Treatment for disorders of the kidney or spleen
The combination of oligonucleotide-based medicaments with 12,13-dehydrooleanane aglycone core saponins addresses inefficiencies in delivering oligonucleotides to kidney and spleen cells, enhancing therapeutic efficacy and safety by improving cellular uptake and reducing toxicity.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-10-23
- Publication Date
- 2026-04-30
AI Technical Summary
Oligonucleotide-based medicaments face challenges in efficient delivery and uptake into kidney and spleen cells, leading to inefficacious therapy, nephrotoxicity, and inflammation, with less than 2% of the therapeutic dose being correctly internalized and the rest retained in endosomal compartments.
A combination of oligonucleotide-based medicaments with penta-cyclic triterpene saponins, specifically 12,13-dehydrooleanane aglycone core saponins, enhances intracellular delivery and release into kidney and spleen cells, allowing effective modulation of gene expression without nephrotoxicity.
The combination enables safe and effective delivery of oligonucleotides at lower doses, improving therapeutic efficacy and reducing adverse effects by enhancing cellular uptake and avoiding renal and splenic accumulation.
Smart Images

Figure IMGF000053_0001 
Figure IMGF000062_0001 
Figure IMGF000067_0001
Abstract
Description
[0001] TREATMENT FOR DISORDERS OF THE KIDNEY OR SPLEEN
[0002] TECHNICAL FIELD
[0003] The invention relates to the fields of therapy and drug delivery. It is based on an unexpected finding that a combination of an oligonucleotide-based medicament with a saponin component comprising a penta-cyclic triterpene saponin of a 12,13-dehydrooleanane aglycone core, not only does not appear to be associated with oligonucleotide medicament-induced nephrotoxic effects after systemic administration in vivo, but also that it allows the oligonucleotide-based medicament to enter and act on its nucleic acid target inside of the kidney cells instead of remaining unproductively trapped in renal subcellular compartments or being eliminated into the urine via the renal glomerular filtration system. In line with this finding, herein disclosed are therapeutic combinations, compositions, and formulations, as well as methods of treatment involving their administration, which comprise an oligonucleotide-based medicament that acts on an intracellular nucleic acid target in the kidney cells and / or in the cells of the spleen, being the other blood filtering organ in addition to the kidney, and a saponin component that enables the effective release of said medicament inside of these cells, thus allowing its use at a much lower and safer dose. The provision of the presented herein therapeutic combinations enables effective modulation of gene expression in the kidney and / or spleen cells and, therefore, it opens not only new treatment options for kidney diseases, in particular those involving inflammation and / or splenomegaly, but also for diseases of other organs which affect or are affected by the pathological processes happening in the kidneys and / or in the spleen, in particular being inflammatory processes.
[0004] BACKGROUND
[0005] Therapeutic use of oligonucleotides including small interfering RNAs (siRNAs) and antisense oligonucleotides (ASOs, AONs) is appreciated as holding great promise for the treatment of numerous diseases. Their ability to specifically recognise and bind in a sequence-specific manner to an intracellular nucleic acid and thereby modulate its expression via a range of processes including RNA interference (RNAi), target degradation by RNase H-mediated cleavage, splicing modulation, ADAR-based RNA editing, non-coding RNA inhibition, gene activation, etc. (Roberts et al., 2020), makes the oligonucleotide-based medicines one of the most flexible and pragmatic therapeutic modalities for treating any disorders and conditions associated with a specific genetic target. Furthermore, specific classes of oligonucleotide therapeutics have standardised manufacturing pipelines, allowing for rapid and relatively inexpensive drug development for even rare genetic (orphan) disorders and / or personalised medicines aiming at treating individual mutations.
[0006] To date, 20 oligonucleotide-based medicaments of different oligonucleotide chemistries have been commercially approved by the US The Food and Drug Administration (FDA) since the first approval in 1998 of phosphorothioate linkage-modified ASO (PS-ASO) fomivirsen (Vitravene) for used in the treatment of cytomegalovirus retinitis (CMV). The 20 approved medicaments include 12 ASOs, 6 siRNAs, 1 aptamer, and 1 mixed ss / ds DNA. Although the pace of approvals is increasing over the last years, many candidates regularly fail due to limited biodistribution / uptake and poor safety profile (Echevarria & Goyenvalle, 2022). In pursuit of better delivery and higher cellular uptake, oligonucleotide chemistries are being optimised or various ligands or carriers are attached. Despite the ongoing progress, therapeutic inactivity within the target organ and the safety aspect continuously remain the main reasons of clinical failures. In particular, nephrotoxicity and other side-effects in the kidney are an important concern (Echevarria & Goyenvalle, 2022).
[0007] Toxicological properties of oligonucleotides have been comprehensively and extensively summarised (Andersson et al., 2019; Frazier 2015) and, in addition to the kidney, they also concern the liver and the spleen (Wu et al., 2022). Although naked oligonucleotides below the size-limit of the glomerular filtration barrier are subject to rapid elimination via renal filtration, for bigger and heavily modified oligonucleotide-based medicaments, the kidneys are considered a primary site of accumulation, accounting for up to 20% of the concentration of the total administered oligonucleotide dose (Geary et al., 2015). Accordingly, renal toxicity following systemic administration is mostly regarded as accumulation-related and sequence unspecific, except for rarer more acute lesions reported with high-affinity ASOs such as locked nucleic acids (LNAs; Goyenvalle et al., 2023). The highest oligonucleotide uptake is generally observed in the proximal tubular epithelial cells in the kidney cortex, whereas uptake in the kidney medulla is much lower. Consequently, renal lesions generally occur at the proximal tubules (Goyenvalle et al., 2023) and renal toxicity symptoms associated with these lesions are a common reason for drug discontinuation or placing warning labels, even for charge-neutral oligonucleotides like PMOs.
[0008] For example, five FDA-approved oligonucleotide-based medicaments (nusinersen, inotersen, golodirsen, viltolarsen, and casimersen) have warning labels for renal toxicity while nephrotoxicity data obtained during their preclinical studies and clinical trials mentions renal tubular degeneration, glomerulonephritis, and increased urinary protein levels (Wu et al., 2022). In particular, deterioration of renal tubule and irreversible renal damage was reported in preclinical studies of golodirsen; the decline of renal tubule was reported in preclinical studies of nusinersen; the degeneration of renal tubule was observed at the highest doses in animal experiments receiving viltolarsen; the deterioration of renal tubule was mentioned in preclinical studies of casimersen; and the glomerulonephritis and proteinuria was seen in clinical trials of inotersen. Notably, due to unacceptable nephrotoxicity as well as hepatotoxicity risk, mipomersen was withdrawn from the market in 2019 (Fogacci et al., 2019).
[0009] The kidney is a critical organ and any therapeutic side-effects that may potentially cause damage thereto must be carefully balanced versus the desired therapeutic outcome with careful regard to the quality of life of the patient and on a case to case basis. Oligonucleotides of different chemical modifications were postulated to be reabsorbed from the glomerular filtrate by receptor mediated-endocytosis through multiligand receptors, such as megalin, that are highly expressed at the proximal tubules (Cartón-García et al., 2021). Such pharmacokinetics and biodistribution would suggest that designing kidney-specific treatments with oligonucleotides should be possible. In fact, the global burden of kidney damage manifesting in kidney diseases, notably including chronic kidney disease (CKD), is increasing every year and represents a great cost for public healthcare systems, especially considering that the majority of these diseases are progressive. Given the apparent preferential accumulation in the kidney of oligonucleotides above the renal filtration threshold, one would expect that targeting disease symptoms directly in the kidney cells with this type of medicaments will likely succeed. Furthermore, many inherited kidney diseases are monogenetic (Bondue, et al. 2022), which makes them a perfect choice for oligonucleotide-based treatments. Consequently, oligonucleotide-based medicaments are intensively being tested as a prime treatment strategy for currently over 100 kidney disorders, including different chemical modifications and delivery modalities (Bondue, et al. 2023a).
[0010] However, although potentially druggable nucleic acid targets within the kidney have been identified, the efficient delivery of oligonucleotide-based medicaments into the kidney cells, paradoxically remains challenging. As a consequence, only few oligonucleotide candidates with the aimed delivery into the kidney remain at present in the clinical trials, and there exist many examples of such drugs that failed or become discontinued due to inactivity and even nephrotoxicity, the latter case notably including 2'-methoxyethyl (MOE)-modified ASO compound ISIS 388626 (van Meer et al., 2017) that was designed to target human sodium glucose cotransporter 2 (SGLT2) mRNA in the kidney cells.
[0011] Consequently, while it is acknowledged that oligonucleotide drugs accumulate in renal cells, the lack of efficacy indicates that they are not being efficiently delivered into the compartments of the kidney cells where they would be able to act upon their target nucleic acids. In fact, reports exist suggesting that oligonucleotide therapeutics do not appear to become therapeutically effective in kidney cells but, if they do not become eliminated, they get unproductively trapped in the subcellular compartments of the kidney cells, which manifests in accumulation of (usually basophilic) granules visible in the kidney tissues upon histopathological examination. The accumulation of these granules has been linked to nephrotoxicity through induction of cell death and inflammation caused by infiltration of white blood cells into the kidney, which are the major cause of nephrotoxicity (Crooke et al., 2021). For example, in rodents treated with high dose of PS-ASO, it is also frequent to observe even tissue macrophages (referred to as histiocytes) which store inflammatory cytokines (Migliorati et al., 2022) that can worsen kidney structural damage and scarring.
[0012] The low efficiency of productive oligonucleotide delivery in the kidney in turn is addressed by increasing of the drug dose, which further exacerbates the above-described toxicity by accelerating the accumulation of the granules and increasing the inflammation. This appears to be one of the reasons why oligonucleotide-based medicaments aimed at acting in kidney cells eventually fail.
[0013] Inflammation is a process intimately linked to renal diseases and involves a complex network of interactions between kidney cells of the kidney parenchyma and resident in the kidney immune cells, such as macrophages and dendritic cells, coupled with recruitment of circulating monocytes, lymphocytes, and neutrophils (Andrade-Oliveira et al., 2019). Once stimulated, the immune cells activate stress signalling via, among others, Toll-like receptor and Nod-like receptor (NLR), which can set in motion major innate immunity pathways such as nuclear factor KB (NF-KB) and NLRP3 inflammasome, causing metabolic reprogramming and phenotype changes of immune cells and parenchymal cells and triggering the secretion of a number of inflammatory mediators that can cause irreversible tissue damage and functional loss within the kidney (Andrade-Oliveira et al., 2019). Growing evidence suggests that this response can be deeply impacted by the crosstalk between the kidneys and other organs, such as the liver, the pancreas, the gut, and, notably, the spleen (Gigliotti and Okusa, 2014).
[0014] The spleen is the main filter for blood-borne pathogens and antigens; it makes lymphocytes, stores blood cells, participates in iron metabolism, and is responsible for the removal of damaged erythrocytes (Bronte and Pittet, 2014). In line with its blood-filtering and scavenging function, the spleen, just like the kidney, is highly vascularised with discontinuous or fenestrated endothelia and performs removal from the circulation of various compounds and nanoparticles in a manner that is very much dependent on their size (Cataldi et al., 2017). In brief, particles larger than 15 nm but smaller than 200 nm are captured by macrophages in the spleen’s marginal zones; whereas particles larger than 200 nm are retained in the red pulp of the spleen (Moghimi et al., 2012). It has also been demonstrated that nanoparticles larger than 100-200 nm are incapable of crossing the endothelial slit of splenic sinuses, and can also be filtered off and retained in the spleen’s red pulp where they are internalised by red pulp macrophages and eventually slowly destroyed (Cataldi et al., 2017). Based on these features, it is unsurprising that the spleen is, just like the kidney, also a major site for oligonucleotide-based drug accumulation (Cartón-García et al., 2021), which appears to activate inflammatory responses within this organ. For example, treatment of mice with high doses of PS-ONDs has shown increased levels of circulating cytokines and chemokines and resulted in a dose-dependent lymphoid hyperplasia with enlargement of the spleen (Goyenvalle et al., 2023). Lymphoid hyperplasia was also noted in the spleens of monkeys treated with PS-ASOs, together with lymphohistiocytic infiltrates in multiple other organs (Frazier 2015).
[0015] There exists no doubt of spleen’s involvement in systemic inflammation and in stimulating inflammatory processes at other organs, for which it appears to function as a reservoir of inflammatory monocytes (Mandal et al., 2016). Experimental models have shown that following tissue injury, splenic monocytes enter the circulation migrating to inflammatory sites, where they differentiate into macrophages, participating in inflammatory responses. In this context, a key role of splenic monocytes has been demonstrated in post ischemic brain injury, atherosclerosis, myocardial infarction, and septic peritonitis (Mandal et al., 2016). Many kidney diseases like CKD are often associated with enlarged spleen (splenomegaly) and white blood cells infiltration into kidney parenchyma, suggesting a similar splenocytic involvement. The latter is further supported by the fact that inflammatory monocytes of likely at least partially splenic origin are a major component of the cellular infiltrate in acutely rejecting human kidney allografts (Lai et al., 2022). Furthermore, the spleen appears to be a key player in the “cytokine storm” response that develops after infection and trauma, which can lead to systemic inflammation. Evidence suggests that controlling the splenic cytokine response improves tissue function and mortality in sepsis and other inflammatory-mediated diseases (Gigliotti and Okusa, 2016). For example, the high mortality rate of sepsis-associated AKI patients is thought to be due to multiorgan dysfunction in which spleen was suggested to be involved through massive release of proinflammatory cytokines including interleukins (I L)-1,-6, -8,-12, and, most notably, tumour necrosis factor (TNF)-a, in response to bacterial sequestration by phagocytes in the spleen. The role of the spleen in AKI has been demonstrated in experimental studies in splenectomised animals, suggesting that it can be a potential therapeutic target for kidney diseases (Gigliotti and Okusa, 2016). However, development of oligonucleotide therapies aimed at targeting the spleen cells are not often considered, likely because development of such medicaments is expensive while it is estimated that one can in principle live a normal lifespan without the spleen, provided that precautions against infections are taken. As a consequence, development of effective therapies for kidney diseases that could act directly at the level of kidney cells, rather at the level of spleen cells, appeared to have received a higher focus from the pharmaceutical industry, despite the potential of the latter approach, in particular from the perspective of managing inflammation.
[0016] Consequently, there exist a need for increasing of the efficacy, bioavailability, and long termeffects of oligonucleotide-based therapeutics in the kidney cells.
[0017] Oligonucleotide therapeutics are known to suffer from an extremely inefficient cellular uptake, which prevents them from effectively reaching the cytoplasmic and / or the nuclear intracellular compartments where they are supposed to act upon their generic targets. This perhaps is best reflected by the quantitative estimation that less than 2% from a therapeutic dose of an oligonucleotide drug becomes correctly internalised, possibly due to an estimated 98% thereof being retained within the endosomal compartment and eventually degraded in the lysosomes (Gilleron et al., 2013).
[0018] In conclusion, improved strategies are needed for delivering oligonucleotide-based medications in a more efficient way into the kidney cells, including the immune cells resident in the kidney, and possibly into the spleen cells as well, allowing to lower their doses to minimise the risks of nephrotoxic and / or deleterious immunostimulatory effects. It is an objective of the present disclosure to provide such strategies, as explained below.
[0019] SUMMARY
[0020] Sapreme Technologies B. V. is a biotechnology company focused on improving the delivery and efficacy of macromolecule therapeutics, thereby enhancing target engagement, and have developed an efficient intracellular delivery platform based on a specific group of penta-cyclic triterpene saponins comprising an aglycone core of 12,13-dehydrooleanane type believed to have endosomal escapeenhancing (EEE) properties. Saponins of this type were shown in WO2020126626, WO2020126627, W02020126620, W02020126627, W02020126064, W02020126604, W02020126600, and W02020126609 to dramatically improve cancer treatment using oligonucleotide therapeutics. They were further shown in W02020126610, WO2021261992, WO2021261992, WO2022055351, WO2022265493 as potentiating the effects of antisense oligonucleotides in the liver cells following GalNAc-mediated targeting of these cells. Lastly, they were also shown in WO2023121444, WO2023121445, and WO2023121446 to potentiate exon-skipping effects of therapeutic oligonucleotides in differentiated muscle cells. However, it was never before observed or demonstrated that these saponins could be delivered into the kidney in vivo, nor that they would have any effect on oligonucleotide delivery efficiency into these cells in vivo, in particular from the bloodstream and / or following systemic administration.
[0021] The presented herein therapeutic solutions are based on an unexpected observation made during in vivo targeted hepatic delivery experiments with low dosages of antisense oligonucleotide (ASO) effectors together with the EEE saponins. Namely, it was observed that in the presence of the EEE saponins, intravenously administered liver-targeted therapeutic oligonucleotides were not only effectively silencing the expression of the target nucleic acid in the liver cells, but also in the kidney cells, furthermore without showing any visible hallmarks of nephrotoxicity. This serendipitous and surprising observation indicated that the oligonucleotide therapeutic that was provided at a very low dose, was not only taken up by the kidney cells, but also that in the presence of the EEE saponin, it was also effectively released after its uptake into the kidney cell cytoplasm where it could act on its target mRNA instead of remaining unproductively trapped in the renal subcellular compartments. As it is demonstrated in the in vivo experiments performed in mice and in a non-human primate (NHP), as shown below, the same was observed for therapeutic combinations of non-targeted-oligonucleotide-saponin conjugates and in a codelivery setting involving a targeted-oligonucleotide-based medicament and a separate targeted EEE saponin component.
[0022] Based on this finding, provided herein are therapeutic combinations, compositions, formulations, and methods involving their administration, for use in the treatment and / or prevention of a human disease, which are comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in cells of a blood filtration organ selected from kidney cells and spleen cells (and thereby to modulate gene expression in the kidney cells and / or the spleen cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type; wherein the treatment and / or prevention comprises administration of the saponin component and the oligonucleotide-based medicament to a human subject in the need thereof, wherein the saponin component and the oligonucleotide-based medicament are delivered into the blood filtering organ, preferably being the kidney cells, and wherein the human disease is preferably a disease affecting the kidney and possibly affecting the spleen and / or other organs in addition to affecting the kidney, advantageously wherein the human disease is a kidney disease, optionally wherein the human disease is a disease affecting the kidneys and involving inflammation such as a kidney disease involving inflammation.
[0023] It is one of the objectives of the disclosed further herein embodiments to provide a solution to the problem of inefficacious delivery of oligonucleotide-based medicaments into the kidney cells and / or the spleen cells.
[0024] Another one of the objectives of the disclosed herein embodiments is to provide a solution to the problem of low efficiency of target engagement by oligonucleotide-based medicaments, which appears to be the likely cause of the effective dose of the oligonucleotide-based medicaments being too low at the target site in the kidney and / or the spleen following systemic administration.
[0025] A further one of the objectives of the disclosed herein embodiments is to provide a solution to any one or more of the problems of insufficient delivery of the required quantity of oligonucleotide-based medicaments to the kidney and / or the spleen, their abrogated or suboptimal therapeutic efficacy following said delivery, as well as their off-target activity and / or undesired adverse effects and potentially nephrotoxic effects, possibly involving inflammation such as inflammation in the kidney parenchyma and enlarged and / or inflamed and possibly enlarged spleen. Last but not least, another one of the several objectives of the disclosed herein embodiments is to provide a solution to the problem of insufficient safety characteristics of the currently existing oligonucleotide-based medicaments, in particular those relating to adverse effects related to nephrotoxicity when systemically administered to human patients in need thereof, in particular the toxic side-effects and / or inflammation caused by the use of excessive doses.
[0026] DEFINITIONS
[0027] The terms “therapeutic combination” and “pharmaceutical combination”, as used herein, are to be construed as synonymous and as referring to a combined use of at least two bioactive components (herein being an oligonucleotide-based medicament and a saponin component that potentiates the effects of the oligonucleotide-based medicament) in treating of a disease and / or in preventing that a disease develops. In the present context, the two components of the therapeutic combination can be covalently conjugated together to form a single larger component (“1 -component”) and provided in a single therapeutic (pharmaceutical) composition, or can be kept as two separate components that can either be co-formulated in a single (2-component) therapeutic (pharmaceutical) composition, or can be provided independently in separate therapeutic (pharmaceutical) formulations e.g. in a form of a kit or a kit of parts containing two or more separate products packaged together in a single package or as a unit, wherein each product contains a separate pharmaceutical formulation of a different component of the presented herein therapeutic combination. As it will be understood by the skilled person, different modes of formulating the two compounds of the therapeutic combination have different advantages. For example, 1 -component (conjugate) and 2-component (co-formulation) therapeutic compositions have the advantage of ease of administration to the subject. On the other hand, two separate formulations allow more flexibility for fine-tuning the treatment by e.g. using different administration routes and having a choice between preforming a simultaneous or sequential administration.
[0028] The terms “kidney” and “kidneys” have their regular meaning as recognised in the field of biology that relate to one or more of usually two excretory filtration organs that belong to the urinary system and produce urine by filtering blood. The skilled person will be familiar with the anatomy, histology and the functioning of the kidney and, therefore, will know the substructures and different types of cells (as used herein, kidney cells) that build the kidney and molecular markers associated therewith (Agarwal et al., 2021). In brief, a typical mammalian kidney has a renal capsule, cortex, medulla, one or more renal calyces, and a renal pelvis (although the latter two may be absent in some species). The medulla usually contains one or more renal pyramids, forming papillae with their innermost parts. Generally, the urine produced by the cortex and the medulla drains from the papillae into the calyces, and then into the renal pelvis, from which it exits the kidney through the ureter. The cortex and the medulla contain the structural and functional units of the kidney known as the nephrons, which are composed of a renal corpuscle and a renal tubule. The blood is filtered inside of the corpuscles, which are primarily located in the cortex, while the medulla of a mammalian kidney contains the major sections of the tubules including loops of Henle, which are responsible for urine concentration. The renal corpuscle is made of a tuft of capillaries called the glomerulus that is covered by a Bowman's capsule. The renal tubule is connected to and extends from the capsule, and both are composed of epithelial cells and have a lumen. The tuft is structurally supported by the mesangium (the space between the blood vessels), composed of intraglomerular mesangial cells, which make up about 30–40% of the glomerular cell population (Ebefors et al., 2022). The blood is filtered across the capillary walls to form a filtrate that passes to the renal tubule. During the filtration, the blood passes through three layers that form the glomerular filtration barrier, which are: the endothelial cells of the capillary wall, its basement membrane, and between the podocyte foot processes of the lining of the capsule. The barrier filters molecules based on size and charge and is made from three types of filters present in the different layers: (i) the endothelial fenestrations in glomerular capillaries, (ii) the glomerular basement membrane, and (iii) the visceral epithelial cell podocyte slit diaphragm. The tubule has adjacent peritubular capillaries that run between the descending and ascending portions of the tubule. As the filtrate from the capsule flows down into the tubule, it is processed by the epithelial cells lining of the tubule: water is reabsorbed and substances are exchanged (some are added, others are removed); first with the interstitial fluid outside the tubules, and then into the plasma in the adjacent peritubular capillaries through the endothelial cells lining that capillary. This process regulates the volume of body fluid as well as levels of many body substances. At the end of the tubule, the remaining fluid — urine — exits: it is composed of water, metabolic waste, and toxins. Human kidney anatomy and function are part the common general knowledge as evidenced by academic textbooks and review articles (cf. e.g. Alallam et al., 2023).
[0029] In line with the above, the term “disease affecting the kidneys” will be clear to the skilled person as any pathological or disease state that can or will negatively affect the functioning of the kidneys, e.g. by increasing the metabolic strain on the filtration processes and / or causing inflammation within the kidney. The term should be construed as broader than and encompassing the term “kidney disease” that should be construed as any abnormality of the kidneys that can be observed, even if the observable damage is very slight. Examples of a diseases affecting the kidney include but are not limited to many diseases affecting the liver, pancreas, and / or spleen, as well as many cardiovascular diseases, diabetes, and certain muscular dystrophies such as Duchenne muscular dystrophy (DMD), which are diseases that are likely to lead to a kidney disease. In the context of the present disclosure, it will be understood by the skilled person that by selection of a different disease-specific oligonucleotide-based medicament acting within the kidney cells, severe kidney-related and other potentially-lethal symptoms of the diseases affection the kidney could potentially be postponed, avoided, ameliorated, or perhaps even cured (e.g. through accelerated recovery via improved kidney functioning) by modulation of gene expression within the kidney cells of a subject in need of a treatment or in need of an application of preventive measures to avoid disease development or further progression to more advanced stages.
[0030] The term “spleen” has its regular meaning as recognised in the field of biology that relates to a blood filtering organ that is responsible for initiating immune reactions to blood-borne antigens and for filtering the blood of foreign material and old or damaged red blood cells, which functions are carried out by the two main compartments of the spleen, being the white pulp (according to Cesta 2006, being the compartment including the marginal zone) and the red pulp, respectively. Both of these compartments differ in their architecture, vascular organization, and cellular composition. Being a blood filter, it follows that the spleen is a highly vascular organ. However, the blood flow through the spleen is so complex that certain aspects thereof are not fully agreed upon by different scholars (Cesta 2006). The subjects of the controversies are, however, irrelevant for the present disclosure. In general, it is recognised that the blood enters the spleen via the splenic artery which divides into trabecular arteries located within the trabeculae entering the splenic parenchyma. Small arterioles branch from the trabecular arteries and enter the red pulp where they become central arterioles surrounded by lymphoid tissue. Smaller arterioles branch from the central arterioles and feed the white pulp capillary beds. Some of these terminate in the marginal sinus at the junction of the white pulp and the marginal zone, others terminate within the marginal zone, and a few extend beyond the white pulp to terminate in the red pulp. Once through the marginal zone, the blood either flows directly into adjacent venous sinuses or enters the reticular meshwork of the red pulp. It is assumed that as much as 90% of the total splenic blood flow travels through the adjacent venous sinuses, bypassing the reticular meshwork of the red pulp. Blood from the red pulp collects in the venous sinuses which enter the trabeculae and merge into the trabecular veins, which then converge at the hilus to form the splenic vein which drains into the hepatic portal system. The red pulp is a blood filter composed of a three-dimensional meshwork of splenic cords and venous sinuses. The splenic cords are composed of reticular fibres, reticular cells (considered to be myofibroblasts), and associated macrophages. Within the spaces between the cords are blood cells. The red pulp macrophages are actively phagocytic and remove old and damaged erythrocytes and blood-borne particulate matter. The spleen is also the largest secondary lymphoid organ that initiates immune responses to blood-borne antigens and contains about one-fourth of the body’s lymphocytes. The immune response function resides primarily with the white pulp which surrounds the central arterioles and is composed of three sub-compartments: the periarteriolar lymphoid sheath (PALS), the follicles (lymph follicles), and the marginal zone. The PALS is populated by lymphocytes (both B-cells and T-cells, primarily T-cells), sporadic macrophages, and, upon antigenic stimulation, plasma cells. It also contains concentric layers of reticular fibres and flattened reticular cells. IgM and IgG2 are produced in this zone. These molecules play a role in opsonization of extracellular organisms, encapsulated bacteria in particular. The follicles lay between the PALS and the marginal zone bordering on the red pulp and are composed primarily of B-cells and may contain germinal centres, which form upon antigenic stimulation. The marginal zone (MZ) is situated at the interface of the red pulp with the PALS and the follicles. It is considered by some to be a separate compartment rather than part of the white pulp, and it is designed to screen the systemic circulation for antigens and pathogens and plays an important role in antigen processing. MZ contains a unique subset of non-circulating B-cells and antigen-presenting cells (APCs), such as dendritic cells and macrophages expressing pattern recognition receptors such as toll-like receptors (TLRs), which dendritic cells and macrophages are involved in clearance of microorganisms and viruses. The MZ macrophages are of different subtypes including a specialized kind known as metallophilic macrophages (marginal metallophilic macrophages, MMM).
[0031] As used herein, the terms “spleen cell” or “splenocyte” will be clear to the skilled person and interpreted as referring to any cell or cells belonging to any one or more of the different populations of white blood cell like leukocytes like B-cells and T-cells, dendritic cells, and macrophages, which reside in the spleen, for example but not limited to red pulp macrophages, white pulp B-cells (white pulp B-lymphocytes), white pulp T-cells (white pulp T-lymphocytes), marginal zone (MZ) B cells (marginal zone B-lymphocytes or MZ B-lymphocytes), marginal zone (MZ) dendritic cells, and white pulp macrophages that, as used herein and unless specified otherwise, are to be construed as macrophages of the white pulp that are not present in the marginal zone, in contrast to marginal zone (MZ) macrophages.
[0032] The term “subject” as used herein refers to a human suffering from or at risk of a certain health-related disorder, such as a disease or other pathological condition. The terms “subject” and “patient” are used interchangeably herein.
[0033] The term ’’treatment” as used herein has its conventional meaning and refers to a medical intervention or management of a subject with the intention to cure, ameliorate, or stabilise a health-related disorder. The term “treatment” includes e.g. active treatment that is a type of an action directed specifically toward the improvement of a health-related disorder, and also includes causal treatment that is a treatment directed towards a removal of the cause of the associated therewith health-related disorder. The terms “prevention” and “prophylaxis” as used herein are to be construed as referring to a medical intervention or management of a subject with the intention to maintain health or the normal bodily functions and / or prevent the otherwise anticipated development of a health-related disorder.
[0034] As used herein the term “administration” is to be construed as referring to the way of providing a substance, such as a compound, or a composition to a subject. Conversely, as used herein the term “delivery” is to be construed as referring to the way a compound reaches its destination site, e.g. specific zone, organ, its sub-compartment, cell or tissue type, for example the kidney, the kidney cortex, kidney medulla, a specific kidney cell type etc. Administration can relate to e.g. an intravenous, subcutaneous or other way of providing one or more compounds into the subject’s body, with an intended delivery to e.g. kidney cells and / or spleen cells, as the destination site. Usually, the terms “administering” or “administration” will be construed as relating to the provision of a substance that is physiologically and / or pharmacologically useful (e.g. medicament) to treat or prevent a disease or a pathological condition in the subject.
[0035] As used herein, the term “oligonucleotide-based medicament” is to be construed as a substance containing an oligomeric molecule that has a functionality of an oligonucleotide in the sense of being capable of sequence-dependent binding to a target nucleic acid (as used herein “targeting and binding”) that can be present within a cell, and through this binding, modulating the outcomes related to the target nucleic acid within the cell, for example by silencing the nucleic acid’s expression or by leading to different gene editing result (mRNA), whereby the successful modulation will be generally expected to have a positive therapeutic or prophylactic effect against a disease or development thereof. As a consequence, as used herein, an oligonucleotide-based medicament does not have to be a clinically-proven and / or Regulatory Authority-approved oligonucleotide-based medicament, although it certainly can be. However, it can also be an oligonucleotide-based medicament that is at a stage of pre-clinical trials, or is discontinued as a result of a failed clinical trial stage (e.g. phase III) but is credible to be able to produce a positive therapeutic or prophylactic effect but has failed e.g. due safety and / or toxicity concerns, often in relation to formulation and / or (possibly too high) dose. One of the advantages of the presented herein therapeutic combinations, formulations, and / or compositions containing the saponin component is the ability to use much lower doses of the credibly potentially-effective oligonucleotide-based medicaments to have them safely delivered into the cells, thus allowing to unleash their therapeutic potential at lower safety risks and / or likelihood of toxicity-related failures. As sometimes used herein, the oligonucleotide-based medicament will be referred to as an “effector component”, in which the therapeutic oligomeric nucleic acid and / or nucleic acid analogue molecule or moiety will be considered to function as an “effector molecule”, or “effector moiety”, respectively, for its ability to exert its desired therapeutic modulatory effect through binding to its target intracellular nucleic acid in the cytosol (cytoplasm) and / or in the nucleus of a cell, herein being a kidney cell. A typical example of an oligonucleotide-based medicament effector component suitable for the presented herein purposes can be a so called antibody-oligonucleotide conjugate (AOC). The term “oligonucleotide-based medicament” will in general be clear to the skilled person who will be familiar with different possible chemistries of the oligomeric molecule contained therein and other known in the art modifications and addition thereto, examples of which can be found in Roberts et al., 2020.
[0036] As used herein, the terms “nucleic acid” and “polynucleotide” are synonymous to one another and are to be construed as encompassing any polymeric molecule made of units, wherein a unit comprises at least a nucleobase (or simply “base”) e.g. being a canonical nucleobase like adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U), or any known non-canonical, modified, or synthetic nucleobase like 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 7-methylguanine; 5,6-dihydrouracil etc., or a functional equivalent thereof, which renders said polymeric molecule capable of engaging in hydrogen bond-based nucleobase pairing (such as Watson-Crick base pairing) under appropriate hybridisation conditions with naturally-occurring nucleic acids such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), which naturally-occurring nucleic acids are to be understood as being polymeric molecules made of units being nucleotides, whereby each nucleotide consists of a pentose sugar, a phosphate group and one of the nucleobases.
[0037] From the chemistry perspective, the term nucleic acid under the present definition can be construed as encompassing polymeric molecules that chemically are DNA or RNA, as well as polymeric molecules that are nucleic acid analogues, also known as xeno nucleic acids (XNA) or artificial nucleic acids, which are polymeric molecules wherein one or more (or all) of the units are modified nucleotides or are functional equivalents of nucleotides. Nucleic acid analogues are well known in the art and due to improved properties, such as specificity and / or affinity, higher binding strength to their target and / or increased stability in vivo, they are extensively used in research and medicine. Typical examples of nucleic acid analogues include but are not limited to locked nucleic acid (LNA) (that is also known as bridged nucleic acid (BNA)), phosphorodiamidate morpholino oligomer (PMO also known as Morpholino), peptide nucleic acid (PNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), hexitol nucleic acid (HNA), 2'-O, 4'-C-ethylene-bridged nucleic acid (ENA), 2’-deoxy-2’-fluoroarabinonucleic acid (FANA or FNA), 2’-deoxy-2’-fluororibonucleic acid (2’-F RNA or FRNA); altritol nucleic acids (ANA), cyclohexene nucleic acids (CeNA), nucleic acids containing modified linkages like phosphoryl guanidine (PN) backbone linkages etc. In line with the above, in some instance, the nucleic acid of the present disclosure may be chemically modified. For example, the nucleic acid may be modified on its backbone. Examples of modifications that can be performed on the backbone of a nucleic acid include, but are not limited to, phosphorothioate (PS), PN linkages, boranophosphate, phosphonoacatate (PACE), morpholine, peptide nucleic acid backbone modification (PNA), and amid-linked bases. The nucleic acid may also be modified on the sugar moiety and / or on the base moiety. Examples of modifications that can be performed on the sugar and / or the base moieties include, but are not limited to, locked nucleic acid (LNA), phosphoramidate (PN), 2'F-RNA, 2'-0 methoxyethyl (2'MOE), 2'0-methyl (2'0Me), 2'-O-fluoro (2'-F) 5-bromouracil, 5-iodouracil, 5-methylcytosine, ethylene bridged nucleic acids (ENA), diaminopurine, 2-thiouracil, 4-thiouracil, pseudouracil, hypoxantine, 2-aminoadenine, 6-methyl or other alkyl derivates of adenine and guanine, 2-propyl and other derivative of adenine and guanine, 6-azo-uracil, 8-halo, 8-amino, 8-thiol, 8-hydroxyk and other 8-substituted adenines and guanines, constrained ethyl sugar moiety (cET), ribofuranosyl, 2'-0,4'-C-methylene and 2'-0,4'-C-ethylene bicyclic nucleotide analogues, acyclic nucleotides (UNA and PNA), and dihydrouridine modification. Other modifications that may be performed on nucleic acids are, but are not limited to, modifications that include deoxyribonucleotide bases incorporated in a ribonucleotide sequence. The incorporations may be limited to the overhang structure in the canonical siRNA architecture or may be distributed in the sequence, and non-limiting examples thereof are shown in Hu et al., 2020. Modifications to RNA molecules include, but are not limited to blunt-ended siRNA, 25-27mer siRNA, single strand siRNA, short hairpin siRNA, dumbbell siRNA, asymmetric siRNA, short interspaced siRNA, hybrid between siRNA and antisense oligonucleotides (ASO). Other analogue nucleic acids may be contemplated include those with non-ribose backbones. In addition, mixtures of naturally occurring nucleic acids, analogues, and both may be made. Nucleic acids include but are not limited to DNA, RNA and hybrids where the nucleic acid contains any combination of deoxyribo- and ribo-nucleotides, and any combination of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, 5-methylcytidine, pseudouridine, etc. Modified 5' cap structures such as 3'-O-Me-m7G(5')ppp(5')G (anti-reverse cap analogue), may also be used for increased translation of mRNA. Nucleic acids include DNA in any form, RNA in any form, including triplex, duplex or single-stranded, antisense, siRNA, ribozymes, deoxyribozymes, polynucleotides, oligonucleotides, chimeras, and derivatives thereof.
[0038] In accordance with the cannon, length of a nucleic acid is expressed herein as the number of units from which a single strand of a nucleic acid is build. Because each unit corresponds to exactly one nucleobase capable of engaging in one base pairing event, the length is frequently expressed in so called "base pairs" or "bp" regardless of whether the nucleic acid in question is a single stranded (ss) or double stranded (ds) nucleic acid. In ss nucleic acids 1 bp usually corresponds to 1 nucleotide, abbreviated to 1 nt. For example, a ss nucleic acid made of 1000 nucleotides (or a ds nucleic acid made of two complementary strands each of which is made of 1000 nucleotides) is described as having a length of 1000 base pairs or 1000 bp, which length can also be expressed as 1000 nt or as 1 kilobase that is abbreviated to 1 kb. 2 kilobases or 2 kb are equal to the length of 2000 bp which equates 2000 nt in an ssRNA or ssDNA. To avoid confusion however, in view of the fact the nucleic acids as defined herein may comprise or consist of units not only chemically being nucleotides but also being functional equivalents thereof, the length of nucleic acids will preferentially be expressed herein in "bp" or "kb" rather than in the equally common in the art denotation "nt".
[0039] As used herein, an oligonucleotide (or simply “an oligo”) is to be construed as a relatively short nucleic acid, usually no longer than 500 bp, preferably no longer than 200 bp, i.e. in accordance with the above provided definition, being any polymeric molecule made of no more than 200 units, wherein each unit comprises a nucleobase or a functional equivalent thereof, which renders said oligonucleotide capable of engaging in nucleobase pairing under appropriate hybridisation conditions with DNA or RNA. Within the ambit of said definition, it will immediately be appreciated that the disclosed herein oligonucleotides can comprise or consist of units not only being from a purely chemical point of view nucleotides, but also units being synthetic equivalents thereof. In other words, from chemistry perspective, as used herein, the term oligonucleotide will be construed as possibly comprising or consisting of RNA, DNA, or one or more different or same nucleic acid analogues such as but not limited to LNA (BNA), PMO (Morpholino), PNA, GNA, TNA, HNA, FANA, FRNA, ANA, CeNA and / or the like.
[0040] The term “saponin" has its regular scientific meaning and refers to a chemical compound from a group of amphipathic glycosides that comprise one or more hydrophilic glycone moieties (usually arranged in chains containing at least one sugar group, but more frequently containing an often branched glycan chain of several sugar groups), which one or more glycone moieties are covalently bound to a lipophilic aglycone core of steroid or terpenoid structure that is termed sapogenin.
[0041] In the context of saponins, the terms “aglycone core”, “sapogenin”, and “aglycone core structure”, “aglycone glycoside core (structure)” are used interchangeably and in line with their scientifically accepted meaning in the field. Namely, these terms refer to the lipophilic part of a saponin, which part has a steroid or terpenoid structure and to which one or more glycone moieties are attached (these glycone moieties are sometimes also referred to as “glycone antennae” or “sugar antennae”).
[0042] The term “saccharide chain” or “carbohydrate chain” has its regular scientific meaning and here refers to any of a glycan, a carbohydrate antenna, a single saccharide moiety (monosaccharide) or a chain comprising multiple saccharide moieties (oligosaccharide, polysaccharide). The saccharide chain can consist of only saccharide moieties or may also comprise further moieties such as any one of 4E-Methoxycinnamic acid, 4Z-Methoxycinnamic acid, and 5-O-[5-O-Ara / Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid), such as for example present in QS-21.
[0043] The term “Api / Xyl-“ or “Api- or Xyl-“ in the context of the name of a saccharide chain has its regular scientific meaning and here refers to the saccharide chain either comprising an apiose (Api) moiety, or comprising a xylose (Xyl) moiety.
[0044] As it will be apparent from the present description, a specific group of saponins with an aglycone core of terpenoid structure will form part of the presented herein pharmaceutical combinations, compositions, formulations and therapeutic methods. Because of this aglycone core structure, the saponins are classified as penta-cyclic triterpene saponins which, in particular, comprise an aglycone core of 12,13-dehydrooleanane type. The chemical structure of this aglycone core type is schematically shown in a saponin presented in Scheme of SAPONIN A (in Detailed Description). Examples of aglycone cores of 12,13-dehydrooleanane type include saponin aglycone cores of quillaic acid and of gypsogenin, which in naturally-occurring forms in addition also contain an aldehyde function at position C-23 of the aglycone core. For example, quillaic acid is the aglycone glycoside core structure for SO1861, SO1832, AG1856.
[0045] A saponin may be naturally occurring or non-naturally occurring, e.g. modified during isolation process, partial degradation, chemical modification, or can be partially or entirely synthetic. Consequently, as used herein, the term “saponin” should be construed as referring to any glycoside compound (that is free or conjugated to another compound) as long as this glycoside compound comprises at least one hydrophilic glycone moiety that is covalently bound to a lipophilic aglycone core moiety of a steroid or terpenoid structure, regardless whether this glycoside compound is identical to a naturally-occurring saponin, or appears to largely correspond in structure to a naturally-occurring saponin but possesses at least one chemical group modification on either one of the glycone moiety or aglycone core moiety as compared to its corresponding naturally-occurring saponin, or is a glycoside compound that does not seem to correspond to any naturally-occurring saponin but by the above definition is a saponin, which could have been synthetically obtained through chemical and / or biotechnological synthesis routes and for this reason does not resemble any naturally-occurring saponin but still visibly comprises at least one hydrophilic glycone moiety that is covalently bound to a lipophilic aglycone core moiety of a steroid or terpenoid structure.
[0046] As already indicated above, as used herein, the term “saponin” shall be construed as encompassing: (i) non-conjugated (“free”) saponins, which are further referred to herein using a term “unconjugated saponin molecule” in the context of the disclosed herein saponin components of the pharmaceutical compositions and therapeutic methods; and (ii) saponins that are covalently conjugated to other compound types and, hence, form part of conjugates comprising at least one saponin as a saponin moiety of the conjugate, which saponin moiety is conjugated to an at least one non-saponin moiety such as a linker for further conjugation, or as an effector molecule like an oligonucleotide, or a targeting ligand recognised by a cell-surface receptor, for example an endocytic receptor etc. Hence, in the context of the disclosed herein saponin components of the therapeutic (pharmaceutical) combinations, compositions, formulations and therapeutic methods of the disclosure, such covalently conjugated saponins will be further referred to herein using a term “saponin moiety”, to discern them from the non-conjugated (“free”) saponins or “unconjugated saponin molecules”.
[0047] As used herein, the term “saponin component" refers to a component of a pharmaceutical combination, composition, formulation or of a therapeutic method (to be construed as synonymous to the term “method of treatment”), which component comprises a saponin as defined above. Consequently, saponin component can be present in the disclosed herein pharmaceutical combinations, compositions, formulations, or therapeutic methods in an unconjugated form (as used herein, as an “unconjugated saponin molecule”), or in a form that is covalently bound (conjugated) to at least one other chemical compound that is not a saponin, thus forming a part of a conjugate comprising the saponin (as used herein, as a “saponin moiety” of said conjugate) and the at least other chemical compound that is not a saponin (as used herein, as a “non-saponin moiety” of said conjugate).
[0048] For example, as used herein the ’’unconjugated saponin molecule” can correspond to a naturally-occurring saponin molecule found in or isolatable from natural sources, such as plant material, or can correspond to a non-naturally-occurring saponin molecule that has a chemical group modification as compared to the naturally-occurring saponin, which is a result of e.g. degradation and / or oxidation. In case such saponin molecule becomes covalently conjugated to another compound, for example a linker moiety that can be used for further conjugation steps, the saponin part of such formed conjugate will be referred to as a “saponin moiety”. For comparison, in case a saponin component comprises a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type and an acid sensitive covalent bond with one or several atoms and which bond can be seen as simply replacing the aldehyde function at position C-23 of the aglycone core for the reason that said one or several atoms cannot be further classified functionally (e.g. said one or several atoms are not a linker with a chemical group for further conjugation reactions; nor a ligand for binding a receptor) or structurally (e.g. said one or several atoms are not an oligonucleotide, a peptide, an oligosaccharide, etc.), in such a case, such saponin component could be further referred to using the term “saponin molecule” rather than the term “saponin moiety” depending on the specific context, which will be clear to the skilled person. If however such saponin component comprises a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type and an acid sensitive covalent bond with another functionally or structurally distinct non-saponin moiety (e.g. a linker, a ligand, an oligonucleotide, etc.), in such a case, such saponin will be further referred to using the term “saponin moiety” rather than the term “saponin molecule”. The above distinction will be clear to the skilled person and requires not further elaboration.
[0049] The term “Saponinum album” has its normal meaning and here refers to a mixture of saponins produced by Merck KGaA (Darmstadt, Germany) containing saponins from Gypsophila paniculata and Gypsophila arostii, containing SA1657 and mainly SA1641.
[0050] The term “Quillaja saponin” has its normal meaning and here refers to the saponin fraction of Quillaja saponaria and thus the source for all other QS saponins, mainly containing QS-18 and QS-21.
[0051] “QS-21” or “QS21” has its regular scientific meaning and here refers to a mixture of QS-21 A-apio (-63%), QS-21 A-xylo (-32%), QS-21 B-apio (-3.3%), and QS-21 B-xylo (-1.7%).
[0052] Similarly, “QS-21 A” has its regular scientific meaning and here refers to a mixture of QS-21 A-apio (-65%) and QS-21 A-xylo (-35%).
[0053] Similarly, “QS-21 B” has its regular scientific meaning and here refers to a mixture of QS-21 B-apio (-65%) and QS-21 B-xylo (-35%).
[0054] The term “Quil-A” refers to a commercially available semi-purified extract from Quillaja saponaria and contains variable quantities of more than 50 distinct saponins, many of which incorporate the triterpene-trisaccharide substructure Gal-(1^2)-[Xyl-(1^3)]-GlcA- at the C-3beta-OH group found in QS-7, QS-17, QS-18, and QS-21. The saponins found in Quil-A are listed in van Setten (1995), Table 2 [Dirk C. van Setten, Gerrit van de Werken, Gijsbert Zomer and Gideon F. A. Kersten, Glycosyl Compositions and Structural Characteristics of the Potential Immuno-adjuvant Active Saponins in the Quillaja saponaria Molina Extract Quil A, RAPID COMMUNICATIONS IN MASS SPECTROMETRY, VOL. 9,660-666 (1995)]. Quil-A and also Quillaja saponin are fractions of saponins from Quillaja saponaria and both contain a large variety of different saponins with largely overlapping content. The two fractions differ in their specific composition as the two fractions are gained by different purification procedures.
[0055] The term “QS1861” and the term “QS1862” refer to QS-7 and QS-7 api. QS1861 has a molecular mass of 1861 Dalton, QS1862 has a molecular mass of 1862 Dalton. QS1862 is described in Fleck et al. (2019) in Table 1, row no. 28 [Juliane Deise Fleck, Andresa Heemann Betti, Francini Pereira da Silva, Eduardo Artur Troian, Cristina Olivaro, Fernando Ferreira and Simone Gasparin Verza, Saponins from Quillaja saponaria and Quillaja brasiliensis: Particular Chemical Characteristics and Biological Activities, Molecules 2019, 24, 171; doi:10.3390 / molecules24010171]. The described structure is the api-variant QS1862 of QS-7. The molecular mass is 1862 Dalton as this mass is the formal mass including proton at the glucuronic acid. At neutral pH, the molecule is deprotonated. When measuring in mass spectrometry in negative ion mode, the measured mass is 1861 Dalton. Similarly, the terms “SO1903” and “SO1904” refer to the same saponin of Saponaria officinalis, as well as do “SO1831 ” and “SO1832”.
[0056] The terms “SO1861” and “SO1862” refer to the same saponin of Saponaria officinalis, though in deprotonated form or api form, respectively. The molecular mass is 1862 Dalton as this mass is the formal mass including a proton at the glucuronic acid. At neutral pH, the molecule is deprotonated. When measuring the mass using mass spectrometry in negative ion mode, the measured mass is 1861 Dalton.
[0057] The term “conjugate” has its regular scientific meaning and herein refers to at least a first molecule (further termed “first moiety”) that is covalently bound to at least a second molecule (“second moiety”), therewith forming a covalently coupled assembly comprising or consisting of the first moiety and the second moiety. Typical conjugates are an ADC, an AOC, and SO1861 -EMCH (EMCH linked to the aldehyde function of the aglycone glycoside core structure of the saponin, according to formula (I) (see below)). As used herein, the term “conjugate” is thus to be construed as a combination of two or more different moieties, which before the covalent conjugation, as used herein (purely to discern between the conjugated and unconjugated state), were referred to as the two or more molecules. For example, different moieties forming a conjugate as disclosed herein may include one or more saponins or saponin moieties with one or more ligands that bind to an endocytic receptor present on a surface of the target cells (herein being kidney cells and / or spleen cells), preferably wherein the ligand is e.g. one or more GalNAc moieties or an antibody or a binding fragment thereof, such as an IgG, a monoclonal antibody (mAb), a single domain antibody such as a VHH domain or another nanobody type, a bivalent nanobody molecule comprising two single domain antibodies, a camelid VH, or a humanized VHH with humanised a human (lgG1 -derived) Fc and / or humanized VHH-Fc antibody etc. In some instances, the disclosed herein conjugates may be made by covalently linking different moieties via one or more intermediary moieties such as linkers, for example for linking to a central or further linker. In a conjugate, not all of the two or more different moieties need to be directly covalently bound to each other. Different moieties in the conjugate may also be covalently bound by being both covalently bound to the same intermediary moiety such as a linker or each by being covalently bound to an intermediary moiety such as a further linker or a central linker wherein these two intermediary moieties such as two (different) linkers, are covalently bound to each other. According to this definition even more intermediary moieties such as linkers, may be present between the two different moieties in a conjugate, as long as there is a chain of covalently bound atoms in between.
[0058] As used herein, the term “ligand” is to be understood as any molecule that binds to or can be recognised by a another, usually bigger, molecule, most frequently - a receptor. A typical ligand will be proteinaceous but can also be or comprise a polysugar, i.e. contain or consist of one or more sugar moieties such as (1, 2, 3 or 4) GalNAc moieties.
[0059] The term “GalNAc” has its regular scientific meaning and refers to N-acetylgalactosamine and / or to the IUPAC name thereof: 2-(acetylamino)-2-deoxy-D-galactose. Ligands containing GalNAc are well known in the art and are usually employed for liver cell-targeting purposes for the reason of binding to the ASGPR1 receptor expressed on the liver cells. Consequently, ligands based on GalNAc are usually considered as liver cell-specific ligands and are not considered as kidney cell-specific ligands (cf Bhingardeve et al., 2020; Chan et al., 2005) although, as demonstrated by the data presented herein below, these ligands based on GalNAc appear to undergo endocytic uptake at the kidney cells as well ( / .e. can be considered as belonging to non-kidney cell specific ligand for kidney cells), possibly via multifunctional kidney endocytic receptors such as megalin and cubilin that are highly expressed at e.g. renal proximal tubules and that rescue a variety of ligands filtered from the blood including lipoproteins, vitamin-binding proteins, and various carriers, etc.
[0060] Proteinaceous ligands advantageously comprise or consist of an antibody or a fragment thereof; but they can also be or contain a protein, a peptide, a glycoprotein, or a fragment of any one thereof that, in the present context, is advantageously capable of being recognised by an endocytic receptor.
[0061] As used herein, the term “an endocytic receptor” is to be understood as any one of cell surface molecules, likely receptors or transporters that are accessible to their specific ligands from the external side or surface of cell membrane (also known as plasmalemma) and capable of undergoing internalisation via endocytic pathway e.g., upon external stimulation, such as ligand binding to the receptor. In some embodiments, an endocytic receptor can be internalized by clathrin-mediated endocytosis, but can also be internalized by a clathrin-independent pathway, such as, for example, phagocytosis, macropinocytosis, caveolae- and raft-mediated uptake or constitutive clathrin-independent endocytosis. In some embodiments, the endocytic receptor comprises an intracellular domain, a transmembrane domain, and / or (e.g., and) an extracellular domain, which may optionally further comprise a ligand-binding domain. In some embodiments, the endocytic receptor becomes internalized by the cell after ligand binding. In some embodiments, a ligand may be a specific-cell-targeting agent, for example a natural ligand (or a synthetic fragment thereof) or an antibody or a binding fragment thereof.
[0062] The term “proteinaceous” has its regular scientific meaning and refers to a molecule that is at least protein-like, meaning that the molecule possesses, to some degree, the physicochemical properties characteristic of a protein, is of protein, relating to protein, containing protein, pertaining to protein, consisting of protein, resembling protein, or being a protein. The term “proteinaceous” as used in for example ‘proteinaceous molecule’ refers to the presence of at least a part of the molecule that resembles or is a protein, wherein ‘protein’ is to be understood to include a chain of amino-acid residues at least two residues long, preferably at least 3, 4, 5, 6, 7, 8, 9, 10 residues long, thus including a peptide, a polypeptide and a protein and an assembly of proteins or protein domains. In the proteinaceous molecule, the at least two amino-acid residues are for example linked via (an) amide bond(s), such as (a) peptide bond(s). In the proteinaceous molecule, the amino-acid residues are natural amino-acid residues and / or artificial amino-acid residues such as modified natural amino-acid residues. In a preferred embodiment, a proteinaceous molecule is a molecule comprising at least two amino-acid residues, preferably between two and about 2.000 amino-acid residues. In one embodiment, a proteinaceous molecule is a molecule comprising from 2 to 20 (typical for a peptide) amino acids. In one embodiment, a proteinaceous molecule is a molecule comprising from 21 to 1.000 (typical for a polypeptide, a protein, a protein domain, such as an antibody, VHH, a Fab, an scFv, a ligand for a receptor such as EGF) amino acids. Preferably, the amino-acid residues are (typically) linked via (a) peptide bond(s). As disclosed herein, said amino-acid residues are or comprise (modified) (non-)natural amino acid residues.
[0063] As used herein, the term “antibody or a binding fragment thereof or a binding domain thereof’ refers to a polypeptide that includes at least one immunoglobulin variable domain or at least one antigenic determinant, e.g., paratope that specifically binds to an antigen. In some embodiments, an antibody is a full-length antibody. In some embodiments, an antibody is a chimeric antibody. In some embodiments, an antibody is a humanized antibody. However, in some embodiments, an antibody is a Fab fragment, a F(ab’) fragment, a F(ab')2 fragment, a Fv fragment or a scFv fragment. In some embodiments, an antibody is a nanobody derived from a camelid antibody or a nanobody derived from a shark antibody. In some embodiments, an antibody is a diabody. In some embodiments, an antibody comprises a framework having a human germline sequence. In another embodiment, an antibody comprises a heavy chain constant domain selected from the group consisting of IgG, IgG 1, lgG2, lgG2A, lgG2B, lgG2C, lgG3, lgG4, IgAI, lgA2, IgD, IgM, and IgE constant domains. In some embodiments, an antibody comprises a heavy (H) chain variable region (abbreviated herein as VH), and / or (e.g., and) a light (L) chain variable region (abbreviated herein as VL). In some embodiments, an antibody comprises a constant domain, e.g., an Fc region. An immunoglobulin constant domain refers to a heavy or light chain constant domain. Human IgG heavy chain and light chain constant domain amino acid sequences and their functional variations are known. With respect to the heavy chain, in some embodiments, the heavy chain of an antibody described herein can be an alpha (a), delta (D), epsilon (e), gamma (g) or mu (m) heavy chain. In some embodiments, the heavy chain of an antibody described herein can comprise a human alpha (a), delta (D), epsilon (e), gamma (g) or mu (m) heavy chain. In a particular embodiment, an antibody described herein comprises a human gamma 1 CH1, CH2, and / or (e.g., and) CH3 domain. In some embodiments, the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (g) heavy chain constant region, such as any known in the art. Nonlimiting examples of human constant region sequences have been described in the art, e.g., see U. S. Pat. No. 5,693,780 and Kabat E A et al, (1991) supra. In some embodiments, the VH domain comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identical to any of the variable chain constant regions provided herein. In some embodiments, an antibody is modified, e.g., modified via glycosylation, phosphorylation, sumoylation, and / or (e.g., and) methylation. In some embodiments, an antibody is a glycosylated antibody, which is conjugated to one or more sugar or carbohydrate molecules. In some embodiments, the one or more sugar or carbohydrate molecule(s) is / are conjugated to the antibody via N-glycosylation, O-glycosylation, C-glycosylation, glypiation (GPI anchor attachment), and / or (e.g., and) phosphoglycosylation. In some embodiments, the one or more sugar or carbohydrate molecule(s) is / are monosaccharides, disaccharides, oligosaccharides, or glycans. In some embodiments, the one or more sugar or carbohydrate molecule(s) is / are a branched oligosaccharide or a branched glycan. In some embodiments, the one or more sugar or carbohydrate molecule include(s) a mannose unit, a glucose unit, an N-acetylglucosamine unit, an N-acetylgalactosamine unit, a galactose unit, a fucose unit, or a phospholipid unit. In some embodiments, an antibody is a construct that comprises a polypeptide comprising one or more antigen binding fragments of the disclosure linked to a linker polypeptide or an immunoglobulin constant domain. Linker polypeptides comprise two or more amino acid residues joined by peptide bonds and are used to link one or more antigen binding portions. Examples of linker polypeptides have been reported (see e.g., Holliger, P, et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R. J., et al. (1994) Structure 2:1121-1123). Still further, an antibody may be part of a larger immunoadhesion molecule, formed by covalent or noncovalent association of the antibody or antibody portion with one or more other proteins or peptides. Examples of such immunoadhesion molecules include use of the streptavidin core region to make a tetrameric scFv molecule (Kipriyanov, S. M., et al. (1995) Human Antibodies and Hybridomas 6:93-101) and use of a cysteine residue, a marker peptide and a C-terminal polyhistidine tag to make bivalent and biotinylated scFv molecules (Kipriyanov, S. M., et al. (1994) Mol. Immunol. 31:1047-1058).
[0064] The term “single domain antibody”, or “sdAb”, in short, or ‘nanobody’, has its regular scientific meaning and here refers to an antibody fragment consisting of a single monomeric variable antibody domain, unless referred to as more than one monomeric variable antibody domain such as for example in the context of a bivalent sdAb, which comprises two of such monomeric variable antibody domains e.g. in tandem. A bivalent nanobody is a molecule comprising two single domain antibodies targeting epitopes on molecules present at the extracellular side of a cell, such as epitopes on the extracellular domain of a cell surface molecule that is present on the cell. Preferably the cell-surface molecule is a cell-surface receptor. A bivalent nanobody is also named a bivalent single domain antibody. Preferably the two different single domain antibodies are directly covalently bound or covalently bound through an intermediate molecule that is covalently bound to the two different single domain antibodies. Preferably the intermediate molecule of the bivalent nanobody has a molecular weight of less than 10,000 Dalton, more preferably less than 5000 Dalton, even more preferably less than 2000 Dalton, most preferably less than 1500 Dalton.
[0065] The term “antibody-oligonucleotide conjugate” or “AOC” has its regular scientific meaning and here refers to any conjugate of an antibody such as an IgG, a Fab, an scFv, an immunoglobulin, an immunoglobulin fragment, one or multiple VH domains, one or multiple single-domain antibodies, one or multiple VHH, one or more camelid VH, etc., and any polynucleotide (oligonucleotide) molecule that can exert a therapeutic effect when contacted with cells of a subject such as a human patient, such as an oligonucleotide selected from a natural or synthetic string of nucleic acids encompassing DNA, modified DNA, RNA, mRNA, modified RNA, synthetic nucleic acids, presented as a single-stranded molecule or a double-stranded molecule, such as a BNA, an antisense oligonucleotide (ASO, AON), a short or small interfering RNA (siRNA; silencing RNA), an anti-sense DNA, anti-sense RNA, etc.
[0066] As used herein, the term “covalently linked” refers to a characteristic of two or more molecules being linked together via at least one covalent bond, i.e. directly, or via a chain of covalent bonds, i.e. via a linker comprising at least one or more atoms.
[0067] The term “moiety” as used herein will usually refer to a molecule that is bound, linked, conjugated to a further molecule, linker, assembly of molecules, etc., and therewith forming part of a larger molecule, conjugate, assembly of molecules. Typically, a moiety is a first molecule that is covalently bound to a second molecule (second moiety), involving one or more chemical groups initially present on the first and second molecules. For example, when a saponin molecule is covalently linked via at least one linker to one or more GalNAc molecules, both the saponin molecule is a saponin moiety in the formed saponin-GalNAc conjugate and the GalNAc molecule(s) is / are a moiety / moieties in said conjugate. For example, a nucleic acid such as an antisense oligonucleotide, that is conjugated to an endocytic receptor binding ligand such as an antibody or one or more GalNAc molecules, is a nucleic acid moiety in the nucleic acid - GalNAc conjugate or in the nucleic acid - antibody conjugate.
[0068] As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0069] The terms first, second, third and the like in the description and in the claims, are used for distinguishing between for example similar elements, compositions, constituents in a composition, or separate method steps, and not necessarily for describing a sequential or chronological order. The terms are interchangeable under appropriate circumstances and the disclosed herein embodiments can operate in other sequences than described or illustrated herein, unless specified otherwise.
[0070] The term “comprising”, used in the claims, should not be interpreted as being restricted to for example the elements or the method steps or the constituents of a compositions listed thereafter; it does not exclude other elements or method steps or constituents in a certain composition. It needs to be interpreted as specifying the presence of the stated features, integers, (method) steps or components as referred to, but does not preclude the presence or addition of one or more other features, integers, steps or components, or groups thereof. Thus, the scope of the expression “a method comprising steps A and B” should not be limited to a method consisting only of steps A and B, rather with respect to the present disclosure, the only enumerated steps of the method are A and B, and further the claim should be interpreted as including equivalents of those method steps. The scope of the expression “a method comprising steps A and B” encompasses a method consisting of steps A and B, unless the context clearly requires otherwise. Thus, the scope of the expression “a composition comprising components A and B” should not be limited to a composition consisting only of components A and B, rather with respect to the present disclosure, the only enumerated components of the composition are A and B, and further the claim should be interpreted as including equivalents of those components. The scope of the expression “a composition comprising components A and B” encompasses a composition consisting of components A and B, unless the context clearly requires otherwise.
[0071] In addition, reference to an element or a component by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element or component are present, unless the context clearly requires that there is one and only one of the elements or components. The indefinite article "a" or "an" thus usually means "at least one".
[0072] The use of terms in brackets in the text, with the exception of chemical and / or mathematical formulae, usually means that the term within brackets specifies a possible option or a possible meaning and should thus not be considered limiting. The embodiments as described herein can operate in combination and cooperation, unless specified otherwise. Furthermore, the various embodiments, although referred to as “preferred” or “e.g.” or “for example” or “in particular” and the like are to be construed as exemplary manners in which the disclosed herein concepts may be implemented rather than as limiting.
[0073] For all Figures, “Figure” and “Fig.” refer to the same.
[0074] BRIEF DESCRIPTION OF THE DRAWINGS
[0075] Figure 1. In vivo co-administration of ligand-saponin with ligand-ASO#02 dose-dependently enhances the ASO-effector potency in kidney cortex and medulla. Relative ApoB expression analysis in mouse cortex and medulla 72 hr (A) and 336 hr (B) after intravenous administration of vehicle (DPBS), ASO#02 alone, ligand-ASO#02 alone or co-administration of ligand-ASO#02 with ligand-saponin. Data are shown as mean ± SEM, n=2-3. Legend to be read from top to bottom, which corresponds to the bars from left to right (for both (A) cortex and (B) medulla).
[0076] Figure 2. Administration of ligand-saponin-ASO#02 enhances the effector potency compared to ligand-ASO#02 treatment (without saponin component) in kidney cortex and medulla. Relative ApoB expression analysis in mouse cortex and medulla 72 hr (A) and 336 hr (B) after intravenous administration of vehicle (DPBS), ligand-ASO#02 or ligand-saponin-ASO#02. Data are shown as mean ± SEM, n=2-3.
[0077] Figure 3. Delayed ligand-saponin administration to ligand-siRNA causes an efficacy enhancement in NHP kidneys. Relative SERPINC1 expression in NHP kidneys at day 45 after subcutaneous administration of (i) ligand-siRNA (at day 1) or (ii) ligand-siRNA (at day 1) followed by ligand-saponin (at day 28). Data are shown as mean normalized expression (relative to TBP and DDX3X) ± SEM, n=1. In Figure 3 and 4 and Figure 10 and 11, Ligand-siRNA and Ligand-siAT3 refer to the same conjugate. Figure 4. Dose dependent efficacy enhancement of ligand-saponin co-administration to ligand-siRNA in NHP kidneys. Relative SERPINC1 expression analysis in NHP kidneys after 11-17 days of subcutaneous co-administration of ligand-saponin and ligand-siRNA, or 45 days of subcutaneous administration of ligand-siRNA alone. Data are shown as average mean normalized expression (relative to TBP and DDX3X) ± SD, n=1-2. In Figure 3 and 4 and Figure 10 and 11, Ligand-siRNA and Ligand-siAT3 refer to the same conjugate.
[0078] Figure 5. Administration of ligand-saponin-PMO enhances the effector potency compared to ligand-PMO treatment in kidney cortex and medulla. Average DMD exon 23 skipping in (A) mouse cortex and (B) medulla after intravenous administration of vehicle (DPBS), ligand-PMO or ligand-saponin-PMO. Data are shown as mean ± SEM, n=2-3. (C) Average DMD exon 23 skip in kidney cortex and medulla of CD-1 mice treated with vehicle (DPBS), aCD71 ligand-PMO or aCD71 ligand-SPT-PMO. Exon skip was determined by ddPCR at D14 after dosing, which shows that administration of ligand-saponin-PMO enhances the effector potency in kidney cortex and medulla two weeks after intravenous administration, which effect is not present in the ligand-PMO treated group. Data are shown as mean ± SEM, n=2-3 Figure 6. Non-kidney cell-specific ligand (GalNAc) conjugation to ASO#01 (in ligand-ASO#01) does not improve the ASO efficacy in HEK293-FT kidney cells compared to ASO#01 alone. Relative HSP27 expression in HEK293-FT cells upon treatment with a titration of ASO#01 or ligand-ASO#01.
[0079] Figure 7. Both saponin-compound and ligand-saponin co-administration enhance (ligand-)ASO#01 efficacy in HEK293-FT cells. (A) Relative HSP27 expression in HEK293-FT cells upon treatment with a titration of saponin-compound or ligand-saponin co-dosed with 100 nM ASO#01. (B) Relative HSP27 expression in HEK293-FT cells upon treatment with a titration of saponin-compound or ligand-saponin co-dosed with 100 nM ligand-ASO#01.
[0080] Figure 8. Saponin co-administration enhances ASO#01 and ligand-ASO#01 efficacy in HEK293-FT cells. Relative HSP27 expression in HEK293-FT cells upon treatment with a titration of saponin codosed with 100 nM ASO#01 or ligand-ASO#01.
[0081] Figure 9. Non-targeted ASO#02-saponin shows a high potency in mouse liver in vivo. Relative ApoB100 expression in mouse livers after intravenous administration of vehicle (DPBS), ASO#02 alone or ASO#02-saponin. Data are shown as mean ± SEM, n=3-6.
[0082] Figure 10. Co-dosing of saponin compound induces efficient reduction in serum AT3 protein level in non-human primates (NHPs). Serum AT3 level is shown of NHPs treated with (A) ligand-siAT3 administered alone, or ligand-siAT3 co-dosed with 0.3 mg / kg ligand-saponin at day 1, (B) ligand-siAT3 administered alone, or ligand-siAT3 co-dosed with 1 mg / kg ligand-saponin at day 1, and (C) ligand-siAT3 administered alone, or ligand-siAT3 co-dosed with 3 mg / kg ligand-saponin at day 1. Data are shown as mean ± SEM, n=1-2. In Figure 10 and 11 and Figure 3 and 4, Ligand-siAT3 and Ligand-siRNA refer to the same conjugate.
[0083] Figure 11. Delayed saponin component administration induces efficient reduction in serum AT3 protein level in non-human primates (NHPs). Serum AT3 level is shown of NHPs treated with ligand-siAT3 administered alone at day 1, or ligand-siAT3 at day 1 (indicated by the black arrow) followed by ligand-saponin at day 28 (indicated by the white arrow), n=1. In Figure 10 and 11 and Figure 3 and 4, Ligand-siAT3 and Ligand-siRNA refer to the same conjugate.
[0084] Figure 12. Saponin component does not activate NF-KB pathway. (A) Neither the saponin component ‘Cetux-DoL4 SPT’ (also referred to as ‘Cetuximab-SPT DoL4-l’), nor the control monoclonal anti-EGFR antibody cetuximab alone (‘Cetux’), induce activation of the NF-KB pathway in HEK293-FT cells incubated with the compounds for 5-6 hours. Cetux-DoL4 SPT is a covalent conjugate of cetuximab with 4 saponin moieties covalently bound to it as described in detail in international application W02020126627, page 98, line 1-3 and line 22-25, page 117, line 9-16, page 161, line 10-19, page 148, line 1-20, in conjunction with the figures 50, 60, 63 and 66A. “ug / ml” is dosage in microgram per millilitre. (B) The NF-KB pathway is activated in HEK293-FT cells in response to TNF-alpha (‘TNFa’), used as a positive control, whereas the negative control, cell-culture medium (‘Ct NT’) does not induce NF-KB pathway activation. (C) HEK293-FT cells transfected with the NF-KB-inducible luciferase reporter plasmid pGL4.32 are exposed to an increasing-concentration series of TNFa in the cell-culturing medium, resulting in activation of the NF-KB pathway. Read-out: luciferase luminescence following activated NF-KB-dependent induction of the luciferase reporter. (D) HEK293-FT cells are exposed to saponin component in the cell-culture medium, herein provided as a saponin moiety covalently conjugated with a linker via a hydrazone bond involving the C-23 aldehyde function of the saponin (‘SPT-AH (block)’), which does not result in activation of the NF-KB pathway; “uM” is dosage in micromoles. The synthesis of the saponin component is described in international application W02020126627, page 31, line 21-25, page 98, line 1-3, page 117, line 9-16, page 148, line 1-29, in conjunction with the figures 60, 61 B, 63 and 66A. (E) Neither the saponin component ‘SO1861’ (a saponin molecule), nor the saponin component ‘SPT-AH-Mal’ (conjugate of SO1861 with EMCH) induce activation of the NF-kB pathway in HEK293-FT cells incubated with the compounds for 5-6 hours. (F) The saponin components Cetuximab-SPT DoL4-l (a first batch), Cetuximab-SPT DoL4-ll (a second batch) and ‘GalNac-SPT DoL 1 (a conjugate comprising a GalNAc moiety and comprising a SO1861 moiety as described in international application WO2021261992, Figure 3 in conjunction with the Examples section relating to its synthesis), tested at a concentration of 10 microgram / ml dose, did not activate the NF-kB pathway, neither did Cetuximab (‘Cetuximab-hlgG1)’ and buffer control ‘Ct NT’, whereas the NF-KB pathway is activated in the HEK293-FT cells in response to a dose of 10 ng / ml TNFa (‘TNFa’). (G) None of the saponin components ‘OKT9-SPT DoL4’, an antibody binding to transferrin receptor (TfR) conjugated with SO1861, ‘SO1861’ (a saponin molecule) ‘SPT-AH-Mal’ (conjugate of SO1861 with EMCH), tested at a concentration of 10 microgram / ml dose, did activate the NF-kB pathway, neither did the anti-TfR antibody OKT9 and buffer control ‘Ct NT’, whereas the NF-KB pathway is activated in the HEK293-FT cells in response to a dose of 10 ng / ml TNFa (‘TNFa’).
[0085] Figure 13. Administration of different ligand-saponin-PMO conjugates enhances the effector potency compared to PMO and ligand-PMO treatment in kidney cortex and medulla in humanized, disease relevant hDMDdel52 / mdx mouse model. Data are shown as mean ± SEM, n=4 per group.
[0086] Figure 14. 3M12-lgG1 antibody binding to endogenous hTfR1 in HEK293FT cells.
[0087] Figure 15. Relative MALAT1 mRNA expression in HEK293FT cells after treatment with a titration of ASO-2, for 72 hr.
[0088] Figure 16. (A) Relative MALAT1 mRNA expression in HEK293FT cells after treatment with a titration of hCD71-SPT (also shown as aCD71-SPT) alone or hCD71-SPT + 200 nM ASO-2, for 72 hr. (B) Relative cell viability of HEK293FT cells after treatment with a titration of hCD71-SPT alone or hCD71-SPT + 200 nM ASO-2, for 72 hr.
[0089] Figure 17 Relative STAT3 mRNA expression in HEK293FT cells after treatment with a titration of ASO-1, for 72 hr.
[0090] Figure 18: (A) Relative STAT3 mRNA expression in HEK293FT cells after treatment with a titration of hCD71-SPT (also shown as aCD71-SPT) alone or hCD71-SPT + 200 nM ASO-1, for 72 hr. (B) Relative cell viability of HEK293FT cells after treatment with a titration of hCD71-SPT alone or hCD71-SPT + 200 nM ASO-1, for 72 hr.
[0091] Figure 19: Relative STAT3 mRNA splice switching in HEK293FT cells after treatment with a titration of PMO-1, for 72 hr. The arrow indicates the 1 micromolar PMO dose as applied in the experiment depicted in Figure 20.
[0092] Figure 20: (A) Relative STAT3 mRNA splice switching in HEK293FT cells after treatment with a titration of hCD71-SPT (also shown as aCD71-SPT) alone or hCD71-SPT + 1 μM PMO-1, for 72 hr. (B) Relative cell viability of HEK293FT cells after treatment with a titration of hCD71-SPT alone or hCD71-SPT + 1 μM PMO-1, for 72 hr.
[0093] Figure 21: Tolerability of GN3-SPT in mice at exaggerated doses: histopathology. Mice received a single subcutaneous dose of vehicle [DPBS] or GN3-SPT. (A) Liver histopathology. (B) Kidney histopathology. See Table 13 for clinical observations; gross necroscopy and histopathology description.
[0094] DETAILED DESCRIPTION
[0095] The innovative concepts as presented herein will be described in relation to particular aspects and embodiments of the disclosure, which should be regarded as descriptive and not as limiting the matter as described in the claims. The aspects and / or the embodiments as described herein can operate in combination and cooperation, unless specified otherwise. While the disclosed herein innovative concepts are described with reference to these aspects and / or embodiments, it is contemplated that alternatives, modifications, permutations and equivalents thereof will become apparent to one having ordinary skill in the art upon reading the specification in view of the drawings and / or graphs. The disclosed matter is not limited in any way to specific embodiments as illustrated herein, and changes to these embodiments should be construed as acceptable as long as they can be made without departing from the scope as defined by the appended claims.
[0096] Disclosed herein are therapeutic combinations, compositions, and formulations, as well as methods of treatment involving their administration, which comprise an oligonucleotide-based medicament that acts on an intracellular nucleic acid target in the kidney cells and / or in the spleen cells, and an endosomal-escape enhancing (EEE) saponin component that enables the effective release of said oligonucleotide-based medicament inside of the kidney cells and / or the spleen cells, thus allowing its use at a much lower and safer dose than it would be required in the absence of the EEE saponin component. As a consequence, the presented herein combinations of oligonucleotide-based medicaments and saponins enable effective modulation of gene expression in the kidney cells and / or the spleen cells, and, therefore, open new treatment options not only for kidney diseases, but also for diseases of other organs which affect the kidneys and / or which are affected by inefficient or impaired kidney function, and / or which possibly involve inflammation and / or undesired effects in the spleen.
[0097] Without wishing to be bound by any theory, the disclosed herein pharmaceutical combinations follow from an observation that a specific group of penta-cyclic triterpene saponins comprising an aglycone core of 12,13-dehydrooleanane type, appears to exhibit potent endosomal-escape enhancing properties. Saponins of this specific type were characterised and reported in e.g. W02020126620 as possessing an EEE activity towards various antibody-drug conjugates (ADCs) in several cancer cell lines. This group of saponins was further disclosed in W02020126626, W02020126627, WG2020126620, WG2020126627, WG2020126064, WG2020126604, WG2020126600, and W02020126609 as being capable of dramatically improving cancer treatment using oligonucleotide therapeutics, as demonstrated by enhanced by the saponin silencing of the HSP27 gene transcript, using HSP27-specific BNA-based oligonucleotide in different tumour models and cell lines. They were further shown in WG2020126610, WO2021261992, WO2021261992, WO2022055351, WO2022265493 as potentiating the effects of antisense oligonucleotides in the liver cells following GalNAc-mediated targeting of these cells with different therapeutic combinations of the oligonucleotide-based effector and the saponin. Lastly, they were also shown in WO2023121444, WO2023121445, and WO2023121446 to potentiate exon-skipping effects of therapeutic oligos in differentiated muscle cells.
[0098] As for the first time documented in the accompanying examples, following systemic administration in vivo, a therapeutic combination of an oligonucleotide-based medicament and a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type, not only underwent a successful co-delivery into the kidney cells without becoming fully eliminated by renal filtration or becoming unproductively trapped within kidney cells, but also it visibly resulted in sufficient oligonucleotide therapeutic bioavailability to induce its target silencing in the kidney without resulting in apparent signs of oligonucleotide-associated nephrotoxicity. The fact that the oligonucleotide-based medicament was so efficiently delivered from the circulation into the kidney cells in a productive manner even despite no kidney-specific targeting and at the low doses and as used in the experiments, was unexpected.
[0099] In line with these findings, in a first general aspect, provided herein is a therapeutic combination for use in the treatment and / or prevention of a human disease, the therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in kidney cells (and thereby to modulate gene expression in the kidney cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type; wherein the treatment and / or prevention comprises administration of the therapeutic combination to a human subject in the need thereof, wherein the saponin component and the oligonucleotide-based medicament are delivered to the kidney cells.
[0100] In a related general aspect, provided herein is a use of a therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in kidney cells (and thereby to modulate gene expression in the kidney cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type, for the manufacture of a medicament for the treatment and / or prevention of a human disease, wherein the treatment and / or prevention comprises administration of the therapeutic combination to a human subject in the need thereof, and wherein the saponin component and the oligonucleotide-based medicament are delivered to the kidney cells.
[0101] In a further general aspect, a method is provided for treating a human subject in the need of a treatment or prevention of a disease, the method comprising one or more steps of administration to the human subject of a therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in kidney cells (and thereby to modulate gene expression in the kidney cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type, whereby the saponin component and the oligonucleotide-based medicament are delivered to the kidney cells.
[0102] These general aspects are based on a serendipitous realisation that in the presence of the described herein saponin component, even at very low concentrations, a systemically (intravenously or subcutaneously) administered antisense oligonucleotide, which, even more surprisingly, was neither specifically targeted to the kidney or which was targeted by a non-kidney cell specific ligand (GalNAc, being a liver cell specific ligand), was able to effectively enter into the kidney cells without being eliminated by the renal filtration, and to act upon its nucleic acid target causing its silencing within the kidney cells, without causing apparent signs of nephrotoxicity such as deposition of basophilic granules which are believed to be indicative of unproductive entrapment of oligonucleotide therapeutics that eventually lead to nephrotoxicity. This finding is surprising and unexpected and opens exciting possibilities for treating or preventing diseases at the level of gene modulation within the kidney cells, which can be diseases affecting the kidneys (and possibly also other organs and / or systemic diseases) as well as kidney diseases wherein pathological symptoms are already observed within the kidney.
[0103] Kidney diseases are estimated to afflict about 37 million people in the United States and to incur treatment costs exceeding $130 billion annually (Imig at al., 2021). In general, the pathologies underlying kidney diseases are extremely complex, progress at different rates, and involve several cell types and cell signalling pathways (Imig at al., 2021), although many pathologies are also known to be caused by a monogenic mutation, in particular in paediatric subjects but also in adults (Connaughton et al, 2019). Major risk factors are hypertension, diabetes, and family history; and, once developed, kidney diseases are often associated with cardiovascular diseases and high morbidity and mortality (Loftus et al., 2021). Depending on the pathology and underlying aetiology, many types of kidney diseases and diseases that eventually affect the kidneys together with possibly other organs, are known. Notable types of kidney diseases include acute kidney injury (AKI), chronic kidney disease (CKD) and glomerulonephritis (GN, glomerular disease; GD), which all are associated with severe outcomes and often lead to dialysis and the need for kidney transplantation.
[0104] For example, causes for AKI can range from drug toxicity caused by anti-inflammatory, antibacterial, and immunosuppressant drugs, but also ischemia during thoracic surgeries, and septic infections (Scholz et al., 2021). The pathophysiology of AKI includes decreased blood and oxygen supply from systemic hypotension, systemic hypoxia, and disrupted regional oxygen delivery in the kidney. Signalling and metabolic pathways in renal tubular segments and epithelial cells that contribute to AKI include activation of hypoxia-inducible factor, activation of the peroxisome proliferator-activated receptor y (PPARY)-PPARY coactivator 1a (PGC-1a) pathway, mitochondrial signalling, and fructokinase activation (Basile et al., 2012). CKD is a long-term condition characterised by a persisting renal damage and a progressive and irreversible loss of kidney function due to progression to end-stage renal disease (ESRD; Lousa et al., 2021). It largely due to hypertension and diabetes that cause progressive renal damage via different cellular mechanisms (D’Agati et al., 2016) and is estimated to affect 10-14% of global population. A hallmark manifestation in different progressive CKDs is kidney fibrosis, characterized by excessive extracellular matrix deposition leading to scarring, tubule atrophy, interstitial chronic inflammation and glomerulosclerosis, and vascular rarefaction (Huang et al., 2023). Diabetic nephropathy results from oxidative stress, inflammation, mitochondrial dysfunction, and fatty acid metabolism that contributes to kidney fibrosis and impairs tubular transport, renal hemodynamics, and glomerular filtration (D’Agati et al., 2016). Glomerular diseases, such as GN, start because of a damage to the glomerulus that can then lead to renal damage outside the glomerular structure. Immune complexes and complement components, such as C3 and C5, lead to glomerular inflammatory cell infiltration (Holdsworth et al., 2016). Glomerular mesangial cells, podocytes, and endothelial cells become damaged, with increased extracellular matrix leading to glomerulosclerosis. Next, non-immune mechanisms result in progressive renal damage leading to interstitial fibrosis (Meng et al., 2014).
[0105] Although the mechanisms underlying CKD, AKI, and GN are quite distinct (Andrade-Oliveira et al., 2019), clinical evidence suggests that these conditions are inextricably linked to inflammation being their major pathogenic mechanism. The kidney harbours a variety of resident immune cells, which play an important role in the maintenance of tissue homeostasis. Dendritic cells (DCs), macrophages, regulatory T-cells (Tregs), CD8 positive T-cells, and NK lymphocytes, among other cell types, are in close contact with the kidney cells of the kidney parenchyma. Both resident and circulating immune cells can interact with the kidney cells of the parenchyma to trigger an inflammatory response when subjected to stress, causing irreversible tissue damage that will eventually end in kidney failure. Thus, targeting inflammation has been recognised as constituting a rational strategy in the management of inflammation linked kidney diseases like GN, CKD and AKI (Andrade-Oliveira et al., 2019).
[0106] In AKI, it was shown that in response to bacterial products or viral products and drug-induced toxicity, epithelial cells and endothelial cells of the kidney undergo necrosis or apoptosis, releasing products that can activate Toll-like receptors (TLR), NOD-like receptors (NLR), and NLPR3 inflammasome in immune cells and kidney cells. This activation leads to the production of chemokines and proinflammatory cytokines, which recruit monocytes and neutrophils to the organ. Concomitantly, resident immune cells (mainly dendritic cells) get activated and induce the proliferation of T-cells (TH1, TH17, and CD8 cytotoxic cells), which in turn produce cytokines, exacerbating the inflammation process (Andrade-Oliveira et al., 2019). Many inflammation-related genes have been identified to be involved in these processes. For example, it was shown that lack of TLR4, TLR2, and MyD88 limited renal damage in a sepsis model, mainly by decreasing the recruitment of neutrophils. In mice with cisplatin-induced AKI, it was shown that the presence of TLR4 was needed for the development of renal damage, in which process p38 MARK pathways appeared to be involved. Next, a mutation in the TLR4 gene was shown to result in a reduction in TLR4 receptor signalling that was sufficient to attenuate the response of kidney grafts to alarmins, hence limiting cytokine production, inflammation, and eventual organ failure. Similarly, it was shown that NOD2 knock-out (KO) and NOD1 / NOD2 double KO mice when subjected to renal ischemia, develop less renal inflammation and tubular cell apoptosis than wild-type mice, being thus protected from IRI (Andrade-Oliveira et al., 2019). It follows from the above that a blockade or inactivation of any one or more of TLR4, TLR2, MyD88, NOD1, and / or NOD2 could constitute a promising genetic target for the prevention or mitigation of AKI.
[0107] Furthermore, activation of renal TLR4 was shown not only to act locally but also on remote organs, contributing to induction of a state of systemic inflammation that considerably aggravates the clinical scenario. In general, inflammation initiated in the kidneys was shown to lead to the release of cytokines and chemokines to the circulation, resulting in dysfunction of distant organs such as the liver, the heart, the pancreas, and the spleen (Andrade-Oliveira et al., 2019). The same inter-relationship exists in the other direction; meaning that cytokines and chemokines released from these other organs under inflammatory stress will affect and cause the dysfunction in the kidney.
[0108] An organ whose function is in particular tightly linked to the regulation of inflammation in the body and in other organs under potential stress, is the spleen. As explained above, spleen shares a lot of functional and histological similarities with the kidney in the sense that it is also a highly vascularised blood filtering organ with fenestrated endothelia, which, in addition to its other functions in immunological pathogen recognition and red blood cells homeostasis, like the kidney, is responsible for the removal of many different compound types from the circulation (Cataldi et al., 2017). Furthermore, just like the kidney, spleen is a major site of oligonucleotide-based drug accumulation (Cartón-García et al., 2021), which appears to activate inflammatory responses within the spleen, which can affect other organs including the kidney and vice versa (Goyenvalle et al., 2023). In view of these facts, it is credible that the unexpected observations as presented herein and made in relation to the kidney, will equally well be applicable to the spleen.
[0109] In line with the above, in another general aspect, provided herein is a therapeutic combination for use in the treatment and / or prevention of a human disease, the therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in spleen cells (and thereby to modulate gene expression in the spleen cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type; wherein the treatment and / or prevention comprises administration of the therapeutic combination to a human subject in the need thereof, wherein the saponin component and the oligonucleotide-based medicament are delivered to the spleen cells.
[0110] In a related general aspect, provided herein is a use of a therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in spleen cells (and thereby to modulate gene expression in the spleen cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type, for the manufacture of a medicament for the treatment and / or prevention of a human disease, wherein the treatment and / or prevention comprises administration of the therapeutic combination to a human subject in the need thereof, and wherein the saponin component and the oligonucleotide-based medicament are delivered to the spleen cells.
[0111] In a further general aspect, a method is provided for treating a human subject in the need of a treatment or prevention of a disease, the method comprising one or more steps of administration to the human subject of a therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in spleen cells (and thereby to modulate gene expression in the spleen cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type, whereby the saponin component and the oligonucleotide-based medicament are delivered to the spleen cells.
[0112] Taken as a whole, there appears to be multiple potentially druggable nucleic acid targets involved in the pathologically-activated cell signalling pathways within the kidney cells and / or the spleen cells, which effective targeting by oligonucleotide-based drugs could have an enormous potential not only for treating kidney diseases but also for managing various disease originated at a different organ but affecting the kidneys, the different organ advantageously being the spleen.
[0113] In addition to the spleen, further exemplary organs whose pathological functioning is heavily implicated in the kidney metabolism are the liver, the pancreas, and the skeletal and / or the cardiac muscles. In line with the above, in an advantageous embodiment, therapeutic combinations, compositions, formulations, and methods as provided, wherein the human disease selected from any one or more of: a disease affecting the kidneys; a disease affecting the liver, a disease affecting the spleen, a disease affecting the pancreas, a disease affecting the skeletal and / or cardiac muscles and / or a disease affecting the heart, and / or a cardiovascular disease, preferably wherein the human disease is a disease affecting the kidneys. In a specific embodiment, the human disease is a kidney disease. Alternatively, in another embodiment, the human disease is a spleen disease.
[0114] The kidney is tightly physiologically and pathologically connected to the other visceral organs being the liver, the pancreas, and the spleen. Deficiency or a pharmaceutical intervention in one of these organs will frequently affect the remaining ones. With regard to the liver, CDK often occurs as a complication of viral hepatitis and many liver diseases coexist with CKD (Wong, 2011). Then, the established marker of cardiovascular disease and atherosclerosis, Apolipoprotein B (ApoB), whose full-length isoform (ApoB-100) is primarily and dominantly expressed in the liver, also correlates with renal dysfunction and is seen as a risk factor in several kidney diseases, notably in CKD (Xu et al., 2023; Mazidi et al., 2022) and ESKD (ESRD; Kwon et al., 2021). High serum ApoB levels were observed to precede the occurrence of CKD, which suggests that monitoring and reducing serum ApoB levels may provide an alternative method to prevent and treat CKD (Zhao et al., 2020). Lastly, it was reported that mammalian kidney can also express and secrete ApoB100 (although at levels much lower than the liver), which was hypothesised to play a role in attenuating excess storage of triglycerides in proximal tubule cells (Krzystanek et al, 2010). Another example of the close inter-relationship of the kidney and the liver is provided by the FDA-approved siRNA drug lumasiran (sold under the brand name Oxlumo) which is prescribed for a genetic condition known as primary hyperoxaluria type 1 (PH1). Lumasiran treats kidney stones and kidney failure caused by excessive amount of oxalate but it primarily acts not on the kidney but on the liver by targeting HAO1 mRNA in the hepatocytes, which results in lowering of glycolate oxidase (GO) enzyme and consequently also of urinary and plasma levels of oxalate. Regarding the pancreas, for example, acute pancreatitis is known to result in the kidneys not filtering waste from the blood, and AKI is a frequent complication of severe acute pancreatitis (Nassar & Qunibi, 2019). At the same time, pancreatitis is known to be a frequent and potentially severe complication in CKD patients (de Tersant et al., 2019). Lastly, regarding the spleen, which is a critical organ at the crossroad between bacterial infection and multi-organ dysfunction, it was shown by several studies to play an important role in sepsis-associated AKI and in AKI resulting from ischemia-reperfusion injury (IRI; Gigliotti and Okusa, 2014).
[0115] In a further embodiment of the disclosure, the human disease is a disease affecting the kidneys and involving inflammation, for example the human disease is a kidney disease involving inflammation, possibly associated with inflammation in the spleen and / or in the enlarged spleen (splenomegaly). In a further advantageous embodiment in accordance with the present disclosure, the human disease is a disease involving inflammation and affecting both the kidney and the spleen, such as, advantageously, rheumatoid arthritis (RA). RA is associated with an increased risk of potentially serious kidney disease, including kidney dysfunction and CKD (Oweis et al., 2020). Furthermore, splenic hyperfunction is observed in RA and in some subgroups of RA patients such as Felty syndrome. Splenectomy can significantly relief the symptom and, when performed early, can lead to bone preservation (Dong et al., 2009; Khanfar et al., 2019). For example, anti-TNF-a therapy is an effective treatment for rheumatoid arthritis and a spleen-specific suppression of TNF-a has been demonstrated with cationic hydrogel-delivered ASOs in the prevention of arthritis in animal models. TNF-a is known to be important in the function of the spleen as deficiency of TNF-a or TNFR resulted in splenic dysfunction and in abnormal tissue construction including the absence of splenic primary B-cell follicles, the lack of organized follicular dendritic cell networks and germinal centres (Dong et al., 2009), which indicates that specific suppression of TNF-a in the spleen will result in decreasing systemic inflammation and may be helpful in treating autoimmune diseases like RA and / or its symptoms related thereto present in or affecting the kidney.
[0116] The kidney also plays a central role in maintaining cardiovascular homeostasis and tends to be heavily affected by excess production of metabolic waste and protein-metabolism byproducts (such as nitrogenous waste) that occurs in malfunctioning skeletal and / or the cardiac muscles. The former can be seen e.g. during diabetes (Ayo et al. 1990) and the cardiovascular-kidney-metabolic (CKM) syndrome, while the latter effect is in particular visible in several muscular dystrophic disorders with Duchenne muscular dystrophy (DMD) perhaps being the most notable example (Wada et al., 2019). Renal dysfunction is a frequent complication in patients with, in particular, advanced DMD (Duan et al.
[0117] 2021). Consequently, DMD is a promising example of a disease affecting the kidney in which targeting kidney cells directly with oligonucleotide based-medicaments would appear likely to be beneficial for the patients through either improving the kidney elimination efficiency of metabolic by-products generated by the strained dystrophic muscles, or by inducing exon skipping in the mutated dystrophin transcripts directly in the kidney cells. The latter approach would seem supported by the fact that a dystrophin isoform Dp71 was recently reported to be highly expressed in the kidney and although its exact function there is not fully understood, it was suggested to play a role in the protection of renal epithelial cells (Duan et al. 2021). Of note, a crosstalk between the DMD-affected muscles and the spleen was also reported based on the proteomic analysis performed in mdx-4cv mice (Dowling et al., 2020).
[0118] In line with the above, it would seem beneficial to envisage a treatment modality in accordance with the present disclosure, wherein a mutated or a specific SNP-associated nucleic acid isoform could be targeted in the kidney cells and further simultaneously in another organ which is affect by said mutation or SNP. In an advantageous embodiment, such other organ could be the heart and / or the skeletal muscles, which could be simultaneously targeted for therapy in addition to a therapy aimed for acting within the kidney with a single oligonucleotide-based medicament. In the case of DMD, such medicament could possibly be an e.g. exon-skipping inducing oligonucleotide that would be designed to act both in the kidney cells and in the muscle cells following a systemic administration. Another good example of a kidney disease showing phenotype in other organs in the is Alport syndrome (also known as Alport’s disease), being a monogenic condition characterized by severe kidney disease, and also by hearing loss and eye abnormalities. Alport syndrome is caused by pathogenic variants in 3 genes encoding several a chains of collagen 4, namely, COL4A3, COL4A4, and COL4A5, and is the second most frequent cause of monogenic kidney disease after autosomal dominant polycystic kidney disease (ADPKD; Gillion et al., 2024). Another gene considered to be implicated in Alport syndrome is miR-21 and mouse studies showed that miR-21 silencing dramatically improved survival in Alport mouse model (Gomez et al., 2015). Of note, miR-21 is also known to be heavily implicated in liver diseases, and in chronic liver diseases in particular (Xue et al., 2024). The above examples show that due to the genetic complexity of diseases affecting the kidney and kidney diseases, development of therapeutics that could simultaneously act on mutated or SNPs-bearing nucleic acid both within the kidney cells and also within the cells of another organ could be highly beneficial for managing certain multiorgan-affecting syndromes.
[0119] Hence, in a further advantageous embodiment, therapeutic combinations, compositions, formulations, and methods as provided herein for use in the treatment and / or prevention of a disease affecting the kidneys and further affecting another organ selected from the liver, the spleen, the pancreas, the skeletal muscles, and / or the heart, preferably is a disease affecting the kidneys and the spleen, more preferably wherein the disease is selected from Duchenne muscular dystrophy (DMD), Alport syndrome, cardiovascular-kidney-metabolic (CKM) syndrome, primary hyperoxaluria; and diabetes such as type 2 diabetes mellitus; more preferably wherein the disease is DMD or Alport syndrome.
[0120] In an advantageous embodiment, therapeutic combinations, compositions, formulations, and methods are provided herein for use in the treatment and / or prevention of a human disease being a kidney disease. Examples of kidney diseases and drug-targetable nucleic acid targets involved in them and / or oligonucleotide-based therapeutics suitable for targeting such nucleic acids involved in such examples of kidney diseases are listed and / or referred to in Table I (summarising preclinical studies of kidney diseases) and Table II (listing selected details of known drug-development programmes including ongoing or terminated clinical studies related to kidney diseases), presented below.
[0121] Table I. Examples of preclinical studies targeting the kidney with oligonucleotide-based therapies.
[0122]
[0123]
[0124]
[0125]
[0126] Adapted from Cartón-García et al., Biomedicines. 2021 Mar; 9(3): 303.; the abbreviations are as follows: intravenous administration (IV); subcutaneous administration (SC); intraperitoneal administration (IP); renal artery administration (RA); retrograde renal vein administration (RV); renal parenchyma administration (RP); retrograde ureteral administration into the ureter or bladder (RU).
[0127] In a specific embodiment in accordance with the preceding one, the kidney disease is selected from any one or more of the kidney diseases listed and / or referred to in Table I and / or Table II, preferably being Table II, more preferably wherein the oligonucleotide-based medicament is selected from the corresponding therapeutic as listed in Table II (column 3) in connection to a specific kidney disease as listed Table II (column 2).
[0128] TABLE II: Exemplary drug development programs targeting the kidney
[0129]
[0130]
[0131]
[0132] Advantageously, the kidney disease for use in accordance with the present disclosure, is selected from any one or more of: Alport syndrome, APOL1 -Mediated Kidney Disease (also known as APOL1 -Associated Kidney Disease), acute kidney injury (AKI), chronic kidney disease (CKD), diabetic nephropathy (DN), unilateral ureteral obstruction (UUO), cardiovascular-kidney-metabolic (CKM) syndrome, glomerulonephritis (GN, glomerular disease; GD), glomerulopathy such as complement 3 (C3) glomerulopathy (C3G), cystic kidney disease such as glomerulocystic kidney disease (GCKD), medullary cystic kidney disease (MCKD), nephronophthisis, and / or polycystic kidney disease (PKD) including autosomal dominant polycystic kidney disease (ADPKD) or autosomal recessive polycystic kidney disease (ARPKD),in particular ARPKD associated with PKHD1 gene mutation, congenital abnormality of the kidneys and urinary tract (CAKUT), end stage renal disease (ESRD; end-stage kidney disease; ESKD) including paediatric end stage renal disease (ESRD), lupus nephritis, minimal change disease (MCD), renal vasculitis, amyloidosis including primary amyloidosis or dialysis-related amyloidosis, interstitial nephritis, thrombotic thrombocytopenic purpura (TTP), haemolytic uremic syndrome (HUS), atypical haemolytic uremic syndrome (aHUS), IgA nephropathy, membranous nephropathy, cystinosis, Fabry disease, focal segmental glomerulosclerosis (FSGS), Goodpasture syndrome, and granulomatosis with polyangiitis (GPA).
[0133] In a particular embodiment, therapeutic combinations, compositions, formulations, and methods of the disclosure are provided herein for use in the treatment and / or prevention of any one or more of: Alport syndrome, end stage renal disease (ESRD), acute kidney injury (AKI), APOL1 -Mediated Kidney Disease, and CKD. Advantageously, the kidney disease for use in accordance with the present disclosure, is selected from any one or more of: Alport syndrome, APOL1 -Mediated Kidney Disease, acute kidney injury (AKI) and chronic kidney disease (CKD), or optionally is selected from kidney diseases involving inflammation such as acute kidney injury (AKI), chronic kidney disease (CKD).
[0134] As it will be apparent to the skilled person, in the specific context of the present disclosure, the disease affecting the kidneys (preferably being a kidney disease) will advantageously be any disease that could be treated or ameliorated using a specifically designed oligonucleotide-based medicament that is able to act on a nucleic acid present in the kidney cells, and thereby is also able and adapted to modulate gene expression in the kidney cells. Many oligonucleotide-based medicaments for the abovelisted kidney-affecting and / or kidney diseases have been subject of and / or are currently being tested in preclinical studies and clinical trials and appear highly credible to be suitable for use in accordance with the present disclosure. Examples of oligonucleotide-based medicaments suitable for the presented herein therapeutic uses and which can belong to particular embodiments of the present disclosure are listed in or referred to in Table I (relating to preclinical studies); Table II (listing known drug development programs targeting the kidney), Table Illa (showing kidney-disease relevant therapeutics listed in GlobalData records in October 2024) and Table 11 lb (showing a selection of therapeutics that are directly or indirectly relating to kidney disorders). As it will be apparent to the skilled person, the targets mentioned in these tables are not exhaustive or limiting and other nucleic acid targets can equally well be suitable for the presented herein uses, provided they can be acted upon in the kidney cells by an oligonucleotide-based medicament. Additional exemplary potential targets are e.g. mentioned in Corridon 2023.
[0135] TABLE Illa: Kidney disease-relevant programs in GlobalData (status of October 2024)
[0136]
[0137]
[0138]
[0139] TABLE IIIb: Selected listing of drugs directly or indirectly relating to kidney disorders
[0140]
[0141]
[0142]
[0143] None of the above listed or referred to in Tables I, II, Illa, and lllb oligonucleotide-based medicaments have been approved to date, or at least not for acting at the level of kidney / spleen cells (only very few TTR-targeting oligonucleotide-based medications have been FDA approved for hATTR treatment but only for acting in liver and not kidney / spleen cells). Many are still undergoing studies or are currently under different stages of clinical trials and some have been discontinued and / or have failed the trials due to inactivity and or reported toxicity. Such reasons do not preclude the possibly that such discontinued and / or failed oligonucleotide-based medicaments will be therapeutically effective when provided in a therapeutic combination with the saponin component in accordance with the present disclosure, which, based on the presented herein data, appear to have an enormous potential for reducing the effective dose of such oligonucleotides while increasing their intracellular efficacy, which could improve the therapeutic window and eliminate the toxicity issues which could have led to the failure.
[0144] Hence, in a possible embodiment that is compatible with any one of preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament is adapted to target and bind to a nucleic acid molecule present in kidney cell selected from any one or more nucleic acid targets as listed or referred to in any one or more of the Tables I, II, Illa, and lllb.
[0145] In a related possible embodiment, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament is selected from any one or more of the therapeutics as listed or referred to in any one or more of the Tables I, II, Illa, and lllb.
[0146] Till March 2024, only 20 oligonucleotide-based medicaments have been approved but none of them intended to bind and target a nucleic acid target present in the kidney cells. Four of them are intended for the therapy of DMD but their ability to induce exon-skipping in the kidney and any potential therapeutic implications of such effect is not known. These are eteplirsen (Exondys 51), golodirsen (Vyondys 53), viltolarsen (Viltepso), and casimersen (Amondys 45). A further notable number of the FDA-approved oligonucleotide-based medicaments is also intended for acting at the level of liver cells but it has not been shown that they can also act within the kidney cells following their administration.
[0147] An example of a promising oligonucleotide-based medicament that has passed a phase II trial and is intended to target and bind a nucleic acid target that is present in kidney cells includes an siRNA compound teprasiran (QPI 1002 or I5NP) that was developed by Quark Pharmaceuticals for IV administration for the use in the prevention of AKI in high-risk patients and treatment of Delayed Graft Function (DGF) in kidney transplantation. Teprasiran was shown to accumulate in proximal tubular epithelial cells, where it was intended to inhibit p53 expression and thus, helps prevent cell death and kidney failure. Another promising oligonucleotide-based medicament example for the presented herein therapeutic uses would be an ASO targeting the transcript of the Sodium Glucose Cotransporter 2 (SGLT2) such as the lonis 2’-methoxyethyl (MOE)-modified ASO compound termed ISIS 388626 (Zanardi et al., 2012), which unfortunately failed after first-in-man trials due to unexpected renal effects (van Meer et al., 2017). It would appear that by lowering the dose of ISIS 388626 and increasing its efficacy in the kidney cells with the therapeutic combinations as presented herein, the effects that lead to the failure could be prevented.
[0148] In a possible embodiment, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament is capable of silencing a gene or disabling a gene product present in the kidney cells, preferably being any one or more of nucleic acid targets as listed or referred to in any one or more of the Tables I, II, Illa, and lllb, more preferably wherein the oligonucleotide therapeutic is selected from the group consisting of the therapeutics as listed or referred to in any one of the Tables I, II, Illa, and lllb, most preferably being or comprising teprasiran or ISIS – 388626.
[0149] As it will be apparent to the skilled person, the targeted nucleic acid does not have to be a protein-coding nucleic acid. In certain embodiments, targeting microRNAs (miRNAs) and long noncoding RNAs (IncRNAs) can also be envisaged and promising non-coding nucleic acid targets of potential therapeutic significance in kidney diseases are summarised in Bravo-Vázquez et al., 2024.
[0150] IncRNAs are widely expressed non-coding RNA molecules of more than 200 nucleotides in length. They were shown to regulate the expression of functional genes and to be involved in a variety of pathogenic conditions, including acute kidney injury.
[0151] A particularly promising IncRNA to target in kidney disorders is metastasis-associated lung adenocarcinoma transcript 1 (MALAT1). MALAT1 was found to be involved in acute kidney injury through involvement in the miR-204 / APOL1 pathway (Lu et al., 2021) and was also demonstrated to act as a sponge RNA for miR-145 that is involved in ZEB2 expression control, through which it has been liked to induction of epithelial to mesenchymal transition (EMT) as well as renal fibrosis (Nikooei et al., 2023). Induction of MALAT1 by N6-methyladenosine (m6A) was also shown to promote kidney fibrosis (He & Li, 2025). These and other findings show that targeting MALAT1 for downregulation with oligonucleotide therapeutics could be a promising therapeutic approach, if such oligonucleotides could be efficiently delivered into kidney cells. The presented herein findings make such therapies finally achievable.
[0152] In view of the above, in one possible embodiment, therapeutic combinations, compositions, formulations, or methods are provided herein for use in the treatment of MALAT1-mediated / -associated renal diseases. In a related embodiment, the therapeutic combinations, compositions, formulations, or methods of the disclosure are provided, wherein the oligonucleotide-based medicament targets MALAT1. In an advantageous embodiment, the renal diseases are selected from chronic kidney disease, acute kidney injury, renal fibrosis and diabetic nephropathy (DN). In another embodiment, the therapeutic combinations, compositions, formulations, or methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament targets MALAT1, preferably inhibits MALAT1. In a particularly preferred embodiment, the renal diseases are selected from diabetic nephropathy (DN), acute kidney injury and chronic kidney disease.
[0153] In a further embodiment that is compatible with any one of preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament targets a gene and / or gene transcript selected from: DMD / dystrophin gene, HSP27, ApoB, SERPINC1 (AT3), SGLT2, TP53 (P53), EGFP, MAPK1, P38A MAPK, P65 AQP1, SMAD4, COX2, CASPASE 3, FAS, TLR9, TGF-1B, C3, RELB, CD40, VEGF, KRAS, MTORC, RAGE MIR21, MIR192, MIR204, MIR107, MIR668, COL4A5, STAT3, and / or MALAT1; preferably DMD / dystrophin gene, HSP27, ApoB, SERPINC1 (AT3), SGLT2, TP53 (P53), COL4A5, STAT3, and / or MALAT1.
[0154] For example, signal transducer and activator of transcription-3 (STAT3) is a transcriptional factor that is involved in the innate immune response and sustaining inflammatory pathways, which is a key feature in the pathogenesis of many diseases, including various renal disorders. STAT3 is expressed in various renal tissues under these pathological conditions and has been shown to be involved in many renal pathologies, an overview of which can be found in Yu et al., 2023. This makes STAT3 a promising target for oligonucleotide-based therapies for these pathologies. For example, STAT3 expression in renal tubular epithelial cells contributes to the pathogenic mechanism of diabetic nephropathy (DN) in humans, and it has been shown inhibition of STAT3 in murine tubular epithelial cells prevents kidney fibrosis and nephropathy in diabetic mice (Zheng et al., 2019). Furthermore, STAT3 is considered to a critical mediator in the oncogenesis and progression of renal tumors, notably including renal cell carcinomas (RCC) (Guo et al., 2009). Interestingly, STAT3 alternative splicing modulation was shown to have antitumorigenic potential (Zammarchi et al., 2011), making splice-inducing therapeutic oligonucleotides an interesting approach to consider, provided they could be efficiently delivered into kidney cells. The presented herein findings make such therapies finally achievable.
[0155] In one embodiment, the therapeutic combinations, compositions, formulations, or methods are provided for use in the treatment of STAT3 mediated renal diseases. In a related embodiment, the therapeutic combinations, compositions, formulations, or methods of the disclosure are provided, wherein the oligonucleotide-based medicament targets STAT3. In an advantageous embodiment, the renal diseases are selected from diabetic nephropathy (DN), acute kidney injury, lupus nephritis, polycystic kidney disease, and renal cell carcinoma. In another embodiment, the therapeutic combinations, compositions, formulations, or methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament targets STAT3, preferably inhibits STAT3 and / or provokes alternative splicing modulation of STAT3. In a particularly preferred embodiment, the renal diseases are selected from diabetic nephropathy (DN), acute kidney injury, lupus nephritis, polycystic kidney disease, and renal cell carcinoma.
[0156] In brief and taken together, notable examples of oligonucleotide-based medicaments that appear to be particularly suitable and advantageous for therapeutic uses in accordance with the present disclosure and can be comprised in advantageous embodiments thereof include the following oligonucleotide-based medicaments: (i) ASO ISIS 388626 that selectively inhibits renal glucose reabsorption by inhibiting mRNA expression of SGLT2, which is suitable for use in the treatment of diabetes, such as type 2 diabetes mellitus;
[0157] (ii) siRNA teprasiran that temporarily inhibits p53-mediated cell death, which is suitable for use in the treatment of AKI;
[0158] (iii) anti-miR-21 lademirsen, which is suitable for use in the treatment of Alport syndrome; (iv) anti-miR-17 RGLS8429, which is suitable for use in the treatment of ADPKD;
[0159] (v) ASO IONIS-APOL1Rx targeting AP0L1 mRNA, which is suitable for use in the treatment of APOL1 -Associated Kidney Disease; and / or
[0160] (vi) exon skipping ASO-ENA targeting exon 21 of COL4A5 gene, which is suitable for use in the treatment of severe male X-linked Alport syndrome (XLAS; Yamamura et al., 2020).
[0161] In another embodiment that is related to the aspect of targeting a nucleic acid in the spleen cells and / or possibly related to an aspect of targeting a nucleic acid in the immune cells resident in the kidney, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament targets a gene and / orgene transcript selected from any one or more TNF-a, TNFR, TLR4, TLR2, MyD88, TLR4, TLR2, MyD88, NOD1, NOD2, preferably being TNF-a or TLR4.
[0162] As it will be evident from the above-listed examples, the oligonucleotide-based therapeutic can be designed to comprise or consists of a therapeutic oligonucleotide having any chemical-modifications as known in the art and engage in any functional role within the cell in a pathway leading to gene expression modulation (e.g. silencing, activation, RNA editing etc.) as known in the art. Hence, in an embodiment that is compatible with any one of preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament comprises a DNA-based therapeutic oligonucleotide and / or RNA-based therapeutic oligonucleotide and / or a nucleic acid analogue-based therapeutic oligonucleotide comprising one or more nucleotide or nucleoside analogues and / or backbone modifications, preferably selected from: DNA aptamer, DNA antisense oligonucleotide (ASO, AON), RNA ASO, siRNA, miRNA, RNA miRNA inhibitor (anti-microRNA, anti-miRNA, anti-miR) and / or RNA miRNA inhibitor ASO, RNA aptamer, ribozyme, RNA decoy, short hairpin RNA (shRNA), anti-hairpin-shaped microRNA; or mixed DNA / RNA therapeutic, preferably comprising one or more of the following analogues or modifications: phosphoramidate morpholino oligomer (PMO, Morpholino), peptide nucleic acid (PNA), phosphorothioate-modified antisense oligonucleotide (PS-ASO), antisense oligonucleotides containing phosphoryl guanidine (PN) backbone linkages (PN-ASO; PGO); 2'-O-methyl (2-OMe) phosphorothioate RNA, 2-O-methoxyethyl (2'-O-MOE) RNA (2’-O-methoxyethyl-RNA (2-MOE, MOE), locked nucleic acid (LNA, bridged nucleic acid, BNA; for example 2’-O,4’-aminoethylene bridged nucleic acid (BNA-NC), BNA-based siRNA, BNA-based antisense oligonucleotide (BNA-ASO), BNA-based anti-microRNA etc.), 2'-O, 4'-C-ethylene-bridged nucleic acid (ENA), 2’-deoxy-2’-fluoroarabino nucleic acid (FANA), 3’-fluoro hexitol nucleic acid (FHNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), more preferably wherein the oligonucleotide-based medicament comprises or consists of mixed DNA / RNA and / or synthetic nucleic acid therapeutic selected from: synthetic ASO, substantially DNA-based synthetic ASO, substantially RNA-based synthetic ASO preferably comprising 2 -MOE modification, substantially DNA-based synthetic aptamer, substantially RNA-based synthetic aptamer, synthetic gapmer, synthetic siRNA, synthetic miRNA, synthetic anti-miRNA and / or synthetic anti-miRNA ASO.
[0163] In a particular embodiment that is compatible with any one of preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the oligonucleotide-based medicament comprises an oligonucleotide therapeutic selected from an siRNA therapeutic or an antisense oligonucleotide (ASO) therapeutic, preferably comprising one or more nucleotide analogues and / or backbone modifications, for example comprising 2'-O, 4'-C-ethylene-bridged (ENA) or 2'-MOE nucleic acid modifications and / or phosphoryl guanidine (PN) backbone linkages (PN-ASO), more preferably being a mutation specific therapeutic, for example being a mutation specific ASO comprising one or more nucleotide analogues and / or backbone modifications, possibly designed to silence a gene implicated in the disorder and / or to induce exon skipping or induce oligonucleotide-directed RNA editing e.g. via ADAR-family enzymes (Bellingrath et al., 2023), or being a transcription factor decoy (TFD).
[0164] In general, therapeutic combinations in accordance with the present disclosure and comprising oligonucleotide-based therapeutics designed to target monogenic kidney diseases, appear very advantageous from their relatively straightforward targeting-strategy design perspective. Monogenic diseases are ideal targets for oligonucleotide-based medicaments and approximately 500 monogenic causes of chronic kidney disease (CKD) have been identified, mainly in paediatric populations (Connaughton et al., 2020). They often show symptoms like kidney fibrosis, hyperoxaluria, glomerulonephritis, and are frequently associated with high morbidity and resource utilisation. Many of them tend to progress to kidney carcinoma or end stage kidney disease (ESKD) and kidney failure.
[0165] Alport syndrome and XLAS were briefly discussed above. Autosomal dominant polycystic kidney disease (ADPKD) is caused by mutations in the PKD1 or PKD2 gene. The disease is characterised by the formation of kidney cysts that arise from the nephron and compress the surrounding normal renal parenchyma, which leads to kidney failure (Igarashi & Somlo, 2007). Like XLAS, Dent disease is a rare genetic X-linked kidney disorder; Dent disease type 1 is caused by a mutation in CLCN5 while Dent disease type 2 by mutations in the OCRL1; both genes located on the X chromosome. It is characterised by increased levels of calcium and spillage of small proteins in the urine, kidney calcifications (nephrocalcinosis), recurrent episodes of kidney stones (nephrolithiasis) and eventually CKD and eventually kidney failure. Cystinosis (MIM #219800 and #219900) is a lysosomal storage disease caused by recessive mutations in the CTNS gene coding for a proton-driven transporter cystinosin that exports cystine out of lysosomes. The accumulation of cystine leads to multisystemic complications including proximal tubular dysfunction (renal Fanconi syndrome, being the initial renal manifestation of cystinosis) and, most often, kidney failure. Cystinosis is in fact a prototype disorder of proximal tubular dysfunction and metabolic tubular injury (Bondue et al., 2023b; Chevalier 2014). Half of the affected individuals of Northern European descent are homozygous for a 57kb deletion at 17p13 and arising apparently through a founder effect (Gillion et al., 2024). A further example of a monogenic lysosomal storage disease is the X-linked Fabry Disease (FD) due to inactivating mutations in the GLA gene coding for the lysosomal enzyme alpha-galactosidase A. The enzymatic defect leads to the multisystemic accumulation of glycosphingolipids, especially globotriaosylceramide, causing CKD, hypohydrosis, skin lesions (angiokeratomas), cardiomyopathy with arrythmias, strokes, and small-fibre peripheral neuropathy, which shortens the life expectancy (Gillion et al., 2024).
[0166] Many potentially suitable oligonucleotide therapeutics have already been designed to target mutations in the above-mentioned nucleic acid targets of monogenic kidney diseases and could be readily included in therapeutic combinations in accordance of the present disclosure. For example, known oligonucleotide-based medicaments that could be used in the treatment in accordance with the present disclosure of e.g. Alport syndrome include lademirsen and Regulus RGLS8429.
[0167] Along these lines, in an advantageous embodiment of the present disclosure, the kidney disease is a monogenic kidney disease. Specific monogenic kidney diseases can preferably be selected from any one of more of Alport syndrome, autosomal dominant polycystic kidney disease (ADPKD), APOL1-Mediated Kidney Disease, Cystinosis, Dent disease, and Fabry Disease, more preferably being Alport syndrome such as severe male X-linked Alport syndrome (XLAS).
[0168] As the presented herein therapeutic combinations, compositions, formulations, and methods have the particular advantage of improved and effective release of the oligonucleotide-based medicament, another advantageous application thereof could relate to targeting viral nucleic acids present in the kidney cells. Viral infections are important causative agents in renal disease and are responsible for significant morbidity and mortality. Of particular interest are those viral infections with productive replication in the kidney, which often occur in immunocompromised hosts such as renal allograft recipients. Epstein-Barr virus, cytomegalovirus, adenovirus and polyomavirus (type BK) are prominent members of this group causing specific diseases. Renal disease associated with viral infections can either predominate in the cortex within the glomeruli (e.g. hepatitis C [HCV]) or preferentially within the tubulointerstitial compartment ( / .e. polyomavirus and hantavirus). General mechanisms that are involved in the development of kidney disease by viral infections include the following: (1) classical immune complex deposition; (2) direct cytopathic effects due to viral replication leading to cell death via cellular dysfunction; and (3) release of various mediators leading to inflammation, tissue injury and functional deterioration. The presented herein combinations can target endogenous kidney nucleic acids involved in any one or more of these processes and / or can directly target the underlying cause being the exogenous nucleic acid of the kidney-cell-infecting viral agent.
[0169] In line with this, in a further possible embodiment of the present disclosure, the targeted human disease is a kidney disease caused by a viral infection, preferably being viral infection caused by a virus replicating in the kidney cells and wherein the oligonucleotide-based medicament is adapted to target and bind to a nucleic acid molecule being a viral nucleic acid molecule present in the kidney cells. For example, the kidney disease can be caused by a polyomavirus such as BK virus and / or JK virus, or can be caused by Epstein-Barr virus, a cytomegalovirus, or an adenovirus. Advantageously, therapeutic combinations, compositions, formulations, and methods of the disclosure are provided wherein the kidney disease is caused by a polyomavirus, preferably a polyomavirus selected from BK virus and / or JK virus.
[0170] As explained above, the presented herein concepts were based on the observation that efficient renal delivery of oligonucleotide-based medicaments is possible following systemic administration in vivo in mice and NHP in the presence ofthe saponin component. In various advantageous embodiments of the presented herein therapeutic combinations, compositions, formulations, and methods, the administration is selected from intravenous administration (IV); subcutaneous administration (SC); intraperitoneal administration (IP); renal artery administration (RA); retrograde renal vein administration (RV); renal parenchyma administration (RP); retrograde ureteral administration into the ureter or bladder (RU). All of these administration routes have their advantages depending on the therapeutic aim and design. Feasibility of shRNA delivery via RP was demonstrated in vivo (Zhou et al., 2010). Direct anterograde infusion into the renal artery was shown to allow more specific targeting of the glomeruli and tubular epithelium, at least for gene therapy and more recently, renal artery injection of transforming growth factor (TGF)-pZSmad-small siRNA has been used for the treatment of glomerulonephritis and renal vein injection of FAS-siRNA for improving survival after ischemia / reperfusion injury in mouse models (Granata et al., 2023). Hence, although IP, RA, RV, RP; or RU administration types have mostly been used in preclinical studies to avoid the size restriction ofthe glomerular filtration barrier (Ahn, I., et al., 2023), they may be preferred if the intention would be to potentiate the therapeutic effect specifically within the kidney or specific parts thereof, and / or to limit exposure of other organs. However, given the promising safety data as discussed below, as intravenous administration (IV) or subcutaneous administration (SC) appear to perform well, and require less skill, for some applications they may be the preferred route of administration, especially when induction of therapeutic effects in other organs in addition to the kidney is also desired. Hence, in a specific embodiment, the administration is selected from IV and SC, most preferably is IV.
[0171] In some instances, attaining of higher and more kidney specific concentrations of the oligonucleotide-based medicament and / or the saponin can be desired, possibly with preference for specific kidney sub-compartments, structures, or cell types. Many kidney diseases such as AKI, diabetic nephropathy, CKD, FSGS, GN, and ESKD are considered to involve several kidney cell types, for example renal tubulointerstitial injuries including renal interstitial inflammation or fibrosis and tubular atrophy are the common result of kidney diseases and are crucial in the development of CKD and ESKD (ESRD). They can occur secondary to vascular and glomerular diseases, or primary to tubulointerstitial diseases, for example, AKI (Dolman et al., 2010; Grgic et al., 2012; Falke et al., 2015; Ramos et al., 2015). Overactivated immune system and oxidative stress play important roles in the pathogenesis of the diseases at many sites in the kidney. However, for many other diseases such as e.g. viral infections, there might be a preference for targeting a specific cell type of structure like the glomerulus or one or more parts of renal tubules.
[0172] The skilled person will be aware of gene expression patterns underlying different diseases and their location within the kidney and / or their cell-specificity, if known, and will be aware that different targeting strategies have been developed based on different oligonucleotide chemistries and use of targeting ligands and / or carriers. Consequently, the skilled person will be sufficiently equipped to develop therapeutic combinations in accordance with the present disclosure, to target a nucleic acid that is expressed in a specific structure or type of kidney cells.
[0173] Hence, in a possible embodiment of the presented herein therapeutic combinations, compositions, formulations, and methods, the oligonucleotide-based medicament binds to a nucleic acid present in kidney cells selected from kidney cortex cells or kidney medulla cells, preferably being nephron cells. Possibly, the kidney cells are the cells of the renal corpuscle and / or the tubule epithelial cells. Advantageously, the kidney cells are selected from glomerular mesangial cells (MCs), glomerular endothelial cells, (GECs), glomerular podocytes, proximal tubule epithelial cells (PTECs); and / or distal tubule epithelial cells (DTECs).
[0174] In another possible embodiment of the presented herein therapeutic combinations, compositions, formulations, and methods, the oligonucleotide-based medicament binds to a nucleic acid present in spleen cells, preferably selected from white pulp and / or marginal zone splenocytes, more preferably being selected from marginal zone macrophages, marginal zone dendritic cells, white pulp B-lymphocytes, white pulp T-lymphocytes, and white pulp macrophages; even more preferably being marginal zone macrophages or marginal zone dendritic cells, most preferably being marginal zone macrophages.
[0175] The skilled person will also know that the glomerulus has a glomerular filtration barrier setting a size limit of 6-7 nm that prevents the delivery of most oligonucleotide-based medicaments from the circulation; only oligonucleotides that are 3-6 nm (and are usually naked) can pass through it, unless glomerular injury is present. Consequently, the skilled person will know that siRNAs and AONs will in general be more likely to enter the cells of the renal tubule, which is divided into the proximal tubule, the loop of Henle, the distal tubule, and the collecting ducts. For example, the skilled person will know that phosphorothioate oligonucleotides appear to preferentially undergo receptor-mediated endocytosis in proximal tubules (Janssen et al, 2019) and that many reports suggest that systemically-delivered oligonucleotide therapeutics in general end up trapped in renal proximal tubule cells in the cortex (primarily, in the proximal tubule epithelial cells, PTECs), in in which the uptake is substantially higher than as observed in the kidney medulla (Goyenvalle et al., 2023).
[0176] In a related advantageous embodiment, in particular when targeting is desired, the disclosed herein therapeutic combinations, compositions, formulations, and methods, further comprise a ligand or a carrier, preferably a kidney cell specific ligand, or alternatively a scaffold acting as a (nano)carrier such as PAMAM dendrimers or PEG-based nanoparticles which appear to be preferentially captured by kidney cells depending on their size and charge (cf. Huang et al., 2021; Alallam et al., 2023; Chade and Bidwell 2022; Trac et al.,2023). The skilled person will be aware that the scaffolds’ / carries’ size and / or charges will have an influence on kidney cellular uptake, circulation half-life, and kidney targeting. The influence of the physicochemical properties (size, shape, charge, material types) of various carriers on their renal clearance and accumulation is summarised in Alallam et all. 2023).
[0177] The skilled person will in general know and take into consideration when designing particular components of the presented herein therapeutic combinations, especially when designing multi- molecule conjugates and considering targeting strategy for the kidney, that components of an average size of 100 nm have a longer half-life period than components of smaller sizes, which can be removed either by phagocytosis in the liver and spleen, or by renal excretion if they are smaller than 10 nm. The skilled person will also be aware that nanoparticles with sizes of approximately 75 ± 25 nm targeted the renal mesangium, whereas larger nanoparticles (>100 nm) cannot pass the glomerular filter.
[0178] In view of this knowledge, when considering a kidney targeting strategy for the presented herein combinations and components thereof, the skilled person will be aware to and will control the size of any ligand- and / or scaffold element that may be further comprised in the particular components of the presented herein therapeutic combinations.
[0179] Use of ligands is advantageous and, in many embodiments, it will be preferred over use of scaffolds, although either of these approaches or both could be combined in specific embodiments of the presented herein therapeutic combinations. In an advantageous embodiment, the disclosed herein therapeutic combinations, compositions, formulations, and methods, are provided, wherein the saponin component further comprises a first ligand recognised by a first endocytic receptor, and / or wherein the oligonucleotide-based medicament further comprises a second ligand recognised by a second endocytic receptor. As already explained, in certain embodiments, the second endocytic receptor possibly is the same as the first endocytic receptor. In further possible embodiments, the second ligand is the same as the first ligand. In other embodiments, the second endocytic receptor differs from the first endocytic receptor with the proviso that the two different endocytic receptors are both present on the same kidney cell or cells, or on the same spleen cell or cells.
[0180] In a possible embodiment in accordance with any of the preceding ones, the first ligand and / or the second ligand is / are a proteinaceous ligand, for example a naturally existing or artificial peptide or protein ligand or a receptor-interacting part thereof.
[0181] In view of the fact that the transferrin (Tf) receptor (CD71, TfR1) appears to undergo expression at the proximal tubules (Smith et al., 2019), in certain embodiments, the first ligand and / or the second ligand can be CD71 ligand(s). In other advantageous embodiments, in view of the abundant expression at the proximal tubules of two multiligand receptors that are known as megalin (LRP2) and cubilin (or rather: CUBAM, consisting of three cubilin proteins bound to a single transmembrane chaperone amnionless or AMN; Larsen et al., 2018), the first ligand and / or the second can be ligands for megalin and / or cubilin ligands.
[0182] Another example of cell-surface receptor is that was found to be expressed in the kidney cells is CD63 (also referred as cluster differentiation 63 or tetraspanin; Schröder et al., 2008)
[0183] Another cell surface receptor is parathyroid hormone receptor 1 R (PTH1R). PTH1R, was upregulated in chronic albuminuria in rats, with detectable expression on glomerular mesangial and endothelial cells, and abundant localization on proximal and distal tubular epithelial cells.
[0184] In an embodiment that is compatible with any one of preceding embodiments, therapeutic combinations, compositions, formulations, and methods are provided for the disclosed herein use, wherein the first endocytic receptor and / or the second endocytic receptor is / are a kidney-cell specific receptor and / or is / are selected from megalin (LRP2), cubilin, cluster differentiation 63 (CD63 or tetraspanin), parathyroid hormone receptor 1 R (PTH1R) and CD71 (transferrin receptor), preferably being selected from megalin and / or CD71.
[0185] Targeting megalin and cubilin is advantageous as they both are relatively kidney-specific endocytic receptors. Megalin is a low-density lipoprotein (LDL) receptor that is expressed in epithelial cells of the kidney but also in the intestine, and several other tissues (Nielsen et al., 2016). On the apical plasma membrane of proximal tubule cells, it can bind with cubilin and mediate the endocytosis of many types of low molecular weight molecules that escape the glomerular filtration barrier (Christensen and Birn, 2002; Lin et al., 2013; Oroojalian et al., 2017; Xu et al., 2020).
[0186] The cytoplasmic tails of megalin and AMN contain NPXY and NPXF motifs, respectively, that engage the clathrin adaptor protein Dab2 to enable endocytic uptake of the receptors via clathrin coated pits that form at the base of proximal tubule microvilli. After uncoating, endocytic vesicles fuse with apical early endosomes, where luminal acidification triggers ligand dissociation from their receptors. Ligands are retained within fluid-rich maturing endosomal compartments and ultimately delivered to lysosomes for degradation, while megalin and cubilin (CUBAM) are recycled to the apical membrane in tubular structures (Rbaibi et al., 2023).
[0187] As megalin and cubilin mediate the recovery of different types of low molecular weight proteins like albumin, peptides, and other primarily proteinaceous molecules from the glomerular filtrate at the proximal tubules (Eshbach and Weisz, 2017, Christensen et al., 2012), in certain embodiments, such low molecular weight moieties could be included in one or more, preferably both, components of the presented herein pharmaceutical combinations for proximal tubule targeting-purposes. Examples of such ligands are listed in Table IV below (and e.g. in Table 1 of Eshbach and Weisz, 2017).
[0188] Table IV. Ligand table for megalin and cubilin (adapted from Nielsen et al.,2016)
[0189]
[0190]
[0191] Trichosanthin Colistin
[0192]
[0193]
[0194] The skilled person will also be aware of other cellular targets and ligands and / or carriers like nanoparticles that allow targeting to specific kidney cell types as known in the art (Alallam et al., 2023).
[0195] Examples include but are not limited to use of targeting VCAM-1 receptor to target TNFalpha-activated podocytes (Alallam et al., 2023), and use of anti-E-selectin-specific antibodies to target glomerular endothelial cells, for use in the treatment of e.g. glomerulonephritis (Asgeirsdottir et al., 2008). Furthermore, the skilled person will know that to target glomerular mesangial cells inside of the glomerulus, the drug present in the circulation should be larger than 6 nm to prevent filtering by the urinary tract, but smaller than 70-90 nm to be captured in the glomerulus and pass through the endothelial fenestration (Ahn, L, et al., 2023). Consequently, it was attempted to target mesangial cells with naked siRNAs through administration via the renal artery (Ahn, I., et al., 2023). Alternative targeting approach for glomerular cells is by using a modified non-inhibitory plasminogen activator inhibitor 1R (PAI-1 R) as a ligand, although its cellular entry mechanism is not fully clear (Liu et al., 2022).
[0196] In a further embodiment that is compatible with any one of preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the first ligand and / or the second ligand is / are selected from:
[0197] - antibody or a binding fragment thereof binding to any one of the above-listed receptors;
[0198] - natural ligand or a fragment thereof recognised by any one of the above-listed receptors; and / or wherein the first ligand and / or the second ligand is selected from:
[0199] - megalin ligand, such as a megalin-specific antibody or a fragment thereof (anti-LPR2; preferably of a smaller format such as Fab, VHH, etc.) or any one or more of the megalin ligands listed in Table IV, e.g. EGF;
[0200] - cubilin ligand, such as such as a cubilin-specific antibody or a fragment thereof (preferably of a smaller format such as Fab, VHH, etc.) or any one or more of the cubilin ligands listed in Table IV, e.g. FGF;
[0201] - megalin and cubilin ligand such as any one or more of the megalin and cubilin ligands listed in Table IV, e.g. albumin;
[0202] - transferrin (Tf) or a fragment thereof as recognised by CD71 (Tf also being a cubilin ligand) - non-specific kidney ligand preferably comprising one or more GalNAc moieties, more preferably three GalNAc moieties. - VCAM 1 receptor ligand such as an antibody or a fragment thereof (preferably of a smaller format such as Fab, VHH, etc.)
[0203] - E-selectin-specific ligand such as an antibody or a fragment thereof (preferably of a smaller format such as Fab, VHH, etc.)
[0204] In a next embodiment, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the first ligand and / or the second ligand is / are selected from:
[0205] - megalin ligand, such as a megalin-specific antibody or a fragment thereof (anti-LRP2; preferably of a smaller format such as Fab, VHH, etc.) or any one or more of the megalin ligands listed in Table IV, e.g. EGF;
[0206] - cubilin ligand, such as a cubilin-specific antibody or a fragment thereof (preferably of a smaller format such as Fab, VHH, etc.) or any one or more of the cubilin ligands listed in Table IV, e.g. FGF;
[0207] - megalin and cubilin ligand, such as any one or more of the megalin and cubilin ligands listed in Table IV, e.g. albumin;
[0208] - transferrin (Tf) or a fragment thereof as recognised by CD71 (Tf also being a cubilin ligand)
[0209] Artificial peptide ligands for binding e.g. megalin are known {e.g. Durinova et al., 2024). One example is the (KKEEE)3K peptide ([Lys-Lys-Glu-Glu-Glu]3-Lys; SEQ ID NO: 43) which was shown to achieve targeted kidney delivery through megalin-mediated endocytosis of proximal tubule cells (Wang et al., 2018). Different variations of (KKEEE)3K peptides were shown to possess targeting performance for the kidney (Janzer etal., 2016; Wischnjow etal., 2016; Huang et al., 2020), and could also form part of certain specific embodiments of the present disclosure.
[0210] In another embodiment, therapeutic combinations, compositions, formulations, and methods are provided for the disclosed herein use, wherein the first endocytic receptor and / or the second endocytic receptor is / are expressed both on spleen cells and on resident immune kidney cells, or wherein the first endocytic receptor and / or the second endocytic receptor is / are a spleen-cell specific receptor and / or is / are selected from macrophage receptor with collagenous structure (MARCO), SIGN-R1, and DC-SIGN.
[0211] Many surface proteins expressed by macrophages and DCs are important endocytic receptors for delivery of ligands to intracellular compartments for targeted degradation or antigen processing. Situated in the marginal zone (MZ) of the spleen, MZ macrophages express the pattern recognition receptor macrophage receptor with collagenous structure (MARCO), being a class A scavenger receptor that binds apoptotic cells, as well as blood-borne pathogens. In an embodiment, therapeutic combinations, compositions, formulations, and methods are provided for the disclosed herein use, wherein the first ligand and / or the second ligand is / are a ligand of MARCO and / or anti-MARCO antibody or a MARCO-binding fragment thereof. In addition to MARCO, MZ macrophages express a C-type lectin SIGN-R1 endocytic receptor, which was reported to be differentially regulated as compared to MARCO after the MZ macrophage activation. Hence, in another embodiment involving targeting of splenocytes, a ligand of SIGN-R1 can be provided such as anti- SIGN-R1 antibody or a SIGN-R1-binding fragment thereof. In a further embodiment, a ligand could be provided targeting MZ dendritic cells, such as a ligand of DC-SIGN receptor which internalization motifs in the cytoplasmic tail strongly hint to a function of DC-SIGN as another endocytic receptor that is specific to MZ dendritic cells in the spleen.
[0212] In an advantageous embodiment, the first ligand and / or the second ligand is / are an antibody or a binding fragment thereof (such as a F(ab')2 fragment, Fab' fragment, Fab fragment, scFv, dsFv, scFv-Fc, reduced IgG (rIgG), minibody, diabody, triabody, tetrabody, Fc fusion protein, nanobody, variable V domain, a single-domain antibody (sdAb), preferably a VHH, for example camelid VH). Optionally, the first ligand and / or the second ligand comprise(s) one or more sugar moieties, preferably being or comprising GalNAc such as 1, 2, 3 or 4 GalNAc moieties, preferably 3 GalNAc moieties, which is a kidney cell non-specific ligand that targets asialoglycoprotein receptor (ASGPR) but appears to enter in the kidney cells (and therefore is also likely to enter in the spleen cells), as shown in the Examples section.
[0213] In another advantageous embodiment, the ligand is an antibody or a binding fragment thereof, such as a F(ab')2 fragment, Fab' fragment, Fab fragment, scFv, dsFv, scFv-Fc, reduced IgG (rIgG), minibody, diabody, triabody, tetrabody, Fc fusion protein, nanobody, variable V domain, a single-domain antibody (sdAb), preferably a VHH, for example camelid VH, or a humanized VHH with a human (IgG1 -derived) Fc and / or humanized VHH-Fc antibody, and preferably wherein the ligand is a humanized VHH-Fc dimer antibody.
[0214] In a more specific advantageous embodiment of the present disclosure, the saponin component is based on SO1861 saponin and the first ligand and / or the second ligand is / are selected from: albumin or EGF or a VHH-Fc antibody targeting CD71.
[0215] As it appears based on the data, that at least some oligonucleotide chemistries allow oligonucleotide-based medicaments to enter into kidney cells at least in proximal tubules, in a specific embodiment, therapeutic combinations, compositions, formulations, and methods of the invention are provided wherein the oligonucleotide-based medicament is not targeted, i.e. is not conjugated with a targeting ligand, and can be either provided in a conjugate with the saponin component in a form of a (non-targeted) saponin-oligonucleotide conjugate or can be provided as a non-targeted oligonucleotide-based medicament that is not conjugated with the saponin component, wherein the saponin component comprises a first ligand (i.e. is targeted with a first ligand) or is non-targeted, preferably is targeted.
[0216] On a related note, in a further general aspect, disclosed herein is a therapeutic combination for use in the treatment and / or prevention of a human disease, the therapeutic combination comprising an oligonucleotide-based medicament adapted to target and bind to a nucleic acid molecule present in liver cells (and thereby to modulate gene expression in the liver cells), and a saponin component comprising a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type; wherein the saponin component and the oligonucleotide-based medicament are delivered to the liver cells and / or wherein the saponin component is not conjugated with a ligand comprising GalNAc or another ligand known to bind the ASGPR receptor, preferably wherein the human diseases is a disease affecting the liver and / or a liver disease. The further general aspect is based on another also unexpected finding that a non-targeted ASO-saponin conjugate also showed a high potency in mouse liver in vivo (cf. Figure 9) despite not being conjugated to a GalNAc-comprising ligand. This data shows that conjugates for non-targeted delivery like non-targeted saponin-oligonucleotide conjugates that do not possess a specific ligand for a cell-surface endocytosing receptor present on hepatocytes, can still be considered for delivery and / or treatment of the liver as long as a saponin component is delivered or co-delivered with the oligonucleotide-based medicament to the liver cells.
[0217] The saponin component
[0218] The development of the presented herein advantageous combinations in accordance with all and any one of the aspects and embodiments as presented herein, was based on the surprising realisation that thanks to the inclusion of the endosomal-escape-enhancing saponin in the presented herein therapeutic combinations, an oligonucleotide-based medicament, such as a small interfering RNA (siRNA) or an antisense oligonucleotides (ASOs, also AONs), effectively enters into kidney cells following systemic delivery and binds to its target.
[0219] The “saponin component" as disclosed herein comprises a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type at their structure (also referred to as sapogenin or aglycone), usually shown as a penta-cyclic C30 terpene skeleton. Examples of such known saponins are shown in Table V.
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228] As it can be seen from Table V, naturally existing (unmodified) EEE saponins frequently comprise an aldehyde function at position C-23 of the saponin’s aglycone core structure. This notable feature can be seen in the exemplary chemical structure of such saponin that is schematically depicted below in the Scheme of SAPONIN A:
[0229]
[0230] (SAPONIN A)
[0231] Without wishing to be bound by any theory, it was observed that the presence of said aldehyde function (sometimes referred as “aldehyde group”; which in the present context should be construed as synonymous) can be particularly beneficial for the capacity of the saponin to stimulate and / or potentiate the endosomal escape of effector molecules, such as oligonucleotide-based medicaments. Hence, in an advantageous embodiment, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the penta-cyclic triterpene saponin further comprises
[0232] an aldehyde function at position C-23 of the aglycone core, or
[0233] an acid-sensitive covalent bond configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core, preferably wherein the acid-sensitive covalent bond is selected from any one or more of: hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, and preferably is a hydrazone bond.
[0234] As it can be appreciated from Table V, most of the naturally-occurring known penta-cyclic triterpene saponins comprising the aglycone core of 12,13-dehydrooleanane type and which also comprise the aldehyde function at position C-23 in their native or unconjugated form, are saponins for which the aglycone core is either quillaic acid or gypsogenin.
[0235] In line with this, it was observed that saponins comprising a quillaic acid aglycone or a gypsogenin aglycone core structure are particularly suitable for the purposes of the present disclosure. Hence, in an next embodiment, compatible with preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the penta-cyclic triterpene saponin comprises the aglycone core selected from quillaic acid, gypsogenin, and an aldehyde-substituted derivative of either one of quillaic acid or gypsogenin defined as a quillaic acid-based or gypsogenin-based aglycone core, respectively, wherein the aldehyde function at position C-23 is substituted by the acid sensitive covalent bond configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core,
[0236] preferably wherein the quillaic acid or the quillaic acid-based aglycone core is selected from:
[0237] AG1856, AG1, AG2, Agrostemmoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP- 017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP- 017773, NP-017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SG1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio and QS-21 B-xylo, or the aldehyde-substituted derivative of any one thereof, respectively; or
[0238] wherein the gypsogenin or the gypsogenin-based aglycone core is selected from:
[0239] SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP- 017888, NP-017889, NP-018108 and, SO1658, or the aldehyde-substituted derivative of any one thereof, respectively.
[0240] Saponins can comprise one or more saccharide chains attached to the aglycone core structure. Preferred saponins of the therapeutic combinations, composition, formulation, and methods for use according to the disclosure comprise a single chain ( / .e. are mono-desmosidic) or two chains ( / .e. are bis-desmosidic) attached to the aglycone core structure. In line with this, in another embodiment that is compatible with preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the penta-cyclic triterpene saponin is mono-desmosidic or bi-desmosidic, preferably comprising a first saccharide chain bound to a position C-3 of the aglycone core, more preferably wherein the first saccharide chain is selected from Group A listed in Table VI.
[0241] Table VI: GLYCANS
[0242]
[0243]
[0244] In an advantageous embodiment, the first saccharide chain comprises a glucuronic acid group, preferably being a terminal glucuronic acid group, such as wherein the first saccharide chain comprises: Gal-(1→2)-[Xyl-(1→3)]-GlcA.
[0245] In a particular embodiment, compatible with the preceding ones, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the penta-cyclic triterpene saponin is isolated from Saponaria officinalis, and is preferably any one or more of Saponarioside B, SO1542, SO1584, SO1658, SO1674, SG1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably any one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861.
[0246] Other possible optional and / or specific embodiments relating to different features of the saponin component are summarised in a section provided above the Examples.
[0247] In a specific embodiment, the saponin component as disclosed herein includes one or more unconjugated saponin molecules, and / or saponin molecules that have been conjugated and are further referred to as saponin moieties (purely to discern them from their unconjugated free molecule counterparts). In a possible embodiment, compatible with preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the saponin component comprises an unconjugated saponin molecule (defined as the penta-cyclic triterpene saponin that is not covalently conjugated to a non-saponin moiety, possibly wherein the saponin component consists of the unconjugated saponin molecule).
[0248] Saponin molecules that have been conjugated were experimentally shown to have certain advantages over unconjugated saponin molecules in e.g. showing improved efficacy and tolerability in vitro and in vivo. For example, compared to native SO1861, an engineered SO1861 that was ligated with a linker or a ligand (like GalNAc ligand) shows reduced haemolytic activity on red blood cells (RBCs), inducing haemolysis at a ~6-fold higher concentration (data not shown).
[0249] Hence, in a preferred embodiment, the saponin component comprises a saponin moiety that is covalently conjugated with at least one non-saponin moiety; preferably via an acid-sensitive covalent bond that breaks under acidic conditions, more preferably being an acid-sensitive covalent bond at the position C-23 of the aglycone core, even more preferably wherein the acid sensitive covalent bond at the position C-23 of the aglycone core is configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core thus resulting in a release of the penta-cyclic triterpene saponin comprising the aldehyde function at the position C-23 of the aglycone core from the non-saponin moiety. Advantageously, the acid-sensitive covalent bond is selected from any one or more of: a hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, preferably being a hydrazone bond. Alternatively, the saponin moiety can be covalently conjugated with the at least one non-saponin moiety by an acid-stable bond, advantageously via a glucuronic acid group if said group is present.
[0250] In a related embodiment, the non-saponin moiety comprises any one or more of:
[0251] a linker, advantageously a click chemistry linker,
[0252] the first ligand,
[0253] the oligonucleotide-based medicament of the therapeutic combination, and / or
[0254] a scaffold molecule,
[0255] advantageously, wherein the saponin moiety is directly covalently conjugated with the linker and / or wherein the linker comprises or is covalently conjugated to the saponin moiety via the acid sensitive covalent bond, advantageously at the position C-23 of the aglycone core, or via the acid-stable bond, such as at the glucuronic acid group if said group is present.
[0256] Advantageously, in certain embodiments, the linker is further covalently conjugated to the first ligand and / or to the an oligonucleotide-based medicament, possibly via the scaffold molecule, for example wherein the scaffold molecule is a multi-functional linker scaffold molecule or a polymeric scaffold molecule possibly comprising a dendron, such as a poly-amidoamine (PAMAM) dendrimer, or a polyethylene glycol, such as any of PEG3 - PEG30.
[0257] As used herein, the term scaffold molecule is to relate to a moiety of a conjugate which can serve as a scaffold for conjugating other moieties to a conjugate. In the present context, such scaffold molecule can be used for effectuating covalent linking between the saponin moiety, an effector moiety, and further possibly the first ligand. The linking to scaffold molecule can be effectuated either directly, or via the first, second, of any further linker.
[0258] Typical scaffold molecules as known in the art are based on an oligomeric or polymeric structure, frequently either being a dendron such as a poly-amidoamine (PAMAM) dendrimer, or a poly-ethylene glycol such as any of PEG3 - PEG30. In advantageous embodiments of the disclosure, any one of such scaffold molecules can be used. For example, it can advantageously be a polymeric or oligomeric structure being any one of PEG4 - PEG12 or any one of a G2 dendron, a G3 dendron, a G4 dendron and a G5 dendron, more preferably being a G2 dendron or a G3 dendron or a PEG3-PEG30. Dendrons appear particularly advantageous for the reason as they appear to be associated with advantageous properties from kidney-targeting perspective (Huang et al., 2021) but other scaffolds were also shown to potentially act as carriers for kidney -targeted delivery of medicaments (Alallam et al., 2023; Chade and Bidwell 2022; Trac et a / ., 2023), which was discussed above in the targeting context.
[0259] In another example, compatible with the above ones, a multi-functional linker can be used as a scaffold (termed above “multi-functional linker scaffold molecule”). A multi-functional linker scaffold molecule can be made from a trifunctional linker, such as the one shown by Structure A in the example below, here represented in non-conjugated form:
[0260]
[0261] (Structure A)
[0262] In a possible embodiment, a conjugate can be comprising 1-4 of such trifunctional linkers for every molecule of the targeting ligand comprised by the conjugate, more preferably being 1-2 trifunctional linkers, most preferably being 1.2 - 1.8. trifunctional linkers on average.
[0263] In a conjugated form, the trifunctional linker in its conjugated form is represented by Structure B:
[0264]
[0265] wherein:
[0266] S is the at least one saponin moiety,
[0267] L1 is a linker bound to the saponin moiety;
[0268] NA is the oligonucleotide-based medicament,
[0269] L2 is a linker bound to the oligonucleotide-based medicament;
[0270] A is one or more molecules of the first ligand, preferably being an antibody or a binding fragment thereof or at least one GalNAc moiety, preferably 3 GalNAc moieties,
[0271] L3 is a linker bound to the first ligand,
[0272] wherein L1, L2 and L3 are the same or different.
[0273] In a particularly advantageous embodiment, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the saponin moiety is covalently conjugated with the non-saponin moiety comprising the oligonucleotide-based medicament, which covalent conjugation results in a conjugate further termed a saponin-oligonucleotide conjugate, preferably wherein the saponin-oligonucleotide conjugate further comprises the linker, more preferably wherein the linker is directly covalently conjugated to the saponin moiety possibly wherein the saponin-oligonucleotide conjugate further comprises the first ligand (and is further termed targeted a saponin-oligonucleotide conjugate).
[0274] In possible embodiments, the targeted saponin-oligonucleotide conjugate comprises 1 - 16 saponin moieties and 1 - 5 molecules of the nucleic acid (also termed effector moieties) per 1 ligand moiety, preferably wherein the targeted saponin-oligonucleotide conjugate comprises 2 - 8 saponin moieties per 1 ligand moiety; preferably 3 - 6 saponin moieties per 1 ligand moiety; more preferably 4 - 5 saponin moieties per 1 ligand moiety; most preferably wherein the targeted saponin-oligonucleotide conjugate comprises on average 4-4.5 saponin moieties per 1 molecule of the ligand. In an advantageous further embodiment that is compatible with preceding embodiments, therapeutic combinations, compositions, formulations, and methods for the disclosed herein use are provided, wherein the administration comprises provision to the human subject of the oligonucleotide-based medicament and of the saponin component which are either co-formulated in a single pharmaceutical composition, or which are formulated separately as at least two pharmaceutical formulations that can be administered either simultaneously or sequentially, preferably, wherein first the second pharmaceutical formulation is administered and subsequently the first pharmaceutical formulation is administered after an interval of at least 1 day, preferably at least one week, more preferably at least one month, most preferably at least 3-6 months, wherein the first pharmaceutical formulation comprises the saponin component and wherein the second pharmaceutical formulation comprises the oligonucleotide-based medicament.
[0275] Possibly, in certain embodiments, the administration is further followed after an interval of at least 1 day, preferably at least one week, more preferably at least one month, most preferably at least 3-6 months, with a boosting administration of the saponin component that is further referred to as a booster, e.g. when the at least two pharmaceutical formulations are previously administered simultaneously. We have observed that such booster performed with the saponin component (the boosting saponin component) results in an extension of the duration of effects of the oligonucleotide-based medicament and / or in an extension of the dosing interval and / or in a reduction of the dosing frequency of the oligonucleotide-based medicament and / or a (delayed) potentiation of its therapeutic effects.
[0276] Possibly, the booster comprises an unconjugated saponin molecule or a saponin moiety covalently conjugated with the non-saponin moiety being at least the linker or at least the first ligand or at least the linker and the first ligand. In certain embodiments, the boosting application can be performed at a site of the administration or at another administration site, and / or using the same mode of administration (e.g. IV or SC).
[0277] In possible embodiments, the interval is at least 1 day after the administration, preferably at least 2 days, at least 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, or at least 6 months after the administration.
[0278] In certain embodiments, the booster can be applied directly into the kidney (e.g. into the parenchyma or renal artery etc.) or can be applied IV or SC. In a particular embodiment, the booster can be performed at a site of the administration, or if the administration involved application at multiple sites, the boosting application can be made in one of these sites.
[0279] In case of multiple sites of the administration or repeated administrations or in case of the administration encompassing multiple partial administrations, e.g. wherein the administration involves provision of two or more pharmaceutical formulations as separate and possibly timed doses, the site of the administration is to be construed as at least one of the sites of the administration. In a next embodiment, compatible with preceding embodiments, the administration comprises provision of the single pharmaceutical composition selected from any one or more of the following:
[0280] 2-component free-saponin formulation, defined as comprising the saponin component consisting of the unconjugated saponin molecule and wherein the 2-component free-saponin formulation further comprises the oligonucleotide-based medicament that possibly comprises a second ligand recognised by a second endocytic receptor;
[0281] 2-component linker-saponin formulation defined as comprising the saponin component comprising the saponin moiety, wherein the saponin moiety is covalently conjugated with the linker; wherein the 2-component linker-saponin formulation further comprises the oligonucleotide-based medicament that possibly comprises a second ligand recognised by a second endocytic receptor;
[0282] 2-component targeted-saponin formulation defined as comprising the saponin component comprising the saponin moiety, wherein the saponin moiety is covalently conjugated with the first ligand, and preferably wherein the non-saponin moiety comprises the linker; and wherein the 2-component targeted-saponin formulation further comprises the oligonucleotide-based medicament that possibly comprises the second ligand;
[0283] 1 -component formulation defined as comprising the saponin-oligonucleotide conjugate, possibly wherein the saponin-oligonucleotide conjugate further comprises the first ligand ( / .e. is the targeted saponin-oligonucleotide conjugate).
[0284] The presented herein below data shows that a co-treatment with a 2-component linkerformulation comprising a targeted saponin-component (exemplified by SO1861 conjugated with a GalNAc-comprising ligand moiety) strongly improved the potency of a targeted oligonucleotide-medicament (exemplified by an ASO also conjugated with a GalNAc-comprising ligand moiety such as GN3 (reference is made to the Examples section)), by at least two to three orders of magnitude. The improvement was also observed in a 1 -component formulation setting comprising a saponin-oligonucleotide conjugate and / or a targeted saponin-oligonucleotide conjugate (1 -component system with the ASO covalently conjugated with SO1861 or with the ASO covalently conjugated with SO1861 also further conjugated to a ligand, such as a GalNAc-comprising ligand GN3) as well as in coadministration setting of the 2-component system, with all systems having at least a 10 to 100-fold safety margin. Together, the data showed below demonstrated that a co-administration is a safe treatment option which results in a 10-fold potency improvement as compared to oligonucleotide-based medicament when provided without the saponin component.
[0285] In a next embodiment, compatible with preceding embodiments, the administration comprises provision of the at least two pharmaceutical formulations comprising a combination of the first pharmaceutical formulation with the second pharmaceutical formulation selected from any one or more of the following:
[0286] non-targeted combination defined as comprising
[0287] the first pharmaceutical formulation, wherein the saponin component does not comprise a ligand and preferably comprises or consists of the unconjugated saponin molecule and / or the saponin wherein the saponin moiety is covalently conjugated with the linker, and the second pharmaceutical formulation, wherein the oligonucleotide-based medicament does not comprise a ligand;
[0288] targeted-effector combination defined as comprising
[0289] the first pharmaceutical formulation, wherein the saponin component does not comprise a ligand and preferably comprises or consists of the unconjugated saponin molecule and / or the saponin moiety, wherein the saponin moiety is covalently conjugated with the linker, and
[0290] the second pharmaceutical formulation, wherein the oligonucleotide-based medicament comprises the second ligand;
[0291] targeted-saponin combination defined as comprising
[0292] the first pharmaceutical formulation, wherein the saponin component comprises the saponin moiety, wherein the saponin moiety is covalently conjugated with the first ligand, and preferably wherein the non-saponin moiety comprises the linker, and
[0293] the second pharmaceutical formulation, wherein the oligonucleotide-based medicament possibly comprises the second ligand.
[0294] In sum, as disclosed herein, the saponin component is:
[0295] a penta-cyclic triterpene saponin of the 12,13-dehydrooleanane type;
[0296] preferably comprising an aldehyde function at position C-23 of the aglycone core, or an acidsensitive covalent bond configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core, preferably wherein the acid-sensitive covalent bond is selected from any one or more of: a hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, and preferably is a hydrazone bond;
[0297] mono-desmosidic or bi-desmosidic, preferably bi-desmosidic; and / or
[0298] comprising a first saccharide chain bound to its aglycone core structure, selected from Group A listed in Table VI and / or comprising a second saccharide chain bound to its aglycone core structure, selected from Group B listed in Table VI, and preferably a first saccharide chain and a second saccharide chain are comprised by the saponin molecule or saponin moiety: and / or is:
[0299] preferably comprising a first saccharide chain bound to position C-3 of its aglycone core structure, selected from Group A listed in Table VI, wherein preferably said first saccharide chain of the saponin molecule comprises a glucuronic acid group or optionally said first saccharide chain of the saponin moiety comprises a glucuronic acid group; and / or preferably comprising the first saccharide chain which comprises a terminal glucuronic acid residue and / or comprising the second saccharide chain which comprises at least four sugar residues in a branched configuration; and / or
[0300] preferably comprising the first saccharide chain Gal-(1 -^2)-[Xy l-(1 -^3)]-GlcA and / or a branched second saccharide chain of at least four sugar residues comprising a terminal fucose residue and / or a terminal rhamnose residue, preferably selected from Table VI; and / or preferably comprising a first saccharide chain at position C-3 of the saponin’s aglycone core structure and / or a second saccharide chain at position C-28 of the saponin’s aglycone core structure, preferably wherein the first saccharide chain is a carbohydrate substituent at the C- 3beta-OH group of the saponin’s aglycone core structure and / or wherein the second saccharide chain is a carbohydrate substituent at the C-28-OH group of the saponin’s aglycone core structure; and / or
[0301] optionally comprising at least one acetoxy (Me(CO)O-) group in the first saccharide chain and / or in the second saccharide chain, preferably in the second saccharide chain; and / or comprising an aglycone core structure selected from:
[0302] quillaic acid;
[0303] gypsogenin;
[0304] 2alpha-hydroxy oleanolic acid;
[0305] 16alpha-hydroxy oleanolic acid;
[0306] hederagenin (23-hydroxy oleanolic acid);
[0307] 16alpha,23-dihydroxy oleanolic acid;
[0308] protoaescigenin-21(2-methylbut-2-enoate)-22-acetate;
[0309] 23-oxo-barringtogenol C-21,22-bis(2-methylbut-2-enoate);
[0310] 23-oxo-barringtogenol C-21 (2-methylbut-2-enoate)-16,22-diacetate;
[0311] 3, 16,28-trihydroxyoleanan-12-en;
[0312] gypsogenic acid; and
[0313] a derivative thereof; and / or
[0314] preferably comprising an aglycone core structure selected from quillaic acid, gypsogenin, and a derivative thereof; and / or
[0315] preferably comprising the aglycone core structure quillaic acid; and / or
[0316] selected from any one or more of the saponins listed in Table V (above);
[0317] and / or is:
[0318] a) selected from any one or more of list A:
[0319] - Quillaja saponaria saponin mixture, or a saponin isolated from Quillaja saponaria, for example Quil-A, QS-17-api, QS-17-xyl, QS-21, QS-21A, QS-21 B, QS-7-xyl;
[0320] - Saponinum album saponin mixture, or a saponin isolated from Saponinum album',
[0321] - Saponaria officinalis saponin mixture, or a saponin isolated from Saponaria officinalis; and - Quillaja bark saponin mixture, or a saponin isolated from Quillaja bark, for example Quil-A, QS-17-api, QS-17-xyl, QS-21, QS-21 A, QS-21 B, QS-7-xyl; or
[0322] b) comprising a gypsogenin aglycone core structure and is selected from list B:
[0323] SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP- 017888, NP-017889, NP-018108 and SO1658; or
[0324] c) comprising a quillaic acid aglycone core structure and is selected from list C:
[0325] AG1856, AG1, AG2, Agrostemmoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP- 017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio and QS-21 B-xylo; or
[0326] d) comprising a 12, 13-dehydrooleanane type aglycone core structure without an aldehyde group at the C-23 position of the aglycone and is selected from list D:
[0327] Aescin la, aescinate, alpha-Hederin, AMA-1, AMR, AS6.2, AS64R, Assamsaponin F, dipsacoside B, esculentoside A, macranthoidin A, NP-005236, NP-012672, Primula acid 1, saikosaponin A, saikosaponin D, Teaseed saponin I and Teaseedsaponin J, preferably, any one or more selected from list A, B or C, more preferably, selected from list B or C, even more preferably selected from list C; and / or
[0328] any one or more of AG1856, GE1741, a saponin isolated from Quillaja saponaria, Quil-A, QS- 17, QS-21, QS-7, SA1641, a saponin isolated from Saponaria officinalis, Saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832 having a formula according to formula ‘SO1832'
[0329]
[0330] SO1832
[0331] , SO1861 having a formula according to formula ‘SO186T
[0332]
[0333] SO1861
[0334] , SO1862 and SO1904, preferably any one or more of QS-21, SO1832, SO1861, SA1641, AG1856 and GE1741, more preferably AG1856, SO1832 or SO1861, most preferably SO1861 or SO1832; and / or
[0335] a saponin isolated from Saponaria officinalis, preferably any one or more of Saponarioside B, SO1542, SO1584, SO1658, SO1674, SG1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably any one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861; and / or
[0336] a saponin molecule, wherein the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C-3 of the aglycone core structure of the saponin molecule is transformed into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) as shown for SO1861 in formula (3):
[0337]
[0338] or a saponin molecule having a formula according to one of the following formulas (9)-(12):
[0339]
[0340]
[0341]
[0342] In certain preferred embodiments, the saponin comprises a glucuronic acid group in the carbohydrate substituent at the C-3beta-0H group, and preferably the saponin is selected from the group consisting of (refer to Table V for the structural details): NP-017777, NP-017778, NP-017774, NP-018110, NP-017772, NP-018109, NP-017888, NP-017889, NP-018108, SA1641, AE X55, SO1658, gypsoside A, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, AG1, NP-003881, NP-017676, NP-017677, NP-017706, NP-017705, NP-017773, NP-017775, SA1657, AG2, GE1741, SO1542, SO1584, SO1674, SG1700, Saponarioside B, SO1730, SO1772, SO1832 (protonated SO1831; also referred to as Saponarioside A), SO1861 (deprotonated SO1862), SO1862 (protonated SO1861; also referred to as Sapofectosid), SO1904, QS-7 (also referred to as QS1861), QS-7 api (also referred to as QS1862), QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio, QS-21 B-xylo, QS-21, Agrostemmoside E (also referred to as AG1856 or AG2.8), NP-005236, NP-012672, beta-Aescin (described: Aescin la), Aescinate, Teaseed saponin I, Teaseedsaponin J, Assamsaponin F, Primula acid 1.
[0343] In certain preferred embodiments, the saponin does not comprise an aldehyde function linked to the C-4 atom of the aglycon core structure, and preferably the saponin is selected from the group consisting of (refer to Table V for the structural details): NP-005236, AMA-1, AMR, alpha-Hederin, NP-012672, beta-Aescin (described: Aescin la), Aescinate, dipsacoside B, esculentoside A, Teaseed saponin I, Teaseedsaponin J, Assamsaponin F, Primula acid 1, AS64R, Macranthoidin A, saikosaponin A, saikosaponin D, AS6.2.
[0344] In certain preferred embodiments, the saponin comprises a glucuronic acid group in the carbohydrate substituent at the C-3beta-OH group and the saponin does not comprise an aldehyde function linked to the C-4 atom of the aglycon core structure, and preferably the saponin is selected from the group consisting of (refer to Table V for the structural details): NP-005236, NP-012672, beta-Aescin (described: Aescin la, Aescinate, dipsacoside B, esculentoside A, Teaseed saponin I, Teaseedsaponin J, Assamsaponin F, Primula acid 1, Macranthoidin A, saikosaponin A, saikosaponin D. In some particular embodiments, possibly compatible with preceding ones, pharmaceutical combinations for the disclosed herein use can be provided, wherein one, two or three, preferably one or two, more preferably one, of:
[0345] an aldehyde function in the aglycone core structure of the at least one saponin has been derivatised when present,
[0346] a carboxyl group of a glucuronic acid moiety in a first saccharide chain of the at least one saponin has been derivatised when present in the at least one saponin, and
[0347] at least one acetoxy (Me(CO)O-) group in a second saccharide chain of the at least one saponin has been derivatised if present.
[0348] In more particular embodiments, pharmaceutical combinations for the disclosed herein use can be provided wherein the at least one saponin comprises:
[0349] i. an aglycone core structure comprising an aldehyde function which has been derivatised by:
[0350] - reduction to an alcohol;
[0351] - transformation into a hydrazone bond through reaction with N-e-maleimidocaproic acid hydrazide (EMCH) wherein the maleimide group of the EMCH is optionally derivatised by formation of a thioether bond with mercaptoethanol;
[0352] - transformation into a hydrazone bond through reaction with N-[B-maleimidopropionic acid] hydrazide (BMPH) wherein the maleimide group of the BMPH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or
[0353] - transformation into a hydrazone bond through reaction with N-[K-maleimidoundecanoic acid] hydrazide (KMUH) wherein the maleimide group of the KMUH is optionally derivatised by formation of a thioether bond with mercaptoethanol; or
[0354] ii. a first saccharide chain comprising a carboxyl group, preferably a carboxyl group of a glucuronic acid moiety, which has been derivatised by transformation into an amide bond through reaction with 2-amino-2-methyl-1,3-propanediol (AMPD) or A / -(2-aminoethyl)maleimide (AEM); or Hi. a second saccharide chain comprising an acetoxy group (Me(CO)O-) which has been derivatised by transformation into a hydroxyl group (HO-) by deacetylation; or
[0355] iv. any combination of two or three derivatisations i., ii. and / or Hi., preferably any combination of two derivatisations of i., ii. and Hi.
[0356] In a specific embodiment, pharmaceutical combinations for the disclosed herein use is provided wherein the aldehyde function in position C-23 of the aglycone core structure of the at least one saponin is covalently bound to linker EMCH, which EMCH is covalently bound via a thio-ether bond to a sulfhydryl group in the oligomeric molecule or in the polymeric molecule of the covalent saponin conjugate, such as a sulfhydryl group of a cysteine.
[0357] Binding of the EMCH linker to the aldehyde group of the aglycone of the saponin results in formation of a hydrazone bond. Such a hydrazone bond is a typical example of a cleavable bond under the acidic conditions inside endosomes and lysosomes.
[0358] When the saponin component comprises the saponin moiety, the saponin moiety is any one of the here-above defined saponin molecules with covalently bound thereto: a linker, such as a linker suitable for covalently binding the saponin molecule to a further molecule, wherein the linker comprises or is for example:
[0359] a. a polyethylene glycol (PEG) with a length of any number between 2 and 60 (PEG2, PEG3, PEG4, PEG5, PEG6, PEG7-PEG10, PEG11-PEG25, PEG25-PEG50, etc.)
[0360] b. a peptide;
[0361] c. a linear or branched or cyclic alkyl, a linear or branched or cyclic alkenyl, a linear or branched or cyclic alkynyl;
[0362] d. a polymeric structure or an oligomeric structure, for example:
[0363] wherein the polymeric or oligomeric structure is selected from:
[0364] i. poly- or oligo(amines), such as polyethylenimine and poly(amidoamine), ii. polyethylene glycols,
[0365] Hi. poly- or oligo(esters), such as poly(lactids),
[0366] iv. poly (lactams),
[0367] v. polylactide-co-glycolide copolymers,
[0368] vi. poly- or oligosaccharides, such as cyclodextrin and polydextrose, vii. poly- or oligo(amino acids), such as proteins, peptides and polylysine, and viii. DNA oligomers or polymers, RNA polymers, stabilized RNA polymers and PNA (peptide nucleic acid) polymers, and / or
[0369] ix. dendron of type G2, G3, G4 or G5;
[0370] a linker, such as a linker as hereabove defined, with a further molecule covalently bound to the linker
[0371] wherein said further molecule is any one or more of:
[0372] a. a further linker, such as a linker as hereabove defined; and / or
[0373] b. an effector moiety, wherein the effector moiety is an oligonucleotide-based medicament and / or
[0374] c. a ligand for binding to an endocytic cell-receptor,
[0375] wherein the ligand is a proteinaceous ligand or a non-proteinaceous ligand or a combination thereof, preferably wherein the ligand is a proteinaceous ligand, and for examples is:
[0376] a. a protein ligand capable of binding to a(n) endocytic cell-surface receptor, which binding results in internalization of the protein ligand;
[0377] b. an antibody, wherein the antibody is defined as an immunoglobulin (Ig) or a functional binding fragment or binding domain thereof.
[0378] The saponin component is suitable for passive or active transfer from outside a cell to inside said cell. Moreover, the saponin is suitable for transfer from outside a cell into said cell, being the transfer in the endosomes of said cell. The saponin component is suitable for entry into a cell upon binding of a ligand for binding to an endocytic cell-receptor, bound to the saponin moiety comprised by the saponin component, to said endocytic cell receptor, via endocytosis. Upon binding of the ligand, endocytosis occurs and the saponin component is delivered in the endosomes of the cell bearing the cell receptor. Notable examples of such cell-surface receptors are megalin and cubilin, that are multifunctional endocytic receptors expressed in the kidney. Another suitable endocytosing cell-surface receptor is CD71.
[0379] When the proteinaceous ligand comprised by the saponin component (and suitable for binding to an endocytic cell-surface receptor) is an antibody, the antibody is for example selected from IgG, IgM, IgE, IgA, or IgD, or any antigen-binding fragment thereof, preferably is selected from a monoclonal antibody, polyclonal antibody, human antibody, humanized antibody, chimeric antibody, resurfaced antibody, anti-idiotypic antibody, mouse antibody, rat antibody, rat / mouse hybrid antibody, llama antibody, llama heavy-chain only antibody, heavy-chain only antibody, a molecule comprising or consisting of a VHH domain, a VH domain (for example camelid VH), a humanized VHH with a human (lgG1 -derived) Fc and / or humanized VHH-Fc antibody a Fab, an scFv, an Fv, monomeric Vhh-Fc type antibody (e.g. wherein Vhh is from camelid origin, preferably alpaca; the Fc is from human origin and is engineered to prevent Fc-gamma receptor binding), a single domain antibody (sdAb), an F(ab)2, Fcab fragment. A monoclonal antibody and a Fab and a single sdAb or a string of covalently linked sdAb’s is preferred.
[0380] The linker covalently bound to the saponin molecule, forming the saponin component comprising the saponin moiety and the linker (and in some embodiments a ligand covalently bound to the linker), is in preferred embodiments covalently bound to the saponin via a bond that is cleavable under conditions present in the endosome of mammalian cells, for example human cells. Such cleavable bond is for example subject to cleavage under acidic, reductive, enzymatic and / or light-induced conditions; preferably wherein the cleavable bond is selected from:
[0381] • a bond subject to cleavage under acidic conditions such as a hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond,
[0382] • a bond susceptible to proteolysis, for example amide or peptide bond, preferably subject to proteolysis by Cathepsin B;
[0383] • a red / ox-cleavable bond such as a disulfide bond, or a thiol-exchange reaction-susceptible bond such as a thio-ether bond
[0384] preferably being an acid-sensitive bond subject to cleavage in vivo under acidic conditions present in endosomes and / or lysosomes of human cells, preferably at pH 4.0 - 6.5, and more preferably at pH < 5.5; more preferably being an acid-sensitive bond selected from any one or more of: a hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, even more preferably selected from a hydrazone bond and a semicarbazone bond; most preferably being a hydrazone bond.
[0385] In a further embodiment, the saponin component comprises a glucuronic acid function with a carboxylic acid functional group in a carbohydrate substituent at the C-3beta-OH group of the saponin, wherein the carboxylic acid functional group is transformed into an active ester.
[0386] In a next embodiment, the saponin component comprises a glucuronic acid function with a carboxylic acid functional group in a carbohydrate substituent at the C-3beta-OH group of the saponin, wherein the carboxylic acid functional group is transformed into an active ester upon binding of a linker to said carboxylic acid functional group.
[0387] In an embodiment, a ligand as hereabove defined is covalently bound to said linker which linker is bound to the saponin moiety. An example of such a saponin moiety comprising an active ester is the moiety resulting from activation of the carboxylic group of the saponin molecule selected for providing the saponin moiety, via 1-[Bis(dimethylamino)methylene]-1 H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU). An example is the saponin with the structure with formula (IV), referred to as SO1861 -HATU, in the list shown here below, suitable for e.g. binding to the amino group of the lysyl side chain of a Lys residue in a proteinaceous ligand. A further example of such a saponin moiety comprising an active ester is the moiety resulting from activation of the carboxylic group of the saponin molecule selected for providing the saponin moiety, via 1-[Bis(dimethylamino)methylene]-1H-1,2,3- triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU) and subsequently with N-(2- Aminoethyl)maleimide trifluoroacetate salt (AEM), therewith providing a maleimide group for forming a covalent bond with a thiol presented by the ligand, e.g. by a Cys residue in a proteinaceous ligand. An example is the saponin with the structure with formula (III), referred to as SO1861-S-Mal, in the list shown here below.
[0388] In embodiments, the linker that is bound to the saponin molecule in the saponin component further comprises an oligomeric or polymeric structure either being a dendron such as a polyamidoamine (PAMAM) dendrimer, or a poly-ethylene glycol such as any of PEG3 - PEG30; preferably the polymeric or oligomeric structure being any one of PEG4 - PEG12 or any one of a G2 dendron, a G3 dendron, a G4 dendron and a G5 dendron, more preferably being a G2 dendron or a G3 dendron or a PEG3-PEG30.
[0389] For example, the saponin component comprises a saponin moiety comprising a covalently bound linker and is a molecule according to any one of formula (I) - (V):
[0390]
[0391]
[0392]
[0393] and / or for example the saponin component comprises
[0394] a saponin, wherein the carboxyl group of the glucuronic acid unit in the first saccharide chain bound to C-3 of the aglycone core structure of the saponin is transformed into an amide bond through reaction with N-(2-aminoethyl)maleimide (AEM) as shown for SO1861 in formula (18):
[0395]
[0396] ora saponin having a formula according to one of the following formulas (14)-(16) and (19)-(21):
[0397]
[0398]
[0399] In a preferred embodiment, the saponin component is the molecule according to formula (I) herein above or is SO1861 or is a conjugate of SO1861 and the first ligand.
[0400] In a preferred embodiment, the saponin component comprises a ligand capable of binding to an endocytic cell-surface receptor.
[0401] In a preferred embodiment, the oligonucleotide-based medicament a ligand capable of binding to an endocytic cell-surface receptor.
[0402] In a preferred embodiment, the oligonucleotide-based medicament comprises a covalently bound thereto any one or more:
[0403] a linker selected from the any one or more linkers hereabove defined for the saponin moiety; a linker, such as a linker as hereabove defined, with a further molecule covalently bound to the linker
[0404] wherein said further molecule is defined as hereabove defined for the saponin moiety, and is any one or more of:
[0405] d. a further linker, such as a linker as hereabove defined;
[0406] e. a ligand for binding to an endocytic cell-receptor,
[0407] wherein the ligand is a proteinaceous ligand or a non-proteinaceous ligand or a combination thereof,
[0408] wherein the proteinaceous ligand is for example:
[0409] a. a protein ligand capable of binding to a cell-surface receptor, which binding results in internalization of the protein ligand;
[0410] an antibody, as defined hereabove for the saponin moiety
[0411] In an embodiment, the saponin component is selected and / or adapted and / or verified so as to not induce NF-KB pathway activation in kidney cells (e.g. by being provided at an in vitro and / or in vivo verified concentration and / or format including, for example, in vitro and / or in vivo verified combination of one or more verified saponin moiety with a linker and alternatively also a ligand).
[0412] The saponin component preferably does not comprise a QS saponin, such as QS-21. The saponin component preferably comprises a saponin with a quillaic acid aglycon or with a gypsogenin aglycon with the proviso that the saponin component does not comprise or consist of a QS saponin such as QS-21. Alternatively, preferred is the saponin component which comprises a saponin without an acyl chain in the glycan / oligosaccharide chain linked to C-28 of the aglycon, preferably quillaic acid or gypsogenin, such as the acyl chain comprised by the glycan linked to C-28 in QS-21, for example the acyl chain comprised by QS-21 apio, i.e. 5-O-[5-O-Ara / Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid (see Table V for more examples of QS saponins with such glycan comprising an acyl chain). Preferred is a saponin component that does not activate the NF-KB pathway, such as a saponin component comprising a saponin isolated from Saponaria officinalis, and is preferably any one or more of Saponarioside B, SO1542, SO1584, SO1658, SO1674, SO1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1903 and SO1904, or the aldehyde-substituted derivative of any one thereof more preferably any one or more of SO1832, SO1861 and SO1862 or the aldehyde-substituted derivative of any one thereof, even more preferably SO1832 or SO1861, or the aldehyde-substituted derivative of any one thereof, most preferably SO1861, or the aldehyde-substituted derivative thereof, or, preferably, any one of AG1856, AG1, AG2, Agrostemmoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SG1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1903, SO1904, or the aldehyde-substituted derivative of any one thereof.
[0413] In another advantageous embodiment of the presented herein therapeutic combinations, compositions, formulations, and / or methods, the saponin component is selected and / or adapted and / or verified so as to it does not induce increase in one or more inflammatory marker(s) level at least in human whole blood, wherein the one or more inflammatory marker(s) level is preferably selected from IL-1 p, IL-2, IFNy, IFNp, IFNa2a, and TNFa, preferably following the duration of at least 1 hr, preferably 2 hrs, more preferably 3 hrs, most preferably 4 hrs post the whole blood exposure to a pre-determined and / or clinically effective dose or concentration of the therapeutic combination, composition, or formulation, comprising the saponin component ( / .e. dose or concentration capable of producing the desired biological response).
[0414] In a further advantageous embodiment, the saponin component is selected and / or adapted and / or verified so as it has no to low propensity, preferably no propensity, for inducing anti-drug antibody formation (ADA) (as measured by any one of assays that are standard in the art) following intravenous injection of a clinically effective dose or concentration of the therapeutic combination, composition, or formulation, comprising the saponin component, at least 1 day following the injection, preferably at least 3 days following the injection, more preferably at least 1 week following the injection, even more preferably at least 2 weeks following the injection, most preferably more than 3 or 4 weeks following the injection, such as 29 days or more.
[0415] In a preferred embodiment, the saponin component comprises both a ligand capable of binding to an endocytic cell-surface receptor as herein above defined and the oligonucleotide-based medicament as here above defined.
[0416] A preferred embodiment is the therapeutic combination of, or therapeutic composition comprising any one of the saponin component as here above defined and any one of the oligonucleotide-based medicament as here above defined.
[0417] A preferred embodiment is the therapeutic combination of, or therapeutic composition comprising any one of the saponin component as here above defined and any one of the oligonucleotide-based medicament as here above defined.
[0418] A preferred embodiment is the therapeutic combination of, or therapeutic composition comprising any one of the saponin component as here above defined wherein the saponin component comprises a ligand as here above defined and any one of the oligonucleotide-based medicament as here above defined wherein the oligonucleotide-based medicament comprises a ligand as here above defined, for targeting an endocytic cell-surface molecule present on the same cell as the endocytic cellsurface molecule targeted by the ligand comprised by the saponin component.
[0419] A preferred embodiment is the saponin component consisting of a saponin molecule.
[0420] A preferred embodiment is a therapeutic combination of, or therapeutic composition comprising a saponin molecule and an the oligonucleotide-based medicament. A preferred embodiment is a therapeutic composition comprising or consisting of a saponin component comprising an oligonucleotide-based medicament and comprising a ligand as here above defined.
[0421] In an embodiment, the therapeutic combinations, compositions or formulations of the disclosure comprise any one or more selected from the following: a pharmaceutically acceptable excipient and / or pharmaceutically acceptable diluent and / or analgesic agent and / or immunosuppressants and / or antiinflammatory agent and / or antibiotic, preferably comprise at least a therapeutically acceptable excipient and / or a therapeutically acceptable diluent. Anti-inflammatory agents include but are not limited to nonsteroidal anti-inflammatory agents such as bromfenac, nepafenac, ketorolac, diclofenac, flurbiprofen; corticosteroids such as dexamethasone, difluprednate, loteprednol, fluocinolone, fluoromethoIone, triamcinolone, rimexolone, prednisone, prednisolone, and integrin antagonists such as lifitegrast. Immunosuppressants include but are not limited to antimetabolites such as azathioprine, methotrexate and mycophenolate mofetil; calcineurin inhibitors such as cyclosporine, tacrolimus and voculosporin; alkylating agents such as cyclophosphamide and chlorambucil; TNF inhibitors such as etanercept, infliximab, adalimumab; lymphocyte inhibitors such as rituximab and abatacept; interferons such as interferon alpha and interleukin antagonists such as IL-1 antagonist anakinra and IL-2 antagonist daclizumab. Antibiotics include but are not limited to ofloxacin, moxifloxacin, levofloxacin, ciprofloxacine, gatifloxacin, azithromycin, besifloxacin, tobramycin, polymyxin b, trimethoprim, trifluridine, vidarabine, gentamicin, chloramphenicol, neomycin, erythromycin and bactiricin. Analgesics include but are not limited to the non-steroidal anti-inflammatory agents and corticosteroids as mentioned above, and local anesthetics such as tetracaine, proparacaine and lidocaine.
[0422] EXAMPLES
[0423] The following examples serve to illustrate the broad applicability of pharmaceutical combinations comprising different oligonucleotide-based medicaments targeting nucleic acids present in the kidney, with an endosomal escape enhancing saponin component that allows these medicaments to be effectively released in the kidney cells. Together these examples show that co-dosing of saponin components with oligonucleotide therapeutics markedly improves the efficacy of the latter in kidney cells. The presented herein data show that regardless of whether directly conjugated, ligand-conjugated or unconjugated, the pentacyclic 12,13-dehydrooleanane-type saponin component increases the potency of oligonucleotide-based medicaments provided into kidney cells without inducing substantial cyto- and nephrotoxicity. Furthermore, our data also show that the saponin component does not induce an inflammatory response in kidney cells, as shown by an apparent lack of the NF-KB pathway activation in HEK293-FT cells in vitro. Furthermore, because of their low-immunogenicity, the presented herein pharmaceutical combinations, compositions and formulations appear to be suitable for parenteral administration as various forms of the saponin component do not appear to trigger innate immune or other inflammatory responses in circulating human whole blood obtained from donors, as verified by comparing levels of markers including IL-10, IL-2, IFNy, IFN0, IFNa2a and TNFa following the donor circulating blood exposure to even relatively high concentrations of the saponin component versus control conditions, even after the duration of 4 hrs. These findings are further corroborated by the results of in vivo experiments, in which mice injected intravenously with an antibody-saponin conjugate did not appear to show signs of apparent immunogenicity or suffer from induction of innate immune responses against such conjugates and, importantly, even 29 days post injection, the determination of anti-drug antibody (ADA) levels showed that such saponin components have no to very low propensity for inducing ADA formation in vivo.
[0424] MATERIALS AND METHODS (CHEMISTRY)
[0425] 1.1.1 Abbreviations
[0426] aCD71 Anti-CD71 antibody targeting murine CD71 (transferrin receptor 1)
[0427] AH Acylhydrazone bond
[0428] AEM N-(2-Aminoethyl)maleimide trifluoroacetate salt
[0429] BNA Bridged nucleic acid
[0430] DBCO Dibenzocyclooctyne
[0431] DMF N, N-dimethylformamide
[0432] DPBS Dulbecco’s phosphate buffer saline
[0433] DTT Dithiothreitol
[0434] EDCLHCI 3-((ethylimino)methyleneamino)-N, N-dimethylpropan-1-aminium chloride EDTA Ethylenediaminetetraacetic acid
[0435] ELSD Evaporative light scattering detector
[0436] EMCH. TFA N-(e-maleimidocaproic acid) hydrazide, trifluoroacetic acid salt
[0437] GalNAc N-Acetylgalactosamine
[0438] GN3 Trimeric GalNAc (also referred to as trivalent GalNAc)
[0439] IPA Iso-propyl alcohol
[0440] LC-MS Liquid chromatography - mass spectrometry
[0441] LRMS Low resolution mass spectrometry
[0442] min Minutes
[0443] MP-LC Medium pressure - liquid chromatography
[0444] NEM N-ethylmaleimide
[0445] NMM 4-methylmorpholine
[0446] PDT Pyridine 2-thione
[0447] r.t. Retention time
[0448] SC Semicarbazone bond
[0449] SDS Sodium dodecyl sulfate
[0450] SEC Size exclusion chromatography
[0451] SMCC Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1 -carboxylate
[0452] SPT SO1861 saponin
[0453] TBEU (Tris-(hydroxymethyl)-aminomethan)-Borat-EDTA-Urea
[0454] TCEP Tris(2-carboxyethyl)phosphine hydrochloride TCO Trans-cycloctene
[0455] Temp Temperature
[0456] TFA Trifluoroacetic acid
[0457] TFL Trifuncltional linker with three functional groups DBCO, TCO, Maleimide THPP T ris(hydroxypropyl)phosphine
[0458] TNBS 2,4,6-trinitrobenzene sulfonic acid
[0459] Tris Tris(hydroxymethyl)aminomethane
[0460] 1.1.2 Analytical methods
[0461] LC-MS method 1
[0462] Apparatus: Waters ICIass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: neg or neg / pos within in a range of 1500-2400 or 2000-3000; ELSD: gas pressure 40 psi, drift tube temp: 50°C; column: Acquity C18, 50x2.1 mm, 1.7 pm Temp: 60°C, Flow: 0.6 ml / min, lin. Gradient depending on the polarity of the product:
[0463] Gradient A: ^to=2% A, tsomin=50% A, t6omin=98% A
[0464] Gradient B: ^to=2% A, t5omin=98% A, t6omin=98% A
[0465] Posttime: 1.0 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
[0466] LC-MS method 2
[0467] Apparatus: Waters ICIass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: pos / neg 100-800 or neg 2000-3000; ELSD: gas pressure 40 psi, drift tube temp: 50°C; column: Waters XSelect™ CSH C18, 50x2.1 mm, 2.5 pm, Temp: 25°C, Flow: 0.5 ml / min, Gradient: tomin = 5% A, t2.omin = 98% A, t2.7min= 98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
[0468] LC-MS method 3
[0469] Apparatus: Waters ICIass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product pos / neg 105-800, 500-1200 or 1500-2500; ELSD: gas pressure 40 psi, drift tube temp: 50°C; column: Waters XSelect™ CSH C18, 50x2.1 mm, 2.5 pm, Temp: 40°C, Flow: 0.5 ml / min, Gradient: tomin = 5% A, t2.omin = 98% A, t2.7min = 98% A, Posttime: 0.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
[0470] LC-MS method 4
[0471] Apparatus: Waters ICIass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: pos / neg 100-800 or neg 2000-3000; ELSD: gas pressure 40 psi, drift tube temp: 50°C column: Waters Acquity Shield RP18, 50x2.1 mm, 1.7 pm, Temp: 25°C, Flow: 0.5 ml / min, Gradient: tomin = 5% A, t2.omin = 98% A, t2.7min = 98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
[0472] LC-MS method 5
[0473] Apparatus: Waters ICIass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: neg / pos within in a range of 1500-2700; ELSD: gas pressure 40 psi, drift tube temp: 50°C; column: Acquity Premier Peptide BEH C18, 50x2.1 mm, 1.7 pm Temp: 25°C, Flow: 0.45 ml / min, Gradient depending on the polarity of the product:
[0474] Gradient A: ^to=2% B, t4omin=50% B, tsomin=98% B, t6omin=98% B
[0475] Gradient B:Bto = 5% B, t6.omin = 98% B, fe.omin = 98% B
[0476] Posttime: 1.0 min, Eluent A: 10 mM ammonium bicarbonate in water (pH=9.5), Eluent B: acetonitrile.
[0477] 1.1.3 Preparative methods
[0478] Preparative MP-LC method 1
[0479] Instrument type: Reveleris™ prep MPLC; column: Waters XSelect™ CSH C18 (145x25 mm, 10 pm); Flow: 40 ml / min; Column temp: room temperature; Eluent A: 10 mM ammoniumbicarbonate in water pH = 9.0; Eluent B: 99% acetonitrile + 1% 10 mM ammoniumbicarbonate in water; Gradient:
[0480] Gradient Gradient
[0481]
[0482] Detection UV: 210, 235, 254 nm and ELSD.
[0483] Preparative MP-LC method 2
[0484] Instrument type: Reveleris™ prep MPLC; Column: Phenomenex LUNA C18(3) (150x25 mm, 10 pm); Flow: 40 ml / min; Column temp: room temperature; Eluent A: 0.1% (v / v) Formic acid in water, Eluent B: 0.1% (v / v) Formic acid in acetonitrile; Gradient:
[0485]
[0486] Detection UV: 210, 235, 254 nm and ELSD.
[0487] Preparative LC-MS method 3
[0488] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XSelect™ CSH (C18, 150x19 mm, 10 pm); Flow: 25 ml / min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH = 9.0; Gradient:
[0489] Gradient A: ^t0= 20% A, t2.5min= 20% A, t11min= 60% A, t13min= 100% A, t17min= 100% A Gradient B:Bt0= 5% A, t2.5min= 5% A, t11min= 40% A, t13min= 100% A, t17min= 100% A
[0490] Detection: DAD (210 nm); Detection: MSD (ESI pos / neg) mass range: 100 - 800; Fraction collection based on DAD.
[0491] Preparative LC-MS method 4
[0492] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XBridge Protein (C4, 150x19 mm, 10 pm); Flow: 25 ml / min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; Gradient:
[0493] Gradient A:At0= 2% A, t2.5min= 2% A, t11min= 30% A, t13min= 100% A, t17min= 100% A
[0494] Gradient B:Bt0= 10% A, t2.5min= 10% A, t11min= 50% A, t13min= 100% A, t17min= 100% A
[0495] Gradient C:Ct0= 5% A, t2.5min= 5% A, t11min= 40% A, t13min= 100% A, t17min= 100% A
[0496] Detection: DAD (210 nm); Detection: MSD (ESI pos / neg) mass range: 100 - 800; Fraction collection based on DAD.
[0497] Flash chromatography
[0498] Grace Reveleris X2® C-815 Flash; Solvent delivery system: 3-piston pump with auto-priming, 4 independent channels with up to 4 solvents in a single run, auto-switches lines when solvent depletes; maximum pump flow rate 250 ml / min; maximum pressure 50 bar (725 psi); Detection: UV 200-400 nm, combination of up to 4 UV signals and scan of entire UV range, ELSD; Column sizes: 4-330 g on instrument, Luer type, 750 g up to 3000 g with optional holder.
[0499] UV-vis spectrophotometry
[0500] Concentrations were determined using either a Thermo Nanodrop 2000 spectrometer or Perkin Elmer Lambda 365 Spectrophotometer and the following mass Extiction Coefficient (EC) values:
[0501] Experimentally determined molar e495 = 58,700 M-1 cm-1 and Rz280:495 = 0.428 were used for SAMSA-fluorescein.
[0502] PMO; mass EC260 = 25.65 (mg / ml)-1 cm-1, Rz 260:280 = 1.859
[0503] Ellman’s reagent (TNB); molar EC412 = 14,150 M-1 cm-1
[0504] Pyridine 2-thione (PDT); molar e363 = 8,080 M-1 cm-1
[0505] TNBS assay
[0506] Glycine standards (0, 2.5, 5, 10, 15 and 20 pg / ml) were freshly prepared using DPBS pH 7.5. TNBS assay reagent was prepared by combining TNBS (40 pl) and DPBS pH 7.5 (9.96 ml). 10% w / v SDS prepared using DI water. For the assay; 60 pl of each sample (singlicate) and standard (triplicate) plated out. To each well was added TNBS reagent (60 pl) and the plate shaker-incubated for 3 hours at 37°C and 600 rpm. After, 50 pl of 10% SDS and 25 pl 1M HCI added and the plate analysed at 340 nm. SO1861-hydrazone-NHS incorporation determined by depletion of lysine concentration of conjugate with respect to unmodified protein. SEC
[0507] The conjugates were analysed by SEC using an Akta purifier 10 system and Biosep SEC-s3000 column eluting with DPBS: IPA (85:15). Conjugate purity was determined by integration of the Conjugate peak with respect to impurities / aggregate forms.
[0508] SDS-PAGE and Coomassie staining
[0509] Native proteins and conjugates were analysed under heat denaturing non-reducing and reducing conditions by SDS-PAGE against a protein ladder using a 4-12% bis-tris gel and MOPS as running buffer (200V, ~40 minutes). Samples were prepared to 0.5 mg / ml, comprising LDS sample buffer and MOPS running buffer as diluent. For reducing samples, DTT was added to a final concentration of 50 mM. Samples were heat treated for 2 minutes at 90-95°C and 5 pg (10 pl) added to each well. Protein ladder (10 pl) was loaded without pre-treatment. Empty lines were filled with 1× LDS sample buffer (10 pl). After the gel was run, it was washed thrice with DI water (100 ml) with shaking (15 minutes, 200 rpm). Coomassie staining was performed by shaker-incubating the gel with PAGEBIue protein stain (30 ml) (60 minutes, 200 rpm). Excess staining solution was removed, rinsed twice with DI water (100 ml) and destained with DI water (100 ml) (60 minutes, 200 rpm). The resulting gel was imaged and processed using ImageJ and MyCurveFit (point-to-point correlation of protein ladder).
[0510] Western Blotting
[0511] From SDS-PAGE, the gel was transferred to nitrocellulose membrane using the X-Cell blot module with the following setup ((-)BP-BP-FP-Gel-NC-BP-BP-BP(+)) and conditions (30V, 60 minutes) using freshly prepared transfer buffer. BP - blotting pad; FP - Filter pad; NC - Nitrocellulose membrane. After, the NC were washed thrice with PBS-T (100 ml) with shaking (5 minutes, 200 rpm), non-specific sites blocked with blocking buffer (50 ml) with shaking (30 minutes, 200 rpm) then active sites labelled with a combination of Goat anti-Human Kappa - HRP (1:2000) and Goat anti-Human IgG - HRP (1:2000) (50 ml) diluted in blocking buffer with shaking (30 minutes, 200 rpm). After, the NC was washed once with PBS-T (100 ml) with shaking (5 minutes, 200 rpm) and complexed antibody detected with freshly prepared, freshly filtered CN / DAB substrate (25 ml). Colour development was observed visually, and after 2 minutes development was stopped by washing the NC with water, and the resulting blot photographed.
[0512] TBEU-PAGE
[0513] Oligo conjugates and oligo standards were analysed under heat denaturing non reducing conditions by TBE-Urea PAGE against an oligo ladder using a 15% TBE-Urea gel and TBE as running buffer (180V, ~60 minutes). Samples were prepared to 0.5 mg / ml, and oligo standards were prepared to 50 to 5 pg / ml, respectively, all comprising TBE Urea sample buffer and purified H2O as diluent. Samples and standards were heat treated for 3 minutes at 70°C and 10 pl added to each well, equating to 5 pg of protein and conjugate samples, and 0.5 / 0.2 / 0.1 / 0.5 pg (DMD-ASO) or 0.2 / 0.1 / 0.05 pg (DMD-PMO) of oligo, per lane. Oligo ladder reconstituted to 0.1 pg / band / ml in TE pH 7.5 (2 pl) was loaded without pre treatment. After the gel was run, it was stained with freshly prepared ethidium bromide solution (1 pg / ml) with shaking (40 minutes, 200 rpm). The resulting gel was visualised by UV epi-illumination (254nm), imaged and processed using ImageJ.
[0514] MALDI-TOF-MS
[0515] MALDI-TOF spectra were acquired using a Bruker Ultraflex III MALDI TOF / TOF mass spectrometer supplied by Bruker. Peptide Calibration Standard II from Bruker and ProteoMassTM from Sigma-Aldrich acted as calibration standards. For measurements, 0.5 pL of the sample was spotted on a well of the target plate (MTP 384 target plate polished steel TF, Bruker Daltons) together with 0.5 pL of the matrix solution via the dried droplet method. Sinapinic acid (SA, 99%, Sigma-Aldrich, solved in ACN / 0.1% TFA (7:3 v / v)) and super-2, 5-Dihydrobenzoic acid (sDHB, 99%, Fluka, solved in ACN / 0.1% TFA (7:3 v / v)) served as matrices. All samples were desalted in Milli-Q water previous to spotting. The mass spectra were operated in three different modes, the linear positive ion (LP), reflector negative ion (RN), and reflector positive ion (RP) mode.
[0516] Materials
[0517] SO1861 (also referred to as saponin) was isolated and purified by Extrasynthese (France) or Analyticon Discovery GmbH (Germany) from raw plant extract obtained from Saponaria officinalis L. and was coupled to respective handles according to methods known in the art by Symeres (Netherlands).
[0518] Antisense oligonucleotide ASO#01, targeting human (Hs) HSP27 mRNA, with the sequence 5'-+G*+G*+C*A*C*A*G*C*C*A*G*T*G*+G*+C*+G-3', with + = BNANC; * = phosphorothioate [SEQ ID NO: 20], and antisense oligonucleotide ASO#02, targeting murine (Mm) ApoB100 mRNA, with the sequence 5'-[Thiol-C6]+G*+C*A*T*T*G*G*T*A*T*+T*+C*+A-3', with + = BNANC; * = phosphorothioate [SEQ ID NO: 1] were custom-made and purchased from Bio-Synthesis Inc. (USA).
[0519] A phosphorodiamidate morpholino oligomer (PMO), targeting murine (Mm) DMD mRNA, with the sequence 5’-GGCCAAACCTCGGCTTACCTGAAAT-[Disulfide amide]-‘3 [SEQ ID NO: 27] was custom-made and purchased from Gene Tools, LLC (USA). GN3-siAT3 (also referred to as ligand-siAT3 or ligand-siRNA), including the sense-strand [SEQ ID NO: 12], was custom-made by Biotage (United Kingdom), using the antisense-strand [SEQ ID NO: 13] produced by BioSpring GmbH (Germany).
[0520] Anti-CD71 antibody (aCD71), clone R17 217.1.3 / TIB-219, targeting murine CD71 (transferrin receptor 1), was purchased from BioXCell (USA).
[0521] Trifluoroacetic Acid (TFA, 99%, Thermo-Fisher), EMCH. TFA (95%, TCI Chemicals), 2-Mercaptoethanol (99%, Sigma-Aldrich), Spectra / Por® 7 (MWO 1kDa, Carl Roth), Ammonium bicarbonate (99%, Sigma-Aldrich), Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, 98%, Sigma-Aldrich), 1-azido-3,6,9-trioxaundecane-11-ol (Santa Cruz), Sodium hydroxide (97%, Sigma-Aldrich), N, N-Dimethylformamide (DMF, 99%, Sigma-Aldrich), Methyltetrazine-NHS ester (95%, BroadPharm), Ethanolamine (99%, Sigma-Aldrich), Triethylamine (TEA, 99%, Sigma-Aldrich), 4-Methylmorpholine (NMM, 99%, Sigma-Aldrich), DBCO-Maleimide (95%, BroadPharm), Dichloromethane (DCM, Sigma-Aldrich) 5,5- Dithiobis(2-nitrobenzoic acid) (DTNB, Ellman’s reagent, 99%, Sigma-Aldrich), Zeba™ Spin Desalting Columns (2 mL, Thermo-Fisher), NuPAGE™ 4-12% Bis-Tris Protein Gels (Thermo-Fisher), NuPAGE™ MES SDS Running Buffer (Thermo-Fisher), Novex™ Sharp Pre-stained Protein Standard (ThermoFisher), PageBlue™ Protein Staining Solution (Thermo-Fischer), Pierce™ BCA Protein Assay Kit (Thermo-Fisher), N-Ethylmaleimide (NEM, 98%, Sigma-Aldrich), 1,4-Dithiothreitol (DTT, 98%, Sigma-Aldrich), Sephadex G25 (GE Healthcare), Sephadex G50 M (GE Healthcare), Superdex 200P (GE Healthcare), Isopropyl alcohol (IPA, 99.6%, VWR), Tris(hydroxymethyl)aminomethane (Tris, 99%, Sigma-Aldrich), Tris(hydroxymethyl)aminomethane hydrochloride (Tris.HCl, Sigma-Aldrich), L-Histidine (99%, Sigma-Aldrich), D-(+)-Trehalose dehydrate (99%, Sigma-Aldrich), Polyethylene glycol sorbitan monolaurate (TWEEN 20, Sigma-Aldrich), Dulbecco's Phosphate-Buffered Saline (DPBS, Thermo-Fisher), Guanidine hydrochloride (99%, Sigma-Aldrich), Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA-Na2, 99%, Sigma-Aldrich), sterile filters 0.2 pm and 0.45 pm (Sartorius), Vivaspin T4 and T15 concentrator (Sartorius), Superdex 200PG (GE Healthcare), Tetra(ethylene glycol), Dimethyl sulfoxide (DMSO, 99%, Sigma-Aldrich), N-(2-Aminoethyl)maleimide trifluoroacetate salt (AEM, 98%, Sigma-Aldrich), L-Cysteine (98.5%, Sigma-Aldrich), deionized water (DI) was freshly taken from Ultrapure Lab Water Systems (MilliQ, Merck), Nickel-nitrilotriacetic acid agarose (Ni-NTA agarose, Protino), Glycine (99.5%, VWR), 5,5-Dithiobis(2-nitrobenzoic acid (Ellman’s reagent, DTNB, 98 %, Sigma-Aldrich), S-Acetylmercaptosuccinic anhydride Fluorescein (SAMSA reagent, Invitrogen) Sodium bicarbonate (99.7%, Sigma-Aldrich), Sodium carbonate (99.9%, Sigma-Aldrich), PD MiniTrap desalting columns with Sephadex G-25 resin (GE Healthcare), PD10 G25 desalting column (GE Healthcare), Zeba Spin Desalting Columns in 0.5, 2, 5, and 10 mL (Thermo-Fisher), Vivaspin Centrifugal Filters T4 10 kDa MWCO, T4 100 kDa MWCO, and T15 (Sartorius), Biosep s3000 aSEC column (Phenomenex), Vivacell Ultrafiltration Units 10 and 30 kDa MWCO (Sartorius), Nalgene Rapid-Flow filter (Thermo-Fisher), dichlormethan (Sigma-Aldrich), methanol (Sigma-Aldrich), diethyl ether (Sigma-Aldrich), acetonitrile (Sigma-Aldrich), Pyridine 2-thione (Sigma-Aldrich), Goat anti-Human IgG - HRP (Southern Biotech), Goat anti-Human Kappa - HRP (Southern Biotech), Tris concentrate (ThermoFisher), MOPS running buffer (20x, Thermo-Fisher), LDS sample buffer (4x, Thermo-Fisher), TBS Blocking Buffer (Thermo-Fisher), Tris (Tris(hydroxymethyl)aminomethane, Merck), Tris HCI (Sigma-Aldrich), Minisart RC15 0.2 pm filter (Sartorius), Minisart 0.45 pm filter (Sartorius), PD Minitrap G25 (Cytiva), TNBS (2,4,6-trinitrobenzene sulfonic acid, Sigma-Aldrich), Sodium Dodecyl Sulfate (SDS, Sigma-Aldrich), SMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1 -carboxylate, ThermoFisher), THPP (Tris(hydroxypropyl)phosphine, Sigma-Aldrich), DBCO-NHS (CAS 1353016-71-3, BroadPharm), PEG4-SPDP (2-Pyridyldithiol-tetraoxatetradecane-N-hydroxysuccinimide, ThermoFisher), Novex™ TBE-Urea Gels, 15% (Thermo-Fisher), TBE buffer (ris-Borat-EDTA, Thermo-Fisher), 1-azido-3,6,9,12-tetraoxapentadecane-15-hydrazide (Conju-Probe, USA, #CP-2069) were used.
[0522] Custom production of ligand-ASO#01, ligand-ASO#02, ligand-saponin (Example 1) or (Example 2 and Example 4), ligand-saponin-ASO#02, saponin-compound, and ASO#02-saponin was performed by Symeres (Netherlands). Custom production of ligand-PMO, and ligand-saponin-PMO was performed by Fleet Bioprocessing (United Kingdom).
[0523] Liqand-siAT3 or Liqand-siRNA
[0524] Ligand-siAT3 (also referred to as ligand-siRNA), containing a trimeric GalNAc as ligand and targeting SERPINC1, with advanced enhanced stability chemistry backbone, was custom produced by Biotage (United Kingdom). For siRNA production, Biotage used the antisense-strand [SEQ ID NO: 13] custom-produced by BioSpring GmbH (Germany). GalNAc monomers were conjugated at the 3’ position of the sense strand [SEQ ID NO: 12] via phosphoramidite chemistry using a GalNAc support (GalNAc C3 CPG, Glen Research) to obtain a linear trimeric GalNAc at the sense strand.
[0525] Saponin-compound
[0526] Intermediate:
[0527] SO1861-AH-Maleimide
[0528] To SO1861 (121 mg, 0.065 mmol) and EMCH. TFA (110 mg, 0.325 mmol) was added methanol (extra dry, 3.00 ml) and TFA (0.020 ml, 0.260 mmol). The reaction mixture stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative MP-LC method 1. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (120 mg, 90%), also referred to as SO1861-AH-Mal also referred to as SPT-EMCH, as a white fluffy solid. Purity based on LC-MS method 4 was 96%.
[0529] LRMS (m / z): 2069 [M-1]1-
[0530] LC-MS r.t. (min): 1.084
[0531] SO1861-AH-Maleimide-Block, referred to as saponin-compound
[0532] To SO1861-AH-Maleimide (0.1 mg, 48 nmol) was added 200 pl mercaptoethanol (18 mg, 230 pmol) and the solution was shaken for 1 hour at 800 rpm on a ThermoMixer C (Eppendorf) at room temperature. Next, the solution was diluted with methanol and dialyzed extensively for 4 hours against methanol using regenerated cellulose membrane tubes (Spectra / Por 7) with a MWCO of 1 kDa. After dialysis, the SO1861-Ald-AH-mercaptoethanol was provided, also referred to as SO1861-AH-Maleimide-Block or saponin-compound, and analyzed via MALDI-TOF-MS.
[0533] (RP mode): m / z 2193 Da ([M+K]+, SO1861-AH-Maleimide-block), m / z 2185 Da ([M+K]+, SO1861-AH-Maleimide-block), m / z 2170 Da ([M+Na]+, SO1861-AH-Maleimide-block).
[0534] Liqand-ASQ#02
[0535] Intermediate 1:
[0536] Methyltetrazine-ASO#02
[0537] To ASO#02 [SEQ ID NO: 1] (20 mg, 4.17 pmol) was added a solution of 20 mM ammonium bicarbonate with 5.0 mM TCEP (2.00 ml, 10.0 pmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000 x g for 30 min, 4x 0.50 ml). Next, the residue solution was diluted with 20 mM ammonium bicarbonate (3.00 ml) and the resulting mixture was directly added to a solution of (E)-1-(4-((2-(6-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)hexanoyl)hydrazineylidene)methyl)benzamido)-N-(4-(6-methyl-1, 2,4, 5-tetrazin-3-yl) benzyl)-, 6, 9,12-tetraoxapentadecan-15-amide (7.22 mg, 9.16 pmol) in acetonitrile (1.0 ml). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was frozen and lyophilized overnight to yield the crude title product as a pink fluffy solid. To the crude product was added a 20 mM ammonium bicarbonate / acetonitrile (2:1, v / v, 2.00 ml) and the resulting solution was subjected to preparative LC-MS method 1, gradient A. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (20.3 mg, 89%) as a pink fluffy solid. Purity based on LC-MS method 3 was 93%.
[0538] LRMS (m / z): 1817 [M-3]3'
[0539] LC-MS r.t. (min): 0.59
[0540] Intermediate 2:
[0541] TFL-(blocked DBCO)-(TCO)-(GN3)
[0542] A solution of 1-azido-3,6,9-trioxaundecane-11-ol (2.17 mg, 9.88 pmol) in DMF (0.50 ml) was added to TFL-(DBCO)-(TCO)-(trivalent GalNAc) (14.6 mg, 4.94 pmol, prepared as described in WO2022055351 A1, 2022, Conjugate of saponin, oligonucleotide and GalNAc, page 145 line 20 - page 146 line 15). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was submitted to preparative MP-LC method 1, gradient C. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (10.00 mg, 64%) as a white solid. Purity based on LC-MS method 1, gradient B was 98%.
[0543] LRMS (m / z): 1750 [fragment]
[0544] LC-MS r.t. (min): 2.33
[0545] GN3-TFL-(AH-ASO#02)-(Block), referred to as ligand-ASO#02
[0546] TFL-(blocked DBCO)-(TCO)-(GN3) (10.0 mg, 3.15 pmol) and methyltetrazine-ASO#02 (10.0 mg, 1.83 pmol) were dissolved in a solution of 20 mM ammonium bicarbonate / acetonitrile (3:1, v / v, 1.00 ml). The reaction mixture was shaken for 1 min and left standing at room temperature. After 3 hours the reaction mixture was frozen and lyophilized overnight. The crude product was dissolved in 20 mM ammonium bicarbonate (1 ml) and the resulting solution was directly subjected to preparative LC-MS method 1, gradient B. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (11.3 mg, 72%) as a white fluffy solid. Purity based on LC-MS method 1, gradient A was 95%.
[0547] LRMS (m / z): 2149 [M-4]4', 2866 [M-3]3'
[0548] LC-MS r.t. (min): 2.92 Liqand-saponin (in Example 1)
[0549] Intermediate 1:
[0550] N-(2-hydroxyethyl)-2-(4-(6-methyl-1,2,4,5-tetrazin-3-yl)phenyl)acetamide
[0551] To a solution of methyltetrazine-NHS ester (30.0 mg, 91.7 pmol) in DMF (1.0 ml) was added ethanolamine (11.1 pl, 0.184 mmol) and triethylamine (25.5 l, 0.183 mmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was submitted to preparative MP-LC method 1, gradient B. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (19.2 mg, 77%) as a purple solid. Purity based on LC-MS method 2 was 89%.
[0552] LRMS (m / z): 274 [M+1]1+
[0553] LC-MS r.t. (min): 0.85
[0554] Intermediate 2:
[0555] SO1861 -AH-azide
[0556] To SO1861 (60 mg, 0.032 mmol) and 1-azido-3,6,9,12-tetraoxapentadecane-15-hydrazide (39.3 mg, 0.129 mmol) were added methanol (extra dry, 1.0 ml) and trifluoroacetic acid (9.86 pl, 0.129 mmol). The reaction mixture was shaken for one minute, left standing at room temperature for two hours, and then subjected to preparative LC-MS method 1. Fractions corresponding to the product were immediately pooled together, frozen, and lyophilized overnight to give SO1861-AH-azide (58.4 mg, 84%) as a white fluffy solid. Purity based on analytical liquid chromatography - mass spectrometry (LC-MS) method 3 was 99%.
[0557] LRMS [m / z]: 2150 [M-1]1-
[0558] LC-MS r. t. (min): 1.10
[0559] GN3-TFL-(AH-SO1861)-(Block), referred to as ligand-saponin (in Example 1)
[0560] A solution of TFL-(DBCO)-(TCO)-(trivalent GalNAc) (36.8 mg, 12.5 pmol, prepared as described in WO2022055351 A1, 2022, Conjugate of saponin, oligonucleotide and GalNAc, page 145 line 20 - page 146 line 15) in DMF (2.0 ml) was added to SO1861-AH-azide (26.8 mg, 12.5 pmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min A / -(2-hydroxyethyl)-2-(4-(6- methyl-1,2,4,5-tetrazin-3-yl)phenyl)acetamide (4.08 mg, 14.9 pmol) was added. The reaction mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was submitted to preparative MP-LC method 1, gradient C. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (37.3 mg, 56%) as a white fluffy solid. Purity based on LC-MS method 1, gradient B was 96%.
[0561] LRMS (m / z): 2676 [M-2]2'
[0562] LC-MS r.t. (min): 2.23
[0563]
[0564] Intermediate: GN3-DBC0
[0565] GN3-amine formate (17.4 mg, 10.2 pmol, prepared as described in WO2022055351A1, 2022, Conjugate of saponin, oligonucleotide and GalNAc, page 143 line 17 - 28) and DBCO-NHS (6.14 mg, 15.3 pmol) were dissolved in a solution of NMM (2.24 pl, 20.3 pmol) in DMF (0.50 ml). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was evaporated in vacuo and the residue was dissolved in water / acetonitrile (8:2, v / v, 1 ml). The resulting solution was directly subjected to preparative MP-LC method 2, gradient C. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (14.2 mg, 72%) as a white solid. Purity based on LC-MS method 1, gradient B was 96%.
[0566] LRMS (m / z): 1950 [M-1]1-
[0567] LC-MS r.t. (min): 1.86
[0568] GN3-AH-SO1861, referred to as ligand-saponin (in Example 2 and Example 4)
[0569] To SO1861-AH-azide (30.0 mg, 13.9 pmol) and GN3-DBCO (27.2 mg, 13.9 pmol) was added a mixture of acetonitrile (250 pl) and 20 mM ammonium bicarbonate (750 pl). The reaction mixture was shaken for one minute, left standing at room temperature for one hour, and then subjected to preparative MP-LC method 1, gradient A. Fractions corresponding to the product were pooled together, frozen, and lyophilized overnight to give the GN3-AH-SO1861 conjugate (50.0 mg, 87%), referred to as ligand-saponin (in Example 2 and Example 4), as a white solid. Purity based on analytical LC-MS method 5, gradient B was 99%.
[0570] LRMS (m / z): 2049 [M-2H]2'
[0571] LC-MS r.t. (min): 2.15
[0572] Liqand-saponin-ASQ#02
[0573] Intermediate:
[0574] GN3-TFL-(AH-SO1861)-(TCO)
[0575] A solution of TFL-(DBCO)-(TCO)-(trivalent GalNAc) (4.60 mg, 1.56 pmol, prepared as described in WO2022055351 A1, 2022, Conjugate of saponin, oligonucleotide and GalNAc, page 145 line 20 - page 146 line 15) in DMF (250 pl) was added to SO1861-AH-azide (3.49 mg, 1.62 pmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was submitted to preparative MP-LC method 2, gradient C. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (3.00 mg, 38%) as a white fluffy solid. Purity based on LC-MS method 1, gradient A was 97%.
[0576] LRMS (m / z): 2553 [M-2]2'
[0577] LC-MS r.t. (min): 2.37
[0578] GN3-TFL-(AH-SO1861)-(AH-ASO#02), referred to as ligand-saponin-ASO#02
[0579] GN3-TFL-(AH-SO1861)-(TCO) (3.00 mg, 0.587 pmol) and methyltetrazine-ASO#02 (3.00 mg, 0.550 pmol) were dissolved in a solution of 20 mM ammonium bicarbonate / acetonitrile (3:1, v / v, 1.00 ml). The reaction mixture was shaken for 1 min and left standing at room temperature. After 3 hours the reaction mixture was lyophilized overnight. The crude product was dissolved in 20 mM ammonium bicarbonate / acetonitrile (3:1, v / v, 1.00 ml) and the resulting solution was directly subjected to preparative LC-MS method 1. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (1.96 mg, 34%) as a white fluffy solid. Purity based on LC-MS method 1, gradient B was 92%.
[0580] LRMS (m / z): 2105 [M-5]5', 2632 [M-4]4'
[0581] LC-MS r.t. (min): 3.23
[0582] Liqand-ASO#Q1
[0583] Intermediate:
[0584] GN3-maleimide
[0585] Trivalent GalNAc-azide (20.3 mg, 12.0 pmol, prepared as described in WO2022055351 A1, 2022, Conjugate of saponin, oligonucleotide and GalNAc, page 138 line 21 - page 139 line 2) and DBCO-maleimide (10.3 mg, 24.0 pmol) were dissolved in a mixture of water / acetonitrile (2:1, v / v, 0.90 mL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative MP-LC method 2, gradient D. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (22.2 mg, 87%) as a white solid. Purity based on LC-MS, method 1, gradient A, was 85%.
[0586] LRMS (m / z): 2115 [M-1]1-
[0587] LC-MS r.t. (min): 1.60
[0588] GN3-ASO#01, referred to as ligand-ASO#01 (or GN3-HSP27)
[0589] To ASO#01-thiol [SEQ ID NO: 20, with 5’ Thiol-C6 modification] (5.00 mg, 0.686 pmol) was added a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (1.00 mL, 2.5 pmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000 x g for 30 min, 2x 0.50 mL). Next, the residue solution was washed twice with a solution of 20 mM ammonium bicarbonate with 2.5 mM TCEP (0.50 mL), each time filtered under the same conditions described above. As next, the residue solution was diluted with 20 mM ammonium bicarbonate / acetonitrile (3:1, v / v, 1.00 mL) and the resulting solution was directly added to GN3-maleimide (3.02 mg, 1.43 pmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS method 4, gradient A. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.75 mg, quant.) as a white fluffy solid. Purity based on LC-MS, method 3 was 98%.
[0590] LRMS (m / z): 2060.8 [M-4]4'
[0591] LC-MS r.t. (min): 2.04
[0592] ASQ#02-saponin Intermediate:
[0593] S01861 -SC-Maleimide
[0594] te / Y-butyl 2-(4-(6-(2,5-dioxo-2,5-dihydro-1 / 7-pyrrol-1-yl)hexanoyl)piperazine-1-carbonyl)hydrazine-1-carboxylate (25.0 mg, 57.1 pmol, prepared as described in WO2022265493A1, 2022, page 205 line 16 -29) was dissolved in a mixture of dichloromethane (500 pL) and TFA (500 pL) and the reaction mixture was stirred at room temperature. After 30 min the reaction mixture was evaporated in vacuo and coevaporated with dichloromethane (3 x 5 mL) and methanol (5 mL). The residue and SO1861 (21.3 mg, 11.4 pmol) were dissolved in methanol (extra dry, 1.0 mL) and the resulting mixture was shaken for 1 min and left standing at room temperature. After 4 hours the reaction mixture was subjected to preparative MP-LC, method 2. Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to yield the title compound (13.7 mg, 55%) as a white fluffy solid. Purity based on LC-MS, method 4 was 97%.
[0595] LRMS (m / z): 2181 [M-1]1-
[0596] LC-MS r.t. (min): 2.13
[0597] ASO#02-SC-SO1861, referred to as ASO#02-saponin
[0598] To ASO#02 [SEQ ID NO: 1] (3.41 mg, 0.468 pmol) was added a solution of 20 mM NH4HCO3 / 2.5 mM TCEP (500 pL, 1.250 pmol). The reaction mixture was shaken for 1 min and left standing at room temperature. After 1 hour the reaction mixture was filtered by using a centrifugal filter with a molecular weight cut-off of 3000 Da (5000 x g for 30 min). Next, the residue solution was added to a freshly made solution of SO1861 -SC-Maleimide (1.531 mg, 0.701 pmol) in 20 mM ammonium bicarbonate (0.037 mg, 0.468 pmol) and acetonitrile (250 pL). The reaction mixture was shaken for 1 min and left standing at room temperature. After 60 min the reaction mixture was frozen and lyophilized overnight. The crude product was dissolved in 20 mM NH4HCO3(1 mL) and resulting solution was directly submitted to preparative LC-MS, method 1. Fractions corresponding to the product were pooled together and frozen and lyophilized overnight to give the title compound (2.4 mg, 54%) as a white fluffy solid. Purity based on LC-MS, method 1, gradient B was 92%.
[0599] LRMS (m / z): 2335 [M-4]4'
[0600] LC-MS r.t. (min): 2.45
[0601] Liqand-PMO
[0602] aCD71-PMO, referred to as ligand-PMO
[0603] An aliquot of aCD71 (42.9 mg, 4.20 ml) was buffer exchanged into DPBS pH 7.5 and normalized to 2.5 mg / ml. To an aliquot of buffer exchanged aCD71 (34.4 mg, 0.23 pmol, 2.53 mg / ml) was added an aliquot of freshly prepared SMCC solution in DMSO (2.0 mg / ml, 3.53 mole equivalents, 0.81 pmol), the mixture vortexed briefly then incubated for 60 minutes at 20°C with roller-mixing. After incubation, the reaction was quenched by the addition of an aliquot of a freshly prepared glycine solution (2.0 mg / ml, ~20 mole equivalents, 4.05 pmol), the mixture vortexed briefly then incubated for >15 minutes at 20°C with roller-mixing. The conjugate was purified by Superdex 200 column eluting with TBS pH 7.5 and analysed by UV-vis to give purified aCD71-SMCC (31.7 mg, yield: 96%, 0.942 mg / ml, SMCC to aCD71 ratio = 2.1).
[0604] Separately, to an aliquot of PMO [SEQ ID NO: 27] (17.2 mg, 1.99 pmol, 10.0 mg / ml) reconstituted using TBS pH 7.5 was added an aliquot of freshly prepared THPP solution (50 mg / ml, 10 mole equivalents, 19.9 pmol, 82.8 pl), the mixture was vortexed briefly then incubated for 60 minutes at 37°C with rollermixing. After incubation, the oligo was purified by PD10 Sephadex G25M column eluting with TBS pH 7.5, to afford PMO-SH (14.8 mg, yield: 86%, thiol to PMO ratio = 0.98).
[0605] To an aliquot of aCD71-SMCC (31.7 mg, 0.21 pmol, 0.942 mg / ml) was added an aliquot of PMO-SH (4.122 mg / ml, 4.0 mole equivalents, 0.85 pmol, 1.771 ml), the mixture vortexed briefly then incubated at 20°C with roller-mixing. After ca. 72 hours, the conjugate mixture was concentrated and purified by Superdex 200PG column eluting with DPBS pH 7.5 to give the purified aCD71 -PMO conjugate, referred to as ligand-PMO. An aliquot was analysed by BCA colorimetric assay, then concentrated and normalized to 2.5 mg / ml, filtered through 0.2 pm filter (Minisart RC15 0.2pm filter) and then dispensed into an aliquot for characterisation via SDS-PAGE, Western Blot, and TBE-Urea PAGE, and an aliquot for product testing. The result was a mCD71-PMO conjugate also referred to as ligand-PMO. Total yield = 25.7 mg, 73%, PMO to aCD71 ratio = 1.2).
[0606] Liqand-saponin-PMO
[0607] Intermediate:
[0608] aCD71-SO1861
[0609] An aliquot of aCD71 (55.1 mg, 0.37 pmol, 8.10 mg / ml, 6.80 ml) was normalized to 5 mg / ml with DPBS pH 7.5 and then was added 30 pl / ml (330 pl) of a pre-mixed Tris / Tris. HCl / EDTA concentrate, comprising Tris concentrate (127 mg / ml, 1.05M), Tris. HCI concentrate (623 mg / ml, 3.95 M) and EDTA.2Na.2H2O concentrate (95 mg / ml, 0.26M) combined 1:1:1 v / v, to give a 50 mM TBS, 2.5 mM EDTA buffer pH ~7.5. To aCD71 (50 mg, 0.33 pmol, 5.044 mg / ml) was added an aliquot of freshly prepared TCEP solution (2.00 mg / ml, 2.74 mole equivalents, 0.912 pmol), the mixture vortexed briefly then incubated for 210 minutes at 20°C with roller-mixing. After incubation (prior to addition of SO1861 -AH-Maleimide), the aCD71-SH was dispensed out for multiple conjugations and a 1.0 mg (0.201 ml) aliquot was removed and purified by gel filtration using Zeba spin desalting column into TBS pH 7.5. This aliquot was characterised by UV-vis analysis and Ellman’s assay (3.248 mg / ml, thiol to aCD71 ratio = 3.97). To an aliquot of aCD71-SH (42 mg, 0.28 pmol, 4.978 mg / ml) was added an aliquot of freshly prepared SO1861 -AH-Maleimide solution (2.0 mg / ml, 8 mole equivalents, 2.24 pmol, 2.32 ml), the mixture vortexed briefly then incubated for 120 minutes at 20°C. Besides the conjugation reaction, two aliquots of desalted aCD71-SH (0.25 mg, 0.077 ml, 1.67 nmol) were reacted with NEM (8.00 equivalents, 134 nmol, 6.7 pl of a 0.25 mg / ml solution) or TBS pH 7.5 buffer (6.7 pl) for 120 minutes at 20°C, as positive and negative controls, respectively. After incubation, a ca. 0.4 mg aliquot of aCD71-SO1861 mixture was removed, purified by gel filtration using Zeba spin desalting column into TBS pH 7.5 and characterised by Ellman’s assay alongside the positive and negative controls to obtain SO1861 incorporation. To the bulk aCD71-SO1861 mixture was added an aliquot of freshly prepared NEM solution (5 mole equivalents, 1.40 pmol, 70.1 pl of a 2.5 mg / ml solution) to quench the reaction. The conjugate was purified by Superdex 200 column eluting with DPBS pH 7.5 to give purified aCD71-SO1861 conjugate. The product was concentrated then normalised to 2.5 mg / ml, filtered through 0.2 pm filter (Minisart RC15 0.2pm filter) and then dispensed into aliquots for characterisation via SDS-PAGE, and Western Blot, product testing and further conjugation. Ttotal yield = 37.3 mg, 89%, SO1861 to aCD71 ratio = 3.8.
[0610] aCD71-PMO-SO1861, referred to as ligand-saponin-PMO
[0611] To an aliquot of aCD71-SO1861 with DAR3.8 (20 mg, 0.126 pmol, 2.53 mg / ml) was added an aliquot of freshly prepared SMCC solution in DMSO (2.0 mg / ml, 3.53 mole equivalents, 0.447 pmol), the mixture vortexed briefly then incubated for 60 minutes at 20°C with roller-mixing. After incubation, the reaction was quenched by the addition of an aliquot of a freshly prepared glycine solution (2.0 mg / ml, ~20 mole equivalents, 2.5 pmol), the mixture vortexed briefly then incubated for >15 minutes at 20°C with rollermixing. The conjugate was purified by Superdex 200 column eluting with TBS pH 7.5 and analysed by UV-vis to give purified aCD71-SO1861 -SMCC (18.6 mg, yield: 93%, 0.942 mg / ml, SMCC to aCD71 ratio = 2.6).
[0612] Separately, to an aliquot of PMO [SEQ ID NO: 27] (17.2 mg, 1.99 pmol, 10.0 mg / ml) reconstituted using TBS pH 7.5 was added an aliquot of freshly prepared THPP solution (50 mg / ml, 10 mole equivalents, 19.9 pmol, 82.8 pl), the mixture was vortexed briefly then incubated for 60 minutes at 37°C with rollermixing. After incubation, the oligo was purified by PD10 Sephadex G25M column eluting with TBS pH 7.5, to afford PMO-SH (14.8 mg, yield: 86%, thiol to PMO ratio = 0.98).
[0613] To an aliquot of aCD71-SO1861-SMCC (17.2 mg, 0.11 pmol, 0.95 mg / ml) was added an aliquot of PMO-SH (4.1 mg / ml, 4.0 mole equivalents, 0.44 pmol, 0.86 ml), the mixture vortexed briefly then incubated at 20°C with roller-mixing. After ca. 72 hours, the conjugate mixture was concentrated and purified by Superdex 200PG column eluting with DPBS pH 7.5 to give purified aCD71-SO1861-PMO conjugate, referred to as ligand-saponin-PMO or aCD71-SPT-PMO. The aliquot was analysed by BCA colorimetric assay and a new EC value was assigned for the conjugate, then concentrated and normalised to 2.5 mg / ml, filtered through 0.2 pm filter (Minisart RC15 0.2pm filter) and then dispensed into an aliquot for characterisation via SDS-PAGE, Western Blot, and TBE-Urea PAGE and an aliquot for product testing Total yield = 15.2 mg, 79%, PMO to aCD71-SO1861 ratio = 1.6.
[0614] MATERIALS AND METHODS (BIOLOGY)
[0615] In vivo tolerability and efficacy of ligand-saponin conjugates in kidney in a C57BL / 6J model Per group, 5-6 C57BL / 6J male mice, approximately 6 - 7 weeks at arrival and 8 - 9 weeks at dosing, were dosed. The study treatment groups and doses are shown in Table 1. The mice were dosed intravenously (IV) in the lateral tail vein, at 5 ml / kg with dose volumes corresponding to the individual bodyweights; in case of 2-component treatment groups, the second component was infused in the contralateral tail vein. Body weights were determined at day -1 and mice were subsequently weighed weekly, and at termination. After dosage, mice were clinically monitored twice a day for 3 days. Blood samples were collected from the sublingual plexus in standard vials without serum clotting activator at predose, 24 hr, 72 hr, 192 hr, and 336 hr post dose. Approximately 20 pl of serum was prepared and stored at -70°C until analysis. A terminal blood sample (ca 500 pl) was collected from isoflurane anesthetized mice and serum was prepared and aliquoted for the determination of serum total cholesterol, LDL-C, HDL-C and ALT. At termination a gross necropsy was performed, and the liver (excluding the left lateral liver lobe) and both kidneys were collected. Tissues were preserved in RNAIater for a period of 24-72 hours at 4°C, then snap frozen and subsequently stored at -80°C until analysis.
[0616] Table 1: Treatment groups and dosing concentrations of ‘In vivo tolerability and efficacy of ligand-saponin conjugates in kidney in a C57BL / 6J model’
[0617]
[0618] In vivo tolerability and efficacy of ASO-saponin conjugate in liver in a C57BL / 6J model Per group, 3-6 C57BL / 6J male mice, approximately 6 - 7 weeks at arrival and 8 - 9 weeks at dosing, were dosed. The study treatment groups and dosing concentrations are shown in Table 2. The mice were dosed intravenously (IV) in the lateral tail vein, at 5 ml / kg with dose volumes corresponding to the individual bodyweights. After dosage, mice were clinically monitored twice a day for 3 days. Serum samples were collected at pre-dose (-24 hours), and at 72 hr, 336 hr, and 672 hr post dosing for all animals in the study at those time points. Serum ApoB100 protein, LDL-C and ALT levels were determined from serum collected at termination. At termination a gross necropsy was performed, and the liver (excluding the left lateral liver lobe) and both kidneys were collected. Tissue samples were preserved in RNAIater for a period of 24-72 hours at 4°C, then snap frozen and subsequently stored at -80°C until analysis.
[0619] Table 2: Treatment groups and dosing concentrations of ‘In vivo tolerability and efficacy of ASO-saponin conjugate in liver in a C57BL / 6J model’
[0620]
[0621] In vivo tolerability and efficacy of ligand-saponin-PMO conjugates in kidney in a CD-1 model The study was conducted in 45 male CD-1 mice, which had been allocated to five dosing groups. Mice were dosed with the test compounds, according to Table 3. The mice were dosed intravenously (IV) in the lateral tail vein, at 5 ml / kg with dose volumes corresponding to the individual bodyweights. Body weights were determined at day -1 and mice were subsequently weighed weekly, and at termination. At termination a gross necropsy was performed, and the gastrocnemius (left and right), heart, diaphragm, liver (excluding the left lateral liver lobe), and both kidneys were dissected. All tissues were preserved in RNAIater for a period of 24 hours at 4°C, then snap frozen and subsequently stored at -80°C until analysis.
[0622] Table 3: Treatment groups and dosing concentrations of ‘In vivo tolerability and efficacy of ligand-saponin-PMO conjugates in kidney in a CD-1 model’
[0623]
[0624] One mouse in group 2 (day 28) died prematurely and was excluded from further analysis.
[0625] In vivo tolerability and efficacy of ligand-saponin conjugates in non-human primates (NHPs) Non-human primate (NHP) care and experimental procedures were performed in compliance with Council Directive No. 2010 / 63 / EU and French decree No. 2013-118. Non-naïve NHPs aged 50-76 months at dosing initiation were obtained from Noveprim (Mauritius). Before study initiation, NHPs were acclimated in-house for two weeks, and a complete clinical examination and full clinical pathology screening was performed.
[0626] Details of the study design are shown in Table 4. In brief, male NHPs received a single subcutaneous (s.c.) dose administration of 0.3 mg / kg ligand-siRNA at 1 ml / kg on day 1, which was for most groups combined with a single s.c. dose administration at 1 ml / kg of 3.0, 1.0 or 0.3 mg / kg ligand-saponin on day 1 or 0.1 mg / kg ligand-saponin at day 28. A general in-life assessment was performed daily with clinical and cage side observations and body weight measurements for each individual animal at least once every 2 weeks during the dosing period. Blood sampling was performed pre-dose and on D3, D7, D14, D16, D21, D23, D28, D30, D35, D38, D42, and D45 (= EoS) or (if possible) when the humane endpoint was reached. Blood was collected by venipuncture and processed either in the presence of anticoagulants into plasma or in the presence of a serum clotting activator into serum. Serum AT3 protein levels were measured by ELISA using the Human AT3 AssayMax™ ELISA Kit (AssayPro LLC), according to the manufacturer’s instructions. After sacrifice, all animals were subjected to a gross necropsy examination followed by tissue collection of various internal organs for histopathological analysis (brain, adrenal gland, heart, kidney, liver, lung, small intestine (ileum), spleen, stomach, thymus and injection site) or expression analysis (kidney and liver). Tissue samples collected for expression analysis were preserved in RNAIater for 24-72 hours at 4°C, then snap frozen, and subsequently stored at -80°C until analysis.
[0627] Female NHPs received a single subcutaneous (s.c.) dose administration of 3.0 or 10.0 mg / kg ligand-saponin at 1 ml / kg on day 1. A general in-life assessment was performed daily with clinical and cage side observations and body weight measurements for each individual animal at least once every 2 weeks during the dosing period. Blood sampling was performed pre-dose and on D3, D6, D9, D12, D14, and D15 (= EoS). Blood was collected by venipuncture and processed either in the presence of anticoagulants into plasma or in the presence of a serum clotting activator into serum, followed by an extensive clinical pathology panel assessing hematology, coagulation, and clinical chemistry.
[0628] Table 4: Treatment groups and dosing concentrations of ‘In vivo tolerability and efficacy of ligand-saponin conjugates in non-human primates (NHPs)’
[0629]
[0630]
[0631] * Ligand-siRNA is also referred to as Ligand-siAT3.
[0632] HEK293-FT cell treatment
[0633] HEK293-FT cells were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH) at 37°C and 5% CO2. Cells were seeded in a 24-well plate at 30.000 cells / well in 600 pl / well and in a 96-well plate at 5.000 cells / well in 100 pl / well and incubated overnight at 37°C. The next day, 10x concentrated compound-mix samples were prepared in DPBS. Additional culture medium was added to the wells (210 pl / well in the 24-well plate or 35 pl / well in the 96-well plate), followed by the addition of 90 pl compound-mix / well in the 24-well plate or 15 pl compound-mix / well in the 96-well plate. Cells were treated with compound-mix or DPBS as vehicle control for 72 hrs, without medium change, at 37°C. At the end of the experiment, cells from the 24-well plate harvested for gene expression analyses, and the 96-well plate was used for a cell viability measurement.
[0634] RNA isolation and cDNA synthesis
[0635] For mice kidney analysis, one murine kidney was used for tissue RNA analysis. The frozen kidney was put into a petri dish on dry ice and with a cold razorblade, cortex material was scraped off and transferred into a 2.0 ml (RNase free) safe-lock tube kept on dry ice. Next, the underlying medulla material was dissected, cut into smaller fragments and transferred into a second 2.0 ml (RNase free) safe-lock tube kept on dry ice. For mice liver and NHP kidney or liver analysis a 50-100 mg tissue sample was dissected, cut into smaller fragments and transferred into a 2.0 ml (RNase free) safe-lock tube kept on dry ice. All tissue material was homogenized in 1 ml TRIzol™ Reagent (Thermo Scientific), using a TissueLyser LT or TissueLyser II (Qiagen). For RNA isolation from cultured cells, the media was removed and the cells were directly homogenized in 1 ml TRIzol™ Reagent (Thermo Scientific), by repeated pipetting.
[0636] Total RNA was isolated using TRIzol® Reagent, according to the manufacturer’s instruction. Conversion into cDNA was performed using iScript™ cDNA Synthesis Kit (BioRad).
[0637] Gene expression analysis by qPCR
[0638] Gene expression levels were determined using quantitative real-time PCR assays (qRT-PCR) using iTaq™ Universal SYBR® Green Supermix (BioRad) and the Light Cycler 480 II (Roche Diagnostics) with specific DNA primers, listed in Table 5. Each analysis reaction was performed in triplicate, and the geometrical mean Ct value was used for expression analysis, using the ACt method.
[0639] For mouse derived samples, gene expression was determined relative to two housekeeping control genes (Mm Ppia and Mm Rps17). The relative ApoB expression level per treatment sample was subsequently normalized to vehicle treated samples (per timepoint). To verify cortex and medulla separation in the kidney samples, the relative expression of Slc5a2 (cortex selective gene, expressed in proximal convoluted tubule) and Slc22a13 (medulla selective gene, expressed in proximal straight tubule) were analyzed in both cortex and medulla samples. For cortex, the gene enrichment factor was determined by calculating the expression ratio of Slc5a2 in cortex / medulla for each sample individually, followed by an average enrichment calculation per study group and per study overall to determine average cortex gene enrichment factor. For medulla, the gene enrichment factor was determined by calculating the expression ratio of Slc22a13 in medulla / cortex for each sample individually, followed by an average enrichment calculation per study group and per study overall to determine average medulla gene enrichment factor.
[0640] For NHP derived samples, SERPINC1 expression was determined relative to two housekeeping control genes (Mf DDX3X and Mf TBP) and analysed as mean normalized expression (M. N. E.).
[0641] For cultured cells, HSP27 expression was determined relative to two housekeeping control genes (Hs HMBS and Hs BGUS). Subsequently, the relative HSP27 expression level of compound treated cells was normalized to that of DPBS treated cells x 100.
[0642] Table 5. Primers used in qPCR analysis
[0643]
[0644]
[0645] Exon skipping analysis by ddPCR
[0646] For exon skipping analysis, a droplet digital PCR (ddPCR) was performed using the ddPCR™ Supermix for Probes (BioRad) and the QX200 droplet reader (BioRad) with specific DNA primers / probes, listed in Table 6. Each analysis reaction was performed in duplicate. A ddPCR master mix was made containing per reaction 2.3 pl RNAse free water (PAN-Biotech), 11 µl of 2x ddPCR™ Supermix for Probes (BioRad), 0.198 µl of 100 µM forward primer, 0.198 µl of 100 µM reverse primer 1, 0.198 µl of 100 µM reverse primer 2, 0.055 µl of 100 µM probe 1, and 0.055 µl of 100 µM probe 2. To this 8 pl cDNA or 5 pl gBIock control + 3 pl RNAse free water was added to yield a total volume of 22 µl / well. Droplets were generated with the AutoDG - Droplet Generator (Bio-Rad). Next, the samples were subjected to a PCR run of 3 min at 25°C, 10 min at 95°C, 60 cycles of: 30 sec at 94°C and 1 min at 51 °C, followed by 10 min at 98°C, and an overnight incubation of the plate at 12°C. Droplets were analysed using the QX200 Droplet Reader (Bio-Rad) and QX Manager 1.2 Standard Edition Software (Bio-Rad) to determine the copies per µl (c / µl). Per sample, the percentage of PMO induced exon skipping was calculated by (skipped copies / sum of skipped and non-skipped copies) * 100 per 22 µl reaction volume, while taking the acceptance criteria into account. Acceptance criteria for each sample were: ‘Limit of Blank’ (LoB) = 2.15 skipped copies or 3.45 non-skipped copies per 22 pl reaction and ‘Limit of Quantification' (LoQ) = 5.00 skip copies per 22 pl reaction. Values below LoB were set at 0 and values between LoB and LoQ were set at LoQ / √2.
[0647] Table 6. Primers used in ddPCR analysis
[0648]
[0649] Cell viability assay (MTS)
[0650] After treatment the cells were incubated for 72 hr at 37°C before the cell viability was determined by a MTS-assay, performed according to the manufacturer’s instruction (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega). Briefly, the MTS solution was diluted 20x in DMEM without phenol red (PAN-Biotech GmbH) supplemented with 10% FBS. Treatment media was removed, after which 100 pl diluted MTS solution was added / well. The plate was incubated for approximately 20-30 minutes at 37°C. Subsequently, the OD at 492 nm was measured on a Thermo Scientific Multiskan FC plate reader (Thermo Scientific). For quantification the background signal of ‘medium only' wells was subtracted from all other wells, before the cell viability percentage of treated / untreated cells was calculated, by dividing the background corrected signal of treated wells over the background corrected signal of the untreated wells x 100.
[0651] FACS analysis
[0652] HEK293-FT cells were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech GmbH) and Pen / Strep (PAN-Biotech GmbH) at 37°C and 5% CO2. HepG2 and Huh7 cells were cultured in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (FBS) (PAN-Biotech GmbH), 1x Insulin-Transferrin-Selenium-Ethanolamine solution (ITS-X) (Thermo Scientific) and Pen / Strep (PAN-Biotech GmbH) at 37°C and 5% CO2. Cells were routinely cultured in a T75 flasks until approximately 90% confluency. For antibody staining, the cells were trypsinized (TryplE Express, Thermo Scientific) to single cells, and transferred to a 15 ml tube. Cells were collected by centrifugation, resuspended in culture media and counted. About 100.000-500.000 cells were transferred to round bottom polystyrene FACS tube and washed ones with cold DPBS supplemented with 2% FBS (DPBS + 2% FBS). The cells were centrifuged and resuspended in 200 pl DPBS + 2% FBS antibody solution, containing anti-human ASGPR1-PE (#SC-52623 PE, SantaCruz) or matched isotype control mouse lgG1-PE (#400122, BioLegend). Samples were incubated for 30 min. at 4°C. Afterwards, the cells were washed twice with cold DPBS + 2% FBS. If appropriate, cells were fixated for 20 min at room temperature using a 2% PFA solution in DPBS + 2% FBS, followed by another wash with cold DPBS+ 2% FBS. Cells were resuspended in cold DPBS for FACS analysis. Samples were measured on a Sysmex Cube 8 (Sysmex) or FACS Quanteon (Agilent) flow cytometry system and data was analyzed using FCS Express 7 Research edition or FACS Quanteon software. For expression analysis, the ASGPR1 signal per cell line was calculated as fold-signal increase compared to the isotype control signal of the same cell line.
[0653] Supplementary Materials and Methods - for examples 3, 10 - 14
[0654] STAT3 ASO (ASO-1)
[0655] A STAT3 antisense oligonucleotide (STAT ASO) with the following sequence and following modification [SEQ ID NO: 33]: 3*1*2*rrT*G*G*A*T*G*T*0*2*4*3, with 0 = 5-Methyl-dC, 1 = 2’MOE-5Me-rU, 2 = 2’MOE-rA, 3 = 2’MOE-5Me-rC, 4 = 2’MOE-rG, * = phosphorothioate, was produced by BioSpring Gesellschaft fur Biotechnologie GmbH, Germany, according to methods known in the art.
[0656] Malatl ASO (ASO-2) An antisense oligonucleotide targeting murine (Mm) Malatl mRNA, Malatl ASO [SEQ ID NO: 34], with the sequence and modifications (5’-C6-disulfide)-[4*3324G* 9*T*G* G*T*T* A*T*G* 231* 3*2]; with [1 = 2’-MOE-5Me-rU; 2 = 2’MOE-rA, 3 = 2’MOE-5Me-rC; 4 = 2’MOE-rG; 9 = 5-Methyl-dC; * = phosphorothioate] was custom-produced by BioSpring Gesellschaft fur Biotechnologie mbH, Germany, according to methods known in the art. This ASO was further modified to yield Malatl -S-S-PEG3-OH, as described.
[0657] STAT3 PMO (PMO-1)
[0658] A phosphorodiamidate morpholino oligomer targeting both murine and human STAT3a mRNA, inducing an isoform splice-switch from STAT3a mRNA to STAT3[3, thereby effectively reducing STAT3a mRNA levels (STAT3_ST2 PMO, 5’-ATTGCTGCAGGTCGTTCTGTAGG-‘3 [SEQ ID: 35]) was custom-produced by Gene Tools, LLC, according to methods known in the art.
[0659] hTfR1 expression analysis by FACS
[0660] HEK293FT cells were harvested and distributed at 1 x 105 / well in 100 pl in complete medium (DMEM + 10% FBS + penicillin / streptomycin); cells were left on ice for 20 min. Increasing doses of 3M12-hlgG1 diluted with DPBS in a final volume of 100 pl were added to cells for 1h at 4°C. After 2 washes (1000 rpm, 4°C) in FACS buffer (DPBS + 2% FBS), cells were incubated with anti-human PE coupled secondary antibody (Jackson ImmunoResearch #109-116-170) diluted in DPBS (1:1500). After 2 washes (1000 rpm, 4°C) in FACS buffer, cells were resuspended in 100 pl FACS buffer and the fluorescence was recorded in a NovoCyte Quanteon (Agilent) flow cytometer.
[0661] RNA isolation and quantitative gene expression analysis (HEK293FT cells)
[0662] Total RNA from cells was isolated using TRIzol™ Reagent (Thermo Scientific) according to the manufacturer’s instruction. Conversion into cDNA was performed using iScript™ cDNA Synthesis Kit (BioRad) using standard protocols. Gene expression levels of the gene of interest (GOI) and levels of specific housekeeping genes were determined using quantitative real-time PCR assays (qRT-PCR) using iTaq™ Universal SYBR® Green Supermix (BioRad) and the Light Cycler 480 II (Roche Diagnostics) with specific DNA primers, listed in Table 7. Each analysis reaction was performed in triplicate. Analysis was done by the ACt method to determine GOI expression relative to 2 specific housekeeping control mRNAs. Results are expressed as % relative GOI expression levels after normalization to DPBS treated control cells.
[0663] Table 7. Primers used in qPCR analysis (HEK293FT cells)
[0664]
[0665]
[0666] RNA isolation and gel analysis (HEK293FT cells)
[0667] Total RNA from cells was isolated using TRIzol™ Reagent (Thermo Scientific) according to the manufacturer’s instruction. Conversion into cDNA was performed using iScript™ cDNA Synthesis Kit (BioRad) using standard protocols. The gene expression was determined on 50 ng cDNA using the SapphireAmp Fast PCR Master Mix (Takara) with specific DNA primers, listed in Table 8. The PCR product was separated on a 2% agarose gel and fragments were analysed on the ChemiDoc XRS+ (BioRad) using Image Lab software (BioRad). For quantification of the % exon skip, the signal intensity of the splice switched product (260 bp) was divided over the total signal intensity of the non-switched + splice switched product (310 bp) x 100.
[0668] Table 8. Primers used in gel analysis (HEK293FT cells)
[0669]
[0670] RNA isolation and cDNA synthesis (vivo samples)
[0671] For mice kidney analysis, one murine kidney was used for tissue RNA analysis. The frozen kidney was put into a petri dish on dry ice and with a cold razorblade, cortex material was scraped off and transferred into a 2.0 ml (RNase free) safe-lock tube kept on dry ice. Next, the underlying medulla material was dissected, cut into smaller fragments and transferred into a second 2.0 ml (RNase free) safe-lock tube kept on dry ice. For mice heart and liver analysis a 50-100 mg tissue sample was dissected, cut into smaller fragments and transferred into a 2.0 ml (RNase free) safe-lock tube kept on dry ice. All tissue material was homogenized in 1 ml TRIzol™ Reagent (Thermo Scientific), using a TissueLyser LT or TissueLyser II (Qiagen). Total RNA was isolated using TRIzol® Reagent, according to the manufacturer’s instruction. Conversion into cDNA was performed using iScript™ cDNA Synthesis Kit (BioRad).
[0672] Exon skipping analysis by ddPCR
[0673] For exon skipping analysis, a droplet digital PCR (ddPCR) was performed using the ddPCR™ Supermix for Probes (BioRad) and the QX200 droplet reader (BioRad) with specific DNA primers / probes, listed in Table 6. Each analysis reaction was performed in duplicate.
[0674] For exon skip analysis in CD-1 mouse, a ddPCR master mix was made containing per reaction 5.3 µl RNAse free water (PAN-Biotech), 11 µl of 2x ddPCR™ Supermix for Probes (Bio-Rad), 0.198 µl of 100 µM forward primer, 0.198 µl of 100 µM reverse primer 1, 0.198 µl of 100 µM reverse primer 2, 0.055 µl of 100 µM probe 1, and 0.055 µl of 100 µM probe 2. To this 5 µl cDNA or gBIock control was added to yield a total volume of 22 µl / well. Droplets were generated with the AutoDG - Droplet Generator (BioRad). Next, the samples were subjected to a PCR run of 3 min at 25°C, 10 min at 95°C, 60 cycles of: 30 sec at 94°C and 1 min at 51 °C, followed by 10 min at 98°C, and an overnight incubation of the plate at 12°C. Droplets were analysed using the QX200 Droplet Reader (Bio-Rad) and QX Manager 1.2 Standard Edition Software (Bio-Rad) to determine the copies per µl (c / µl). Per sample, the percentage of PMO induced exon skipping was calculated by (skipped copies / sum of skipped and non-skipped copies) * 100 per 22 µl reaction volume, while taking the acceptance criteria into account. Acceptance criteria for each sample were: ‘Limit of Blank’ (LoB) = 2.15 skipped copies or 3.45 non-skipped copies per 22 pl reaction and ‘Limit of Quantification' (LoQ) = 5.00 skip copies per 22 pl reaction. Values below LoB were set at 0 and values between LoB and LoQ were set at LoQ / √2.
[0675] For exon skip analysis in hDMDdel52 / mdx mouse, a similar approach as applied for the CD-1 mouse model and as commonly known in the art was applied.
[0676] Material:
[0677] Anti-CD71 antibody (aCD71), clone R17 217.1.3 / TIB-219, targeting murine CD71 (transferrin receptor 1), was purchased from BioXCell (USA), or custom-produced by Wuxi XDC by using the R17 217.1.3 / TIB-219 Fab-encoding regions grafted onto a human lgG1 backbone and transiently expressed in CHO cells. Similarly, an anti-CD63-binding IgG targeting CD63 tetraspanin functioning as a cell surface receptor was produced by Wuxi XDC by grafting an NVG2-encoding Fab region onto a human lgG1 backbone and transiently expressed in CHO cells. Anti-human CD71 clone 3M12-lgG1 was produced by Biointron (China).
[0678] Ligand1-PMO (as referred to in Example 17)
[0679] Preparation of SPT-AH-maleimide also referred to as SO1861-AH-maleimide, SPT-EMCH, and SO1861-EMCH
[0680] SO1861 (2.20 g, 1.18 mmol, 1.00 equiv) and compound EMCH (N-(e-maleimidocaproic acid) hydrazide) (2.00 g, 5.90 mmol, 5.00 equiv, TFA (Trifluoroacetic acid) salt) were dissolved in MeOH (methanol) (50 mL), and trifluoroacetic acid (TFA, 538 mg, 4.72 mmol, 4.00 equiv) was added. The reaction mixture was stirred at 20 °C for 2 h, after which LC–MS analysis confirmed formation of the desired product. The crude mixture was purified by preparative HPLC under neutral conditions (column: Phenomenex Luna C18, 250 x 50 mm, 10 pm; mobile phase: water [10 mM NH4HCO3]–acetonitrile; gradient: 0–45% B over 3 min; flow rate: 100 mL / min). The purified fractions were combined and lyophilized to afford SPT-AH-Maleimide as a white solid (1.85 g, 0.895 mmol, 75.8% yield, 99% purity).
[0681] PMO PMO is purchased from WuXi AppTec (CN) and is synthesized according to standard procedures known in the art (see for example Paul & Caruthers, Synthesis of Backbone-Modified Morpholino Oligonucleotides Using Phosphoramidite Chemistry; Molecules, 2023, 28, pp.5380-5391, doi.org / 10.3390 / molecules28145380). The PMO was synthesized using solid-phase phosphoramidite chemistry, building the oligonucleotide chain in a 5' to 3' direction. The PMO consists of a chain of nucleotides as set forth by SEQ ID NO: 42 (GTGTCACCAGAGTAACAGTCTGAGTAGGAG). TMTH-sulfoximine-NHS ester
[0682] TMTH sulfoximine NHS ester was synthesized according to published literature (M. Timmers, et al., Exploring the Chemical Properties and Medicinal Applications of Tetramethylthiocycloheptyne Sulfoximine Used in Strain-Promoted Azide-Alkyne Cycloaddition Reactions, Pharmaceuticals 2023, 16, 1155, doi.org / 10.3390 / ph16081155), and following the following procedure:
[0683] Procedure for preparation of compound TMTH-sulfoximine-NHS
[0684] Compound 7 (1.00 g, 5.00 mmol) was dissolved in acetonitrile (ACN, 10 mL) and added to a solution of N,N'-disuccinimidyl carbonate (DSC, CAS 74124-79-1; 1.41 g, 5.52 mmol, 1.1 equiv) in ACN (20 mL) at 25 °C. The reaction mixture was stirred at 25 °C for 30 min under an atmosphere of N2. Thin-layer chromatography (TLC) indicated formation of the desired product. Four batches were combined for work-up.
[0685] The reaction mixture was diluted with petroleum ether (100 mL) and ethyl acetate (100 mL) and washed with H2O (3 x 100 mL). The aqueous layers were extracted with ethyl acetate (3 x 100 mL), and the combined organic extracts were washed with brine (100 mL), dried over anhydrous Na2SO4, and concentrated in vacuo. The crude product was triturated with ethyl acetate (20 mL) at 25 °C for 5 min to afford TMTH-sulfoximine-NHS as a white solid (4.40 g, 64.7% yield).
[0686] 1H NMR (400 MHz, CHLOROFORM-d) 5 ppm 3.93 (d, J = 14.2 Hz, 2H), 3.46 (br d, J = 14.2 Hz, 2H), 2.81 (s, 4H), 1.52 (s, 6H), 1.30 (s, 6H).
[0687] PMO-TMTH -sulfoximine
[0688] PMO was functionalized with the TMTH sulfoximine handle via an NHS ester-mediated conjugation reaction targeting the amine group at its 3’ end. The handle is conjugated to the PMO that consists of a chain of nucleotides as set forth by SEQ ID NO: 42.
[0689] Procedure for PMO-3'-TMTH-Sulfoximine Preparation
[0690] PMO (8 g, 793 µmol, 1 equiv) was dissolved in DMSO (dimethylsulfoxide) (100 mL) in reactor R1. In parallel, TMTH-sulfoximine-NHS (1.08 g, 3.17 mmol, 4 equiv) was dissolved in DMSO (60 mL) in reactor R2, and the resulting solution was transferred into reactor R1. To this mixture, 4-ethylmorpholine (274 mg, 2.38 mmol, 301 µL, 3 equiv) and powdered molecular sieves (12 g) were added, and the reaction was stirred at 50 °C for 80 h. Analysis of the crude mixture by UPLC-TOF (MT02311-11-R-P1A3) confirmed formation of the desired product with a crude purity of 75.85%. The reaction mixture was purified by reverse-phase HPLC (RP-HPLC), and the relevant fractions were pooled, concentrated by tangential flow filtration (2 h), and lyophilized to afford PMO-3'-TMTH-sulfoximine as a white solid (8.80 g, 91.92% purity by UPLC-TOF, 854 µmol, 68.7% yield).
[0691] RI7217-LALAPG-azide (also referred to as CD71 -azide) and NVG2-LALAPG-azide (also referred to as CD63-azide)
[0692] The RI7217-LALAPG-azide and NVG2-LALAPG-azide conjugates were synthesized following the same methodology. Consequently, only the detailed procedure for RI7217-LALAPG-azido is presented below. The aCD71 antibody (Ab) RI7217-LALAPG, consisting of the Fab-fragment of clone RI7217 as described in literature and a human lgG1a Fc-fragment with LALAPG mutations (70 mg, 11.97 mg / mL in 20 mM histidine acetate, 0.15 M NaCI, pH 5.5, after glycan removal via PNGase treatment) was mixed with 1x DPBS, pH 7.4 (11 mL) and 1M Tris pH 8.0 (2 mL), final pH was 8.18. Azido-PEG3-amine (600 eq., 4M in DMA (Dimethylacetamide), 2 mL) was added slowly at room temperature. Then, mTG (microbial transglutaminase) (8.55 mg / mL in 25 mM NaOAc (sodium acetat), pH 5.0, 29.53 U / mg, 2 mL) was added to the reaction mixture. The final concentration of Ab in the reaction solution was 3.77 mg / mL and mTG usage was 0.56 U / mg RI7217-LALAPG. The reaction solution was incubated at 37°C using a shaker at 60 rpm overnight. The solution was purified by HiTrap MabSelect SuRe (washing buffer: 25 mM Tris, 150 mM NaCI, pH 7.5, elution buffer: 0.1 M HOAc, pH 3.0). Collected fractions of interest were neutralized by 0.1 M arginine, 400 mM succinic acid, pH 9.2 and 1M Tris, pH 8.0) and pooled. From this, 68 mg RI7217-LALAPG-azido product was obtained with 97% yield, concentration at 6.05 mg / mL (determined by Nanodrop using EC280 of RI7217-LALAPG), LC-MS-determined DAR was ~2 and SEC purity was ~98 %.
[0693] RI7217-LALAPG-AcO-PMO (also referred to as CD71-PMO) and NVG2-LALAPG-AcO-PMO (also referred to as CD63-PMO)
[0694] The RI7217-LALAPG-PMO and NVG2-LALAPG-PMO conjugates were synthesized following the same methodology. Consequently, only the detailed procedure for RI7217-LALAPG-PMO is presented below. The Ab RI7217-LALAPG-azido (40 mg, 11.11 mg / mL in 20 mM Tris / Tris-HCI, 150mM NaCI, pH 7.2, 3.6 mL) was mixed with EDTA (200 mM in ultra-purified water, 88.8 µL to make 2 mM EDTA in reaction solution) and PMO-TMTH-sulfoximine (which was obtained as described in Example 10) (10 eq, 10 mg / mL in 5% DMSO aqueous solution, 5.19 mL) at room temperature. The final concentration of Ab in the reaction solution was 4.51 mg / mL. The reaction solution was incubated at 22°C using a shaker at 60 rpm for 1.5 h.
[0695] The solution was purified by HiTrap MabSelect SuRe (washing buffer: 20 mM Tris, 150 mM NaCI, pH 7.2, elution buffer: 0.1M glycine, pH 3.8). Collected fractions of interest were neutralized by saturated Na2HPO4, pooled and buffer exchanged to 50 mM phosphate buffer, 150 mM NaCI, pH 7.5 with an Amicon Ultracentrifugal Filter (MWCO 30 kDa, 15 mL). The solution was filtered through a 0.22 pm membrane. From this, 21 mg of RI7217-LALAPG-PMO product was obtained with 52% yield, concentration: 22 mg / mL (by BCA), MS-DAR 1.99 and SEC purity 98.36%.
[0696] RI7217-LALAPG-AcO-PMO-saponin (also referred to as CD71-PMO-saponin) and NVG2-LALAPG-AcO-PMO-saponin (also referred to as CD63-PMO-saponin)
[0697] The RI7217-LALAPG-PMO-saponin and NVG2-LALAPG-PMO-saponin conjugates were synthesized following the same methodology. Consequently, only the detailed procedure for RI7217-LALAPG-PMO is presented below.
[0698] RI7217-LALAPG-PMO was reacted with SPT-AH-maleimide (8 equiv, 10 mM in DMSO) via a thiol-ene reaction. The conjugation was performed using the enriched DAR4 technology, in which ZnCI2is employed to protect the hinge-region disulfide bonds from reduction, thereby allowing the thiol-ene reaction to occur predominantly at the heavy chain-light chain interfacial cysteines. Subsequent reduction of the antibody with TCEP, followed by addition of SPT-AH-maleimide, afforded RI7217-hlgG1-LALAPG-PMO-SPT conjugates containing four SPT moieties per antibody.
[0699] OKT9-lgG-SPT DAR6 also referred to as aCD71-SPT (DAR6) or hCD71-SO1861 (DAR6)
[0700] The mAb CD71 (also referred to as OKT9-lgG commercially purchased from BioXCell) was desalted into TBS pH 7.5 buffer and then normalized to 3 mg / ml. To an aliquot of CD71 (7.52 mg, 3.007 mg / ml, 5.1 x 10-5 mmol) was added an aliquot of freshly prepared TCEP solution (2.0 mg / ml, 4.95 mole equivalents, 25.2 × 10-5mmol), the mixtures vortexed briefly then incubated for 210 minutes at 20 °C with roller-mixing. After incubation (prior to addition of SPT-EMCH), a ca. 1 mg (0.340 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. These aliquots were characterized by UV-vis analysis and Ellman’s assay (Ab to SH ratio = 6.6). To the bulk Ab-SH was added an aliquot of freshly prepared SPT-EMCH solution (2 mg / ml, 2.0 mole equivalents per ‘thiol’, 6.12 × 10-4mmol), the mixtures vortexed briefly then incubated for 120 minutes at 20 °C. Besides, two aliquots of desalted Ab-SH (0.25 mg, 1.67 × 10-6mmol) were reacted with NEM (2.0 mole equivalents per ‘thiol’, 20 × 10-6mmol) or TBS pH 7.5 buffer for 120 minutes at 20 °C, as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.200 ml aliquot of Ab - SPT-EMCH mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls were characterized by Ellman’s assay to obtain SPT-EMCH incorporations. To the bulk Ab - SPT-EMCH mixture was added an aliquot of freshly prepared NEM solution (2.5 mg / ml, 7.5 mole equivalents, 3.8 × 10-4mmol) and the mixtures purified by zeba spin desalting columns eluting with DPBS pH 7.5 to give purified CD71 - SPT-EMCH conjugate. The product was concentrated using vivaspin T4 concentrators (3,000 g, 5 minutes, 5 °C), then normalized to 2.5 mg / ml and filtered to 0.2pm prior to dispensing.
[0701] The conjugate hCD71-SO1861 was obtained at a concentration of 2.50 mg / mL with a purity of 99.5%. The isolated yield was 4.8 mg, corresponding to 73% of the theoretical yield. The obtained SPT to antibody ratio (DAR) was 6.
[0702] RESULTS & DISCUSSION
[0703] EXAMPLE 1: Ligand-saponin and ligand-saponin-oligonucleotide markedly enhance the effector potency in kidney cortex and medulla
[0704] Efficient kidney delivery of oligonucleotide drugs remains challenging. In many cases, off-target effects and side-effects of high dosages preclude the development and translation of renal oligonucleotide therapies to the clinic. Oligonucleotides and saponins are small sized molecules, which are subject to rapid excretion through renal filtration. Kidneys are a primary site of oligonucleotide accumulation, accounting for up to 20% of the concentration of the total administered dose [Geary et al., 2015]. However, while it is acknowledged that oligonucleotide drugs accumulate in renal cells, the lack of efficacy indicates that they are not being efficiently delivered onto the RNA target in the cytoplasm or nucleus of the cells, likely due to intracellular (endosomal) entrapment in the renal cells. The presented herein experiments were initiated as a result of an unexpected observation made while performing in vivo targeted hepatic delivery experiments with low dosages of antisense oligonucleotide (ASO) effectors together with EEE saponins. While investigating efficacy and safety profile of intravenously administered GalNAc-targeted conjugates in mice, we have observed efficient knock-down of ApoB100 mRNA in the liver even at very low dosages of the ASO, which importantly was not associated with any observable toxicity effects in the liver and in the kidney, which are usually caused by accumulation of ASOs in these organs. We first have hypothesised that this positive effect was due to a combination of the liver-specific uptake of the GalNAc-conjugated ASO, the low dose and endosomal-escape enhanced properties provided by the saponin, as well as, based on the size of the conjugates, elimination of any ASO not captured by the liver cells through the filtration mechanism in the kidney. Surprisingly, however, when performing gene expression analysis in the kidney samples collected from the ASO and saponin-treated mice, we found that ApoB100 mRNA levels were also decreased in a dose-dependent level in the kidney, even despite the fact that GalNAc is not a kidneyspecific ligand and ApoB100 mRNA is not particularly abundantly expressed in kidney cells. This serendipitous and surprising finding shows that the ASO conjugate was not only taken up by the kidney cells despite the very low dose and liver-specific targeting, but also that in the presence of the saponin, the ASO was also effectively released in the kidney cell cytoplasm where it could act on its target mRNA instead of remaining unproductively trapped in the renal subcellular compartment.
[0705] Based on this unexpected observation, we have therefore sought to confirm and further investigate possibilities of efficient and enhanced delivery of endosomal escape enhancing ligand-saponin and ligand-saponin-oligonucleotide conjugates. To this end, C57BL / 6J mice were treated with either (1) an oligonucleotide targeting ApoB100 mRNA (ASO#02), (2) a ligand-ASO#02 conjugate or (3) a combination of ligand-ASO#02 conjugate and ligand-saponin (see Table 1 for details), where in this instance, the ligand is a not a kidney-cell specific ligand and the oligonucleotide is an antisense oligonucleotide with a fully phosphorothioated backbone and sugar puckering, also described as locked nucleic acid (LNA) or bridged nucleic acid (BNA). Treatments were well tolerated, and bodyweight and serum biomarkers of kidney function (creatinine) and liver function (ALT) were not affected by any of the applied treatments.
[0706] Relative ApoB mRNA expression was analyzed in kidney, divided into kidney cortex and kidney medulla, after 72 hr and 336 hr of treatment (Figure 1). To establish that cortex and medulla sections were separated, the gene enrichment of Slc5a2 (a cortex selective gene, expressed in proximal tubule (S1 )) was compared to Slc22a13 (a medulla selective gene, expressed in proximal tubule (S3)) in the respective samples. This analysis showed a clear enrichment of gene Slc5a2 in the cortex isolations and a clear enrichment of the Slc22a13 gene in the medulla isolations, confirming tissue separation in the analysis.
[0707] In both cortex and medulla, a reduction in ApoB mRNA expression is observed for all treatment groups compared to a vehicle (DPBS) treated group, at both 72 hr and 336 hr. Most strikingly, the absolute efficacy is highest after 72 hrs for the co-administration groups with ligand-saponin, while these groups were treated with the lowest effector dose or ligand-ASO#02 dose compared to the ASO#02 only group and the ligand-ASO#02 only group (Figure 1 A). Importantly, in this study, ASO#02 (2 mg / kg) and ligand-ASO#02 (1 mg / kg total dose, corresponding to 0.54 mg / kg ASO#02) were dosed with 37-and 10-times higher effector amounts, respectively, compared to the co-administration groups with ligand-saponin, where ligand-ASO#02 was dosed at only 0.1 mg / kg (corresponding to 0.054 mg / kg ASO#02). Yet, co-administration of ligand-saponin with ligand-ASO#02 clearly leads to the strongest enhancement of the ligand-ASO#02 efficacy. More importantly, the potency increases in a ligand-saponin dose dependent manner, i.e. the higher the ligand-saponin dose, the higher the reduction of ApoB mRNA while the ligand-ASO#02 dose remained constant at 0.1 mg / kg (see also Table 1 for absolute ASO dose and saponin dose per treatment group). Furthermore, this enhancing effect of ligand-saponin in cortex is durable as it is still observed at least 336 hr after treatment (Figure 1B). Taken together, these data show that ligand-saponin is markedly enhancing the potency of ligand-oligonucleotide in the kidney cortex.
[0708] Similarly, also in the kidney medulla, ligand-saponin co-administration improves oligonucleotide potency (Figure 1A). Here, ligand-saponin enables lowering the oligonucleotide dose about 37-fold compared to treatment with ASO#02 alone and 10-fold compared to treatment with ligand-ASO#02 alone while achieving comparable efficacy (Figure 1A), and prolonged co-administration treatment with ligand-saponin (336 hrs) dose dependently potentiates the ASO#02 efficacy in kidney medulla (Figure 1B).
[0709] To further show the ability of saponin compounds to enhance oligonucleotide efficacy in the kidney, the effect of direct saponin-to-oligonucleotide conjugation was studied using a saponinoligonucleotide conjugate, with a non-kidney cell specific ligand. Administering ligand-saponin-ASO#02 to mice showed that conjugation of the saponin to the oligonucleotide markedly enhances the potency in the kidney cortex (Figure 2A). Saponin-oligonucleotide conjugation markedly enhances the oligonucleotide potency, especially when taking into account the total administered oligonucleotide doses: 1 mg / kg ligand-saponin-ASO#02 conjugate only contains 0.44 mg / kg ASO#02, while 1 mg / kg ligand-ASO#02 contains 0.54 mg / kg ASO#02. Also in the kidney medulla a clear reduction in ApoB is observed for the saponin-oligonucleotide conjugate over the ligand-ASO#02 that does not comprise the saponin (Figure 2A). In both cortex and medulla, the potency enhancement of conjugated saponin-oligonucleotide (ligand-saponin-ASO#02) is durable, and is still observed after 336 hr of treatment (Figure 2B). In conclusion, these analyses showthat a saponin component, either when co-administered with an oligonucleotide or by (covalent) conjugation of the saponin to the oligonucleotide, strongly potentiates the efficacy of an antisense oligonucleotide in both kidney cortex and medulla.
[0710] EXAMPLE 2: Ligand-saponin enhances ligand-siRNA potency in non-human primate (NHP) kidneys
[0711] To show that the potentiating effect of saponin compounds translates to other oligonucleotide classes than fully phosphorothioated antisense oligonucleotides and translates efficacy also into higher species, the tolerability and efficacy of saponin compounds on ligand-siRNA potency in NHP (Macaca fascicularis) kidneys was examined.
[0712] To demonstrate tolerability, female NHPs received a single subcutaneous (s.c.) dose of 3 mg / kg or 10 mg / kg ligand-saponin (see Table 4 for details). These doses were well tolerated without any clinical observations, including acceptable tolerability as assessed in an extensive cl...
Claims
CLAIMS1. A therapeutic combination comprisingan oligonucleotide-based medicament adapted to target and bind to nucleic acid molecule present in cells of a blood filtering organ selected from kidney cells and spleen cells, anda saponin component comprising a saponin moiety that is a penta-cyclic triterpene saponin comprising an aglycone core of 12,13-dehydrooleanane type;the therapeutic combination for use in the treatment and / or prevention of a human disease, wherein the treatment and / or prevention comprises administration of the therapeutic combination to a human subject in the need thereof, wherein the saponin component and the oligonucleotide-based medicament are delivered into the blood filtering organ cells; andwherein the saponin component further comprises at least one non-saponin moiety that is covalently conjugated with the saponin moiety;wherein the at least one non-saponin moiety is a first ligand recognised by a first endocytic receptor present on the kidney cells.
2. Therapeutic combination for use according to claim 1, wherein the human disease is selected from any one or more of: a disease affecting the kidneys, a disease affecting the spleen, a disease affecting the liver, a disease affecting the pancreas, a disease affecting the skeletal and / or cardiac muscles, a disease affecting the heart, a cardiovascular disease, preferably wherein the human disease is a disease affecting the kidneys, more preferably wherein the human disease is a kidney disease; optionally wherein the human disease is a disease affecting the kidneys involving inflammation such as a kidney disease involving inflammation.
3. Therapeutic combination for use according to any one of claims 1 or 2, wherein the human disease is a disease affecting the kidneys and further affecting another organ selected from the spleen, the liver, the pancreas, the skeletal muscles, and / or the heart, preferably is a disease affecting the kidneys and the spleen, more preferably wherein the human disease is selected from Duchenne muscular dystrophy (DMD), Alport syndrome, cardiovascular-kidney-metabolic (CKM) syndrome, primary hyperoxaluria, rheumatoid arthritis, and diabetes such as type 2 diabetes mellitus, more preferably wherein the human disease is Duchenne muscular dystrophy (DMD) or Alport syndrome.
4. Therapeutic combination for use according to any one of claims 1 or 2, wherein the human disease is a kidney disease, preferably selected from any one or more of: Alport syndrome, APOL1 -Mediated Kidney Disease, acute kidney injury (AKI), chronic kidney disease (CKD), diabetic nephropathy (DN), unilateral ureteral obstruction (UUO), cardiovascular-kidney-metabolic (CKM) syndrome, glomerulonephritis (glomerular disease; GD), glomerulopathy such as complement 3 (C3) glomerulopathy (C3G), cystic kidney disease such as glomerulocystic kidney disease (GCKD), medullary cystic kidney disease (MCKD), nephronophthisis, and / or polycystic kidney disease (PKD)including autosomal dominant polycystic kidney disease (ADPKD) or autosomal recessive polycystic kidney disease (ARPKD), in particular ARPKD associated with PKHD1 gene mutation, congenital abnormality of the kidneys and urinary tract (CAKUT), end stage renal disease (ESRD; end-stage kidney disease; ESKD) including paediatric end stage renal disease (ESRD), lupus nephritis, minimal change disease (MCD), renal vasculitis, amyloidosis including primary amyloidosis or dialysis-related amyloidosis, interstitial nephritis, thrombotic thrombocytopenic purpura (TTP), hemolytic uremic syndrome (HUS), atypical hemolytic uremic syndrome (aHUS), IgA nephropathy, membranous nephropathy, cystinosis, Fabry disease, focal segmental glomerulosclerosis (FSGS), Goodpasture syndrome, and granulomatosis with polyangiitis (GPA), more preferably wherein the human disease is selected from Alport syndrome, APOL1 -Mediated Kidney Disease, acute kidney injury (AKI) and chronic kidney disease (CKD), or optionally is selected from kidney diseases involving inflammation such as acute kidney injury (AKI), chronic kidney disease (CKD).
5. Therapeutic combination for use according to claim 4, wherein the kidney disease is a monogenic kidney disease, preferably selected from any one of more of Alport syndrome, APOL1 -Mediated Kidney Disease, ADPKD, Cystinosis, Dent diseases and Fabry Disease, more preferably being Alport syndrome such as severe male X-linked Alport syndrome (XLAS).
6. Therapeutic combination for use according to any one of claims 1 or 2, wherein the human disease is a kidney disease caused by a viral infection, preferably being viral infection caused by a virus replicating in the kidney cells and wherein the oligonucleotide-based medicament is adapted to target and bind to a nucleic acid molecule being a viral nucleic acid molecule present in the kidney cells, more preferably wherein the kidney disease is caused by a polyomavirus such as BK virus and / or JK virus, or is caused by Epstein-Barr virus, or is caused by a cytomegalovirus, or is caused by an adenovirus, even more preferably wherein the kidney disease is caused by a polyomavirus, most preferably wherein the kidney disease is caused by a polyomavirus selected from BK virus and / or JK virus.
7. Therapeutic combination for use according to any one of the preceding claims, wherein the administration is selected from intravenous administration; subcutaneous administration; intraperitoneal administration; renal artery administration; retrograde renal vein administration; renal parenchyma administration; retrograde ureteral administration, preferably wherein the administration is selected from intravenous administration and subcutaneous administration.
8. Therapeutic combination for use according to any one of the preceding claims, wherein the oligonucleotide-based medicament further comprises a second ligand recognised by a second endocytic receptor, possibly wherein the second endocytic receptor is the same as the first endocytic receptor, further possibly wherein the second ligand is the same as the first ligand, alternatively wherein the second endocytic receptor differs from the first endocytic receptor with the proviso that the two different endocytic receptors are both present on the same kidney cells and / or spleen cells; preferably wherein the first ligand and / or the second ligand is / are a proteinaceous ligand, for example a naturally existingpeptide or protein ligand or a receptor-interacting part thereof, or is an antibody or a binding fragment thereof; optionally wherein the first ligand and / or the second ligand comprises one or more sugar moieties, preferably being or comprising GalNAc.
9. Therapeutic combination for use according to any one of the preceding claims, wherein the oligonucleotide-based medicament binds to a nucleic acid present in kidney cells, preferably selected from kidney cortex cells or kidney medulla cells, preferably being nephron cells, more preferably being cells of the renal corpuscle and / or the tubule epithelial cells, even more preferably being kidney cells selected from glomerular mesangial cells (MCs), glomerular endothelial cells (GECs), glomerular podocytes, proximal tubule epithelial cells (PTECs) and / or distal tubule epithelial cells (DTECs); or wherein the oligonucleotide-based medicament binds to a nucleic acid present in spleen cells, preferably selected from white pulp and / or marginal zone splenocytes, more preferably being selected from marginal zone macrophages, marginal zone dendritic cells, white pulp B-lymphocytes, white pulp T-lymphocytes, and white pulp macrophages; even more preferably being marginal zone macrophages or marginal zone dendritic cells, most preferably being marginal zone macrophages.
10. Therapeutic combination for use according to any one of the preceding claims, wherein the penta-cyclic triterpene saponin further comprisesan aldehyde function at position C-23 of the aglycone core, oran acid-sensitive covalent bond configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core, preferably wherein the acid-sensitive covalent bond is selected from any one or more of: hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, and preferably is a hydrazone bond.
11. Therapeutic combination for use according to any one of the preceding claims, wherein the penta-cyclic triterpene saponin is mono-desmosidic or bi-desmosidic, preferably comprising a first saccharide chain bound to a position C-3 of the aglycone core, more preferably wherein the first saccharide chain is selected from Group A listed in Table VI, even more preferably wherein the first saccharide chain comprises a glucuronic acid group, preferably a terminal glucuronic acid group, most preferably wherein the first saccharide chain comprises or is: Gal-(1^2)-[Xyl-(1^3)]-GlcA.
12. Therapeutic combination for use according to any one of the preceding claims, wherein the penta-cyclic triterpene saponin comprises the aglycone core selected from quillaic acid, gypsogenin, and an aldehyde-substituted derivative of either one of quillaic acid or gypsogenin defined as a quillaic acidbased or gypsogenin-based aglycone core, respectively, wherein the aldehyde function at position C-23 is substituted by the acid sensitive covalent bond configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core, preferably wherein the penta-cyclic triterpene saponin is selected from:AG1856, AG1, AG2, Agrostemmoside E, GE1741, Gypsophila saponin 1 (Gyp1), NP-017674, NP-017810, NP-003881, NP-017676, NP-017677, NP-017705, NP-017706, NP-017773, NP-017775, SA1657, Saponarioside B, SO1542, SO1584, SO1674, SG1700, SO1730, SO1772, SO1832, SO1861, SO1862, SO1904, QS-7, QS-7 api, QS-17, QS-18, QS-21 A-apio, QS-21 A-xylo, QS-21 B-apio and QS-21 B-xylo, or the aldehyde-substituted derivative of any one thereof, respectively; orwherein the penta-cyclic triterpene saponin is selected from:SA1641, gypsoside A, NP-017772, NP-017774, NP-017777, NP-017778, NP-018109, NP-017888, NP-017889, NP-018108 and SO1658, or the aldehyde-substituted derivative of any one thereof, respectively.
13. Therapeutic combination for use according to any one of the preceding claims, wherein the penta-cyclic triterpene saponin is isolated from Saponaria officinalis, and is preferably any one or more of Saponarioside B, SO1542, SO1584, SO1658, SO1674, SG1700, SO1730, SO1772, SO1832, SO1861, SO1862 and SO1904, more preferably any one or more of SO1832, SO1861 and SO1862, even more preferably SO1832 or SO1861, most preferably SO1861.
14. Therapeutic combination for use according to any one of the preceding claims, wherein the saponin moiety is covalently conjugated with the at least one non-saponin moiety via an acid-sensitive covalent bond that breaks under acidic conditions, preferably being an acid-sensitive covalent bond at the position C-23 of the aglycone core, more preferably wherein the acid sensitive covalent bond at the position C-23 of the aglycone core is configured to break under acidic conditions so as to create the aldehyde function at position C-23 of the aglycone core thus resulting in a release of the penta-cyclic triterpene saponin comprising the aldehyde function at the position C-23 of the aglycone core from the non-saponin moiety, even more preferably wherein the acid-sensitive covalent bond is selected from any one or more of: a hydrazone bond, a semicarbazone bond, an imine bond, an acetal bond including a 1,3-dioxolane bond, a ketal bond, an ester bond, and / or an oxime bond, most preferably being a hydrazone bond,and / or wherein the saponin moiety is covalently conjugated with the at least one non-saponin moiety by an acid-stable bond, preferably via a glucuronic acid group if said group is present.
15. Therapeutic combination for use according to any one of the preceding claims, wherein the non-saponin moiety further comprises any one or more of:a linker,the oligonucleotide-based medicament, and / ora scaffold molecule,preferably, wherein the saponin moiety is directly covalently conjugated with the linker, more preferably wherein the linker comprises or is covalently conjugated to the saponin moiety via the acid sensitive covalent bond, more preferably at the position C-23 of the aglycone core, or via the acid-stable bond, preferably at the glucuronic acid group if said group is present;even more preferably wherein the linker is further covalently conjugated to the first ligand and / or to the oligonucleotide-based medicament.
16. Therapeutic combination for use according to any one of the preceding claims, wherein the saponin moiety is covalently conjugated with the non-saponin moiety further comprising the oligonucleotide-based medicament, which covalent conjugation results in a conjugate further termed a saponinoligonucleotide conjugate, preferably wherein the saponin-oligonucleotide conjugate further comprises the linker, more preferably wherein the linker is directly covalently conjugated to the saponin moiety.
17. Therapeutic combination for use according to any one of the preceding claims, wherein the administration comprises provision to the human subject of the oligonucleotide-based medicament and of the saponin component which are either co-formulated in a single pharmaceutical composition, or which are formulated separately as at least two pharmaceutical formulations that can be administered either simultaneously or sequentially, preferably, wherein first the second pharmaceutical formulation is administered and subsequently the first pharmaceutical formulation is administered after an interval of at least 1 day, preferably at least one week, more preferably at least one month, most preferably at least 3-6 months, wherein the first pharmaceutical formulation comprises the saponin component and wherein the second pharmaceutical formulation comprises the oligonucleotide-based medicament, possibly, wherein the administration is further followed after an interval of at least 1 day, preferably at least one week, more preferably at least one month, most preferably at least 3-6 months, with a boosting administration of the saponin component that is further referred to as a booster, e.g. when the at least two pharmaceutical formulations are previously administered simultaneously.
18. Therapeutic combination for use according to claim 17, wherein the administration comprises provision of the single pharmaceutical composition selected from any one or more of the following:2-component targeted-saponin formulation defined as comprising the saponin component, wherein the saponin moiety is covalently conjugated with the first ligand, preferably wherein the non-saponin moiety further comprises the linker; and wherein the 2-component targeted-saponin formulation further comprises the oligonucleotide-based medicament that possibly comprises the second ligand of claim 8;1 -component formulation defined as comprising the saponin-oligonucleotide conjugate of claim 16.
19. Therapeutic combination for use according to claim 17, wherein the administration comprises provision of the at least two pharmaceutical formulations comprising a combination of the first pharmaceutical formulation with the second pharmaceutical formulation, preferably being a targeted-saponin combination defined as comprising the first pharmaceutical formulation, wherein the saponin component comprises the saponin moiety, wherein the saponin moiety is covalently conjugated with the first ligand, and preferably wherein the non-saponin moiety further comprises the linker, and the secondpharmaceutical formulation, wherein the oligonucleotide-based medicament possibly comprises the second ligand of claim 8.
20. Therapeutic combination for use according to any one of the preceding claims, wherein the oligonucleotide-based medicament comprises a DNA-based therapeutic oligonucleotide and / or RNA-based therapeutic oligonucleotide and / or a nucleic acid analogue-based therapeutic oligonucleotide comprising one or more nucleotide or nucleoside analogues and / or backbone modifications, preferably selected from: DNA aptamer, DNA antisense oligonucleotide (ASO, AON), RNA ASO, siRNA, miRNA, RNA miRNA inhibitor (anti-microRNA, anti-miRNA, anti-miR) and / or RNA miRNA inhibitor ASO, RNA aptamer, ribozyme, RNA decoy, short hairpin RNA (shRNA), anti-hairpin-shaped microRNA; or mixed DNA / RNA therapeutic, preferably comprising one or more of the following analogues or modifications: phosphoramidate morpholino oligomer (PMO, Morpholino), peptide nucleic acid (PNA), phosphorothioate-modified antisense oligonucleotide (PS-ASO), antisense oligonucleotides containing phosphoryl guanidine (PN) backbone linkages (PN-ASO; PGO); 2'-O-methyl (2-OMe) phosphorothioate RNA, 2-O-methoxyethyl (2′-O-MOE) RNA (2’-O-methoxyethyl-RNA (2-MOE, MOE)), locked nucleic acid (LNA, bridged nucleic acid, BNA; for example 2’-O,4’-aminoethylene bridged nucleic acid (BNA-NC), BNA-based siRNA, BNA-based antisense oligonucleotide (BNA-ASO), BNA-based anti-microRNA etc.), 2'-O, 4'-C-ethylene-bridged nucleic acid (ENA), 2’-deoxy-2’-fluoroarabino nucleic acid (FANA), 3’-fluoro hexitol nucleic acid (FHNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), more preferably wherein the oligonucleotide-based medicament comprises or consists of mixed DNA / RNA and / or synthetic nucleic acid therapeutic selected from: synthetic ASO, substantially DNA-based synthetic ASO, substantially RNA-based synthetic ASO preferably comprising 2'-MOE modification, substantially DNA-based synthetic aptamer, substantially RNA-based synthetic aptamer, synthetic gapmer, synthetic siRNA, synthetic miRNA, synthetic anti-miRNA and / or synthetic anti-miRNA ASO.
21. Therapeutic combination for use according to any one of the preceding claims, wherein the oligonucleotide-based medicament targets a gene and / or gene transcript selected from: DMD / dystrophin gene, HSP27, ApoB, SERPINC1 (AT3), SGLT2, TP53 (P53), EGFP, MAPK1, P38A MAPK, P65 AQP1, SMAD4, COX2, CASPASE 3, FAS, TLR9, TGF-1B, C3, RELB, CD40, VEGF, KRAS, MTORC, RAGEMIR21, MIR192, MIR204, MIR107, MIR668, TNF-a, TNFR, TLR4, TLR2, MyD88, TLR4, TLR2, MyD88, NOD1, NOD2, COL4A5, STAT3, and / or MALAT1; preferably DMD / dystrophin gene, HSP27, ApoB, SERPINC1 (AT3), SGLT2, TP53 (P53), COL4A5, STAT3, and / or MALAT1.
22. Therapeutic combination for use according to any one of the preceding claims, wherein the first endocytic receptor and / or the second endocytic receptor is a kidney cell specific receptor and / or is selected from megalin (LRP2 receptor), cubilin, PTH1R, CD63, and CD71 (transferrin receptor), or is a spleen-cell specific receptor and / or is selected from macrophage receptor with collagenous structure (MARCO), SIGN-R1, and DC-SIGN.
23. Therapeutic combination for use according to any one of the preceding claims, wherein the first ligand and / or the second ligand is selected from:- antibody or a binding fragment thereof binding to any one of the receptors listed in claim 22; - natural ligand or a fragment thereof recognised by any one of the receptors listed in claim 22; and / or wherein the first ligand and / or the second ligand is selected from:- megalin ligand such as EGF;- cubilin ligand such as FGF;- megalin and cubilin binder such as albumin;- transferrin (Tf) or a fragment thereof recognised by CD71;- parathyroid hormone receptor 1 R (PTH1R) ligand such as PTH-related protein (PTHrP); - non-specific kidney ligand preferably comprising one or more GalNAc moieties.
24. Therapeutic combination for use according to any one of the preceding claims, wherein the first ligand and / or the second ligand is a proteinaceous ligand, preferably a peptide or protein ligand or a receptor-interacting part thereof, more preferably wherein the ligand is an antibody or a binding fragment thereof, such as a F(ab')2 fragment, Fab' fragment, Fab fragment, scFv, dsFv, scFv-Fc, reduced IgG (rlgG), minibody, diabody, triabody, tetrabody, Fc fusion protein, nanobody, variable V domain, a singledomain antibody (sdAb), preferably a VHH, for example camelid VH, or a humanized VHH with a human (lgG1 -derived) Fc and / or humanized VHH-Fc antibody, preferably wherein the ligand is a humanized VHH-Fc dimer antibody.
25. Therapeutic combination for use according to any one of the preceding claims, wherein the saponin component is based on SO1861 saponin and the first ligand and / or the second ligand is selected from: albumin or EGF or a VHH-Fc antibody targeting CD71.
Citation Information
Patent Citations
Recombinant antibodies for human therapy
US5693780A
Saponin conjugated to epitope-binding proteins
WO2020126064A1
Antibody-drug conjugate with improved therapeutic window
WO2020126600A1
Saponin conjugates
WO2020126604A1
Drug conjugate
WO2020126609A2