic pathways. Aging Cell 17 (2018). world wide web at doi.org / 10.1111 / acel.1269229 Vaz-Silva, J. et al. Endolysosomal degradation of Tau and its role in glucocorticoid-driven hippocampal malfunction. EMBO J 37 (2018). world wide web at doi.org / 10.15252 / embj .20189908430 Chen, X. et al. Parkinson's disease-linked D620N VPS35 knockin mice manifest tau neuropathology and dopaminergic neurodegeneration. Proc Natl Acad Sci U S A 116, 5765-5774 (2019). world wide web at doi.org / 10.1073 / pnas. 181490911631 Bellucci, A., Bugiani, O., Ghetti, B. & Spillantini, M. G. Presence of reactive microglia and neuroinflammatory mediators in a case of frontotemporal dementia with P301S mutation. Neurodegener Dis 8, 221-229 (2011). world wide web at doi . org / 10.1159 / 00032222832 Spina, S. et al. Frontotemporal dementia with the V337M MAPT mutation: Tau-PET and pathology correlations. Neurology 88, 758-766 (2017). world wide web at doi.org / 10.1212 / WNL.0000000000003636Daly, J. L. et al. Multi-omic approach characterises the neuroprotective role of retromer in regulating lysosomal health. Nat Commun 14, 3086 (2023). world wide web at doi.org / 10.1038 / s41467-023-38719-834 Rogaeva, E. et al. The neuronal sortilin-related receptor SORL1 is genetically associated with Alzheimer disease. Nat Genet (2007).35 Wightman, D. P. et al. A genome-wide association study with 1,126,563 individuals identifies new risk loci for Alzheimer's disease. Nat Genet 53, 1276-1282 (2021). world wide web at doi.org / 10.1038 / s41588-021-00921-z36 Scheltens, P. et al. Alzheimer's disease. Lancet 397, 1577-1590 (2021). world wide web at doi.org / 10.1016 / S0140-6736(20)32205-4524903-6636-5555v.l37 Zhou, X. et al. Transethnic analysis identifies SORL1 variants and haplotypes protective against Alzheimer's disease. Alzheimers Dement 21, el4214 (2025). world wide web at doi.org / 10.1002 / alz.1421438 Sager, K. L. et al. Neuronal LRH / sorLA expression is reduced in mild cognitive impairment. Ann Neurol 62, 640-647 (2007). world wide web at doi . org / 10.1002 / ana.2119039 Simoes, S. et al. Alzheimer's vulnerable brain region relies on a distinct retromer core dedicated to endosomal recycling. Cell Rep 37, 110182 (2021). world wide web at doi.org / 10.1016 / j.celrep.2021.11018240 Dodson, S. E. et al. LR11 / SorLA expression is reduced in sporadic Alzheimer disease but not in familial Alzheimer disease. Journal of neuropathology and experimental neurology 65, 866-872 (2006). world wide web at doi .org / 10.1097 / 01.jnen.0000228205.19915.2041 Scherzer, C. R. et al. Loss of apolipoprotein E receptor LR11 in Alzheimer disease. Arch Neurol 61, 1200-1205 (2004).42 Herskowitz, J. H. et al. Pharmacologic inhibition of ROCK2 suppresses amyloid-beta production in an Alzheimer's disease mouse model. J Neurosci 33, 19086-19098 (2013). world wide web at doi.org / 10.1523 / JNEUROSCI.2508-13.201343 Loirand, G. Rho Kinases in Health and Disease: From Basic Science to Translational Research. Pharmacol Rev 67, 1074-1095 (2015). world wide web at doi.org / 10.1124 / pr.115.01059544 Anton-Plagaro, C. et al. Mapping of endosomal proximity proteomes reveals Retromer as a hub for RAB GTPase regulation. Nat Commun 16, 6990 (2025). world wide web at doi.org / 10.1038 / s41467-025-61802-l45 Wang, Y. et al. Endo-Lysosomal Network Disorder Reprograms Energy Metabolism in SorLl-Null Rat Hippocampus. Adv Sci (Weinh) 11, e2407709 (2024). world wide web at doi.org / 10.1002 / advs.20240770946 Larsen, J. V. et al. Cytokine-Like Factor 1, an Essential Facilitator of Cardiotrophin-Like Cytokine: Ciliary Neurotrophic Factor Receptor alpha Signaling and sorLA-Mediated Turnover. Mol Cell Biol 36, 1272-1286 (2016). world wide web at doi.org / 10.1128 / MCB.00917-1547 Glerup, S. etal. SorLA controls neurotrophic activity by sorting of GDNF and its receptors GFRalphal and RET. Cell Rep 3, 186-199 (2013). world wide web at doi.org / 10.1016 / j.celrep.2012.12.01148 Huang, T. Y. et al. SORLA attenuates EphA4 signaling and amyloid beta-induced neurodegeneration. J Exp Med 214, 3669-3685 (2017). world wide web at doi.org / 10.1084 / jem.2017141349 Pietila, M. et al. SORLA regulates endosomal trafficking and oncogenic fitness of HER2. Nat Commun 10, 2340 (2019). world wide web at doi.org / 10.1038 / s41467-019-10275-0534903-6636-5555v.l50 Follet, J. et al. Parkinson Disease-linked Vps35 R524W Mutation Impairs the Endosomal Association of Retromer and Induces alpha- Sy nuclein Aggregation. J Biol Chem 291, 18283-18298 (2016). world wide web at doi.org / 10.1074 / jbc.Ml 15.70315751 Zeng, Y. et al. TDP-43 nuclear loss in FTD / ALS causes widespread alternative polyadenylation changes. bioRxiv (2024). world wide web at doi.org / 10.1101 / 2024.01.22.57573052 Schneider, J. A., Arvanitakis, Z., Leurgans, S. E. & Bennett, D. A. The neuropathology of probable Alzheimer disease and mild cognitive impairment. Ann Neurol 66, 200-208 (2009). world wide web at doi.org / 10.1002 / ana.21706544903-6636-5555v.l

Claims

CLAIMS1. A method of treating a neurodegenerative disease in a subject comprising administering to the subject amount of a compound having the following structure:whereinX is CH, O, orN;Y is C or N;A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;K is a bond, -CH2-, or -C(O)-;L is -CH2- or a bond; a and P are bonds that are absent or present; when a is present:P is absent,X is O, andY is C;4903-6636-5555v.lwhen p is present: a is absent,X is CH2 or N, andY is N; or a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, effective to treat a neurodegenerative disease in a subject.

2. A method of reducing development of a neurodegenerative disease in a subj ect comprising administering to the subject amount of the compound having the following structure:whereinX is CH, O, orN;Y is C or N;A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;K is a bond, -CH2-, or -C(O)-;4903-6636-5555v.lL is -CH2- or a bond; a and 0 are bonds that are absent or present; when a is present:0 is absent,X is O, andY is C; when 0 is present: a is absent,X is CH2 or N, andY is N; or a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, effective to reduce development of a neurodegenerative disease in a subject.

3. A method of reducing of A04O and / or A042 secretion in a brain cell comprising contacting the brain cell with an amount of the compound having the following structure:4903-6636-5555v.lwhereinX is CH, O, orN;Y is C or N;A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;K is a bond, -CH2-, or -C(O)-;L is -CH2- or a bond; a and P are bonds that are absent or present; when a is present:P is absent,X is O, andY is C; when p is present: a is absent,X is CH2 or N, andY is N; or584903-6636-5555v.la pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, effective to reduce brain cell A04O and / or A042 secretion.

4. A method of reducing of phospho-tau and / or total tau levels in a brain cell comprising contacting the brain with an amount of the compound having the following structure:whereinX is CH, O, orN;Y is C orN;A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;K is a bond, -CH2-, or -C(O)-;L is -CH2- or a bond; a and 0 are bonds that are absent or present; when a is present:0 is absent,4903-6636-5555v.lX is O, andY is C; when p is present: a is absent,X is CH2 or N, andY is N; or a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, effective to reduce phospho-tau and / or total tau levels in a brain cell.

5. A method of inhibiting RhoGEF12 in a subject comprising administering to the subject an amount of the compound having the following structure:whereinX is CH, O, orN;Y is C orN;A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;4903-6636-5555v.lG is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;K is a bond, -CH2-, or -C(O)-;L is -CH2- or a bond; a and are bonds that are absent or present; when a is present:3 is absent,X is O, andY is C; when p is present: a is absent,X is CH2 or N, andY is N; or a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, effective to inhibit RhoGEF12 in a subject.

6. A method of upregulating endosomal recycling in a subject comprising administering to the subject an amount of the compound having the following structure:614903-6636-5555v.lwhereinX is CH, O, orN;Y is C or N;A is an optionally substituted aromatic or nonaromatic heterocycle or carbocycle;E is an optionally substituted mono or bicyclic aromatic or nonaromatic heterocycle or carbocycle;G is a monocyclic aromatic or nonaromatic heterocycle or carbocycle;K is a bond, -CH2-, or -C(O)-;L is -CH2- or a bond; a and P are bonds that are absent or present; when a is present:P is absent,X is O, andY is C; when p is present: a is absent,624903-6636-5555v.lX is CH2 or N, andY is N; or a pharmaceutically acceptable salt or pharmaceutically acceptable salt hydrate or deuterated analog thereof, effective to upregulate endosomal recycling in a subject.

7. An inhibitory molecule comprising an interfering nucleotide sequence portion configured to hybridize to a nucleotide sequence encoding ARHGEF12 gene or aR0CK2 gene.

8. A method of reducing ARHGEF12 gene expression, presence, and / or activity in a cell, tissue, or organism, the method comprising introducing the inhibitory molecule of claim 7 to the cell, tissue, or organism.

9. A method of treating a neurodegenerative disease in a subject, the method comprising administering the inhibitory molecule of claim 7 to the subject.

10. A method of reducing development of a neurodegenerative disease, the method comprising administering the inhibitory molecule of claim 7 to the subject.

11. A method of reducing of phospho-tau and / or total tau levels in a brain cell or of reducing of A04O and / or AP42 secretion in a brain cell, the method comprising administering the inhibitory molecule of claim 7 to the cell.

12. The method of any preceding claim, wherein the neurodegenerative disease is an Alzheimer’s disease.

13. The method of any of claims 1-6 or 12, wherein the compound has the structure:4903-6636-5555v.l14. The method of any of claims 7-12, wherein the inhibitory molecule comprises SEQ ID NO: 1.

15. The method of any of Claims 1-6 or 8-14, wherein the subject or cell is human.644903-6636-5555v.l

Images