Methionine sulfoxide reductase b1 inhibitor and anticancer composition comprising same
Compounds inhibiting MsrB1 activity address the challenge of tumor growth by promoting M1 macrophage differentiation and enhancing immune response, effectively suppressing cancer progression.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-10-20
- Publication Date
- 2026-04-30
AI Technical Summary
Current treatments for cancer lack effective mechanisms to inhibit the activity of methionine sulfoxide reductase B1 (MsrB1), which contributes to tumor growth and angiogenesis by promoting M2 macrophage differentiation and supporting cancer cell survival and metastasis.
Development of compounds such as 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide and 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one, which inhibit MsrB1 activity, thereby inhibiting M2 macrophage differentiation and suppressing cancer cell growth by targeting key signaling pathways like CREB, STAT3, and immune checkpoint proteins.
These compounds effectively inhibit tumor growth and metastasis by promoting M1 macrophage differentiation, reducing angiogenesis factors, and enhancing immune response against cancer cells, demonstrating potential as anticancer agents.
Smart Images

Figure KR2025016633_30042026_PF_FP_ABST
Abstract
Description
Methionine sulfoxide reductase B1 inhibitor and anticancer composition containing the same
[0001] The present invention relates to a methionine sulfoxide reductase B1 inhibitor and an anticancer composition containing the same, and more specifically, to an MsrB1 inhibitor, 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide or 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one, and an anticancer composition containing the same It is about.
[0002]
[0003] Aerobic organisms that breathe oxygen utilize oxygen molecules as terminal transporters in the process of oxidative phosphorylation for energy production, generating reactive oxygen species in the process. Due to their high reactivity, reactive oxygen species such as superoxide anions and hydroxyl radicals affect the integrity of DNA, proteins, and cell membranes in vivo; they can cause damage by damaging nucleic acids to induce mutations or by causing structural changes in proteins and lipids through oxidation (Schallreuter, KU, et al., Biochemical and biophysical research communications, 342(1):145-152, 2006).
[0004] Recently, it has been reported that the absence of reactive oxygen species in vivo or the loss of homeostasis affects aging and related diseases, and that reactive oxygen species not only play a negative role in the body but are also involved in intracellular signaling processes and metabolic regulation (Sauer, H. and M. Wartenberg, Antioxidants & redox signaling, 7(11-12):1423-1434, 2005).
[0005] To prevent protein damage caused by reactive oxygen species, organisms express antioxidant enzymes such as superoxide dismutase and glutathione; one of these antioxidant enzymes, methionine sulfoxide reductase (Msr), plays a role in reducing the oxidized form, methionine sulfoxide (MetO), to methionine (Met). Since methionine residues, along with cysteine, are sulfur-containing amino acids and are sensitive to oxidative stress, they are easily oxidized to MetO; therefore, organisms have developed a mechanism to reduce Met residues through Msr (Kantorow, M., et al., Proceedings of the National Academy of Sciences, 101(26):9654-9659, 2004). In addition, it has recently been reported that the reversible regulation of MetO through Msr plays a role in protecting against oxidative stress as well as regulating biological processes (Lim, JM, et al., Neurochemical research, 44: 247-257, 2019).
[0006] In mammals, methionine sulfoxide reductase B1 (MsrB1) is a selenoprotein located in the cytoplasm and nucleus that reduces Met-RO back to methionine in proteins. Studies have been conducted on the association between MsrB1 and innate immunity, and it has been reported that macrophages, the major constituent cells of innate immunity, reconstruct the structural framework for external antigen responses through the mutual regulation of Mical and MsrB1 (Lee, BC, et al., Molecular cell, 51(3):397-404, 2013). In addition, it has been suggested that MsrB1 may be involved in the inhibition and regulation of inflammatory responses through cytokine secretion, as the expression of anti-inflammatory cytokines such as IL-10 and IL-1ra decreases and the expression of inflammatory cytokines such as IL-12a and IL-12b increases when MsrB1 is deleted (Lee, BC, et al., Scientific reports, 7(1): 5119, 2017).
[0007] In addition to macrophages, the role of MsrB1 in dendritic cells, another component of innate immunity, has been investigated. In dendritic cells, MsrB1 influences cell maturation and antigen presentation, activation of co-stimulatory functions, IL-12 production and STAT6 activation, and differentiation into Th1 cells (Lee, H.-J., et al., Antioxidants, 9(10): 1021, 2020). Furthermore, since methionine can directly donate methyl groups and methyl groups are necessary for DNA synthesis, the possibility that MsrB1 is involved in the growth of cancer cells has been investigated (Szende, B. and E. Tyihak, Cell Biology International, 34(12):1273-1282, 2010).
[0008]
[0009] Accordingly, the present invention confirmed that MsrB1 induces differentiation and functional activity into M2 tumor-associated macrophages, which can affect tumor growth, differentiation, survival, and angiogenesis in a tumor environment, and selected an MsrB1 inhibitor capable of suppressing this. Furthermore, the present invention was completed by confirming that the selected MsrB1 inhibitor effectively inhibits tumor growth.
[0010]
[0011] Therefore, the objective of the present invention is to provide a compound having MsrB1 inhibitory activity.
[0012] Another objective of the present invention is to provide an anticancer composition comprising a compound having the above-mentioned MsrB1 inhibitory activity.
[0013]
[0014] In order to achieve the aforementioned purpose,
[0015] The present invention relates to a method for inhibiting the activity of methionine sulfoxide reductase B1 (MsrB1),
[0016] Provides 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide) represented by the following chemical formula 1, or a pharmaceutically acceptable salt thereof.
[0017] [Chemical Formula 1]
[0018]
[0019] In addition, the present invention inhibits the activity of methionine sulfoxide reductase B1 (MsrB1),
[0020] Provides 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one represented by the following chemical formula 2, or a pharmaceutically acceptable salt thereof.
[0021] [Chemical Formula 2]
[0022]
[0023]
[0024] In order to achieve other purposes,
[0025] The present invention provides a pharmaceutical composition for the prevention or treatment of cancer, or a health functional food composition for the prevention or improvement of cancer, comprising as an active ingredient a compound that inhibits the activity of methionine sulfoxide reductase B1.
[0026] In a preferred embodiment of the present invention, the compound can inhibit M2 differentiation and activity of macrophages and promote M1 differentiation.
[0027] In another preferred embodiment of the present invention, the MsrB1 inhibitor can inhibit the growth or metastasis of cancer cells by inhibiting the phosphorylation of CREB (cAMP Response Element-Binding Protein), inhibiting the phosphorylation of STAT3, inhibiting the expression of angiogenesis factors VEGFA and BCL-2, inhibiting the expression of chemokines associated with cancer progression and metastasis such as CCL17 and CCL22, or inhibiting the expression of the immune checkpoint protein PD-L1.
[0028] In another preferred embodiment of the present invention, the cancer may be lung cancer, pancreatic cancer, brain tumor, liver cancer, blood cancer, skin cancer, colorectal cancer, bone marrow cancer, breast cancer, osteosarcoma, melanoma, blood cancer, or rectal cancer.
[0029]
[0030] In this invention, novel compounds that inhibit MsrB1 activity were selected, and it was confirmed that the MsrB1 inhibitor of this invention inhibits differentiation into tumor-friendly M2 macrophages and inhibits tumor growth. In other words, since it was confirmed that the MsrB1 inhibitor of this invention exhibits an anticancer effect through immune control in the tumor microenvironment, it can be usefully utilized as a composition for cancer treatment.
[0031]
[0032] Figure 1 is data verifying MsrB1 inhibitors, which indirectly determines the activity of MsrB1 by measuring NADPH consumption to confirm the activity of the inhibitors (compounds represented by Chemical Formula 1 and compounds represented by Chemical Formula 2).
[0033] Figure 2 is data confirming that differentiation into M2 macrophages was inhibited using the M2 marker (CD206) when treated with an MsrB1 inhibitor (a compound represented by Chemical Formula 1) after stimulation with TCM (Tumor conditioned media).
[0034] Figure 3 shows data confirming that mRNA expression of M2 macrophage-related markers IL-10 and Arg1 was suppressed when an MsrB1 inhibitor was administered after stimulation with TCM. Gene expression levels were compared after standardization with GAPDH.
[0035] Figure 4 shows data confirming the expression levels of tumor-friendly transcription factors when macrophages and tumor cells were co-cultured and then treated with an MsrB1 inhibitor. Figure 4a shows the inhibition of phosphorylation of CREB (cAMP Response Element-Binding Protein), Figure 4b shows the inhibition of phosphorylation of STAT3, Figure 4c shows the inhibition of expression of angiogenesis factors VEGFA and BCL-2, inhibition of expression of chemokines associated with cancer progression and metastasis such as CCL17 and CCL22, and Figure 4d shows the inhibition of expression of the immune checkpoint protein PD-L1.
[0036] Figure 5 is data confirming that tumor growth was inhibited when an animal model of a xenograft tumor was treated with an MsrB1 inhibitor or MsrB1 knockout was performed.
[0037] Figure 6 is data confirming that when an animal model of a xenograft tumor was treated with an MsrB1 inhibitor or MsrB1 knockout was performed, the proportion of immune cells, such as M1 macrophages, NK, and NKT cells, increased.
[0038]
[0039] The present invention will be described in detail below.
[0040]
[0041] In one aspect, the present invention,
[0042] Inhibits methionine sulfoxide reductase B1 (MsrB1) activity,
[0043] The invention relates to 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide) represented by the following chemical formula 1, or a pharmaceutically acceptable salt thereof.
[0044] [Chemical Formula 1]
[0045]
[0046] The present invention, in another aspect,
[0047] Inhibits methionine sulfoxide reductase B1 (MsrB1) activity,
[0048] The invention relates to 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one represented by the following chemical formula 2, or a pharmaceutically acceptable salt thereof.
[0049] [Chemical Formula 2]
[0050]
[0051]
[0052] In another aspect, the present invention,
[0053] 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide) represented by the above chemical formula 1 or a pharmaceutically acceptable salt thereof; and
[0054] The present invention relates to a pharmaceutical composition for the prevention or treatment of cancer, or a health functional food composition for the prevention or improvement of cancer, comprising as an active ingredient one or more methionine sulfoxide reductase B1 (MsrB1) inhibitors selected from the group consisting of 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one represented by the above chemical formula 2 or pharmaceutically acceptable salts thereof.
[0055] In the present invention, the MsrB1 inhibitor can inhibit M2 differentiation and activity of macrophages and promote M1 differentiation.
[0056] In the present invention, the MsrB1 inhibitor can inhibit the growth or metastasis of cancer cells by inhibiting the phosphorylation of CREB (cAMP Response Element-Binding Protein), inhibiting the phosphorylation of STAT3, inhibiting the expression of angiogenesis factors VEGFA and BCL-2, inhibiting the expression of chemokines associated with cancer progression and metastasis such as CCL17 and CCL22, or inhibiting the expression of the immune checkpoint protein PD-L1.
[0057]
[0058] In the present invention, the cancer may be lung cancer, pancreatic cancer, brain tumor, liver cancer, blood cancer, skin cancer, colorectal cancer, bone marrow cancer, breast cancer, osteosarcoma, melanoma, blood cancer, or rectal cancer.
[0059]
[0060] The pharmaceutical compositions of the present invention may be formulated into various forms according to conventional methods and used. For example, they may be formulated into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, and syrups, and may be formulated into external preparations, suppositories, and sterile injectable solutions. Depending on each formulation, they may further include pharmaceutically acceptable carriers, excipients, and diluents. Additionally, they may be formulated into external preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, and sterile injectable solutions according to conventional methods and used.
[0061] The above carriers, excipients, and diluents include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. When the above pharmaceutical composition is formulated or prepared, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
[0062] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc., with the above composition. In addition to simple excipients, lubricants such as magnesium styrate and talc are also used. Liquid dosage forms for oral administration include suspensions, oral liquids, emulsions, syrups, etc., and may include various excipients, such as humectants, sweeteners, flavorings, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, etc. As non-aqueous solvents and suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cocoa paste, laurin paste, glycerogelatin, etc. may be used.
[0063] The term "administration" as used in the present invention means providing the pharmaceutical composition of the present invention to an individual by any appropriate method. The pharmaceutical composition of the present invention may be administered at a therapeutically effective dose, which is the amount of the active ingredient or pharmaceutical composition that induces a biological or medical response in a tissue system, animal, or human as conceived by a researcher, veterinarian, physician, or other clinician, i.e., an amount that induces the alleviation of symptoms of the disease or disorder being treated. It is obvious to those skilled in the art that the therapeutically effective dose and frequency of administration for the pharmaceutical composition of the present invention will vary according to the desired effect. Therefore, the optimal dose to be administered can be easily determined by those skilled in the art and may be adjusted according to various factors including the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of formulation, the patient's age, body weight, general health condition, gender and diet, the time of administration, the route of administration and the secretion rate of the composition, the duration of treatment, and drugs used concurrently. The pharmaceutical composition of the present invention may be administered to an individual by various routes. For example, it may be administered intravenously, intraperitoneally, intramuscularly, intra-arterially, orally, intracardiaclysmically, intramedullaryly, transdermally, intestinally, subcutaneously, sublingually, or topically, but is not limited thereto. The pharmaceutical composition of the present invention may be administered in an amount of 1 to 10,000 mg / kg / day, and may be administered once a day or divided into several doses.
[0064]
[0065] The health functional food composition of the present invention may be used as a health functional food, a food additive, or a dietary supplement. When the composition of the present invention is used as a food additive, it may be appropriately used according to conventional methods, such as by adding it as is or by mixing it with other foods or food ingredients.
[0066] In addition, the amount of the above-mentioned health functional food composition may be appropriately changed according to the purpose of use (prevention, health, or therapeutic treatment). As a specific example, when manufacturing food or beverages, the composition of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, relative to the raw materials. However, when consumed for a long period for the purpose of health and hygiene or for health control, it may be added in an amount less than the above range, and since there are no issues regarding safety, the active ingredient may also be used in an amount greater than the above range.
[0067] There are no special restrictions on the types of food mentioned above, but examples of food to which the composition of the present invention can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and include all health foods in the conventional sense.
[0068] When the health functional food composition of the present invention is manufactured into a beverage, it may include additional ingredients such as various flavoring agents or natural carbohydrates, as in conventional beverages. The natural carbohydrates may include monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; natural sweeteners such as dextrin and cyclodextrin; and synthetic sweeteners such as saccharin and aspartame. The natural carbohydrates are included in an amount of 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight, based on the total weight of the food composition of the present invention.
[0069] The health functional food composition of the present invention may include various nutritional agents, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., and may include fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages, but is not limited thereto. These ingredients may be used independently or in combination. Although the proportion of the above additives is not significantly limited, it is preferable that they be included in the range of 0.01 to 0.1% by weight relative to the total weight of the food composition of the present invention.
[0070]
[0071] The present invention will be explained in more detail below through examples.
[0072] These examples are solely for illustrating the invention, and it will be obvious to those skilled in the art that the scope of the invention is not to be interpreted as being limited by these examples.
[0073]
[0074] Example 1: Selection of MsrB1 Inhibitors
[0075] In a previous study, the inventors of the present invention developed a redox enzyme-based fluorescent biosensor for identifying MsrB1 inhibitors (Korean Patent Application No. 10-2024-0118107; Hyun Bo Shimet. al., Antioxidants, 13(11):1348, 2024). High-throughput screening of chemical compounds using the biosensor was performed to screen for MsrB1 inhibitors, and a total of 6,868 compounds provided by the Korean Chemical Bank were used for screening.
[0076] Among them, 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide represented by the following chemical formula 1, and
[0077] 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one, represented by the following chemical formula 2, was selected.
[0078] [Chemical Formula 1]
[0079]
[0080] [Chemical Formula 2]
[0081]
[0082]
[0083] Example 2: Confirmation of MsrB1 inhibitory activity of selected MsrB1 inhibitors
[0084] To confirm the activity of the two MsrB1 inhibitors selected in <Example 1> above, the activity of MsrB1 was indirectly determined by measuring NADPH consumption. MsrB1 reduces its substrate, methionine sulfoxide, while being oxidized itself; the oxidized MsrB1 is then reduced again by the thioredoxin (Trx) protein. In this process, the oxidized Trx is reduced again by Trx reductase, and NADPH is used as a co-factor. Since NADPH has an absorbance at a wavelength of 340 nm, changes in the enzymatic activity of MsrB1 for the inhibitor candidates were measured using a spectrophotometer. That is, depending on the activity of MsrB1, NADPH is converted to NADP and its amount decreases, and this reduced amount of NADPH can be measured at 340 nm.
[0085] Specifically, the activity of MsrB1 was evaluated for 900 seconds in 20 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES) buffer at pH 7.5 and 37°C. To the reaction mixture, 500 μM N-Acetyl-MetO (N-acetylated methionine sulfoxide, N-AcMetO), 6 μM MsrB1, 2 μM mouse thioredoxin, 1 μM mouse thioredoxin reductase, 50 μM NADPH, and approximately 50 μM of MsrB1 inhibitor were added, respectively. All components except the inhibitor, substrate (N-AcMetO), and NADPH were pre-mixed, and the reaction was carried out for 10 minutes after the addition of the inhibitor. Next, NADPH (50 μM) and 500 μM N-AcMetO were added before starting the absorbance measurement, and the NADPH oxidation rate was monitored by measuring the absorbance at 340 nm every 30 seconds until the reaction was completed.
[0086]
[0087] As a result, as shown in Figure 1, the two types of MsrB1 inhibitor treatment groups selected in the present invention were found not to have a reduced amount of NADPH compared to the control group, thus confirming that they effectively inhibit MsrB1 activity.
[0088]
[0089] Example 3: Confirmation of Inhibition of Differentiation into M2 Macrophages by MsrB1 Inhibitor
[0090] 3-1: Confirmation of M2 Macrophage Differentiation Inhibition - Flow Cytometry
[0091] Although macrophages can be divided into various subunits, they are generally broadly classified into M1 macrophages, which induce inflammatory responses, and M2 macrophages, which mediate tissue repair. Among the macrophage differentiation marker clusters, CD86 is a representative M1 marker, and CD206 is a representative M2 marker.
[0092] In the present invention, when macrophages were treated with the compound of Formula 1 (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide), which is a MsrB1 inhibitor, and then stimulated with B16F10 cancer cell culture medium, differentiation into tumor-friendly M2 macrophages was inhibited, and this was analyzed using a flow cytometer.
[0093] Bone marrow-derived macrophages (BMDM) were extracted using 8-week-old C57BL / 6(N) female WT and MsrB1- / - mice. First, the skin, muscles, and ligaments were removed using forceps and scissors, and the tibia and femur were separated. Both the femur and tibia were cut, a 26g needle was inserted into a 10 mL syringe, and the bone marrow was pushed over a cell filter using complete DMEM medium (CM). CM consists of DMEM / high glucose medium (Cytiva), 10% fetal bovine serum (Cytiva), 10 mM HEPES (Thermo Fisher Scientific), 1X penicillin-streptomycin (Thermo Fisher Scientific), and 1X beta-mercaptoethanol (Gibco). RBCs were removed from the bone marrow filtered through a 40 µm filter, and 3.5×10⁶ cells were placed in a 25 t flask using 2 mL of 1×RBC lysis buffer. 6 Cells were added and mixed with complete medium and 50 ng / ml M-CSF (BioLegend). Then, 3.5 ml of medium was dispensed, and the cells were cultured in a 5% CO2 incubator at 37°C. On day 3, the same amount of medium and M-CSF was added, and the cells were cultured differently according to the experiment until day 6. For the induction of M2 macrophage differentiation, 20 ng / ml of IL-4 and 20 ng / ml of IL-13 were added.
[0094] For co-culture with cancer cells, B16F10 cell stock was treated in a 37°C water bath for 3 minutes and then cultured in 75T flasks with 10 mL of CM. For subculture, all medium was removed, the cells were washed twice with DPBS (Wellgene), treated with 0.05% trypsin / EDTA for 5 minutes, and then harvested. After counting the cells, 2 x 10⁶ cells were placed in a 75T flask. 6 Canine cells were seeded and cultured at 80% density for 2 days in a 37℃, 5% CO2 incubator.
[0095] Next, the medium was removed, serum-free CM was added, and the mixture was cultured for 24 hours. The culture medium was then collected, centrifuged at 500g for 5 minutes, filtered through a 0.2µm filter (Millipore), and stored at -20℃ or -80℃. For TCM (Tumor conditioned media), CM containing 1% FBS was activated by adding 100x ITS (Thermo Fisher Scientific), and then mixed with tumor culture medium in a 1:1 ratio.
[0096]
[0097] Flow cytometry analysis was performed using the following method.
[0098] 2 x 10 in V-bottom 96-well 6 After inoculating the cells, 100 µl of Zombie Aqua (bioLegend) diluted 1:500 in DPBS was added. CD16 / 32 was diluted 1:200 using FACS buffer prepared by dissolving 0.5% BSA in PBS, and incubated at RT for 5 minutes. Subsequently, 0.5 µl of antibody against the surface marker (APC-CD206, #17-2061-82) was added per well, and the cells were incubated at 4°C for 20 minutes. For maintaining intracellular markers, the Cyto-Fast Fix / Per buffer set (BioLegend) was used for 20 minutes. Flow cytometry was performed using CytoFLEX3 (Bechman Coulter), and data analysis was conducted using the Cytexpert program.
[0099]
[0100] As a result, as shown in Figure 2, it was confirmed that differentiation into tumor-friendly M2 macrophages was inhibited by the MsrB1 inhibitor.
[0101]
[0102] 3-2: Confirmation of gene expression levels for M2 macrophage-related markers
[0103] Reverse transcriptase chain reaction was used to determine the gene expression levels of Arg1 and IL-10, which are M2 macrophage-related markers.
[0104] After removing the medium from macrophages cultured by the method of <Example 3-1> above, 500 µl of TRIzol™ (Thermo Fisher Scientific) was applied and incubated for 5 minutes. Cell lysates and TRIzol were scraped off using a 13 mm scraper (SPL), and cell debris was removed by centrifugation at 13,000 rpm, 4°C, for 15 minutes. After extracting the supernatant, RNA was precipitated using chloroform and isopropyl alcohol, followed by two washes with 75% ethanol prepared using DEPC-TDW. The ethanol was removed using a pipette, and the cells were dried at room temperature for 2 hours to completely evaporate any remaining ethanol. Then, RNA was carefully diluted in 20 µl of DEPC TDW and released using a heat block at 60°C for 10 minutes. RNA concentration was measured using a Nanodrop (Thermo Fisher Scientific), and cDNA was synthesized from the same amount of RNA using the High capacity cDNA reverse transcription kit (Thermo Fisher Scientific) according to product instructions. RT-PCR was performed according to product instructions using the synthesized cDNA, primers for each target, and TOPreal™ SYBR Green qPCR UDG PREMIX (Enzynomics). Information regarding the primers used in the experiment is shown in Table 1 below.
[0105]
[0106] Primer sequence genesequence (5' -> 3') Sequence No. IL-10 ForwardGCAGGACTTTAAGGGTTACTTGGG Sequence No. 1 ReverseCCTTGCTCTTATTTTCACAGGGGAG Sequence No. 2 Arg-1 ForwardGACCACAGTCTGGCAGTTGG Sequence No. 3 ReverseCAGGAGAAAGGACACAGGTTGCC Sequence No. 4
[0107] RT-PCR was performed on M2 macrophage-related markers such as Arg1 and IL-10, and relative gene expression levels were standardized to GAPDH and compared.
[0108] As a result, as shown in Figure 3, the expression of M2 macrophage-related markers Arg1 and IL-10 mRNA was reduced by the MsrB1 inhibitor.
[0109]
[0110] Example 4: Confirmation of Inhibition of Tumor-Affinity Transcription Factor Expression by MsrB1 Inhibitor
[0111] 4-1: Confirmation of CREB phosphorylation inhibition
[0112] In addition to TCM stimulation, a Transwell system was constructed to continuously exchange various factors between macrophages and tumor cells in a manner similar to a real environment, and the degree of phosphorylation of the tumor-affinity transcription factor CREB (cAMP Response Element-Binding Protein) was confirmed.
[0113] First, a transwell culture system was constructed using an SPL hanging insert (#37006) and a 6-well plate. Bone marrow-derived macrophages (CMT93) extracted in <Example 3-1> were placed in the insert at a rate of approximately 5 x 10 5 They were inoculated into dogs and cultured for 3 days in 2 mL of CM containing M-CSF. On the 3rd day, 2 mL of the same medium was added and cultured for another 3 days, and then on the 5th day, A549 lung cancer cell lines were transferred to another 6-well plate at a rate of 1.5 x 10 5Inoculated into dogs and cultured for 1 day. On the 6th day, the medium was replaced with CM, and the insert containing CMT93 was transferred to a 6-well plate containing tumor cells (A549 or B16F10) and cultured for 48 hours.
[0114] After aspirating all medium from the cultured cells, they were washed twice with DPBS. After completely removing the DPBS, 90 µl of CellyticM (Sigma-Aldrich) reagent containing 100x Pierce phosphatase inhibitor and 1x Pierce protein inhibitor (Thermo Fisher Scientific) was added, and the cells were gently shaken at room temperature for 15 minutes. Cell lysates were harvested using a scraper, centrifuged at 13,000 rpm at 4°C for 15 minutes to remove cell debris, and then proteins were quantified according to the manufacturer's protocol using the Pierce BCA protein assay kit (Thermo Fisher Scientific).
[0115] Cell lysates were mixed with 4x Laemmli buffer (62.5 mM Tris-HCl, 2% SDS, 10% glycerol, 0.005% bromophenol blue, pH 6.8), and then, depending on the experiment, equal amounts of protein were electrophoresed on a 10-15% SDS-PAGE gel and transferred to a PVDF (polyvinylidene-difluoride) membrane (Millipore, USA). To prevent non-specific binding, the mixture was incubated at room temperature for 1 hour with TBS containing 3% BSA (with the addition of 0.01% Tween), followed by the addition of the primary antibody, either anti-P-CREB (#9197T) or anti-Actin (#sc-47778), and incubated overnight at 4°C. Subsequently, the secondary antibody, anti-mouse or anti-rabbit, was added and incubated at room temperature for 2 hours. After performing the washing process in the same manner, the membrane was immersed in Prime ECL solution (Cytiva) for 1 minute, visualized using ChemiDoc XRS+ (BioRad), and then the degree of phosphorylation of CREB was quantified using the Image J program.
[0116]
[0117] As a comparative example, MsrB1 knockout cells were used. MsrB1 knockout mice were constructed by inserting a disrupting cassette via homologous recombination immediately after the first exon of the MsrB1 gene located on chromosome 17, resulting in a deficiency of MsrB1 protein and mRNA; BMDMs were extracted from the femoral bone marrow of these mice and used as MsrB1 knockout cells (Reference: https: / pubmed.ncbi.nlm.nih.gov / 18990697 / ).
[0118]
[0119] As a result, as shown in Figure 4a, the phosphorylation level of CREB was reduced in both tumor cells and macrophages by the MsrB1 inhibitor. In macrophages, CREB influences polarization, and in particular, CREB / C / EBPβ is known to reduce the expression of M2 genes such as IL-10 and Arg1 through a series of signaling systems, without affecting the expression of M1 genes such as IL-1, IL-6, and TNF-α. In other words, it can be inferred that the CREB / IL-10 axis plays an important role in M2 polarization when macrophages are cultured with tumor cells.
[0120]
[0121] 4-2: Confirmation of STAT3 Phosphorylation Inhibition
[0122] In addition, to confirm whether STAT3 phosphorylation is inhibited by the MsrB1 inhibitor, an experiment was performed in the same manner as in <Example 4-1> above, and the degree of STAT3 phosphorylation was confirmed through Western blot.
[0123] As a result, as shown in Figure 4b, it was found that STAT3 phosphorylation was reduced in both tumor cells (A549) and macrophages (CMT93) by the MsrB1 inhibitor. Since STAT activation in tumor cells and macrophages supports tumor growth and metastasis, and based on previous research (Xu, M., et al., Pharmaceutical Biology, 58(1): 655-663, 2020) that STAT3 in macrophages can induce M2 differentiation, this implies that MsrB1 is involved in M2 polarization.
[0124]
[0125] 4-3: Confirmation of gene expression related to cancer cell apoptosis inhibition, progression, and metastasis
[0126] To determine whether the expression of genes related to cancer progression and metastasis is suppressed by an MsrB1 inhibitor, an experiment was performed in the same manner as in <Example 4-1> above, and then RT-PCT was performed in the same manner as in <Example 3-2> above.
[0127]
[0128] Primer sequence genesequence (5' -> 3') Sequence No. VEGFAForwardGATGTCTACCAGCGAAGCTACTG Sequence No. 5ReverseGATCCGCATGATCTGCATGGTG Sequence No. 6BCL-2ForwardGGTGAACTGGGGGAGGATTGT Sequence No. 7ReverseAAAGGCATCCCAGCCTCCGTTA Sequence No. 8CCL17ForwardGCAATGATCTCAACACGTGGGC Sequence No. 9ReverseCATGTTTGTCTTTGGGGTCTGCAC Sequence No. 10CCL22ForwardCAGACCTCTGATGCAGGTCCCTA Sequence No. 11ReverseCGGCAGGATTTTGAGGTCCAG Sequence No. 12
[0129] As a result, as shown in Figure 4c, it was confirmed that treatment with a MsrB1 inhibitor reduced the expression of angiogenic factors VEGFA and BCL-2, which induce resistance to apoptosis, in both tumor cells (A549) and macrophages (CMT93). In addition, the expression of chemokines associated with cancer progression and metastasis, such as CCL17 and CCL22, was reduced.
[0130]
[0131] 4-4: Confirmation of Immune Checkpoint Protein PD-L1 Inhibition
[0132] In addition, to confirm whether the expression of PD-L1, an immune checkpoint protein, is suppressed by the MsrB1 inhibitor, an experiment was performed in the same manner as in <Example 4-1> above, and then the degree of PD-L1 expression was confirmed through Western blot.
[0133]
[0134] As a result, as shown in Fig. 4d, it was confirmed that the expression of PD-L1, an immune checkpoint protein, was suppressed in tumor cells (A549) by treatment with an MsrB1 inhibitor.
[0135]
[0136] Example 5: Confirmation of tumor growth inhibition by MsrB1 inhibitor in animal model
[0137] Based on laboratory-established models and in vitro data, in vivo tumor experiments were performed using the B16F10 cell line. 1.8 x 10⁶ B16F10 cells were used per C57BL / 6 mouse. 5 Tumor growth was checked at 3-day intervals starting 10 days after transplanting via subcutaneous injection to form cells. As a comparative example, an animal model (MsrB1 KO group) transplanted with a B16F10 tumor cell line in which MsrB1 was knocked out was used.
[0138] In the MsrB1 inhibitor treatment group, the compound of Formula 1 (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide), which is a MsrB1 inhibitor, was injected intraperitoneally three times at one-week intervals at concentrations of 12.5 μM, 25 μM, and 50 μM.
[0139]
[0140] As a result, as shown in Figure 5, the tumor volume of the MsrB1 inhibitor-treated group or the MsrB1 KO group was significantly reduced compared to the WT model. To confirm whether the inhibition of tumor growth was caused by the MsrB1 inhibitor, experiments were conducted at various concentrations, and it was confirmed that the tumor size decreased according to the concentration of the MsrB1 inhibitor.
[0141]
[0142] Next, immune cell markers within the tumor microenvironment were observed using a flow cytometer. On day 22, mice were sacrificed and dissected to isolate tumor tissue. The tumor tissue was then separated into cells using 10x DNase 0.1 mg / mL and 20x Collagenase 0.5 mg / mL, and immune cells that had infiltrated the tumor were stained and analyzed using a flow cytometer.
[0143] As a result of analyzing various types of lymphoid and myeloid immune cells in addition to macrophages, as shown in Figure 6, M1 macrophages, NK cells, and NKT cells, which can directly attack and kill tumors or induce apoptosis, increased in the MsrB1 inhibitor treatment group and the MsrB1 KO group.
[0144] In other words, it was confirmed that the MsrB1 inhibitor of the present invention exhibits an anticancer effect through immune control in the tumor microenvironment.
[0145]
[0146] It was confirmed that the MsrB1 inhibitor selected in this invention inhibits differentiation into tumor-friendly M2 macrophages and suppresses tumor growth. Furthermore, it was confirmed that it exhibits an anticancer effect through immune control in the tumor microenvironment, making it useful as a composition for cancer treatment.
Claims
1. Inhibiting methionine sulfoxide reductase B1 (MsrB1) activity, 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide) represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof: [Chemical Formula 1] .
2. Inhibiting methionine sulfoxide reductase B1 (MsrB1) activity, 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one) represented by the following chemical formula 2 or a pharmaceutically acceptable salt thereof: [Chemical Formula 2] .
3. 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide) represented by the following chemical formula 1, or a pharmaceutically acceptable salt thereof; and A pharmaceutical composition for the prevention or treatment of cancer comprising, as an active ingredient, one or more methionine sulfoxide reductase B1 (MsrB1) inhibitors selected from the group consisting of 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one represented by the following chemical formula 2 or pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] .
4. In Paragraph 3, A pharmaceutical composition for the prevention or treatment of cancer, characterized in that the above-mentioned MsrB1 inhibitor inhibits M2 differentiation and activity of macrophages and promotes M1 differentiation.
5. In Paragraph 3, The above MsrB1 inhibitor is Inhibition of phosphorylation of CREB (cAMP Response Element-Binding Protein), STAT3 phosphorylation inhibition, Inhibition of the expression of angiogenesis factors VEGFA and BCL-2, Inhibition of the expression of chemokines associated with cancer progression and metastasis, such as CCL17 and CCL22, or A pharmaceutical composition for the prevention or treatment of cancer, characterized by inhibiting the growth or metastasis of cancer cells by inhibiting the expression of PD-L1, an immune checkpoint protein.
6. In Paragraph 3, A pharmaceutical composition for the prevention or treatment of cancer, characterized in that the above cancer is lung cancer, pancreatic cancer, brain tumor, liver cancer, blood cancer, skin cancer, colorectal cancer, bone marrow cancer, breast cancer, osteosarcoma, melanoma, blood cancer, or rectal cancer.
7. 4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide (4-[3-(4-ethylphenyl)-5-(4-hydroxyphenyl)-4,5-dihydro-1H-pyrazol-1-yl]benzene-1-sulfonamide) represented by the following chemical formula 1, or a pharmaceutically acceptable salt thereof; and A health functional food composition for the prevention or improvement of cancer, comprising as an active ingredient one or more methionine sulfoxide reductase B1 (MsrB1) inhibitors selected from the group consisting of 6-chloro-10-(4-ethylphenyl)-4-hydroxypyrimido[4,5-b]quinolin-2(10H)-one represented by the following chemical formula 2 or pharmaceutically acceptable salts thereof: [Chemical Formula 1] [Chemical Formula 2] .
8. In Paragraph 7, A health functional food composition for the prevention or improvement of cancer, characterized in that the above-mentioned MsrB1 inhibitor inhibits M2 differentiation and activity of macrophages and promotes M1 differentiation.
9. In Paragraph 7, The above MsrB1 inhibitor is Inhibition of phosphorylation of CREB (cAMP Response Element-Binding Protein), STAT3 phosphorylation inhibition, Inhibition of the expression of angiogenesis factors VEGFA and BCL-2, Inhibition of the expression of chemokines associated with cancer progression and metastasis, such as CCL17 and CCL22, or A health functional food composition for the prevention or improvement of cancer, characterized by inhibiting the growth or metastasis of cancer cells by inhibiting the expression of PD-L1, an immune checkpoint protein.
10. In Paragraph 7, A health functional food composition for the prevention or improvement of cancer, characterized in that the above cancer is lung cancer, pancreatic cancer, brain tumor, liver cancer, blood cancer, skin cancer, colorectal cancer, bone marrow cancer, breast cancer, osteosarcoma, melanoma, blood cancer, or rectal cancer.