Treatment of pain via modulation of LRRC8a

Increasing LRRC8A expression in the spinal cord to modulate NMDAR activity addresses the challenges of chronic neuropathic pain by reducing synaptic NMDAR activity and alleviating pain symptoms.

WO2026089977A1PCT designated stage Publication Date: 2026-04-30BOARD OF RGT THE UNIV OF TEXAS SYST
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
BOARD OF RGT THE UNIV OF TEXAS SYST
Filing Date
2025-10-16
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Chronic neuropathic pain is challenging to manage due to the unresponsiveness of conventional analgesics and the unclear mechanisms of NMDAR activity in the spinal cord, which are tonically activated under neuropathic pain conditions, amplifying nociceptive input.

Method used

Increasing the expression of LRRC8A proteins in the spinal cord through gene or small molecule vectors to restore the interaction between LRRC8A and NMDARs, thereby reducing synaptic NMDAR activity and alleviating pain.

Benefits of technology

This approach effectively reduces neuropathic pain symptoms by modulating NMDAR activity, specifically decreasing synaptic NMDAR expression and activity in the spinal cord, thus alleviating tactile allodynia and thermal hyperalgesia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025051348_30042026_PF_FP_ABST
    Figure US2025051348_30042026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are methods for treating pain in a subject comprising administering to the subject a therapeutically effective amount of a vector comprising a gene encoding LRRC8A or a small molecule that increases expression of LRRC8A, wherein expression of the gene or administration of the small molecule provides treatment for the pain.
Need to check novelty before this filing date? Find Prior Art

Description

PATENT ATTORNEY DOCKET NO. MDA1350-1WO TREATMENT OF PAIN VIA MODULATION OF LRRC8ACROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority under 35 U. S. C. § 119(e) to U. S. Provisional Application No. 63 / 711,069, filed October 23, 2024. The contents of the prior application are considered part of and are hereby incorporated by reference in their entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0002] The material in the accompanying sequence listing is hereby incorporated by reference into this application. The accompanying sequence listing xml file, named MDA1350-1 WO. xml, was created on October 15, 2025, and is 37,280 bytes.STATEMENT REGARDING GOVERNMENT FUNDING

[0003] This invention was made with government support under NS101880 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND OF THE INVENTION FIELD OF THE INVENTION

[0004] The present invention relates generally to methods for treating pain and more specifically to increasing the level of leucine-rich repeat-containing protein 8A (LRRC8A) expression to affect Glutamate N-methyl D-aspartate receptor (NMDAR) activity in the spinal cord, thereby reducing pain.BACKGROUND INFORMATION

[0005] Chronic neuropathic pain is a debilitating condition for which management remains challenging. Chronic neuropathic pain is highly prevalent among patients with nerve trauma or undergoing major surgery, such as limb amputation, mastectomy, and thoracotomy. Since neuropathic pain is often unresponsive to conventional analgesics, there is a need for understanding its molecular mechanisms essential for developing new targeted treatments. NMDAR-mediated synaptic plasticity at the spinal cord level is crucially involved in neuropathic pain development. Although NMDAR antagonists are effective for managing neuropathic pain, these drugs are often associated with many serious adverse effects. Thus, there is a need to elucidate the mechanisms regulating NMDAR activity in neuropathic pain for identifying new11624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO targets and alternative treatment strategies. NMDARs are expressed in dorsal root ganglion (DRG) neurons and their central terminals. However, these presynaptic NMDARs are functionally quiescent under normal conditions. Also, there is minimal activity of postsynaptic NMDARs in the normal spinal dorsal hom. As a result, intrathecal injection of NMD AR antagonists does not affect normal nociception. In contrast, presynaptic and postsynaptic NMDARs become tonically activated in neuropathic pain, amplifying nociceptive input from primary sensory neurons to excitatory dorsal horn neurons. It has remained unclear how NMDARs at the spinal cord level are latent under normal conditions and how they become tonically active under neuropathic pain conditions.

[0006] Volume-regulated anion channels (VRACs) are composed of various leucine -rich repeat-containing protein 8 (LRRC8) family members. Besides their canonical role in maintaining cell volume, VRACs are also involved in other physiological processes, including cell proliferation, migration, and apoptosis. LRRC8A (also known as SWELL1) is the essential subunit of VRACs and forms homo- or hetero-hexameric channels with at least one of its four paralogs LRRC8B-LRRC8E. LRRC8A is a widely expressed protein with four transmembrane domains, an intracellular N-terminal domain, and a cytoplasmic C terminus with 15-17 predicted leucine-rich motifs that constitute a leucine-rich repeat (LRR) domain. LRRC8A is implicated in a variety of disease conditions, including stroke, infertility, diabetes, and cancer. Its broad expression in tissues and cells, including neurons, suggests that LRRC8A may have additional, yet undiscovered roles in physiology. For instance, LRRC8A functions as a dual sensor of hypoosmolality and low pH in nodose ganglion neurons. However, little is known about the role of neuronal LRRC8A in the control of nociceptive transmission.SUMMARY

[0007] The present invention is based on the seminal discovery that nerve injury reduces LRRC8A expression, which leads to increased synaptic NMD AR trafficking and activity. Described herein is an approach for treating neuropathic pain by increasing the level of LRRC8A proteins to restore the interaction between LRRC8A proteins and NMDARs in the spinal cord, thereby reducing pain. The present invention is exemplified but not limited by the disclosure in the Examples herein.

[0008] In one embodiment, the present disclosure provides a method for treating pain in a subject including administering to the subject a therapeutically effective amount of a vector21624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO including a gene encoding LRRC8A, wherein expression of the gene provides treatment for the pain.

[0009] In some aspects, the vector is administered intrathecally.

[0010] In some aspects, the pain is neuropathic pain. In some aspects, the neuropathic pain is caused by traumatic nerve injury. In some aspects, the traumatic nerve injury is spinal nerve ligation.

[0011] In some aspects, the pain originates from tactile stimulus, noxious pressure, thermal stimulus, or a combination thereof.

[0012] In some aspects, expression of LRRC8A from the vector reduces synaptic NMD AR activity in the spinal cord of the subject. In some aspects, the vector is a lentiviral, adenovirus or adeno-associated virus vector.

[0013] In some aspects, expression of the gene increases LRRC8A protein levels, LRRC8A mRNA levels, or a combination thereof in dorsal root ganglia (DRG) of the subject compared to LRRC8A protein levels, LRRC8A mRNA levels, or a combination thereof in the subject treated with a control vector.

[0014] In some aspects, expression of the gene decreases synaptic expression of NMD AR subunits in the spinal cord of the subject compared to synaptic expression of NMD AR subunits in the spinal cord of the subject prior to treated with a control vector.

[0015] In some aspects, the pain is characterized by at least one of tactile allodynia, mechanical hyperalgesia, and thermal hyperalgesia.

[0016] In some aspects, the gene encodes full-length LRRC8A, LRRC8A N-terminus mutant without VRAC activity, or a functional fragment thereof.

[0017] In another embodiment, the present disclosure provides a method of modulating NMD AR activity in a nervous system of a subject, including administering to the subject a therapeutically effective amount of a vector encoding LRRC8A, thereby increasing the level of expression of LRRC8A and modulating NMD AR activity.

[0018] In some aspects, the NMDA receptor activity is NMD AR activity in the spinal cord of the subject.

[0019] In some aspects, the vector is administered intrathecally.

[0020] In some aspects, modulating receptor activity comprises reducing pain symptoms in the subject.31624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0021] In certain embodiments, the present disclosure provides a method for treating pain in a subject including administering to the subject a therapeutically effective amount of a small molecule that increases expression of LRRC8A, wherein the increased expression of LRRC8A provides treatment for the pain.

[0022] In some aspects, LRRC8A expression levels are increased compared to LRRC8A expression levels in the subject prior to treatment.

[0023] In some aspects, the pain is neuropathic pain. In some aspects, the neuropathic pain is caused by traumatic nerve injury. In some aspects, the traumatic nerve injury is spinal nerve ligation.

[0024] In some aspects, increasing expression of LRRC8A reduces synaptic NMD AR activity in the spinal cord of the subject.

[0025] In some aspects, increasing expression of LRRC8A increases LRRC8A protein levels in DRG of the subject.

[0026] In some aspects, expression of LRRC8A decreases synaptic expression of NMD AR subunits in the spinal cord of the subject.

[0027] In some aspects, the pain is characterized by at least one of tactile allodynia and thermal hyperalgesia.

[0028] In another embodiment, the present disclosure provides a method of modulating NMDA receptor activity in a nervous system of a subject, including administering to the subject a therapeutically effective amount of a small molecule that increases expression of LRRC8A, thereby increasing the level of expression of LRRC8A and modulating NMD AR activity in the nervous system of the subject.

[0029] In some aspects, LRRC8A expression levels are increased compared to LRRC8A expression levels in the subject prior to treatment.

[0030] In some aspects, the NMDA receptor activity is NMD AR activity in the spinal cord of the subject.BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIGs. 1A-1D show the distribution of LRRC8A-immunoreactivity in the rat DRG and spinal cord (SC). FIGs. 1A shows representative confocal images of the co-localization of LRRC8A with NeuN and IB4 in the rat DRG. FIG. IB shows representative confocal images of the co-localization of LRRC8A with CGRP in the rat DRG. FIGs. 1C. ID show representative41624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO confocal images of the co-localization of LRRC8A with NeuN and IB4 in the rat spinal cord. All images are single confocal optical sections.

[0032] FIGs. 2A-2E show nerve injury causes a sustained reduction in LRRC8A expression levels in the rat DRG. FIG. 2A shows quantitative PCR data of the mRNA level of LRRC8A-LRRC8D in the rat DRG, 10, and 21 days after SNL or sham surgery. GAPDH was used as an internal control, and the mean value in the sham group was set to 1 (n = 6 rats per group). ***p < 0.001 vs. the sham group at the same time point (two-way ANOVA followed by Tukey’s post hoc test). FIG. 2B shows representative blotting images and quantification of the LRRC8A protein level in the DRG in sham and SNL rats 21 days after surgery (n = 6 rats / group). GAPDH was used as an internal control. *p < 0.05 vs. the sham group (two-tailed Student's t test). FIG. 2C shows original current traces and quantification of VRAC currents in DRG neurons from sham control (n = 9 neurons) and SNL rats (n = 12 neurons) 21 days after surgery.< 0.01 vs. the sham group (two-tailed Student's t test). Lines above the traces denote the timing of hypotonic solution application. FIG. 2D shows quantitative PCR data for the mRNA levels of Lrrc8a in the spinal cord of sham control and SNL rats 21 days after surgery (n = 6 rats per group). FIG. 2E shows original blotting images and quantification of the LRRC8A protein level in the dorsal spinal cord from sham control and SNL rats 21 days after surgery (n = 6 rats per group). Data are shown as means ± SEM.

[0033] FIGs. 3A-3F show LRRC8A downregulation at the spinal cord level or LrrcSa-cKO in DRG neurons induces NMDAR-dependent pain hypersensitivity. FIG. 3A shows time course of changes in tactile, noxious pressure, and heat withdrawal thresholds in sham control rats and SNL rats treated with control siRNA or LRRC8A-specific siRNA for 6 days (n = 8 rats per group). Arrows denote timing of siRNA injections. *p < 0.05, **p < 0.01, ***p < 0.001 vs. the control siRNA group at the same time point;##p < 0.01;###p < 0.001 vs. the baseline (time 0) of the SNL group (two-way ANOVA followed by Tukey’s post hoc test). FIG.3B shows effects of a single intrathecal injection of 5 pg AP5 on tactile, noxious pressure, and heat withdrawal thresholds in rats treated with the LrrcSa-specific siRNA or control siRNA (n = 8 rats per group). *p < 0.05, **p < 0.01, ***p < 0.001 vs. the vehicle-treated LRRC8A-siRNA group at the same time point (two-way ANOVA followed by Tukey’s post hoc test). FIG. 3C shows mean changes in tactile, noxious pressure, and heat withdrawal thresholds in wild-type (WT) and Lrrc8a-cKO mice. ***p < 0.001 vs. the WT group (n = 8 mice per group, two-tailed Student's t test). FIG. 3D shows effects of a single intrathecal injection of 5 pg AP5 on tactile, noxious pressure, and heat withdrawal thresholds in51624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Lrrc8a-cKO mice. FIG. 3E shows effects of a single intraperitoneal injection of 10 mg / kg memantine on tactile, noxious pressure, and heat withdrawal thresholds in Lrrc8a-cKO mice.FIG. 3F shows effects of a single injection of 5 pg AP5 on tactile, noxious pressure, and heat withdrawal thresholds in Lrrc8a-cKO mice. *p < 0.05, **p < 0.01, ***p < 0.001 vs. the vehicle group at the same time point (n = 8 mice per group, two-way ANOVA followed by Tukey’s post hoc test). Data are shown as means ± SEM.

[0034] FIGs. 4A-4H shows LRRC8A downregulation induced presynaptic and postsynaptic NMD AR hyperactivity in the spinal dorsal horn. FIGs. 4A and 4B show representative current traces and cumulative plots of mEPSCs of spinal lamina II neurons to show the baseline and effect of bath application of 50 pM AP5 in spinal cord slices from control siRNA (FIG. 4A) or LRRC8A-specific siRNA (FIG. 4B) treated rats. FIG. 4C shows mean changes of the effect of AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from control siRNA or LRRC8A-specific siRNA treated rats. *p < 0.05;#p < 0.05 (n = 10 neurons per group, one-way ANOVA followed by Tukey’s post hoc test). FIGs. 4D-4F show representative traces of EPSCs monosynaptic evoked from the dorsal root and paired pulses of EPSCs (FIGs.4D and 4E) as well as mean changes (FIG. 4F) of the baselines and the AP5 effect on the amplitude and the paired pulse ratio (PPR) of EPSCs in lamina II neurons from control siRNA (n = 10 neurons) or LRRC8A-specific siRNA (n = 10 neurons) treated rats. *p < 0.05; #p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). FIGs.4G and 4H show original current traces (FIG.4G) and quantification (FIG. 4H) of NMDA currents elicited by puff application of 100 pM NMDA to spinal lamina II neurons in rats treated with control siRNA (n = 11 neurons) or LRRC8A-specific siRNA (n = 14 neurons). *p < 0.05 vs. the control siRNA group (two-tailed Student's t test). Data are shown as means ± SEM.

[0035] FIGs. 5A-5H show genetic ablation of Lrrc8a in DRG neurons induces hyperactivity of presynaptic NMDARs at central terminals of DRG neurons. FIGs. 5A and 5B show representative recording traces and cumulative plots of the baselines and effect of bath application of 50 pM AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from WT (FIG.5A) and Lrrc8a cKO (FIG. 5B) mice. FIG. 5C shows mean changes show the effect of 50 pM AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from WT (n = 11 neurons) and Lrrc8a cKO (n = 10 neurons) mice. *p < 0.05;##p < 0.01 (one-way ANOVA followed by Tukey’s post hoc test. FIGs. 5D-5F show representative recording traces (FIGs. 5D and 5E) and mean changes (FIG.5F) of the baselines and the effect of bath application of 50 pM AP5 on evoked61624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO monosynaptic EPSCs and the PPR of spinal lamina II neurons from WT (n = 11 neurons) and Lrrc8a cKO (n = 12 neurons) mice. *p < 0.05, **p < 0.01;#p < 0.05,###p < 0.001 (one-way ANOVA followed by Tukey’s post hoc test. FIGs. 5G and 5H show original current traces (FIG.5G) and quantification (FIG. 5H) of NMD A currents elicited by puff application of 100 pM NMD A to spinal lamina II neurons from WT (n = 11 neurons) and Lrrc8a cKO (n = 12 neurons) mice. Data are shown as means ± SEM.

[0036] FIGs. 6A-6J show LRRC8A physically interacts with NMDARs in vivo and in vitro.FIGs. 6A and 6B show coimmunoprecipitation analysis shows the interaction between GluNl and LRRC8A in the membrane extracts of dorsal spinal cord tissues of rats (FIG.6A) and humans (FIG. 6B). Proteins were immunoprecipitated (IP) first with a mouse anti-GluN 1 antibody or IgG. Immunoblotting was performed using a rabbit anti-LRRC8A antibody. IgG and input (tissue lysates only) were used as negative and positive controls, respectively. Similar data were obtained from 3 independent experiments. FIGs. 6C and 6D show reciprocal coimmunoprecipitation analysis of the interaction between LRRC8A and NMD AR subunits in the membrane extracts of dorsal spinal cord tissues of rats (FIG. 6C) and humans (FIG. 6D). Proteins were immunoprecipitated first with a mouse LRRC8A antibody or IgG. Immunoblotting conducted using rabbit anti-GluNl, anti-GluN2A, or anti-GluN2B antibodies. IgG and input (tissue lysates only) were used as negative and positive controls, respectively. Similar data were obtained from 3 independent experiments. FIG. 6E shows coimmunoprecipitation analysis to shows that LRRC8A interacted with NMD AR subunits in membrane extracts of HEK293 cells. Lrrc8a-KO HEK293 cells were co-transfected as indicated on the left side of the gel images. Proteins were immunoprecipitated (IP) first with anti-FLAG antibody using membrane fractions of HEK293 cells. Immunoblotting was performed by using the antibodies indicated on the right side of the gel images. Similar data were obtained from 3 independent experiments. FIGs. 6F-6H show coimmunoprecipitation analysis to show that LRRC8A interacted with NMDARs predominantly through its C-terminal LRR domain. GluNl / GluN2A subunits and various Flag-tagged LRRC8A constructs, indicated above the gel images, were co-expressed in Lrrc8a-KO HEK293 cells. Coimmunoprecipitation (using anti-FLAG antibody) and immunoblotting were performed using the antibodies indicated on the right side of the gel images. Similar data were obtained from 3 independent experiments. FIGs. 61 and 6 J show original gel images and quantification data of the effect of LRRC8A-LRR1 peptide on the LRRC8A-GluNl interaction in HEK293 cells (FIG.61) and spinal cord tissue slices (FIG. 6 J). HEK293 cells were co-transfected with GluNl,71624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO GluN2A, and Flag-tagged LRRC8A. The transfected cells or spinal cord slices were incubated with LRRC8A-LRR1 peptide or control peptide for 30 min. The cell lysis was then isolated and used for coimmunoprecipitation using anti -Flag or anti-LRRC8A antibody. **p < 0.01 (one-way ANOVA followed by Dunnett’s post hoc test). Data are shown as means ± SEM.

[0037] FIGs. 7A-7H show induction of NMDAR-dependent pain hypersensitivity in rats with uncoupling LRRC8A-NMDAR interactions at the spinal cord level. FIG. 7A shows time course of the effects of a single intrathecal injection of LRRC8A-LRR1 peptide on tactile, pressure, and heat withdrawal thresholds in rats (n = 8 rats per group). *p < 0.05, **p < 0.01, ***p < 0.001 vs. the baseline (time 0) in the LRRC8A-LRR1 peptide group);#p < 0.05,###p < 0.001 vs. the control peptide group at the same time point (two-way ANOVA followed by Tukey’s post hoc test). FIGs.7B and 7C show representative recording traces and cumulative plots show the effect of bath application of 50 pM AP5 on the frequency and amplitude of mEPSCs of lamina II neurons of rat spinal cord slices treated with 1 pM control peptide (FIG. 7B) or 1 pM LRRC8A-LRR1 peptide (FIG. 7C) for 30 min. FIG. 7D shows mean changes of the baseline and effect of 50 pM AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from spinal cord slices treated with the control peptide (n = 15 neurons) or LRRC8A-LRR1 peptide (n = 16 neurons). ***p < 0.01; ###p < 0.001 (one-way ANOVA followed by Tukey’s post hoc test). FIGs. 7E-7G show representative recording traces (FIGs. 7E and 7F) and mean changes (FIG. 7G) in the baselines and effect of bath application of 50 pM AP5 on evoked monosynaptic EPSCs and the PPR of EPSCs in spinal lamina II neurons from spinal cord slices treated with 1 pM control peptide (n = 13 neurons) or 1 pM LRRC8A-LRR1 peptide (n = 14 neurons) for 30 min. FIG. 7H shows representative recording traces and mean amplitude of NMD AR currents in spinal lamina II neurons from spinal cord slices treated with 1 pM control peptide (n = 13 neurons) or 1 pM LRRC8A-LRR1 peptide. **p < 0.01, ***p < 0.001;#p < 0.05,###p < 0.001 (one-way ANOVA followed by Tukey’s post hoc test). Data are shown as means ± SEM.

[0038] FIGs. 8A-8F show LRRC8A inhibition of membrane surface and synaptic expression of NMDARs. FIGs. 8 A and 8B show original current traces and mean changes of the effect of ZrrcSa-specific siRNA on whole-cell NMDAR currents in HEK293 cells expressing GluNl / GluN2A (A, n = 15 cells in the Lrrc8a siRNA group; n = 16 cells in the control siRNA group) or GluNl / GluN2B (FIG. 8B, n = 11 cells per group). Current responses were elicited by application of 300 pM NMDA plus 10 pM glycine. **p < 0.01, ***p < 0.01 vs. the control siRNA group. FIGs. 8C and 8D show original blotting images and mean changes show that membrane81624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO surface protein levels of NMD AR subunits in HEK293 cells treated with Lrrc8a-specific siRNA (Ls) or control siRNA (Cs). Immunoblotting was performed using antibodies against GluNl, GluN2A, GluN2B, and LRRC8A for the cell surface proteins isolated using biotinylation. HEK293 cells were co-transfected and treated with Lrrc8a-specific siRNA or control siRNA as indicated above the gel images. Na+ / K+-ATPase, a known membrane protein marker, was used as an internal control (n = 6 independent experiments). * < 0.05 (two-tailed Student's t test). FIG.8E shows representative gel images and quantification data of the protein levels of LRRC8A and NMDAR subunits in spinal cord synaptosomes of rats treated ZrrcSa-specific siRNA (Ls) or control siRNA (Cs). n = 6 samples from 6 rats per group. *p < 0.05 (two-tailed Student's t test).FIG. 8F shows representative gel images and quantification of GluNl protein levels in dorsal spinal cord synaptosomes isolated from WT and Lrrc8a-cKO mice (n = 6 samples from 6 mice per group). PSD-95, a known postsynaptic protein, was used as an internal control. ***p < 0.001 (two-tailed Student's t test). Data are shown as means ± SEM.

[0039] FIGs. 9A-9F show that mice lacking the C-terminal LRR domain of LRRC8A exhibit NMDAR-dependent pain hypersensitivity and augmented synaptic expression of NMDARs in the spinal cord. FIG. 9A shows mean changes in the tactile, noxious pressure, and heat withdrawal thresholds in wild-type (WT, n = 8) and Lrrc8aebo / ebo(ebo / ebo, n = 8) mice. **p < 0.01, ***p < 0.001 vs. the WT group (two-tailed Student's t test). FIGs. 9B and 9C show time course of the effects of a single intraperitoneal injection of 10 mg / kg memantine (FIG. 9B) or intrathecal injection of 5 pg AP5 (FIG. 9C) on the tactile, noxious pressure, and heat withdrawal thresholds in Lrrc8aebo / ebomice. *p < 0.05, **p < 0.01, ***p < 0.001 compared with the vehicle group at the same time point (two-way ANOVA followed by Tukey’s post hoc test). FIG. 9D shows original current traces and mean changes of VRAC currents in DRG neurons from WT (n = 10 neurons) and Lrrc8aebo / ebo(n = 11 neurons) mice. ***p < 0.001 vs. the WT group (two-tailed Student's t test).FIG. 9E shows representative blotting images and quantification of the interaction between LRRC8A and GluNl in the membrane extracts of dorsal spinal cord tissues of WT and Lrrc8aebo / ebomice (n = 6 mice per group). Proteins were immunoprecipitated first with a mouse anti-LRRC8A antibody or IgG. Immunoblotting was performed by using a rabbit anti-GluN 1 antibody. IgG and input (tissue lysates only) were used as negative and positive controls, respectively. ***p < 0.001 vs. the WT group (two-tailed Student's t test). FIG. 9F shows representative gel images and quantification of GluNl protein levels in dorsal spinal cord synaptosomes isolated from WT and Lrrc8aebo / ebomice (n = 6 mice per group). PSD-95, a known postsynaptic protein, was used as an91624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO internal control. **p < 0.01 vs. the WT group (two-tailed Student's t test). Data are shown as means ± SEM.

[0040] FIGs. 10A-10I show Lrrc8a gene delivery at the spinal cord level eliminating nerve injury-induced pain hypersensitivity in rats and enhancing synaptic NMDAR expression. FIG.10A shows time course of changes in the tactile, noxious pressure, and heat withdrawal thresholds of SNL rats after intrathecal injection of the Lrrc8a vector or control vector (n = 8 rats per group). *p < 0.05, < 0.01, ***p < 0.001 vs. the control vector group at the same time point (two-way ANOVA followed by Tukey’s post hoc test). FIGs. 10B and 10C show original gel images (FIG.10B) and quantification (FIG. 10C) of the protein level of LRRC8A in the DRG of sham and SNL rats after intrathecal injection of the Lrrc8a vector or control vector (n = 6 rats per group). *p < 0.05; ***p < 0.01 (one-way ANOVA followed by Tukey’s post hoc test). FIGs. 10D and 10E show representative gel images (FIG. 10D) and quantification (FIG. 10E) of the protein levels of LRRC8A in spinal cord tissues of sham and SNL rats treated with the control vector (Cv) or Lrrc8a vector (Lv) (n = 6 rats per group). **p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). FIGs. 10F and 10G show representative gel images (FIG. 10F) and quantification (FIG. 10G) of the protein levels of GluNl in spinal cord synaptosomes isolated from sham and SNL rats treated with the control vector (Cv) or Lrrc8a vector (Lv) (n = 6 rats per group). ***p < 0.001 (one-way ANOVA followed by Tukey’s post hoc test). FIGs. 10H and 101 show original current traces (FIG. 10H) and quantification (FIG. 101) of VRAC currents in DRG neurons from sham and SNL rats treated with the control vector (Cv) or Lrrc8a vector (Lv). *p < 0.05; ***p < 0.01 (one-way ANOVA analysis followed by Tukey’s post hoc test). Data are shown as means ± SEM.

[0041] FIGs. 11A-11C show validation of siRNA-induced LRRC8A knockdown in the DRG and spinal cord in rats. FIGs. 11A and 11B show original gel images and quantification of the protein level of LRRC8A in the DRG (FIG. 11 A) and dorsal spinal cord tissues (FIG. 11B) from rats treated with control siRNA or Lrrc8a-specific siRNA (n = 6 rats per group). FIG. 11C shows original current traces and quantification of VRAC currents in DRG neurons from rats treated with control siRNA (n = 10 neurons) or LrrcSa-specific siRNA (n = 11 neurons). **p < 0.01; *** / > < 0.01 vs. the control siRNA group (two-tailed Student's t test. Data are shown as means ± SEM.

[0042] FIGs. 12A-12G show validation of diminished LRRC8A expression in DRG neurons in Lrrc8a-cKO mice. FIGs. 12A and 12B show original blotting images and quantification of the101624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO LRRC8A protein level in the DRG (FIG. 12A) and dorsal spinal cord tissues (FIG. 12B) from WT or Lrrc8a-cKO mice (n = 6 mice per group). FIG. 12C shows representative current traces and quantification of VRAC currents in DRG neurons from WT (n = 10 neurons) or Lrrc8a cKO (n = 11 neurons) mice. ***p < 0.01 vs. WT mice (two-tailed Student's t test). Data are shown as means ± SEM. FIGs. 12D and 12E show representative confocal images for the distribution of LRRC8A-immunoreactivity in the DRG from WT (FIG. 12D) and ZrrcSa-cKO (FIG. 12E) mice.FIGs. 12F and 12G show representative low- and high-magnification confocal images for the distribution of LRRC8A-immunoreactivity in the spinal dorsal horn from WT (FIG. 12F) or Lrrc8a-cKO (FIG. 12G) mice. All images are single confocal optical sections. Scale bar: 50 pm for DRG sections; 100 pm or 20 pm for spinal cord sections (sections selected from 3 mice per group).

[0043] FIGs. 13A-13H show that mice lacking the C-terminal LRR domain of LRRC8A exhibit presynaptic and postsynaptic hyperactivity of NMDARs in the spinal dorsal hom. FIGs.13A and 13B show representative recording traces and cumulative plots of the effect of bath application of 50 pM AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from WT (FIG. 13A) and Lrrc8aebo / ebo(ebo / ebo, FIG. 13B) mice. FIG. 13C shows mean changes of the baseline and effect of 50 pM AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from WT (n = 11 neurons) and ebo / ebo (n = 11 neurons) mice. **p < 0.01;###p < 0.001 (one-way ANOVA followed by Tukey’s post hoc test). FIGs. 13D-13F show representative recording traces (FIGs. 13D and 13E) and mean changes (FIG. 13F) of the baseline and the effect of bath application of 50 pM AP5 on evoked monosynaptic EPSCs and the PPR of EPSCs in spinal lamina II neurons from WT (n = 10 neurons) and ebo / ebo (n = 11 neurons) mice. *p < 0.05, **p < 0.01;#p < 0.05,###p < 0.001 (one-way ANOVA followed by Tukey’s post hoc test. FIGs.13G and 13H show original traces (FIG. 13G) and quantification (FIG. 13H) of NMDAR currents elicited by puff application of 100 pM NMDA to spinal lamina II neurons from WT (n = 11 neurons) and ebo / ebo (n = 12 neurons) mice. *p < 0.05 (two-tailed Student's t test). Data are shown as means ± SEM.

[0044] FIGs. 14A-14F show effect of intrathecal Lrrc8a gene transfer on nociception and presynaptic NMDAR activity in the spinal dorsal horn of sham and nerve injured rats. FIG. 14A shows time course of the effect of intrathecal injection of the Lrrc8a vector or control vector on the tactile, pressure, and heat withdrawal thresholds in sham control rats (n = 8 rats per group). *p < 0.05, < 0.01 vs. the control vector group at the same time point (two-way ANOVA followed111624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO by Tukey’s post hoc test). FIGs. 14B-14E show representative recording traces and cumulative plots show the effect of 50 pM AP5 on mEPSCs of spinal lamina II neurons recorded from SNL (FIGs. 14B and 14C) and sham (FIGs. 14D and 14E) rats treated with the control vector or Lrrc8a vector. FIG. 14F shows summary data show then baseline and effect of AP5 on the frequency and amplitude of mEPSCs of lamina II neurons from sham and SNL rats treated with the control vector or Lrrc8a vector. *p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). Data are shown as means ± SEM.

[0045] FIGs. 15A-15F show effect of intrathecal Lrrc8a gene transfer on the activity of postsynaptic NMDARs and NMDARs at primary afferent central terminals in the spinal dorsal hom of sham and nerve injured rats. FIGs. 15A-15D show original recording traces for the AP5 effect on the amplitude and paired pulse of EPSCs of lamina II neurons monosynaptically evoked from the dorsal root in SNL (FIGs. 15A and 15B) and sham (FIGs. 15C and 15D) rats treated with the control vector or Lrrc8a vector. FIG. 15E shows mean changes of the baseline and effect of AP5 on the amplitude of evoked EPSCs or paired pulse ratio (PPR) of EPSCs of spinal lamina II neurons in sham and SNL rats treated with the control vector or Lrrc8a vector. * < 0.05;#p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). FIG. 15F shows original current traces and quantification of NMD AR currents elicited by puff application of 100 pM NMD A to spinal lamina II neurons from sham and SNL rats treated with the control vector or Lrrc8a vector. *p < 0.05;#p < 0.05 (one-way ANOVA followed by Tukey’s post hoc test). Data are shown as means ± SEM.

[0046] FIGs. 16A-16C show that LRRC8A, but not LRRC8B, interacts with NMDARs via its C-terminal LRR domain. Coimmunoprecipitation analysis shows that GluNl interacted with LRRC8A, but not LRRC8B. HEK293 cells were co-transfected with GluNl / GluN2A and Flag-tagged LRRC8A or Flag-tagged LRRC8B. Proteins were immunoprecipitated (IP) first with rabbit anti-GluNl antibody or IgG. FIG. 16A shows illustrative immunoblotting performed by using a mouse anti -Flag antibody. FIGs. 16B-16C show coimmunoprecipitation analysis of LRRC8A interacted with GluNl predominantly through its C-terminal LRR domain. GluNl / GluN2A and various Flag-tagged LRRC8A constructs were co-expressed in Lrrc8a-KO HEK293 cells. Proteins were immunoprecipitated (IP) first with a rabbit anti-GluNl antibody or IgG. Immunoblotting was then performed using a mouse anti-flag antibody. Similar data were obtained from 3 independent experiments.121624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0047] FIGs. 17A-17C illustrate that LRRC8A-NMDAR complexes are present in the DRG and spinal dorsal horn. FIG. 17A shows images illustrating two representative confocal images show the distribution of LRRC8A-GluNl PLA signals (arrow) in rat DRG neurons labeled with NeuN (arrow head). FIG. 17B shows images illustrating representative confocal images IB4 fluorescent labeling and LRRC8A-GluNl PLA signal levels in the spinal dorsal horn from rats subjected to dorsal rhizotomy or sham surgery. FIG. 17C is a graph illustrating quantification of IB4 fluorescent labeling and LRRC8A-GluNl PLA signal levels in the spinal dorsal horn from rats subjected to dorsal rhizotomy or sham surgery, n = 6 images (two images per animal) from three rats per group. IB4 labeling was used to identify laminae I and II. ***p < 0.001 (two-tailed Student's t test). Data are shown as means ± SEM.

[0048] FIGs. 18A-18D illustrate interactions between LRRC8A and NMDARs in HEK293 cells. FIG. 18A shows images representative images illustrating the LRRC8A-GluNl interactions inirrcSa-KO HEK293 cells cotransfected with Flag-LRRC8A and GluNl / GluN2A. FIG. 18B is a graph illustrating the quantification of FIG. 18A. Transfected cells were treated 1 pM control peptide (Cont) or 1 pM LRR4 peptide for 30 min (n = 6 independent experiments per group). Immunoprecipitation was first conducted with an anti-Flag antibody, and immunoblotting was done with an anti-GluNl antibody. FIG. 18C shows representative confocal images illustrating the effect of LRR1 peptide and control peptide (1 pM for 30 min) on LRRC8A-GluNl PLA signals (arrow) in HEK293 cells co-transfected with GFP (arrow head) and GluNl / GluN2A (n = 6 imaging slides per group). FIG. 18D is a graph illustrating the quantification of FIG. 18D. PLA, proximity ligation assay. ***p < 0.001 (two-tailed Student's t test). Data are shown as means ± SEM.

[0049] FIGs. 19A-19C illustrate the structure of volume-regulated anion channel (VRAC) and sequences including mutations on LRRC8. FIG. 19A is a schematic illustrating VRAC structure.FIG. 19B (SEQ ID Nos: 34-38) is a schematic illustrating LRRC8A, LRRC8B, LRRC8C, LRRC8D, and LRRC8D N-terminus sequences and mutations. FIG. 19C (SEQ ID Nos: 39-40) is a schematic illustrating LRRC8A and LRRC8C N-terminus sequences and mutations without VRAC activity.

[0050] FIGs. 20A-20B illustrate VRAC activity in HEK cells expressing Lrrc8a WT and mutant. FIG. 20A is a graph illustrating representative current- voltage (I-V) relation of VRAC currents in Lrrc8a-KO HEK293 cells expressing Lrrc8a wild-type (WT) and Lrrc8a P3C mutant.131624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO FIG. 20B is a graph illustrating quantification of VRAC currents in Lrrc8a-KO HEK293 cells expressing Lrrc8a WT and Lrrc8a P3C mutant (n = 8 cells per group).

[0051] FIGs. 21A-21B illustrate Co-IP of Lrrc8A WT and mutant with GluNl / 2A. FIG. 21 A is a representative co-immunoprecipitation image illustrating NMDAR-LRRC8A interactions in HEK293 cells. FIG. 21B is a graph illustrating quantification of the NMDAR-LRRC8A interactions in HEK293 cells. Lrrc8a-KO HEK293 cells were cotransfected with GluNl / 2A subunits with Lrrc8a wild-type (WT) or Lrrc8a P3C mutant (n = 6 separate experiments per group).

[0052] FIG. 22 shows images illustrating biotinylation for GluNl and Lrrc8a in different transfection ratio.

[0053] FIGs. 23A-23B illustrate recording of NMD AR activity in HEK cells. FIG.23A shows representative traces illustrating NMD AR currents in Lrrc8a-KO HEK293 cells cotransfected with NR1 / 2A subunits with control vector (pcDNA), Lrrc8a wild-type (WT), or Lrrc8a P3C mutant.FIG. 23B is a graph illustrating quantification of NMD AR currents in Lrrc8a-KO HEK293 cells cotransfected with NR1 / 2A subunits with control vector (pcDNA), Lrrc8a wild-type (WT), or Lrrc8a P3C mutant (n =10 cells in pcDAN and WT groups; n = 11 cells in mutant group; one-way ANOVA followed by Tukey post hoc test). Transfection ratio: GluNl:2A: Lrrc8a = 4:4:1.

[0054] FIGs. 24A-24C illustrate the time course of the effects of lentiviruses expressing LRRC8A WT and P3C mutant on nociceptive thresholds of sham and spinal nerve ligated SNL) rats. FIG. 24 A is a graph illustrating nociceptive thresholds in response to tactile (von Frey filaments) stimuli assessed following lentiviral injection (n = 7-8 rats per group). FIG. 24B is a graph illustrating nociceptive thresholds in response to noxious pressure stimuli assessed following lentiviral injection (n = 7-8 rats per group). FIG.24C is a graph illustrating nociceptive thresholds in response to thermal stimuli assessed following lentiviral injection (n = 7-8 rats per group). Data are presented as mean ± SEM. ***p < 0.001 vs. respective baseline (day 14; two-way ANOVA with Tukey’s post hoc test).

[0055] FIGs.25A-25B illustrate that intrathecal injection of lentiviruses expressing Lrrc8a WT or mutant reduces synaptic NMDAR expression in SNL rats (n = 7 / 8). FIG. 25A illustrates representative immunoblots and quantification of the effect of lentiviruses expressing LRRC8A WT and P3C mutant on LRRC8A expression in the DRG. FIG. 25B illustrates representative immunoblots and quantification show the effect of lentiviruses expressing LRRC8A WT and P3C mutant on LRRC8A and GluNl expression in spinal cord synaptosomes.141624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0056] FIGs. 26A-26C illustrate that intrathecal injection of lentiviruses expressing Lrrc8a WT or mutant similarly reduces pain hypersensitivity of Lrrc8a-cKO mice. FIGs. 26A is a graph illustrating nociceptive thresholds in response to tactile (von Frey filaments) stimuli assessed following lentiviral injection (n = 3-4 mice per group). FIGs. 26B is a graph illustrating nociceptive thresholds in response to noxious pressure stimuli assessed following lentiviral injection (n = 3-4 mice per group). FIGs. 26C is a graph illustrating nociceptive thresholds in response to thermal stimuli assessed following lentiviral injection (n = 3-4 mice per group). Data are presented as mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 vs. baseline (day 0; two-way ANOVA with Dunnett’s post hoc test).

[0057] FIGs. 27A-27C illustrate VRAC activity of DRG neurons from WT mice and Lrrc8a-cKO mice treated with intrathecal lentiviruses expressing Lrrc8a mutant. FIG.27A shows graphs illustrating representative current-voltage (I-V) relation and quantification of VRAC currents induced by hypotonic extracellular solution in DRG neurons from wild- type (WT) mice (n = 12 cells). FIG. 27B shows graphs illustrating representative I-V curve and quantification of VRAC currents in DRG neurons from Lrrc8a-Cko mice after intrathecal injection with lentivirus expressing Lrrc8a P3C mutant (n = 12 cells). FIG. 27C illustrates original traces and quantification of VRAC currents, elicited by bath application of hypotonic solution, in DRG neurons from WT mice and mutant lentivirus injected Lrrc8a-cKO mice (n = 15 cells per group). Data are presented as mean ± SEM. ***p < 0.001 (Mann- Whitney test).DETAILED DESCRIPTION

[0058] The present invention is based on the seminal discovery that LRRC8A, mainly through its C-terminal leucine-rich repeat (LRR1-3) domain, forms a protein complex with NMDARs, thereby constitutively restraining their synaptic trafficking and activity. The work shown in the present disclosure indicates that LRRC8A was highly expressed in the DRG and spinal dorsal hom neurons. Nerve injury caused a sustained reduction in LRRC8A expression levels in the DRG. Strikingly, siRNA-mediated LRRC8A knockdown or conditional Lrrc8a knockout in DRG neurons consistently caused a pain hypersensitivity phenotype that was readily reversed by NMD AR antagonists. Correspondingly, LRRC8A knockdown or conditional Lrrc8a knockout in DRG neurons markedly augmented synaptic expression and activity of NMDARs in the spinal cord. LRRC8A interacted with NMDARs in both rat and human spinal cords primarily through its LRR1-3 domain, restricting the synaptic trafficking and activity of NMDARs. Furthermore, Lrrc8aebo / ebomice, which lack the C-terminal LRR domain, exhibited NMDAR-dependent pain151624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO hypersensitivity and synaptic NMD AR hyperactivity in the spinal cord. Described herein is the delivery of intrathecal Lrrc8a gene to eliminated nerve injury-induced pain hypersensitivity and synaptic NMDAR hyperactivity. Described herein is the disclosure that LRRC8A physically interacts with NMDARs and normally restrains their synaptic expression at the spinal cord level independently of VRAC activity. Reduced LRRC8A expression in primary sensory neurons contributes to chronic pain development via enhancing synaptic expression of ‘unleashed’ NMDARs.

[0059] Described herein is the modulation of a protein LRRC8A, which typically regulates cell volume, as having a non-canonical role in restricting synaptic expression and activity NMDARs. LRRC8A is abundant in the normal DRG and dorsal hom neurons. Spinal LRRC8A knockdown, LRRC8A gene mutation, or genetically ablating LRRC8A in DRG neurons unexpectedly causes NMDAR-dependent pain hyperactivity. Remarkably, LRRC8A physically interacts with NMDARs to inhibit their synaptic expression and activity. Nerve injury diminishes LRRC8A in the DRG, resulting in synaptic NMDAR hyperactivity and pain hypersensitivity. LRRC8A gene delivery via intrathecal injection completely reverses nerve injury-induced NMDAR hyperactivity and pain hypersensitivity independently of VRAC activity. Described herein is a non-canonical role of neuronal LRRC8A in regulating pain chronicity by restricting the synaptic expression of NMDARs at the spinal cord level.

[0060] The inventors have made several groundbreaking discoveries regarding LRRC8A’s role in pain signaling. Described herein is the discovery that LRRC8A proteins act as constitutive inhibitors of NMDAR activity in the spinal cord under normal conditions. This inhibition occurs through a direct physical interaction between LRRC8A and NMDARs, primarily via LRRC8A’s C-terminal LRR domain, effectively dampening pain signals and maintaining normal nociception.

[0061] A key finding is LRRC8A’s involvement in neuropathic pain development. The inventors discovered that in cases of traumatic nerve injury, LRRC8A levels in DRG neurons are selectively and persistently reduced. This reduction leads to increased synaptic NMDAR activity in the spinal dorsal hom, resulting in amplified pain signaling and chronic neuropathic pain.

[0062] Before the present compositions and methods are described, it is to be understood that this invention is not limited to particular compositions, methods, and experimental conditions described, as such compositions, methods, and conditions may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and161624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO is not intended to be limiting, since the scope of the present invention will be limited only in the appended claims.

[0063] As used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, references to “the method” includes one or more methods, and / or steps of the type described herein which will become apparent to those persons skilled in the art upon reading this disclosure and so forth.

[0064] As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items.

[0065] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0066] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, it will be understood that modifications and variations are encompassed within the spirit and scope of the instant disclosure. The preferred methods and materials are now described.

[0067] In certain embodiments, the present disclosure provides a method for treating pain in a subject including administering to the subject a therapeutically effective amount of a vector including a gene encoding LRRC8A, wherein expression of the gene provides treatment for the pain.

[0068] The term “leucine -rich repeat containing 8 A” or “LRRC8A” or SWELL 1 refers to a critical component of the volume-regulated anion channel (VRAC) in human cells. LRRC8A forms homo- or hetero-hexameric channels with at least one of its four paralogs LRRC8B-LRRC8E. LRRC8A is a widely expressed protein with four transmembrane domains, an intracellular N-terminal domain, and a cytoplasmic C terminus with 15-17 predicted leucine -rich motifs that constitute a leucine-rich repeat (LRR) domain. LRRC8A is expressed in a wide variety of human cells and tissues including but not limited to cells or tissues found in the brain, kidney, ovary, lung, liver, heart, fetal brain, fetal liver, bone marrow, peripheral blood cells, and immune system. Examples of human cells expressing LRRC8A include but are not limited to neurons,171624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO glia cells, T-cells, B-lineage cells (e.g., pro-B and pre-B cells), myoblasts, pancreatic beta cells, and cells with active lysosomal function.

[0069] The term “subject” as used herein refers to any individual or patient to which the subject methods are performed. Generally, the subject is human, although as will be appreciated by those in the art, the subject may be a non-human animal. Thus, other animals, including vertebrate such as rodents (including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows, horses, goats, sheep, pigs, chickens, and primates (including monkeys, chimpanzees, orangutans and gorillas) are included within the definition of subject.

[0070] The term "treatment" is used interchangeably herein with the term "therapeutic method" or “therapy” and refers to 1) therapeutic treatments or measures that cure, slow down, lessen symptoms of, and / or halt progression of a diagnosed pathologic conditions or disorder, and / or 2) prophylactic / preventative measures. Those in need of treatment may include individuals already having a particular medical disorder as well as those who may ultimately acquire the disorder (i.e., those needing preventive measures).

[0071] The terms “therapeutically effective amount”, “effective dose,” “therapeutically effective dose”, “effective amount,” or the like refer to that amount of the subject compound that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor or other clinician. Generally, the response is either amelioration of symptoms in a patient or a desired biological outcome (e.g., pain relief). Such amount should be sufficient to relieve neuropathic pain. The effective amount can be determined as described herein.

[0072] The terms “administration of’ and or “administering” should be understood to mean providing a pharmaceutical composition in a therapeutically effective amount to the subject in need of treatment. Administration routes can be enteral, topical or parenteral. As such, administration routes include but are not limited to intracutaneous, subcutaneous, intravenous, intraperitoneal, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, transdermal, transtracheal, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal and intrastemal, oral, sublingual buccal, rectal, vaginal, nasal ocular administrations, as well infusion, inhalation, and nebulization. The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration. Administration routes can be inhalation, otic, buccal, conjunctival, dental, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal,181624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO hemodialysis, infiltration, interstitial, intraabdominal, intraamniotic, intraarterial, intraarticular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavemous, intracavitary, intracerebroventricular, intracisternal, intracorneal, intracoronal, intracoronary, intracorpous cavemaosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ophthalmic, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intraparenchymal, intrathecal, intraventricular, stereotactic administration, or any combination thereof.

[0073] One of ordinary skill in the art will appreciate that a method of administering therapeutically effective amounts of the pharmaceutical compositions of the invention to a patient in need thereof, can be determined empirically, or by standards currently recognized in the medical arts. The agents can be administered to a patient as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents of the pharmaceutical compositions of the present invention will be decided within the scope of sound medical judgment by the attending physician. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the type and degree of the cellular response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, gender and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific agent; and like factors well known in the medical arts. It is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.191624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0074] The term "pharmaceutically acceptable" refers to the fact that the carrier, diluent or excipient must be compatible with the other ingredients of the formulation and not deleterious to the recipient thereof. For example, the carrier, diluent, or excipient or composition thereof may be administered to a subject along with a conjugate of the invention without causing any undesirable biological effects or interacting in an undesirable manner with any of the other components of the pharmaceutical composition in which it is contained.

[0075] Dosages can also be administered in a patient-specific manner to provide a predetermined concentration of the agents in the blood, as determined by techniques accepted and routine in the art.

[0076] In some aspects, the vector is administered intrathecally.

[0077] A composition or method of the invention is used to treat, or provide relief of, any type of pain including, but not limited to, inflammatory pain, arthritis pain, complex regional pain syndrome, lumbosacral pain, musculoskeletal pain, neuropathic pain, chronic pain, cancer-related pain, acute pain, postoperative pain, nociceptive pain, fibromyalgia pain, mechanical pain, radicular pain, diabetes related pain, herniated disc pain, migraine headaches, compressed or pinched nerve pain, sciatica pain. In some instances, pain relief may be palliative, or pain relief may be provided independent of improvement of the disease or condition or the underlying cause of the disease or condition.

[0078] In some aspects, the pain is neuropathic pain. In some aspects, the neuropathic pain is caused by traumatic nerve injury. In some aspects, the traumatic nerve injury is spinal nerve ligation.

[0079] In some aspects, the pain originates from tactile stimulus, noxious pressure, thermal stimulus, or a combination thereof.

[0080] In some aspects, expression of LRRC8A from the vector reduces synaptic NMD AR activity in the spinal cord of the subject. The activity of synaptic NMD AR may be reduced by at least about 1% to 100%, e.g., about 1%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, relative to corresponding activity of NMD AR in the subject prior to administration of treatment or the activity of the NMD AR in a subject suffering from pain. The activity of synaptic NMD AR may be silenced relative to corresponding activity of NMD AR in the subject prior to administration of treatment or the activity of the NMD AR in a subject suffering from pain. In one aspect, the activity of NMD AR is reduced in cells of the subject.201624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0081] Methods for detecting and quantifying NMDAR mRNA in biological samples are known in the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying NMDAR protein in biological samples are known in the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is cerebrospinal fluid (CSF) or spinal cord tissue. In some aspects, the sample is cells of the subject. In some aspects, the sample is nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0082] In some aspects, the vector is a viral vector, for example, a lentiviral, adenovirus or adeno-associated virus (AAV) vector. In various aspects, the viral vector is a vector that preferentially targets the spinal cord cells. For example, the AAV vector includes AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, AAV-DJ, AAV-php. B, AAV-LK03, AAV-Rh (e.g. AAV-Rh.1-10, AAVrh32.33), AAV-PHP. S, AAV-PHP.eB, AAV-BR1, AAV-MY, AAV-LP1, AAV-GP1, AAV-DJ / 8, or variants thereof.

[0083] In some aspects, expression of the gene increases LRRC8A protein levels, LRRC8A mRNA levels, or a combination thereof in DRG of the subject compared to LRRC8A protein levels, LRRC8A mRNA levels, or a combination thereof in the subject prior to treatment. For example, expression of LRRC8A of a subject may be increased by at least 1.5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 3 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 1.5 to 5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 10 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain.

[0084] LRRC8A expression may be increased using any known method in the art. For example, in various aspects the nucleic acid sequence encoding LRRC8A is in a viral vector encoding at least the LRRC8A gene or any functional fragments thereof. In various aspects, the211624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO viral vector is a lentiviral, adenovirus or adeno-associated virus (AAV) vector. In various aspects, the viral vector is a vector that preferentially targets the spinal cord cells. For example, the AAV vector includes AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, AAV-DJ, AAV-php. B, AAV-LK03, AAV-Rh (e.g. AAV-Rh.1-10, AAVrh32.33), AAV-PHP. S, AAV-PHP.eB, AAV-BR1, AAV-MY, AAV-LP1, AAV-GP1, AAV-DJ / 8, or variants thereof. In various aspects, the subject is a mammal. In various aspects, the mammal is a human. In various aspects, the human has decreased expression of LRRC8A compared to a human not suffering from the disease.

[0085] Methods for detecting and quantifying LRRC8A mRNA in biological samples are known in the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying LRRC8A protein in biological samples are known in the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is CSF or spinal tissue. In some aspects, the sample is cells of the subject. In some aspects, the sample is nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0086] In some aspects, expression of the gene decreases synaptic expression of NMD AR subunits in the spinal cord of the subject compared to synaptic expression of NMD AR subunits in the spinal cord of the subject prior to treatment or synaptic expression of NMD AR subunits in the spinal cord of a subject suffering from pain. Methods for detecting and quantifying NMD AR mRNA in biological samples are known in the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying NMD AR protein in biological samples are known in the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is CSF or spinal tissue. In some aspects, the sample is221624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO cells of the subject. In some aspects, the sample is nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0087] In some aspects, the pain is characterized by at least one of tactile allodynia and thermal hyperalgesia.

[0088] In some aspects, the gene encodes full-length LRRC8A, LRRC8A N-terminus mutant, or a functional fragment thereof.

[0089] In certain embodiments, the present disclosure provides a method of modulating NMD A receptor activity in a nervous system of a subject, including administering to the subject a therapeutically effective amount of a vector encoding LRRC8A, thereby increasing the level of expression of LRRC8A and modulating NMD AR activity.

[0090] One of ordinary skill in the art will appreciate that a method of administering therapeutically effective amounts of the pharmaceutical compositions of the invention to a patient in need thereof, can be determined empirically, or by standards currently recognized in the medical arts. The agents can be administered to a patient as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents of the pharmaceutical compositions of the present invention will be decided within the scope of sound medical judgment by the attending physician. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the type and degree of the cellular response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, gender and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific agent; and like factors well known in the medical arts. It is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.

[0091] Dosages can also be administered in a patient-specific manner to provide a predetermined concentration of the agents in the blood, as determined by techniques accepted and routine in the art.

[0092] In some aspects, the NMDA receptor activity is NMD AR activity in the spinal cord of the subject.

[0093] In some aspects, the vector is administered intrathecally.231624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0094] In some aspects, modulating receptor activity comprises reducing pain symptoms in the subject.

[0095] In certain embodiments, the present disclosure provides a method for treating pain in a subject including administering to the subject a therapeutically effective amount of a small molecule that increases expression of LRRC8A, wherein the increased expression of LRRC8A provides treatment for the pain.

[0096] In some aspects, LRRC8A expression levels are increased compared to LRRC8A expression levels in the subject prior to treatment or LRRC8A expression levels in a subject suffering from pain. For example, expression of LRRC8A of a subject may be increased by at least 1.5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 3 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 1.5 to 5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 10 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain.

[0097] LRRC8A expression may be increased using any known method in the art. For example, in various aspects the small molecule is a histone deacetylase inhibitor, an antioxidant, a cytokine, a growth factor, nuclear receptor agonist, or a combination thereof. In various aspects, the subject is a mammal. In various aspects, the mammal is a human. In various aspects, the human has decreased expression of LRRC8A compared to a human not suffering from the disease.

[0098] Methods for detecting and quantifying LRRC8A mRNA in biological samples are known the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying LRRC8A protein in biological samples are known the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is CSF or spinal tissue. In some aspects, the sample is cells of the subject. In some aspects, the sample is241624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0099] In some aspects, the pain is neuropathic pain. In some aspects, the neuropathic pain is caused by traumatic nerve injury. In some aspects, the traumatic nerve injury is spinal nerve ligation.

[0100] In some aspects, increasing expression of LRRC8A reduces synaptic NMD AR activity in the spinal cord of the subject. The activity of synaptic NMD AR may be reduced by at least about 1% to about 100%, e.g., about 1%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more, relative to corresponding activity of NMDAR in the subject prior to administration of treatment or the activity of the NMDAR in a subject suffering from pain. The activity of synaptic NMDAR may be silenced relative to corresponding activity of NMDAR in the subject prior to administration of treatment or the activity of the NMDAR in a subject suffering from pain. In some aspects, the activity of NMDAR is reduced in cells of the subject.

[0101] Methods for detecting and quantifying NMDAR mRNA in biological samples are known the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying NMDAR protein in biological samples are known the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is CSF or spinal tissue. In some aspects, the sample is cells of the subject. In some aspects, the sample is nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0102] In some aspects, increasing expression of LRRC8A increases LRRC8A protein levels in DRG of the subject. For example, expression of LRRC8A of a subject may be increased by at least 1.5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 3 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 1.5 to 5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A251624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO of a subject may be increased by at least 10 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain.

[0103] In some aspects, expression of LRRC8A decreases synaptic expression of NMD AR subunits in the spinal cord of the subject. The expression or expression levels of NMD AR subunits maybe decreased by at least about 1% to about 100%, e.g., about 1%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more, relative to corresponding expression or expression levels of NMD AR subunits in the subject prior to administration of treatment or the expression or expression levels of NMD AR subunits in a subject suffering from pain. The expression or expression levels of NMD AR subunits may be silenced relative to corresponding expression or expression levels of NMD AR subunits in the subject prior to administration of treatment or the expression or expression levels of NMD AR subunits in a subject suffering from pain. In some aspects, the activity of NMD AR is reduced in cells of the subject.

[0104] Methods for detecting and quantifying NMDAR mRNA in biological samples are known the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying NMDAR protein in biological samples are known the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is CSF or spinal tissue. In some aspects, the sample is cells of the subject. In some aspects, the sample is nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0105] In some aspects, the pain is characterized by at least one of tactile allodynia and thermal hyperalgesia.

[0106] In certain embodiments, the present disclosure provides a method of modulating NMD A receptor activity in a nervous system of a subject, including administering to the subject a therapeutically effective amount of a small molecule that increases expression of LRRC8A, thereby increasing the level of expression of LRRC8A and modulating NMDAR activity in the nervous system of the subject.

[0107] In some aspects, LRRC8A expression levels are increased compared to LRRC8A expression levels in the subject prior to treatment or LRRC8A expression levels in a subject261624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO suffering from pain. For example, expression of LRRC8A of a subject may be increased by at least 1.5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 3 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 1.5 to 5 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain. Expression of LRRC8A of a subject may be increased by at least 10 times greater than expression of LRRC8A of the subject prior to treatment or expression of LRRC8A of a subject suffering from pain.

[0108] LRRC8A expression may be increased using any known method in the art. For example, in various aspects small molecule is a histone deacetylase inhibitor, an antioxidant, a cytokine, a growth factor, nuclear receptor agonist, or a combination thereof. In various aspects, the subject is a mammal. In various aspects, the mammal is a human. In various aspects, the human has decreased expression of LRRC8A compared to a human not suffering from the disease.

[0109] Methods for detecting and quantifying LRRC8A mRNA in biological samples are known the art. In some aspects, the level of mRNA is determined using RT-qPCR or RNA-seq. Methods for detecting and quantifying LRRC8A protein in biological samples are known the art. In some aspects, the level of protein is determined using immunoblotting, coimmunoprecipitation, immunofluorescence, and / or ELISA. In one aspect, a sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). In some aspects, the sample is CSF or spinal tissue. In some aspects, the sample is cells of the subject. In some aspects, the sample is nervous system tissue of the subject. In some aspects, the sample comprises spinal cord cells of the subject.

[0110] In some aspects, the NMDA receptor activity is NMD AR activity in the spinal cord of the subject.

[0111] Therapeutic compositions of the present invention are administered to a subject in a manner known in the art. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.271624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0112] One may administer the viral vectors or small molecule, or related compound in a local rather than systemic manner, for example, via injection of directly into the desired target site, often in a depot or sustained release formulation. Furthermore, one may administer the composition in a targeted drug delivery system, for example, in a liposome coated with a tissue-specific antibody, targeting, for example, the spinal cord, and more specifically neuronal cells. The liposomes will be targeted to and taken up selectively by the desired tissue. Also included in a targeted drug delivery system is nanoparticle specific spinal cord delivery of the viral vectors, small molecule or compound, alone or in combination with similar compounds. A summary of various delivery methods and techniques of gene therapy administration is provided in Sung, Y., Kim, S. Recent advances in the development of gene delivery systems. Biomater Res 23, 8 (2019) and Mali S. Delivery systems for gene therapy. Indian J Hum Genet. Jan;19(1):3-8 (2013) the contents of which is hereby incorporated by reference in its entirety.

[0113] The pharmaceutical compositions can be administered in a variety of unit dosage forms depending upon the method of administration. Suitable unit dosage forms, include, but are not limited to powders, tablets, pills, capsules, lozenges, suppositories, patches, nasal sprays, injectables, implantable sustained release formulations, and lipid complexes.

[0114] The pharmaceutical composition may also contain other therapeutic agents, and may be formulated, for example, by employing conventional vehicles or diluents, as well as pharmaceutical additives of a type appropriate to the mode of desired administration (for example, excipients, and preservatives) according to techniques known in the art of pharmaceutical formulation.

[0115] In certain embodiments, the compositions disclosed herein are formulated with additional agents that promote entry into the desired cell or tissue. Such additional agents include micelles, liposomes, and dendrimers.

[0116] Pharmaceutical compositions including the conjugate may be administered by any suitable means, for example, parenterally, such as by subcutaneous, intravenous, intramuscular, intrathecal, or intracisternal injection or infusion techniques (e.g., as sterile injectable aqueous or non-aqueous solutions or suspensions) in dosage formulations containing non-toxic, pharmaceutically acceptable vehicles or diluents. In certain aspects the conjugate is administered parenterally, or more preferably, intravenously.

[0117] The mode of delivery chosen for administration of conjugates according to the present invention to a subject, such as a human patient or mammalian animal, will depend in large part on281624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO the particular active agent present in the conjugate and the target cells. In general, the same dosages and administration routes used to administer the active agent alone will also be used as the starting point for the conjugate. However, it is preferred that smaller doses be used initially due to the expected increase in cellular penetration of the active agent. The actual final dosage for a given route of administration is easily determined by routine experimentation. In general, the same procedures and protocols that have been previously used for other antibody-based targeting conjugates (e.g., parenterally, intravenous, intrathecal, and the like) are also suitable for the conjugates of the present invention.

[0118] The pharmaceutical compositions of the conjugate can be administered either alone or in combination with other therapeutic agents, may conveniently be presented in unit dose form and may be prepared by any of the methods well known in the art of pharmacy. All methods include bringing the conjugate into association with the carrier, which constitutes one or more accessory ingredients. In general, the pharmaceutical compositions are prepared by uniformly and intimately bringing the active ingredient into association with a liquid carrier. In a pharmaceutical composition, the conjugate is included in an amount sufficient to produce the desired effect upon the process or condition of disease.

[0119] Depending on the condition being treated, these pharmaceutical compositions may be formulated and administered systemically or locally. Techniques for formulation and administration are generally known in the art. Suitable routes may, for example, parenteral delivery, including intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, or intraperitoneal. For injection, the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.

[0120] Presented below are examples discussing the implication of LRRC8A neuropathic pain contemplated for the discussed applications. The following examples are provided to further illustrate the embodiments of the present invention but are not intended to limit the scope of the invention. While they are typical of those that might be used, other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.291624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO EXAMPLES EXAMPLE 1LRRC8A is Expressed in the DRG and Spinal Dorsal Horn Neurons

[0121] Triple fluorescence labeling was first used to determine the distribution of LRRC8A in the DRG and dorsal spinal cord. Confocal images showed that LRRC8A-immunoreactivity was present in 92.4 ± 6.6% neurons labeled with the neuronal marker NeuN in the rat DRG (FIG. 1A).Also, LRRC8A immunoreactivity was present in all neurons labeled colocalized with IB4, (a marker for non-peptidergic neurons), CGRP (a marker for peptidergic neurons), or NF200 (a marker for myelinated neurons) (FIGs. 1A-1C). Notably, LRRC8A-immunoreactivity was present mostly in the cytoplasmic compartment of DRG neurons.

[0122] In the dorsal spinal cord, LRRC8A immunoreactivity was largely distributed in the superficial laminas of the dorsal horn in rats and was colocalized with NeuN (FIG. ID). In addition, LRRC8A immunoreactivity was colocalized with IB4 on some nerve terminals in laminas I and II of the spinal cord (FIG. ID). In laminae I and II, as defined by IB4 labeling, LRRC8A immunoreactivity was detected in 97.8 ± 8.3% of NeuN-positive neurons. These results suggest that LRRC8A is expressed in the DRG and spinal dorsal horn neurons.EXAMPLE 2Nerve injury causes a sustained reduction in LRRC8A expression in the DRG

[0123] Peripheral nerve injury induces downregulation of antinociceptive genes and upregulation of pronociceptive genes in the DRG. To determine whether nerve injury affects LRRC8A expression in the DRG, L5 and L6 spinal nerve ligation (SNL) were performed in rats, which is commonly used as a rodent model of neuropathic pain. RNA sequencing data indicate that LRRC8A-LRRC8D, but not LRRC8E, is expressed in the DRG and spinal cord. Quantitative PCR analysis showed that compared with sham-operated rats, SNL caused a sustained reduction in the mRNA level of Lrrc8a in the DRG, but not the spinal cord, 5, 10, and 21 days after surgery (n = 6 rats per group; FIG. 2A). However, SNL had no significant effect on the mRNA levels of Lrrc8b-Lrrc8d in the DRG during this period (n = 6 rats per group; FIG. 2A).

[0124] Furthermore, immunoblotting analysis showed that the protein level of LRRC8A in the DRG was significantly lower in SNL rats than in sham-operated control rats 21 days after surgery (p = 0.0246, t(10) = 2.395, n = 6 rats per group; FIG.2B). As expected, the VRAC activity of DRG neurons, elicited by hypotonic solution, was also significantly reduced in SNL rats (p = 0.0071, t(19) = 3.016, n = 12 neurons) compared with that in sham control rats (n = 9 neurons; FIG. 2C).301624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO SNL had no significant effect on the mRNA and protein levels of LRRC8A in the dorsal spinal cord (n = 6 rats per group; FIG.2D-2E). These data indicate that nerve injury induces a rapid and long-lasting reduction in LRRC8A expression in the DRG.EXAMPLE 3LRRC8A Downregulation in the DRG and Spinal Cord Induces NMDAR-dependent Pain Hypersensitivity

[0125] To determine the functional significance of LRRC8A downregulation by nerve injury, intrathecal injection of LRRC8A-specific siRNA (2 pg per day) was initially used to knock down LRRC8A in the DRG and spinal cord of naive rats and then performed behavioral tests in siRNA-treated rats. Strikingly, intrathecal injection of LRRC8A-specific siRNA, but not control siRNA, for six consecutive days caused a gradual and profound reduction from the baseline withdrawal thresholds in response to tactile, noxious pressure, and thermal stimuli (n = 8 rats per group, FIG.3A), indicating the presence of allodynia and hyperalgesia.

[0126] Immunoblotting analysis confirmed that the protein levels of LRRC8A in the DRG and spinal cord were largely reduced in rats treated with LRRC8A-specific siRNA compared with rats treated with control siRNA (n =6 rats per group; FIG. 11A and 11B). Furthermore, the VRAC activity in DRG neurons was much lower in LRRC8A-specific siRNA-treated rats (n = 11 neurons) than in control siRNA-treated rats (n = 10 neurons) (p = 0.0001, t(19) = 4.729; FIG.11C).

[0127] Because increased NMDAR activity at the spinal cord level plays a pivotal role in neuropathic pain, we next determined whether pain hypersensitivity caused by LRRC8A downregulation is mediated by NMDARs. Intrathecal injection of (2R)-amino-5-phosphonopentanoate (AP5, 5 pg), a specific NMDAR antagonist, rapidly reversed the reduced baseline withdrawal thresholds in rats treated with LRRC8A-specific siRNA but had no significant effect in rats treated with control siRNA (n = 8 rats per group, FIG.3B). These findings suggest that diminished LRRC8A expression at the spinal cord level induces pain hypersensitivity via NMDARs.EXAMPLE 4Lrrc8a Conditional Knockout in DRG Neurons Induces NMDAR-dependent Pain Hypersensitivity

[0128] To specifically determine the role of constitutive LRRC8A in DRG neurons in nociceptive regulation, Lrrc8aflox / floxmice was crossed with an AdvillinCre / +Cre and Avil-Cre311624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO expressing mice, a primary sensory neuron-specific Cre mouse line (da Silva et al., 2011), to generate Lrrc8a-conditional knockout (Lrrc8a-cKO) mice in which Lrrc8a was ablated from primary sensory neurons. The protein level of LRRC8A in the DRG, but not the spinal cord, was diminished in Lrrc8a-cKO mice compared with wild-type (WT) control mice (n = 6 mice per group, FIGs. 12A and 12B). Also, the amplitude of VRAC currents in DRG neurons was much smaller in Lrrc8a-cKO mice (n = 11 neurons) than in WT control mice (n = 10 neurons) (p < 0.0001, t(19) = 9.951, FIG. 12C). Because Avil-Cre-induced target gene knockout occurs in 84% of DRG neurons, this explains the incomplete removal of LRRC8A expression in DRG neurons of Lrrc8a-cKO mice.

[0129] In addition, double immunofluorescent labeling with LRRC8A and NeuN antibodies in the DRG and spinal cord showed that compared with WT mice, LRRC8A-immunoreactive DRG neurons were mostly absent in Lrrc8a-cKO mice (FIGs. 12D and 12E). LRRC8A-immunoreactivity on nerve terminals, but not on NeuN-positive neurons, in spinal laminas I and II was also reduced in Lrrc8a-cKO mice (FIGs. 12F and 12G).

[0130] The baseline tactile, pressure, and thermal withdrawal thresholds were much lower in Lrrc8a-cKO mice than in WT controls (n = 8 mice per group; FIG.3C). However, motor function, assessed using the Rotarod test, did not differ significantly between the groups (Fig. 3D).Furthermore, intraperitoneal injection of 10 mg / kg memantine, a clinically used NMD AR antagonist, or intrathecal injection of 5 pg AP5 readily reversed the reduction of the baseline withdrawal thresholds reduced in Lrrc8a-cKO mice (n = 8 mice per group, FIGs. 3E and 3F).Thus, the pain hypersensitivity phenotype induced by LRRC8A loss of function resembles chronic neuropathic pain caused by nerve injury or chemotherapy. These results suggest that LRRC8A proteins in primary sensory neurons constitutively restrain nociceptive hypersensitivity via regulation of NMDARs.EXAMPLE 5LRRC8A Downregulation Induces Tonic Activation of Presynaptic NMDARs in the Spinal Cord

[0131] Spinal dorsal hom neurons are critically involved in processing sensory input from DRG neurons. A critically important mechanism of neuropathic pain is increased synaptic NMD AR activity at the spinal cord level. Because LRRC8A downregulation elicited NMDAR-dependent pain hypersensitivity, whether synaptic NMDAR activity in the spinal cord is altered by intrathecal treatment with LRRC8A-specific siRNA was determined directly. Spinal cord slices321624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO from rats were obtained after treatment with LRRC8A-specific siRNA or control siRNA for 5 days. Then miniature excitatory postsynaptic currents (mEPSCs) were recorded, which reflect quantal glutamate release from presynaptic terminals. Treatment with LRRC8A-specific siRNA, but not control siRNA, significantly increased the baseline frequency, but not amplitude, of glutamatergic mEPSCs in lamina II neurons (n =10 neurons, p = 0.0135, F(5,63) = 4.133). Bath application of 50 pM AP5 normalized the increased frequency of mEPSCs in lamina II neurons of LRRC8A-specific siRNA-treated rats (FIG.4A-4C). In contrast, AP5 had no significant effect on the frequency or amplitude of mEPSCs in lamina II neurons of control siRNA-treated rats (n = 10 neurons, FIG. 4A-4C). These data suggest that LRRC8A downregulation potentiates presynaptic NMD AR activity of spinal dorsal horn neurons.

[0132] Next, it was determined specifically whether LRRC8A downregulation increases the activity of NMDARs at primary afferent central terminals. EPSCs of lamina II neurons monosynaptically evoked from the dorsal root were recorded, which represent induced glutamate released from primary afferent terminals. The baseline amplitude of evoked EPSCs of lamina II neurons was significantly higher in LRRC8A-specific siRNA-treated rats than in control siRNA-treated rats (n = 10 neurons per group, p = 0.0172, F(5,58) = 3.066; FIGs. 4D-4F). Bath application of 50 pM AP5 reversed the increased amplitude of EPSCs and markedly increased the paired-pulse ratio (PPR) of evoked EPSCs of lamina II neurons from LRRC8A-specific siRNA-treated rats (n = 10 neurons, FIGs. 4D-4F). In contrast, AP5 had no significant effect on the baseline amplitude or PPR of evoked EPSCs in lamina II neurons from control siRNA-treated rats (n =10 neurons, FIGs. 4D-4F).

[0133] Additionally, whether LRRC8A downregulation affects postsynaptic NMDAR activity in the spinal dorsal hom was determined by recording NMDAR currents elicited by puff application of 100 pM NMDA directly onto lamina II neurons. The amplitude of the inward NMDAR currents of lamina II neurons was significantly larger in LRRC8A-specific siRNA-treated rats (n = 11 neurons) than in control siRNA- treated rats (n = 14 neurons; p = 0.0225, t(l 7) = 2.509; FIGs. 4G-4H). Taken together, these findings suggest that LRRC8A constitutively suppresses the activity of postsynaptic NMADRs and presynaptic NMDARs at the central terminals of primary sensory neurons.331624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO EXAMPLE 6Lrrc8a Conditional Knockout in DRG Neurons Induces Presynaptic NMD AR Hyperactivity in the Spinal Cord

[0134] Subsequently, the potential role of LRRC8A expressed in DRG neurons in the regulation of presynaptic NMDARs at the central terminals of primary afferent nerves was specifically determined. The baseline frequency of mEPSCs in lamina II neurons was much higher in Lrrc8a-cKO mice (n = 10 neurons) than in WT mice (n = 11 neurons, p = 0.0085, F(5,57) = 4.116; FIGs. 5A-5C). Bath application of 50 pM AP5 reversed the increased baseline frequency of mEPSCs in lamina II neurons in Lrrc8a-cKO mice (n = 10 neurons; FIGs. 5A-5C).Furthermore, the baseline amplitude of EPSCs of lamina II neurons monosynaptically evoked from the dorsal root was much greater in Lrrc8a-cKO mice (n = 12 neurons) than in WT mice (n = 11 neurons, p = 0.0009, F(5,57) = 4.991; FIGs. 5D-5F). Bath application of AP5 normalized the increased amplitude of EPSCs and increased the PPR of evoked EPSCs in lamina II neurons from Lrrc8a-cKO mice (n = 11 neurons per group, FIGs. 5D-5F). However, the amplitude of NMD AR current elicited by puff application of 100 pM NMDA to lamina II neurons did not differ significantly between Lrrc8a-cKO mice (n = 12 neurons) and WT mice (n = 11 neurons; FIGs.5G-5H). These data provide compelling evidence that LRRC8A in DRG neurons constitutively inhibits presynaptic NMDARs at the central terminals of DRG neurons.EXAMPLE 7LRRC8A, but not LRRC8B, Interacts Directly with NMDARs

[0135] NMDARs continuously cycle into and out of the synaptic site, with their movement regulated by protein-protein interactions. Intrigued by the functional association between LRRC8A and NMDARs, it was next determined whether LRRC8A directly interacts with NMDAR proteins. Co-immunoprecipitation (co-IP) assays using membrane protein extracts of dorsal spinal cords obtained from rats and human donors was conducted. An anti-GluNl antibody was used for co-IP assays, because GluNl is an essential subunit of NMDARs. Remarkably, coIP analysis revealed that the anti-GluNl antibody, but not an irrelevant IgG, precipitated LRRC8A proteins from the rat and human spinal cords (FIGs. 6A-6B). Furthermore, reverse co-IP showed that an anti-LRRC8A antibody, but not IgG, precipitated GluNl, GluN2A, and GluN2B subunits in spinal membrane fractions from rat and human spinal cords (FIGs. 6C-6D).

[0136] To determine whether LRRC8A interacts with NMDARs independently of other neural proteins (e.g., a25-l), HEK293 cells in which endogenously expressed LRRC8A was removed341624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO using a CRISPR / Cas9 approach (Lrrc8a-KO HEK293 cells) were used. Co-IP assays using membrane extracts of HEK293 cells expressing Flag-tagged LRRC8A together with either GluN 1, GluN2A, GluN2B, GluNl / GluN2A, or GluNl / GluN2B were used conducted. Interestingly, the anti-Flag antibody precipitated GluNl, but not GluN2A or GluN2B, in HEK293 cells expressing Flag-tagged LRRC8A with GluNl, GluN2A, or GluN2B alone (FIG. 6E). However, in HEK293 cells expressing Flag-tagged LRRC8A with GluNl / GluN2A or GluNl / GluN2B, the anti-Flag antibody precipitated GluNl, GluN2A, and GluN2B (FIG. 6E). Reverse co-IP showed that the anti-GluNl antibody precipitated LRRC8A, but not LRRC8B, in HEK293 cells expressing GluNl / GluN2A with Flag-tagged LRRC8A or Flag-tagged LRRC8B (FIG. 16A).

[0137] Additionally, the proximity ligation assay, a highly sensitive and specific method for detecting and visualizing protein-protein interactions in cells and tissues (35, 36), was used to confirm the LRRC8A-NMDAR interaction in the rat DRG and spinal cord. Punctate LRRC8A-GluNl interaction signals were readily detected in NeuN-labeled DRG neurons, particularly within the cytoplasmic compartment (FIG. 17A), and in the spinal dorsal hom (FIG. 17B).Notably, compared to sham controls, dorsal rhizotomy markedly reduced IB4 labeling in the superficial dorsal horn and diminished LRRC8A-GluNl interaction signals in laminae I and II, as identified by IB4 labeling (FIG. 17B and 17C), suggesting that LRRC8A-GluNl complexes are localized at the central terminals of primary sensory neurons. These results demonstrate a direct association between LRRC8A and NMD AR proteins both in vivo and in vitro. LRRC8A primarily interacts with functional NMDARs via their obligatory subunit, GluN 1.EXAMPLE 8LRRC8A Interacts with NMDARs Mainly via its LRR Domain

[0138] I was then attempted to identify which regions of the LRRC8A protein are involved in its interaction with NMDARs. To this end, GluNl / GluN2A was co-expressed with Flag-tagged wildtype LRRC8A or various Flag-tagged LRRC8A mutants in Lrrc8a-KO HEK293 cells. The intracellular N-terminal-domain of LRRC8A (LRRC8A-ANT) was initially deleted and Flag-LRRC8A-ANT with GluNl / GluN2A in Lrrc8a-KO cells expressed. N-terminal-domain deletion did not affect the interaction between Flag-tagged LRRC8A and GluNl (FIG. 6F). However, when C-terminal-truncated Flag-LRRC8A (LRRC8A-ACT) was co-expressed with GluNl / GluN2A in Lrrc8a-KO HEK293 cells, an anti-Flag antibody precipitated GluNl much less in cells expressing LRRC8A-ACT than in cells expressing WT-LRRC8A (FIG. 6F), suggesting that the C terminus of LRRC8A has a major role in the LRRC8A-GluNl interaction.351624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0139] Leucine-rich repeat (LRR)-containing proteins are frequently involved in the proteinprotein interactions. The C-terminal LRR domain of LRRC8A may provide docking surfaces for protein-protein interactions for signaling to various protein kinases. The LRR domain of LRRC8A has 15-17 predicted leucine-rich motifs. To identify which leucine-rich motifs are crucial for the LRRC8A-NMDAR interaction, #1-3, 4-6, 7-9, 10-12, and 13-16 within the LRR domain of LRRC8A were separately deleted and these Flag-tagged mutants along with GluNl / GluN2A expressed in Lrrc8a-KO HEK293 cells. Co-IP using membrane protein extracts showed that deletion of LRR1-3 in LRRC8A diminished the interaction between Flag-tagged LRRC8A and GluNl (FIG. 6G, FIG. 16B). To pinpoint which specific LRR is most critical for LRRC8A-NMDAR interaction, a series of truncations were generated where LRR1, LRR2, or LRR3 was deleted individually. Co-IP analysis demonstrated that removing LRR1 substantially reduced LRRC8A-GluNl interaction (FIG. 6H, FIG. 16C).

[0140] To further validate direct LRRC8A-NMDAR interactions, we designed a peptide, consisting of 22 amino acids (SEQ ID NO: 21: LELHLFMLSGIPDTVFDLVELE) that mimicked the LRR1 domain of LRRC8A (LRRC8A-LRR1 peptide). The peptide was fused with the cellpenetrating peptide Tat (SEQ ID NO: 22: YGRKKRRQRRR) to disrupt intracellular LRRC8A-NMDAR interactions. A sequence-scrambled peptide, fused with Tat, was used as the control peptide. Co-IP assays using protein extracts from Lrrc8a-KO HEK293 cells expressing Flag-tagged LRRC8A and GluNl / GluN2A and from rat spinal cord tissues showed that treatment with the LRRC8A-LRR1 peptide (1 pM for 30 min) significantly attenuated LRRC8A-NMDAR interaction (FIGs. 6I-6J). However, a Tat- fused peptide mimicking the LRR4 domain (ALHIKFTDIKEIPLWIYSLKTLE (SEQ ID NO: 41); LRR4 peptide) of LRRC8A had no effect on LRRC8A-NMDAR interaction (FIG. 18A and 18B). Additionally, proximity ligation assay showed that LRR1 peptide treatment significantly reduced LRRC8A-GluNl interaction signals in HEK293 cells (FIG. 18C and 18D). Together, these results provide compelling evidence that LRRC8A physically interact with NMDARs mainly via its LRR1-3 domain.EXAMPLE 9Uncoupling LRRC8A-NMDAR interactions induces pain hypersensitivity and hyperactivity of presynaptic and postsynaptic NMDARs in the spinal cord

[0141] Next, LRRC8A-LRR1 peptide was used to determine whether disrupting LRRC8A-NMDAR protein complexes influences nociception. Remarkably, intrathecal injection of 1 pg Tat-fused LRRC8A-LRR1 peptide, but not 1 pg Tat-fused scrambled control peptide, caused a rapid361624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO and large reduction in the tactile, pressure, and thermal withdrawal thresholds in naive rats (n = 8 rats per group, FIG. 7A).

[0142] Then it was determined whether treatment with LRRC8A-LRR1 peptide affects presynaptic NMDAR activity in the spinal dorsal horn. The baseline frequency, but not the amplitude, of mEPSCs in lamina II neurons was much greater in spinal cord slices treated with LRRC8A-LRR1 peptide (1 pM for 30 min) than in slices treated with the control peptide (1 pM for 30 min) (n = 16 neurons per group, p = 0.0003, F(5,57) = 3.596; FIGs. 7B-7D). Bath application of 50 pM AP5 reversed the increased frequency of mEPSCs in lamina II neurons treated with LRRC8A-LRR1 peptide (FIGs. 7B-7D). Furthermore, the amplitude of EPSCs of dorsal lamina II neurons monosynaptically evoked from the dorsal root was much greater in spinal cord slices treated with LRRC8A-LRR1 peptide (n = 14 neurons, FIGs. 7E-7G) than in slices treated with the control peptide (n = 13 neurons, FIGs. 7E-7G). Bath application of 50 pM AP5 reversed the augmented amplitude of EPSCs and increased the PPR of evoked EPSCs in lamina II neurons treated with LRRC8A-LRR1 peptide (n = 11 neurons, FIGs. 7E-7G).

[0143] In addition, the amplitude of puff NMDA currents of lamina II neurons was substantially larger in spinal cord slices treated with LRRC8A-LRR1 peptide (n = 15 neurons) than in slices treated with the control peptide (n = 17 neurons; p < 0.001, t(30) = 6.344; FIG. 7H).These findings demonstrate the critical role of LRRC8A-NMDAR protein complexes in tonically suppressing nociceptive hypersensitivity and synaptic NMDAR activity in the spinal dorsal hom.EXAMPLE 10LRRC8A Inhibits Cell Surface Expression and Synaptic Incorporation of NMDARs in the Spinal Cord

[0144] Because LRRC8A physically interacts with NMDARs, whether LRRC8A affects surface expression and activity of NMDARs reconstituted in a heterologous expression system was investigated. In HEK293 cells expressing GluNl / GluN2A or GluNl / GluN2B subunits, cotransfection with LRRC8A-specific siRNA substantially increased the NMDAR current density (FIGs. 8A-8B). Also, biotinylation assays was used to label and isolate the surface proteins of HEK293 cells expressing GluNl / GluN2A or GluNl / GluN2B subunits. Co-transfection with LRRC8A-specific siRNA significantly increased cell surface protein levels of GluNl, GluN2A, and GluN2B (n = 6 samples per group, p = 0.0321, t(l 0) = 3.516; FIGs. 8C-8D).

[0145] Then whether endogenous LRRC8A controls synaptic expression of NMDARs in vivo was investigated. Synaptosomes were isolated from dorsal spinal cord tissues of rats intrathecally371624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO treated with LRRC8A-specific siRNA or control siRNA (2 pg per day, for 6 days) and then performed immunoblotting. Treatment with LRRC8A-specific siRNA significantly increased the protein levels of GluNl, GluN2A, and GluN2B in spinal cord synaptosomes (n = 8 rats per group, FIG. 8E). In synaptosomes isolated from dorsal spinal cord tissues of WT and Lrrc8a-cKO mice, immunoblotting assays also showed that ablating LRRC8A in DRG neurons markedly increased the protein levels of GluNl in spinal cord synaptosomes (n = 6 mice per group, p = 0.0007, t(l 0) = 4.858; FIG. 8F). Collectively, these results support the notion that LRRC8A tonically inhibits NMD AR expression on the cell surface and spinal cord synapses.EXAMPLE 11The LRR domain of LRRC8A controls NMDAR-dependent nociceptive hypersensitivity as well as synaptic expression and activity of NMDARs in the spinal cord

[0146] Because the C-terminal LRR domain of LRRC8A is critically involved in the LRRC8A-NMDAR interaction, whether the LRR domain of LRRC8A regulates pain hypersensitivity. To do so, the available Lrrc8aebo / ebomouse model was utilized, which harbors a homozygous 2-bp frameshift mutation in Lrrc8a that truncates 15 terminal LRR domains (Platt et al., 2017) were studied. Compared with WT mice, Lrrc8aebo / ebomice had much lower baseline tactile, pressure, and thermal withdrawal thresholds (n = 7 mice per group, FIG. 9A). In Lrrc8aebo / ebomice, intraperitoneal injection of 10 mg / kg memantine or intrathecal injection of 5 pg AP5 readily reversed the reduced tactile, pressure, and thermal hyperalgesia (n = 6 mice per group, FIGs. 9B-9C).

[0147] The VRAC current in DRG neurons was largely reduced in Lrrc8aebo / ebomice (n = 11 neurons) compared with that in WT mice (n = 10 neurons; FIG. 9D). Co-IP analysis of membrane protein extracts of dorsal spinal cords showed that the LRRC8A antibody precipitated GluNl proteins much less in Lrrc8aebo / ebomice than in WT mice (n = 6 mice per group, p = 0.0005, t(l 9) = 5.02; FIG. 9E). In addition, immunoblotting of spinal cord synaptosomes showed that the protein level of GluN 1 was markedly increased in Lrrc8aebo / ebomice compared with WT mice (n = 6 mice per group, p = 0.002, t(l 0) = 4.136; FIG. 9F).

[0148] To determine the potential role of the LRR domain of LRRC8A in the control of synaptic NMD AR activity in the spinal dorsal horn, changes in presynaptic and postsynaptic NMD AR activity in spinal cord slices from WT and Lrrc8aebo / ebomice were examined. The baseline frequency, but not the amplitude, of mEPSCs in lamina II neurons was substantially greater in Lrrc8aebo / ebomice than in WT mice (n = 11 neurons per group, FIGs. 13A-13C). Bath381624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO application of 50 pM AP5 normalized the elevated baseline frequency of mEPSCs in lamina II neurons from Lrrc8aebo / ebomice (n = 11 neurons, FIGs. 13A-13C). Furthermore, the baseline amplitude of EPSCs in lamina II neurons monosynaptically evoked from the dorsal root was much larger in Lrrc8aebo / ebomice (n = 11 neurons) than in WT mice (n = 10 neurons, p = 0.0005, F(5,51) = 5.662; FIGs. 13D-13F). In lamina II neurons from Lrrc8aebo / ebomice, bath application of AP5 markedly reduced the amplitude of evoked EPSCs (n = 11 neurons) and increased the PPR of evoked EPSCs (n = 10 neurons, FIGs. 13D-13F). Additionally, the amplitude of NMD AR currents elicited by puff application of 100 pM NMDA directly onto lamina II neurons was significant greater in Lrrc8aebo / ebomice than in WT mice (n = 14 neurons per group, p = 0.0332, t(l 0) = 2.569; FIGs. 13G-13H). Together, these findings highlight the crucial role of the LRRC8A’s C-terminal LRR domain in the constitutive inhibition of nociceptive hyperactivity as well as synaptic expression and activity of NMDARs at the spinal cord level.EXAMPLE 12Intrathecal Lrrc8a gene transfer reverses nerve injury-induced pain hypersensitivity

[0149] Because this study suggests that LRRC8A functions as an anti-nociceptive regulator via tonically inhibiting synaptic NMDAR activity at the spinal cord level, it was next determined whether Lrrc8a gene delivery using a lentiviral vector, via intrathecal injection (Chen et al., 2018; Li et al., 2016), can rescue nerve injury-induced pain hypersensitivity. Lentiviral vectors encoding rat Lrrc8a (Lrrc8a vector) or enhanced green fluorescent protein (EGFP; control vector) was constructed, intrathecal injection of the Lrrc8a vector or control vector 2 weeks after SNL or sham surgery in rats. Remarkably, Lrrc8a-expressing vector, but not the control vector, fully and persistently reversed allodynia and hyperalgesia induced by SNL in rats within 3-6 weeks after intrathecal injection (n = 8 rats per group, FIG. 10A). Interestingly, intrathecal injection of Lrrc8a vectors also slightly elevated the tactile, pressure, and thermal withdrawal thresholds in sham control rats (n = 8 rats per group, FIG. 14A).

[0150] Immunoblotting showed that the LRRC8A protein level in the DRG was much greater in SNL rats treated with Lrrc8a vectors than in SNL rats treated with control vectors (FIGs. 10B-10C). Notably, in sham control rats, intrathecal injection of Lrrc8a vectors also increased the LRRC8A protein level in the DRG compared with injected control vectors (n = 6 rats / group, p = 0.0356, F(3,35) = 4.256; FIGs. 10B-10C). Furthermore, intrathecal injection of Lrrc8a vectors substantially increased LRRC8A protein levels in the dorsal spinal cord in both sham and SNL rats (n = 6 rats / group, FIGs. 10D-10E).391624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0151] To determine whether increasing LRRC8A expression affects synaptic targeting of NMDARs in the spinal cord, synaptosomes from dorsal spinal cord tissues from sham or SNL rats treated with Lrrc8a vectors or control vectors were isolated. Immunoblotting showed that SNL substantially increased the protein level of GluNl in spinal cord synaptosomes (n = 6 rats per group, p = 0.0007, F(3,35) = 3.516; FIGs. 10F-10G). Treatment with Lrrc8a vectors normalized the increased GluN 1 protein level in spinal synaptosomes of SNL rats but had no significant effect on the GluNl level in sham control rats (n = 6 rats per group, FIGs. 10F-10G).

[0152] Additionally, the amplitude of VRAC currents in DRG neurons was much lower in SNL rats treated with control vectors (n = 12 neurons) than in sham rats treated with control vectors (n = 11 neurons; FIGs. 10H-10I). Intrathecal treatment with Lrrc8a vectors in SNL rats substantially increased the amplitude of VRAC currents in DRG neurons (n = 11 neurons) compared with control vector-treated SNL rats (n = 12 neurons; FIGs. 10H-10I). Furthermore, in sham control rats, intrathecal injection of Lrrc8a vectors significantly increased the amplitude of VRAC currents in DRG neurons (n = 11 neurons per group, p = 0.0317, F(3,41) = 4.153; FIGs. 10H-10I). These results clearly indicate that Lrrc8a gene transfer at the spinal cord level has a profound and long-lasting effect in eliminating chronic pain hypersensitivity caused by nerve injury.EXAMPLE 13Intrathecal Lrrc8a gene transfer diminishes nerve injury-induced synaptic NMD AR hyperactivity in the spinal cord

[0153] Because increased synaptic NMD AR activity in the spinal cord is critically involved in the development of neuropathic pain, whether Lrrc8a gene transfer is capable of reducing synaptic NMD AR hyperactivity caused by nerve injury was determined. Electrophysiological recordings in spinal cord slices obtained from sham and SNL rats 6 weeks after intrathecal injection of the control vector or Lrrc8a vector were performed. The baseline frequency of mEPSCs in lamina II neurons was significantly lower in Lrrc8a vector-treated SNL rats than in control vector-treated SNL rats (n = 11 neurons per group, p = 0.0263, F(2,30) = 2.579; FIGs. 14B-14F). Bath application of 50 pM AP5 reversed the increased frequency of mEPSCs in lamina II neurons of control vector-treated SNL rats (FIGs. 14B-14F). In contrast, AP5 had no significant effect on the frequency of mEPSCs in lamina II neurons from Lrrc8a vector-treated SNL rats (n = 12 neurons; FIGs. 14B-14F).

[0154] Furthermore, the baseline amplitude of EPSCs monosynaptically evoked from the dorsal root in spinal lamina II neurons was significantly larger in control vector-treated SNL rats401624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO (n = 11 neurons) than in control vector-treated sham rats (n = 9 neurons; p = 0.0389, F(5,50) = 4.157; FIGs. 15A-5E). In lamina II neurons from control vector-treated SNL rats, AP5 markedly reduced the amplitude of evoked EPSCs (n = 11 neurons, FIGs. 15A-15E) and increased the PPR of evoked EPSCs (n = 10 neurons; FIGs. 15A, 15B, 15E). In contrast, AP5 had no significant effect on the amplitude of EPSCs or PPR of evoked EPSCs in lamina II neurons from Lrrc8a vector-treated SNL rats (n = 11 neurons per group; FIGs. 15A-15E).

[0155] Lastly, postsynaptic NMD AR currents elicited by puff application of NMD A directly to the recorded lamina II neurons was recorded. The amplitude of the inward NMD AR currents of lamina II neurons was significantly larger in control vector-treated SNL rats than in control vector-treated sham rats (n = 10 neurons per group, p = 0.0153, F(3,35) = 4.179; FIG. 15F).Treatment with Lrrc8a vectors in SNL rats normalized the amplitude of puff NMD AR currents of lamina II neurons to the level observed in control vector-treated sham rats (n = 10 neurons / group, FIG. 15F). Together, these findings indicate that increasing LRRC8A expression at the spinal cord level effectively eliminates presynaptic and postsynaptic NMD AR hyperactivity caused by nerve injury.

[0156] Described herein is that neuronal LRRC8A acts as a powerful regulator of synaptic NMDARs and nociceptive hypersensitivity. Central sensitization, which is the fundamental mechanism of neuropathic pain, results from NMDAR-mediated amplification of nociceptive transmission at the spinal cord. Under physiological conditions, presynaptic NMDARs at central terminals of DRG neurons are not functionally active. However, these receptors become tonically activated by endogenous glutamate in neuropathic pain conditions. Disclosed herein is that siRNA knockdown of LRRC8A at the spinal cord level or Lrrc8a-cKO in DRG neurons consistently caused nociceptive hypersensitivity. Remarkably, it was showed that blocking NMDARs at the spinal cord level effectively reversed nociceptive hypersensitive induced by LRRC8A knockdown or Lrrc8a-cKO in DRG neurons. Supporting the role of NMDARs in this neuropathic pain-like phenotype, described herein is that downregulation of LRRC8A at the spinal cord level substantially increased the activity of both presynaptic and postsynaptic NMDARs in the spinal dorsal horn. Additionally, Lrrc8a-cKO in DRG neurons selectively increased the activity of presynaptic NMDARs at the central terminals of DRG neurons. In a heterologous expression system, LRRC8A knockdown profoundly potentiated the activity of NMDARs reconstituted with GluNl / GluN2A or GluNl / GluN2B subunits. Collectively, these complementary loss-of-function analyses provide compelling evidence that LRRC8A proteins act as constitutive inhibitors of411624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO nociceptive hypersensitivity by limiting synaptic NMD AR activity. This study demonstrates for the first time the physical interaction between LRRC8A, an anion channel protein, and NMDARs, a glutamate-gated cation channel, in the context of nociceptive regulation. The dynamic physical interactions between proteins in living systems are crucial for their roles in biological processes. Investigating these protein-protein interactions is essential for uncovering unknown protein functions at the molecular level and understanding the complex cellular networks involved in neuropathic pain. Many LRR-containing proteins are involved in diverse protein-protein interactions. It is described herein that the LRRC8A-NMDAR interaction occurred in spinal cord tissues from both rats and humans, suggesting that this interaction is conserved across species. Through a series of truncation and mutagenesis analyses, it was identified that LRRC8A interacted with NMDARs predominantly via the LRR1-3 domain on its C terminus. Importantly, disclosed herein is that the peptide mimicking the LRR1 domain disrupted LRRC8A-NMDAR interaction, induced nociceptive hypersensitivity, and increased synaptic NMD AR activity in the spinal cord. These results provide direct evidence of the physical interactions between LRRC8A and NMDARs and their roles in constitutively restricting nociceptive hyperactivity and synaptic NMD AR activity. Interestingly, described herein is that Lrrc8aebo / ebo mutant mice, which lack the C-terminal LRR domain of LRRC8A, exhibited NMDAR-dependent nociceptive hypersensitivity. Additionally, both presynaptic and postsynaptic NMDAR hyperactivity were present in the spinal dorsal hom of these Lrrc8aebo / ebo mice. These findings provide additional compelling evidence highlighting the importance of LRRC8A in regulating NMDAR-mediated nociceptive hypersensitivity in vivo.

[0157] Under normal physiological conditions, NMDARs are present but functionally inactive at primary afferent central terminals. This inactivity is likely attributable to the high expression of LRRC8A proteins, which, as demonstrated in the present study, constitutively restrict synaptic NMDAR expression under basal conditions. Although one study reported that GluNl conditional knockout in DRG neurons induces neuronal hyperexcitability and pain hypersensitivity, these findings have not been replicated and are contradicted by multiple independent studies showing that GluN 1 deletion in DRG neurons does not affect normal nociception. Another report proposed that presynaptic NMDARs at primary afferent central terminals are functionally active and depress synaptic transmission under normal conditions, based on the observation that bath application of exogenous NMDA reduces the amplitude of evoked AMPAR-EPSCs. However, exogenous NMDA application can activate peri- and extra-synaptic NMDARs, which can indirectly suppress421624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO postsynaptic AMPAR activity through dephosphorylation and endocytosis. Therefore, the reported reduction in the AMPAR-EPSC amplitude by NMDA bath application likely results from postsynaptic AMPAR inhibition rather than presynaptic NMD AR activation.

[0158] These findings provide new insight into the regulatory mechanism of NMDAR-mediated synaptic plasticity in neuropathic pain. In this study, described herein is that siRNA-induced LRRC8A knockdown or Lrrc8a-cKO in DRG neurons potentiated synaptic expression of NMDARs in the spinal cord, suggesting that LRRC8A constitutively inhibits the synaptic trafficking of NMDARs. Through physical interaction with NMDARs, LRRC8A proteins may facilitate intracellular retention of NMDARs, thereby limiting their synaptic expression and activity. Thus, abundant LRRC8A in normal DRG neurons may have a critical role in inhibiting chronic pain development via restraining synaptic NMD AR expression. Disclosed herein is that nerve injury selectively reduced expression levels of LRRC8A in the DRG, without affecting other subunits of VRACs. When nerve injury reduces LRRC8A expression in the DRG, NMDARs that are no longer bound to LRRC8A could become ‘unleashed’, allowing them freely traffic to the central terminal of DRG neurons. This could cause hyperactivity of presynaptic NMDARs and potentiate glutamate release from primary afferent nerves through Ca2+ influx, representing a novel molecular mechanism by which nerve injury induces hyperactivity of presynaptic NMDARs in the spinal dorsal hom. Notably, the NMDAR-restraining action of LRRC8A is unlikely limited to DRG neurons, because both presynaptic and postsynaptic NMD AR hyperactivity in the spinal cord were observed after siRNA-induced LRRC8A knockdown and in Lrrc8aebo / ebomutant mice. Therefore, the transition from LRRC8A-bound NMDARs to LRRC8A-free NMDARs likely constitutes a crucial molecular mechanism for the tonic activation of synaptic NMDARs in the spinal dorsal hom under neuropathic pain conditions.

[0159] Recent studies indicate that a25-l, commonly known as a voltage-gated Ca2+ channel subunit, is a crucial protein that preferentially interacts with phosphorylated NMDARs to enhance their synaptic trafficking in the spinal cord in neuropathic pain. In this study, described herein is that LRRC8A interacted with NMD AR subunits expressed in HEK293 cells, suggesting that LRRC8A-NMDAR interaction is likely independent of other neuronal proteins, including a25-l. Furthermore, LRRC8A knockdown significantly increased membrane surface expression of NMDARs in HEK293 cells, indicating that LRRC8A regulates NMDARs independently of a25-1. Thus, LRRC8A and a25-l appear to have opposite roles in regulating the synaptic expression and activity of NMDARs. These two proteins may maintain a delicate “push-pull” balance in431624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO controlling NMDAR trafficking under normal and pathological conditions. Following nerve injury, the combined effects of a25-l upregulation and LRRC8A downregulation could enhance the interaction between a25-l and NMDARs while concurrently reducing LRRC8A-NMDAR complexes, thereby potentiating the synaptic trafficking of NMDARs in the spinal dorsal hom. Further studies are needed to delineate how LRRC8A and a25-l cooperates to direct the intracellular and synaptic expression of NMDARs in vivo.

[0160] Another notable finding from this study is that lentivirus-mediated Lrrc8a gene transfer at the spinal cord level completely reversed nerve injury-induced pain hypersensitivity and synaptic NMDAR hyperactivity of spinal dorsal horn neurons. Lentiviral vectors have the advantage of predominantly transfecting mature neurons in vivo and are considered safe for micro injection into the brain in humans. The profound and sustained effects of Lrrc8a gene transfer are likely due to the ability of lentiviral vectors to induce LRRC8A expression in both spinal dorsal hom and DRG neurons. This increase in LRRC8A-bound NMDARs eliminated nerve injury-induced NMDAR hyperactivity at both presynaptic and postsynaptic sites in the spinal cord, indicating that LRRC8A abundance governs NMDAR activity on both sides of the synapse. Interestingly, while nerve injury-induced hyperalgesia was abolished within 2 weeks of Lrrc8a gene transfer, the reversal of tactile allodynia was more gradual, taking about 6 weeks to reach its maximum effect. This more rapid alleviation of hyperalgesia compared to allodynia may be attributed to the possibility that the lentiviral vector initially transduces more high-threshold nociceptive neurons than low-threshold sensory neurons. These findings provide additional convergent evidence for the critical role of LRRC8A in constitutively inhibiting nociceptive hyperactivity and synaptic NMDAR activity in the spinal dorsal horn. Gene therapy has the potential to offer prolonged pain relief without the need for repeated treatments, making it particularly suitable for managing chronic pain. However, lentivirus-mediated LRRC8A expression may carry the risk of unintended effects. Given that intrathecal injection through lumbar puncture is a widely used and minimally invasive procedure, these findings suggest that this therapeutic approach could be viable for treating patients with severe, treatment-resistant neuropathic pain.

[0161] In contrast to the antinociceptive role of LRRC8A demonstrated in this study, a recent report suggests that LRRC8A expressed in spinal microglia could promote neuropathic pain by releasing ATP. Also, intrathecal injection of dicoumarol, a non-specific VRAC inhibitor, has been shown to reduce nerve injury-induced mechanical allodynia. In the present disclosure, described441624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO herein are NMDAR-mediated nociceptive hyperactivity in rats with siRNA-induced knockdown, Lrrc8a-cKO mice, and Lrrc8aebo / ebomutant mice. These findings strongly suggest that the interaction between LRRC8A and NMDARs is critical for LRRC8A's role in restraining chronic pain development. Importantly, LRRC8A knockdown via siRNA and Lrrc8a mutation in Lrrc8aebo / ebomice are not cell type-specific. Moreover, the complete reversal of nerve injury-induced pain hypersensitivity by virus-mediated LRRC8A expression in the DRG and spinal cord indicate that LRRC8A's antinociceptive effects are not restricted to neurons alone. Therefore, the overall function of LRRC8A at the spinal cord level appears to be the inhibition of nociceptive hypersensitivity, even though its effects may vary across different cellular contexts.

[0162] The reduction in LRRC8A expression due to nerve injury may result in a loss of inhibitory, hyperpolarizing CE currents, potentially leading to increased neuronal excitability and nociceptive hypersensitivity. However, DRG neurons have a high intracellular CE concentration49, and nerve injury can augment intracellular CE levels in spinal dorsal hom neurons3’39’50. Therefore, LRRC8A-mediated VRAC activity is likely associated with depolarizing, rather than hyperpolarizing, currents in DRG and spinal dorsal hom neurons in neuropathic pain conditions. Additionally, LRRC8A-mediated VRACs are permeable to ATP and glutamate25,44. But the reduced release of ATP and glutamate from VRACs in DRG and spinal dorsal hom neurons does not see to account for the nociceptive hypersensitivity caused by LRRC8A loss-of-function in this study. These findings suggest that the LRRC8A controls nociceptive hypersensitivity primarily through regulating NMD AR synaptic expression, rather than through VRAC activity.

[0163] In summary, these study, using comprehensive loss- and gain-of-function approaches, identifies LRRC8A as a novel regulatory protein of synaptic NMDARs and nociceptive hyperactivity. The loss of LRRC8A’s restraining action on synaptic NMDARs at the spinal cord level may play a cmcial role in the development of neuropathic pain. This new information advances the understanding of the homeostatic synaptic plasticity that governs pain chronicity. Identifying LRRC8A as a key NMDAR-restraining protein opens the possibility for developing new strategies to attenuate NMD AR hyperactivity without directly blocking NMD AR channels, thereby potentially avoiding the common side effects associated with NMDAR antagonists. Described herein is proof of principle that Lrrc8a gene delivery at the spinal cord level is highly effective for managing chronic neuropathic pain.451624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO EXAMPLE 14LRRC8A protein restrains NMD AR activity and nerve injury-induced pain hypersensitivity independently of VRAC activity

[0164] A major limitation of previous studies is that LRRC8A is the obligatory subunit of volume-regulated anion channels (VRACs). Because of the lack of highly specific VRAC blockers, it was difficult to determine whether LRRC8A-mediated VRAC activity is involved in NMD AR hyperactivity and pain hypersensitivity induced by nerve injury or Lrrc8a knockdown. The present disclosure provides that mutation on the N-terminus of LRRC8A profoundly diminishes VRAC activity (FIG. 19A-19B). Lrrc8a P3C (proline to cysteine) mutation has no VRAC activity (FIGs. 20A-20B).

[0165] NMDARs interact with both WT and mutant LRRC8A in vitro (FIGs.21 A-21B). Initial biotinylation assay shows NMD AR (GluNl) surface expression is reduced by coexpression of Lrrc8a WT and P3C mutant (FIG. 22). Lrrc8a-KO HEK293 cells were cotransfected with GluNl / 2A subunits with Lrrc8a wild-type (WT) or Lrrc8a P3C mutant. Both WT and mutant LRRC8A similarly reduce NMDAR currents in vitro (FIGs. 23A-23B).

[0166] Intrathecal injection of lentiviruses expressing LRRC8A wild-type (WT) and P3C mutant effectively reveres nerve injury-induced pain hypersensitivity (FIGs. 24A-24C).Intrathecal lentivirus expressing Lrrc8a WT or mutant reduces pain hypersensitivity in SNL rats (FIGs. 24A-24C). Rats were subjected to sham or spinal nerve ligation (SNL) surgery. One week later, a cannula was implanted at the lumbar level. The following week, the lentivirus expressing LRRC8A-WT or LRRC8A-P3C mutant was intrathecally injected.

[0167] Intrathecal injection of lentiviruses expressing LRRC8A wild-type (WT) or P3C mutant attenuates nerve injury-induced synaptic GluNl increase in the spinal cord (FIGs. 25A-25B).Rats were subjected to sham or spinal nerve ligation (SNL) surgery. One week later, a cannula was implanted at the lumbar level. Lentivirus carrying LRRC8A-WT or LRRC8A-P3C was intrathecally injected one week later. At the end of behavioral tests, total proteins and synaptosomal fractions were extracted from tissues for immunoblot analysis (n = 7 rats per group). GAPDH and PSD-95 were used as loading controls. *p < 0.05, **p< 0.01, ***p < 0.001 (two-way ANOVA with Tukey’s post hoc test).

[0168] Intrathecal injection of lentiviruses expressing LRRC8A wild-type (WT) or P3C mutant effectively rescues pain hypersensitivity in Lrrc8a-cKO mice (FIGs. 26A-26C). Time course of the effects of intrathecal lentiviruses expressing LRRC8A WT or P3C mutant on nociceptive461624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO thresholds. Lrrc8a-conditional knockout (Lrrc8a-cKO) was induced in AvilCre / +:: Lrrc8aflox / flox mice by tamoxifen injection. Two weeks post tamoxifen treatment, Lrrc8a-cKO mice were subjected to intrathecal injection of lentivirus expressing LRRC8A-WT or LRRC8A-P3C mutant.

[0169] DRG neurons from Lrrc8a-cKO mice injected with lentivirus expressing LRRC8A P3C mutant has diminished VRAC activity (FIGs.27A-27C).EXAMPLE 15Materials and Methods

[0170] Animals

[0171] Adult male Sprague-Dawley rats (9-10 weeks of age) were purchased from Envigo. Wild-type (WT) C57BL / 6J mice (strain #000664) were obtained from Jackson Laboratory (Bar Harbor, ME). Lrrc8aebo / ebocongenic mice carrying a spontaneous mutation (ZrrcSaF443* MGI:1861665) were backcrossed onto C57BL / 6J background for 12 generations as described previously.

[0172] Lrrc8aa°x+I+mice with LoxP sites flanking the protein coding region of exon3 in the Lrrc8a gene, on a genetic background C57BL / 6J, were generated as described previously23. To selectively delete Lrrc8a in DRG neurons, LrrcSaflox / floxmice were crossed with the sensory neuron-specific Avil-Cre line, resulting in Lrrc8a conditional knock-out (LrrcSa-cKO) mice. Male Hvz / Cre / +mice were first crossed with female LrrcSaflox / floxmice to obtain male Avie / +:: Lrrc8aa°x / +mice, which were then crossed with female Lrrc8aaoxm°xmice to generate AviFs / +Lrrc8aRox / aoxmice, maintained on a C57BL / 6J genetic background. Age-matched littermates Avis / ^ Lrrc8aaox / a°x') were used as WT controls. Adult Lrrc8aebo / eboLnx8a- AO mice (8-11 weeks of age) were used for final experiments. All animals were housed in a pathogen-free environment (24 ± 2 °C, 12 h light / dark cycle) with access to standard laboratory food and water ad libitum.

[0173] Rat model of neuropathic pain

[0174] Spinal nerve ligation (SNL) was used as a rat model of neuropathic pain, as previously described. Briefly, anesthesia was induced with 2-3% isoflurane. The left L5 and L6 spinal nerves were isolated and ligated with a 6-0 silk suture. Control rats underwent a sham surgical procedure without nerve ligation. In the SNL model, stable pain hypersensitivity was typically established 10-14 days after SNL and lasted for at least 8 weeks. At the end of the experiments, rats were euthanized with 5% isoflurane and exsanguination.471624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0175] Behavioral assessment of nociception

[0176] To quantify the tactile withdrawal threshold, rats or mice individually placed in suspended chambers on a mesh floor. After a 30-min acclimation period, a series of calibrated von Frey filaments was applied perpendicularly to the plantar surface of the hindpaw with sufficient force to bend the filament for 6 s. A brisk withdrawal or paw flinching was considered a positive response. If there was no response, the filament with the next greater force was applied. If a response occurred, the filament with the next lower force was applied. Each trial was repeated twice at approximately 2-min intervals, and the mean value was used to determine the force required to elicit withdrawal responses. The tactile stimulus force producing a 50% likelihood of withdrawal was calculated using the “up-down” method.

[0177] To determine the mechanical nociceptive threshold, a paw pressure test on the hindpaw was conducted using an analgesiometer (Ugo Basile, Varese, Italy). The device was activated by pressing a foot pedal to generate a continuously increasing force. When the animal displayed pain by withdrawing its paw or vocalizing, the device was immediately deactivated, and the animal’s withdrawal threshold was recorded on the scale.

[0178] For measuring thermal sensitivity, animals were placed on the glass surface of a thermal testing apparatus and allowed to acclimate for 30 min before testing. The glass surface temperature was maintained at a constant 30°C. A mobile radiant heat source located beneath the glass was focused onto the hindpaw of each animal. Paw withdrawal latency was recorded using a timer, and each hindpaw was tested twice to obtain an average value.

[0179] Intrathecal treatment with Lrrc8a-specific siRNA or LRRC8A-LRR1 peptide

[0180] Rat Lrrc8a-specific siRNA or universal negative-control siRNA was mixed with i-Fect to a final concentration of 400 mg / L for the intrathecal injection. Lrrc8a-specific siRNA or negative control siRNA (2 pg / day for 6 days) was administered intrathecally to the rats. The LRRC8A-LRR1 peptide, which mimics the LRR1 domain of LRRC8A (SEQ ID NO: 21: LELHLFMLSGIPDTVFDLVELE), and a scrambled control peptide (SEQ ID NO: 23: TLEIEDFPVLMELHLFVDLSLG), both fused with the cell-penetrating peptide Tat (SEQ ID NO: 22: YGRKKRRQRRR), were synthesized by Synpeptide Co. and validated using liquid chromatography and mass spectrometry.

[0181] Intrathecal catheters were implanted in rats under isoflurane-induced anesthesia using a method described previously. Briefly, the anesthetized animal was placed on a stereotaxic frame, and a small incision was made at the back of its neck. A PE- 10 catheter (~8 cm) was then inserted481624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO through a puncture in the atlanto-occipital membrane of the cistema magna. The caudal tip of the catheter was advanced to the lumbar enlargement of the spinal cord. During surgery, 1 % lidocaine was injected around the incision site. Animals were allowed to recover for at least 5 days before receiving intrathecal injections. Rats showing any motor weakness or paralysis were promptly euthanized by CO2 inhalation.

[0182] Lentiviral vector preparation

[0183] The full-length coding sequence of rat Lrrc8a or EGFP was cloned into the lentiviral vector pLenti6 / V5-DEST under the control of a cytomegalovirus promoter (Invitrogen, Carlsbad, CA). The virus was produced using the ViraPower system (Invitrogen) according to the manufacturer’s instructions. Briefly, the vectors were transfected into HEK293FT cells using Lipofectamine 3000 (#L3000015, Invitrogen). The virus-containing supernatant was collected 72 h after transfection and filtered through 0.45 pm Millex-HV filters (Millipore, Billerica, MA). The viruses were purified and concentrated approximately 1,000-fold by centrifugation at 90,000 g. The virus titer, determined by infecting HEK293 cells with a 10-fold gradient dilution of the virus, was about 108 infectious units / mL. Viral vectors (2 x 106 viral particles in 20 pL) expressing GFP-tagged Lrrc8a (Lrrc8a vector) or GFP alone (Control vector) were slowly injected into the rats through an intrathecal catheter, which was then removed. After vector injection, all rats were housed in a restricted biohazardous area for 2 weeks before undergoing behavioral tests. It has previously demonstrated that intrathecal injection of the same lentiviral vector transfects ~94% of DRG and spinal dorsal horn neurons.

[0184] Spinal cord slice preparation and electrophysiological recordings

[0185] The lumbar spinal cords were quickly removed from the rats or mice via laminectomy under isoflurane-induced anesthesia and immediately placed in ice-cold sucrose artificial cerebrospinal fluid containing (in mM) 3.6 KC1, 1.2 MgC12, 2.5 CaC12, 1.2 NaH2PO4, 25.0 NaHCO3, 234 sucrose, and 12.0 glucose pre-saturated with 95% 02 and 5% CO2. The spinal cord was then placed in a shallow groove formed in an agar block and glued onto the stage of a vibratome. Transverse slices of the spinal cords (400 pm thick) were cut in ice-cold sucrose artificial cerebrospinal fluid and preincubated in Krebs solution containing (in mM) 3.6 KC1, 1.2 MgC12, 117.0 NaCl, 2.5 CaC12, 1.2 NaH2PO4, 11.0 glucose, and 25.0 NaHCO3 oxygenated with 95% 02 and 5% CO2 at 34 °C for at least 1 h before being transferred to a recording chamber. The spinal cord slice was placed in an incubation chamber and continuously perfused with Krebs solution at 5 ml / min and 34 °C maintained by an inline solution heater and a temperature491624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO controller. The spinal cord lamina II was identified in each slice using an upright fixed-stage microscope. Neurons in the lamina II outer zone were visualized with differential interference contrast / infrared illumination and selected for whole-cell recordings. The impedance of the glass electrode was 4-7 MQwhen a pipette was filled with an internal solution containing (in mM) 135 potassium gluconate, 0.5 CaC12, 5 KC1, 2.0 MgC12, 5.0 HEPES, 5.0 ATP-Mg, 0.5 Na-GTP, 5.0 EGTA, and 10 QX314 (adjusted to pH 7.25 with 1.0 M KOH, 280-300 mOsm).

[0186] Excitatory postsynaptic currents (EPSCs) were recorded at a holding potential of -60 mV using whole-cell voltage-clamp techniques (Chen et al., 2014a; Xie et al., 2016). The input resistance was monitored, and the recording was abandoned if it changed by more than 15%. EPSCs were recorded using an amplifier (MultiClamp 700A, Axon Instruments, Foster City, CA), filtered at 1-2 kHz, and digitized at 10 kHz. Miniature EPSCs (mEPSCs) were recorded in the presence of 1 pM tetrodotoxin. To evoke glutamate release from primary afferent nerves, a bipolar tungsten electrode connected to a stimulator (0.2 ms, 0.6 mA, 0.1 Hz) was used to electrically stimulate the dorsal root, and monosynaptic EPSCs were identified based on their constant latency and the absence of conduction failure during 20-Hz electrical stimulation. The paired-pulse ratio (PPR) was calculated by evoking two EPSCs using a pair of stimuli at 50-ms intervals. The PPR was expressed as the ratio of the amplitude of the second synaptic response to that of the first.

[0187] To record postsynaptic NMD AR activity, currents were elicited by puff application of 100 pM NMDA directly onto the recorded neuron using a positive pressure system (4 p.s.i., 15 ms; Toohey Company, Fairfield, NJ, USA). To minimize the magnesium block of NMDARs, the puff NMDA currents were recorded in an extracellular solution containing Mg2+ at a low concentration (0.1 mM), 10 pM glycine, and 1 pM tetrodotoxin at a holding potential of -60 mV. The pipette internal solution contained (in mM) 110.0 Cs2SO4, 2.0 MgC12, 0.1 CaC12, 1.1 EGTA, 10.0 HEPES, 2.0 MgATP, and 0.3 Na2GTP (pH adjusted to 7.25 with 1.0 M CsOH [280-300 mosM]). The puff electrode was placed approximately 150 pm away from the recorded neuron.

[0188] All the drugs were prepared in artificial cerebrospinal fluid immediately before the experiments and delivered via syringe pumps to reach their final concentrations. AP5 and tetrodotoxin were purchased from Hello Bio.

[0189] Isolation of DRG neurons and electrophysiological recordings

[0190] Rats were anesthetized with isoflurane and then rapidly decapitated. The thoracic and lumbar segments of vertebral column were surgically removed. The DRGs and the nerve roots were quickly dissected out and transferred immediately onto Dulbecco’s modified Eagle’s501624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO medium on ice. Then the DRGs were dissected free of attached connective tissues minced with fine scissors. The minced DRG fragments were placed in a flask containing 5 ml of DMEM in which trypsin (type III, 0.5 mg / ml, Sigma) and collagenase (type I, 1 mg / ml, Sigma) had been dissolved. After incubation at 34°C in a shaking water bath for 30 min, soybean trypsin inhibitor (type II-s, 1.25 mg / ml, Sigma) was added to terminate digestion. The resulting cell suspension was centrifuged (500 rpm, 6 min) to precipitate the dissociated neurons. The supernatant was removed and the neurons were replenished with DMEM. DRG neurons were subsequently plated onto a 35 -mm culture dish containing poly-L-lysine (50 pg / ml) precoated coverslips and incubated in 5% CO2 at 37°C for at least 1 h before recordings.

[0191] Recording electrodes with a resistance of 2-4 MQ were pulled from GC150TF-10 glass capillaries (ID 1.17 mm, OD 1.5 mm) using a micropipette puller and fire-polished. Neurons were visualized using differential interference contrast optics on an inverted microscope. Recordings were made within 6 h after dissociation to maintain conditions as similar to in vivo conditions as possible. As was described previously, IB4-positivc DRG neurons were recorded in the wholecell configuration at a holding potential of -70 mV using an EPC- 10 amplifier to measure VRAC currents elicited by hypotonic solution. External hypotonic solution (220 mOsm / kg) consisted of 95 mM NaCl, 2 mM CaC12, 1 mM20 MgC12, 5 mM CsCl, 10 mM HEPES, and 10 mM glucose (pH adjusted to 7.4 using NaOH). Sucrose was added to achieve a normotonic solution (320 mOsm / kg). The internal pipette solution consisted of 120 mM Cs-aspartate, 10 mM Cs4BAPTA, 4 mM MgATP, 2 mM MgC12, 8 mM NaCl, and 10 mM HEPES, with the pH adjusted to 7.2 with CsOH). The cell membrane capacitance and series resistance were electronically compensated after whole-cell configuration was established. Leak currents were subtracted using the on-line P / 4 protocol. All experiments were performed at 24°C. Signals were filtered at 1 kHz, digitized at 10 kHz, and acquired using Pulse program (HEKA).

[0192] Immunofluorescence labeling in the DRG and spinal cord

[0193] Double labeling of LRRC8A and Griffonia simplicifolia IB4 (a marker for unmyelinated afferent fibers) was performed in the DRG and spinal cord of rats or mice, similar to what we described previously. Under deep anesthesia with pentobarbital sodium (60 mg / kg, intraperitoneally.), each animal was intracardially perfused with 250 mL of 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS) (pH 7.4) followed by 200 ml of 10% sucrose in 0.1 M PBS (pH 7.4). The lumbar spinal cord and L4 and L5 DRGs were quickly removed, postfixed in511624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO the same fixative solution, and cryoprotected in 30% sucrose in PBS for 48 h at 4°C. The tissues were sectioned at 30 pm thickness and collected free-floating in 0.1 M PBS.

[0194] For LRRC8A immunofluorescent labeling, sections were rinsed in 0.1 M PBS, blocked in 4% normal goat serum in PBS for 1 h, and then incubated with primary antibodies: rabbit anti-LRRC8A (dilution 1:500, gifted from Dr. R. Sah) or mouse anti-NeuN (dilution 1:500) diluted in PBS containing 2% normal goat serum and 0.3% TX-100 for 2 h at 22°C and overnight at 4°C. Subsequently, DRG sections were rinsed in PBS and incubated with secondary antibodies: Alexa Fluor 488-conjugated goat anti-rabbit IgG (dilution: 1300) for LRRC8A labeling and Alexa Fluor 594-conjugated goat anti-mouse IgG (dilution: 1:300) for NeuN labeling. Similarly, spinal cord sections were rinsed in PBS and incubated with secondary antibodies: HRP conjugated goat-anti-rabbit IgG (dilution: 1:100) for LRRC8A and Alexa Fluor 594-conjugated goat anti-mouse IgG (dilution: 1: 300) for NeuN, for 2 h at 22°C. Sections were then rinsed in PBS and incubated with FITC Tyramide (green, 1:100).

[0195] For IB4 labeling, DRG and spinal cord sections were rinsed in PBS for 30 min and then incubated with Alexa Fluor 594-conjugated IB4 (dilution: 2 pg / ml) for 2 h at 22°C. Finally, the sections were rinsed, mounted on slides, dried, and coverslipped. The sections were examined with a laser-scanning confocal microscope, and areas of interest were photodocumented. Cell counting was performed in three sections from each animal, and 5 animals were included in each group.

[0196] Quantitative PCRTotal RNA was extracted from the DRG and spinal cord tissues at the L5 and L6 levels using TRIsure. After RNase-free DNase treatment, 500 ng RNAs were used for reverse-transcription with RevertAid RT Reverse Transcription Kit. A 1 pL aliquot of five-fold diluted cDNA was added to a 10 pL reaction volume containing Sybr Green Real-time PCR mix. The real-time PCR reaction was conducted using the QuantStudio 7 Flex Real-Time PCR System. The thermal cycling conditions were: 1 cycle at 95°C for 10 min; 40 cycles at 95°C for 15 s and 60°C for 60s. The following primers were used: rat Lrrc8a forward, CAGCGTCCATGGAGCAAAAG (SEQ ID NO: 24); rat Lrrc8a reverse, TGGTTTAACCCTGAGATGGCT (SEQ ID NO: 25); rat Lrrc8b forward, CGGGTGTACCTGAAGCAGAT (SEQ ID NO: 26); rat Lrrc8b reverse, CAACACCTTAAAGATCTCTGCC (SEQ ID NO: 27); rat Lrrc8c forward, GTGGGATGTGTTCACGGACT (SEQ ID NO: 28); rat Lrrc8c reverse, AAGAGTGGTTCTGAGCAGGC (SEQ ID NO: 29); rat Lrrc8d forward,521624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO TAGACCCGGCAGCAGTCTAT (SEQ ID NO: 30); rat Lrrc8d reverse, CCATGGCTTCAGGATTCGGT (SEQ ID NO: 31). rat GAPDH forward, GACATGCCGCCTGGAGAAAC (SEQ ID NO: 32); rat GAPDH reverse, AGCCCAGGATGCCCTTTAGT (SEQ ID NO: 33). Relative mRNA levels were calculated using the 2-AACT method and normalized to the GAPDH level in the same sample.

[0197] Cell culture, transfection, and electrophysiological recordings

[0198] Human embryonic kidney (HEK) 293 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco / Life Technologies, Grand Island, NY) supplemented with 10% fetal bovine serum (Sigma-Aldrich, St. Louis, MO) at 37°C in a 5% CO2 incubator. For transfection experiments, cells were plated on poly-D-lysine coated coverslips. Plasmids for GluNl / 2A or GluNl / 2B combinations were transfected with human Lrrc8a-specific siRNA (PDSIRNA2D, SASI_Hs02_00329027, Sigma- Aldrich) or Lrrc8a mutant constructs. The cDNAs for rat GluNl, GluN2A and GluN2B were similar to those used in our previous studies 13,37. Co-expression of GFP was used to identify transfected cells. Transfection was conducted using PolyJet DNA In Vitro Transfection Reagent. To determine the effect of LRRC8A knockdown, LRRC8A-specific siRNA or control siRNA were co-transfected using the same transfection reagent at a final concentration of 0.1 pmol / L. After 4 h, the culture medium was replaced with glutamine-free medium containing 100 pM DL-AP5 (Abeam, Cambridge, MA).

[0199] Electrophysiological recordings were performed 24-48 h after transfection. Whole-cell patch clamp recordings were performed using an EPC- 10 amplifier (HEKA Instruments, Lambrecht, Germany). The extracellular recording solution contained (in mM) 150 NaCl, 2.5 KC1, 1 CaC12, 10 HEPES, 10 glucose, and 0.01 glycine (pH 7.3). Electrodes (resistance, 4-6 MQ) were filled with a pipette solution containing (in mM): 135 CsF, 1 CaC12, 11 EGTA, 10 HEPES, and 2 Mg-ATP (pH 7.3). NMDA currents were elicited by bath application of 300 pM NMDA 13,37 using a VC38 perfusion system (ALA Scientific Instruments, Farmingdale, NY). Cell membrane capacitance and series resistance were electronically compensated. Signals were recorded using the Pulse program (HEKA Instruments), filtered at 1 kHz, and digitized at 10 kHz.

[0200] Lrrc8a constructs

[0201] The vector expressing full-length Lrrc8a was a gift from Dr. R. Sah, provided in a pCNDA3 backbone. Lrrc8a constructs with various truncations were generated based on the full-length plasmid using an In-Fusion HD Cloning Plus kit (#638917, Clontech Laboratories, Inc., Mountain View, CA). In brief, DNA fragments were amplified using HiFi PCR Premix with531624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO paired primers (as shown below). After gel purification, the fragments were treated with In-Fusion HD Enzyme Premix and transferred into Stellar competent cells. All constructs were confirmed by DNA sequencing. Primer sequences were as follows: Lrrc8a-Del-N (N -terminal deletion)-F: GACGACGAATTCATGAAGCCGTGGTGGGATGTGTTCACA (SEQ ID NO: 1); Lrrc8a-Del-N (N-terminal deletion)-R: CATGAATTCGTCGTCGTCCTTGTAGT (SEQ ID NO: 2); Lrrc8a-Del-C (C-terminal deletion)-F: AAGAACGCGCAGGACGCTGACAAGGAGCAGGCCTGA (SEQ ID NO: 3); Lrrc8a-Del-C (C-terminal deletion)-R: GTCCTGCGCGTTCTTGGTGAG (SEQ ID NO: 4); Lrrc8a-Del-Lrrl-3 (LRR1-3 deletion)-F: AAGAACGCGCAGGACGCGCTGCACATCAAGTTCACCGAC (SEQ ID NO: 5); Lrrc8a-Del-Lrrl-3 (LRR1-3 deletion)-R: GTCCTGCGCGTTCTTGGTGAG (SEQ ID NO: 6); Lrrc8a-Del-Lrr4-6 (LRR4-6 deletion)-F: CGTGAGAACCTGCGGAAGCTGTCCATCAACAATGAGGGC (SEQ ID NO: 7); Lrrc8a-Del-Lrr4-6 (LRR4-6 deletion)-R: CCGCAGGTTCTCACGCAGGAAGG (SEQ ID NO: 8); Lrrc8a-Del-Lrr7-9 (LRR7-9 deletion)-F: GGCGTGCACCTGCAG TGCCTTAAGCTGTGGTACAACCAC (SEQ ID NO: 9); Lrrc8a-Del-Lrr7-9 (LRR7-9 deletion)-R: CTGCAGGTGCACGCCCACATCTG (SEQ ID NO: 10); Lrrc8a-Del-Lrrl0-12 (LRR10-12 deletion)-F: CTGCACCGCCTCACCCTAGCCATCACGGCCAAC CGG AT (SEQ ID NO: 11); Lrrc8a-Del-Lrrl0-12 (LRR10-12 deletion)-R: GGTGAGGCGGTGCAGGTGCTGGAA (SEQ ID NO: 12); Lrrc8a-Del-lrrl3-end (deletion from Lrrl3 to the end)-F: CAGAACCTCCAGAACGCTGACAAGGAGCAGGCCTGA (SEQ ID NO: 13); Lrrc8a-Del-Lrrl3-end (deletion from Lrrl3 to the end)-R: GTTCTGGAGGTTCTGCAGGAGGCC (SEQ ID NO: 14); Lrr-l-del-F: AAGAACGCGCAGGACGTCCTCAAGCTGGAGCTGATCC (SEQ ID NO: 15); Lrr-l-del-R: GTCCTGCGCGTTCTTGGTGAG (SEQ ID NO: 16); Lrr-2-del-F: CTGGTGGAGCTGGAGGAGCTGTGGCTCTACCACAC (SEQ ID NO: 17); Lrr-2-del-R: CTCCAGCTCCACCAGGTCAAA (SEQ ID NO: 18); Lrr-3-del-F: CTCCGGGCCTCAAGGCGCTGCACATCAAGTTCACC (SEQ ID NO: 19); Lrr-3-del-R: CTTGAGGCCCGTGAGCTGGGC (SEQ ID NO: 20). All cDNA clones and constructs were confirmed by DNA sequencing.

[0202] Protein sample preparation and immunoblotting

[0203] Protein levels of LRRC8A, GluNl, GluN2A, and GluN2B tissues and HEK293 cells were quantified using immunoblotting. Biotinylated cell surface proteins from HEK293 cells were isolated using the Cell Surface Protein Isolation Kit (Pierce Biotechnology), following the541624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO methods described previously. Dorsal spinal cord and DRG. Spinal cord and DRG tissues at the L5 and L6 levels were collected and homogenized in 300 pl radioimmunoprecipitation assay buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM Na3VO4, 1 mM EDTA, 1 mM NaF, 1% Nonidet P-40, and 0.25% sodium deoxycholate) supplemented with a protease inhibitor cocktail. Additionally, synaptosomes were isolated from the dorsal spinal cord, as previously described.

[0204] The samples with lysis buffer were homogenized on ice for 30 min and then centrifuged at 13,000 x g for 30 min at 4°C. The supernatant was carefully collected, and its protein concentration was measured. Protein samples from spinal cord and DRG tissues were subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane. The membranes were probed with a rabbit anti-LRRC8A antibody (1:100, from Dr. R. Sah) or rabbit anti-GAPDH antibody (1:5000). Protein bands were detected using an ECL kit, and band intensity was visualized and quantified with an Odyssey Fc Imager. The amount of target proteins in each sample was first normalized to the level of GAPDH, Na+-K+-ATPase, or PSD-95 on the same gel, then to its expression level in sham or vehicle-treated rats. The mean value in the sham, WT, control siRNA, or control vector group was set to 1.

[0205] Coimmunoprecipitation

[0206] For coimmunoprecipitation using spinal cord tissue membrane extracts, the dorsal quadrants of lumbar spinal cord tissues were quickly removed from rats anesthetized with 3% isoflurane. The spinal cord tissues were dissected and homogenized in ice-cold immunoprecipitation buffer (50 mM Tris [pH7.4], 250 mM NaCl, 20 mM NaF, 1 mM Na3VO4, 10% glycerol, 0.5% NP-40, 10 mM N-ethyhnaleimide, 1 mM phenylmethylsulfonyl fluoride, and 2 mM benzamide) containing protease and phosphatase inhibitor cocktails (Sigma-Aldrich). The samples were then put on ice for 30 min with constant shaking. Lysates were centrifuged at 13,000 x g for 30 min at 4°C. The supernatant was carefully collected, and the protein concentration was measured using a DC Protein Assay Kit (Bio-Rad, Hercules, CA). The soluble fraction was incubated at 4°C overnight with Protein A / G beads (#16-266, Millipore, Darmstadt, Germany) prebound to a mouse anti-GluNl antibody (1:1,000) or mouse anti-LRRC8A (1:1,000). Protein A / G beads prebound to mouse IgG were used as controls. Samples were washed 3 times with an immunoprecipitation buffer and then subjected to immunoblotting. The following antibodies were used for immunoblotting: rabbit anti-LRRC8A (gifted from Dr. R. Sah), rabbit anti-GluNl (1:1,000), rabbit anti-GluN2A (1:1,000), and rabbit anti-GluN2B (1:1,000). The specificity of these primary antibodies has been validated in previous studies. For immunoblotting, lysates were551624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO separated on a 4-12% gradient SDS-polyacrylamide gel and transferred to a polyvinylidene fluoride membrane. The membrane was blocked by 5% blotting-grade blocker. After antibody incubation, the membrane was washed 3 times with Tris-Buffered Saline with Tween 20. An ECL kit was used to detect the protein bands, which were visualized and quantified using an Odyssey Fc Imager.

[0207] For coimmunoprecipitation using HEK293 cell extracts, Lrrc8a-KO HEK293 cells (from Dr. R. Sah) were transfected with GFP-tagged GluNl, GluN2A / GluN2B, Flag-tagged LRRC8A, and LRRC8A mutant constructs when the cells reached 80-90% confluence in 75-cm2 culture flasks. HEK293 cells expressing NMDARs and LRRC8A were suspended and washed twice in phosphate-buffered saline (PBS). The cells were then incubated at 25°C for 20 min with a rabbit anti-FLAG antibody to precipitate FL AG-tagged LRRC8A. A mouse anti-GFP antibody, which cross-reacts with GFP, was used to precipitate GFP-tagged wild-type LRRC8A or LRRC8A mutants. After washing the cells three times in PBS, they were lysed in Pierce IP Lysis Buffer with a cocktail of protease and phosphatase inhibitors. The lysates were incubated on ice for 30 min and then centrifuged at 13,000 x g for 10 min at 4°C. The supernatant was transferred to a tube with Dynabeads and incubated with rotation at 25 °C for 20 min. The Dynabeads-antibody-antigen complex was washed three times using 200 pL IP Lysis Buffer for each wash. To elute the coimmunoprecipitation complex, IP Lysis Buffer containing 100 pg / ml immunogen peptides of FLAG was added. The eluted proteins were subjected to immunoblotting analysis with the following antibodies: rabbit anti-GluNl, rabbit anti-LRRC8A (1:100), rabbit anti-GFP, rabbit anti-GluN2A, and mouse anti-GluN2B.

[0208] Study design and data analysis

[0209] Data are presented as means ± SEM. The investigators conducting electrophysiological and behavioral experiments were blinded to the drug treatments and genotypes. Animals were assigned to control and treatment groups with a 1: 1 allocation ratio as they became available; no specific randomization methods were used. Because no sex differences in the electrophysiological and biochemical assays was observed in this study, data from male and female mice were pooled for statistical analysis. No animals were excluded from data analysis, and no outlier tests were performed. In electrophysiological experiments, only one neuron was recorded per tissue slice, with at least four animals used for each recording protocol. The amplitude of 10 consecutive evoked EPSCs was analyzed and averaged using Clampfit 10.0 software (Axon Instruments). mEPSCs were analyzed offline using the MiniAnalysis peak detection program (Synaptosoft,561624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Leonia, NJ). The D’Agostino-Pearson normality test was used to assess data normality. A Student’s t-test was used to compare two groups, while a one-way analysis of variance (ANOVA) followed by Dunnett’s or Tukey’s post hoc test was used for comparisons involving more than two groups. Two-way ANOVA followed by Bonferroni’s post hoc test was employed to assess differences in nociceptive withdrawal thresholds between control and treatment groups. Statistical analyses were performed using Prism software (version 9, GraphPad Software Inc., La Jolla, CA). A p-value of < 0.05 was considered statistically significant.

[0210] Although the invention has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.

[0211] Listing of Sequences

[0212] SEQ ID NO: 1: Lrrc8a-Del-N (N-terminal deletion)-F: GACGACGAATTCATGAAGCCGTGGTGGGATGTGTTCACA

[0213] SEQ ID NO: 2: Lrrc8a-Del-N (N-terminal deletion)-R: CATGAATTCGTCGTCGTCCTTGTAGT

[0214] SEQ ID NO: 3: Lrrc8a-Del-C (C -terminal deletion)-F: AAGAACGCGCAGGACGCTGACAAGGAGCAGGCCTGA

[0215] SEQ ID NO: 4: Lrrc8a-Del-C (C-terminal deletion)-R: GTCCTGCGCGTTCTTGGTGAG

[0216] SEQ ID NO: 5: Lrrc8a-Del-Lrrl-3 (LRR1-3 deletion)-F: AAGAACGCGCAGGACGCGCTGCACATCAAGTTCACCGAC

[0217] SEQ ID NO: 6: Lrrc8a-Del-Lrrl-3 (LRR1-3 deletion)-R: GTCCTGCGCGTTCTTGGTGAG

[0218] SEQ ID NO: 7: Lrrc8a-Del-Lrr4-6 (LRR4-6 deletion)-F: CGTGAGAACCTGCGGAAGCTGTCCATCAACAATGAGGGC

[0219] SEQ ID NO: 8: Lrrc8a-Del-Lrr4-6 (LRR4-6 deletion)-R: CCGCAGGTTCTCACGCAGGAAGG

[0220] SEQ ID NO: 9: Lrrc8a-Del-Lrr7-9 (LRR7-9 deletion)-F: GGCGTGCACCTGCAG TGCCTTAAGCTGTGGTACAACCAC

[0221] SEQ ID NO: 10: Lrrc8a-Del-Lrr7-9 (LRR7-9 deletion)-R: CTGCAGGTGCACGCCCACATCTG571624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0222] SEQ ID NO: 11: Lrrc8a-Del-Lrrl0-12 (LRR10-12 deletion)-F: CTGCACCGCCTCACCCTAGCCATCACGGCCAAC CGG AT

[0223] SEQ ID NO: 12; Lrrc8a-Del-Lrrl0-12 (LRR10-12 deletion)-R: GGTGAGGCGGTGCAGGTGCTGGAA

[0224] SEQ ID NO: 13: Lrrc8a-Del-lrrl3-end (deletion from Lrrl3 to the end)-F: CAGAACCTCCAGAACGCTGACAAGGAGCAGGCCTGA

[0225] SEQ ID NO: 14: Lrrc8a-Del-Lrrl3-end (deletion from Lrrl3 to the end)-R: GTTCTGGAGGTTCTGCAGGAGGCC

[0226] SEQNO: 15: Lrr-l-del-F: AAGAACGCGCAGGACGTCCTCAAGCTGGAGCTGATCC

[0227] SEQ ID NO: 16: Lrr-l-del-R: GTCCTGCGCGTTCTTGGTGAG

[0228] SEQ ID NO: 17: Lrr-2-del-F: CTGGTGGAGCTGGAGGAGCTGTGGCTCTACCACAC

[0229] SEQ ID NO: 18: Lrr-2-del-R: CTCCAGCTCCACCAGGTCAAA

[0230] SEQ ID NO: 19: Lrr-3-del-F: CTCCGGGCCTCAAGGCGCTGCACATCAAGTTCACC

[0231] SEQ ID NO: 20: Lrr-3-del-R: CTTGAGGCCCGTGAGCTGGGC

[0232] SEQ ID NO: 21: LRRC8A-LRR1 peptide, which mimics the LRR1 domain of LRRC8A: LELHLFMLSGIPDTVFDLVELE

[0233] SEQ ID NO: 22: cell-penetrating peptide Tat: YGRKKRRQRRR

[0234] SEQ ID NO: 23: a scrambled control peptide: TLEIEDFPVLMELHLFVDLSLG

[0235] SEQ ID NO: 24: rat Lrrc8a forward: CAGCGTCCATGGAGCAAAAG

[0236] SEQ ID NO: 25: rat Lrrc8a reverse, TGGTTTAACCCTGAGATGGCT

[0237] SEQ ID NO: 26: rat Lrrc8b forward, CGGGTGTACCTGAAGCAGAT

[0238] SEQ ID NO: 27: rat Lrrc8b reverse, CAACACCTTAAAGATCTCTGCC

[0239] SEQ ID NO: 28: rat Lrrc8c forward, GTGGGATGTGTTCACGGACT

[0240] SEQ ID NO: 29: rat Lrrc8c reverse, AAGAGTGGTTCTGAGCAGGC

[0241] SEQ ID NO: 30: rat Lrrc8d forward, TAGACCCGGCAGCAGTCTAT

[0242] SEQ ID NO: 31: rat Lrrc8d reverse, CCATGGCTTCAGGATTCGGT

[0243] SEQ ID NO: 32: rat GAPDH forward, GACATGCCGCCTGGAGAAAC

[0244] SEQ ID NO: 33: rat GAPDH reverse, AGCCCAGGATGCCCTTTAGT

[0245] SEQ ID NO: 34: Lrrc8a: MIPVTELRYFADTQPAYRILKPWWD581624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO

[0246] SEQ ID NO: 35: Lrrc8b: MITLTELKCLADAQSSYHILKPWWD

[0247] SEQ ID NO: 36: Lrrc8c: MIPVTEFRQFSEQQPAFRVLKPWWD

[0248] SEQ ID NO: 37: Lrrc8d: MFTLAEVASLNDIQPTYRILKPWWD

[0249] SEQ ID NO: 38: Lrrc8e: MIPVAEFKQFTEQQPAFKVLKPWWD

[0250] SEQ ID NO: 39: Lrrc8a N-terminus sequences: MIPVTELRYFADTQP

[0251] SEQ ID NO: 40: Lrrc8c N-terminus sequences: MIPVTEFRQFSEQQP

[0252] SEQ ID NO: 41: a Tat-fused peptide mimicking the LRR4 domain (LRR4 peptide): ALHIKFTDIKEIPLWIYSLKTLE591624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO ReferencesAbascal, F., and Zardoya, R. (2012). LRRC8 proteins share a common ancestor with pannexins, and may form hexameric channels involved in cell-cell communication. Bioessays 34, 551-560.Bao, J., Perez, C. J., Kim, J., Zhang, H., Murphy, C. J., Hamidi, T., Jaubert, J., Platt, C. D., Chou, J., Deng, M., et al. (2018). Deficient LRRC8A-dependent volume -regulated anion channel activity is associated with male infertility in mice. JCI Insight 3, e99767.Chaplan, S. R., Malmberg, A. B., and Yaksh, T. L. (1997). Efficacy of spinal NMDA receptor antagonism in formalin hyperalgesia and nerve injury evoked allodynia in the rat. J Pharmacol Exp Ther280, 829-838.Chen, C. H., Hsieh, Y. C., Yang, P. M., Liu, Y. R., and Cho, E. C. (2020). Dicoumarol suppresses HMGA2-mediated oncogenic capacities and inhibits cell proliferation by inducing apoptosis in colon cancer. Biochem Biophys Res Commun 524, 1003-1009.Chen, J., Li, L., Chen, S. R., Chen, H., Xie, J. D., Sirrieh, R. E., MacLean, D. M., Zhang, Y., Zhou, M. H., Jayaraman, V., et al. (2018). The a25-l-NMDA Receptor Complex Is Critically Involved in Neuropathic Pain Development and Gabapentin Therapeutic Actions. Cell Rep 22, 2307-2321.Chen, S. R., Hu, Y. M., Chen, H., and Pan, H. L. (2014a). Calcineurin inhibitor induces pain hypersensitivity by potentiating pre- and postsynaptic NMDA receptor activity in spinal cords. J Physiol 592, 215-227.Chen, S. R., and Pan, H. L. (2006). Blocking mu opioid receptors in the spinal cord prevents the analgesic action by subsequent systemic opioids. Brain Res 1081, 119-125.Chen, S. R., Zhou, H. Y., Byun, H. S., Chen, H., and Pan, H. L. (2014b). Casein kinase II regulates N-methyl-D-aspartate receptor activity in spinal cords and pain hypersensitivity induced by nerve injury. J Pharmacol Exp Ther 350, 301-312.601624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WOChen, Y., Chen, S. R., Chen, H., Zhang, J., and Pan, H. L. (2019). Increased alpha2delta-l-NMDA receptor coupling potentiates glutamatergic input to spinal dorsal horn neurons in chemotherapy-induced neuropathic pain. Journal of neurochemistry 148, 252-274.Niraj, G., and Rowbotham, D. J. (2011). Persistent postoperative pain: where are we now? British journal of anaesthesia 107, 25-29. 10.1093 / bja / aer116.Gottschalk, A., Cohen, S. P., Yang, S., and Ochroch, E. A. (2006). Preventing and treating pain after thoracic surgery. Anesthesiology 104, 594-600. 10.1097 / 00000542-200603000-00027.Zhou, H. Y., Chen, S. R., Byun, H. S., Chen, H., Li, L., Han, H. D., Lopez-Berestein, G., Sood, A. K., and Pan, H. L. (2012). N-methyl-D-aspartate receptor- and calpain-mediated proteolytic cleavage of K+-C1- cotransporter-2 impairs spinal chloride homeostasis in neuropathic pain. J Biol Chem 287, 33853-33864. 10.1074 / jbc.M112.395830.Chen, S. R., Zhou, H. Y., Byun, H. S., Chen, H., and Pan, H. L. (2014). Casein kinase II regulates N-methyl-D-aspartate receptor activity in spinal cords and pain hypersensitivity induced by nerve injury. J Pharmacol Exp Ther 350, 301-312. 10.1124 / jpet.114.215855.Xie, J. D., Chen, S. R., Chen, H., Zeng, W. A., and Pan, H. L. (2016). Presynaptic N-Methyl-d-aspartate (NMD A) Receptor Activity Is Increased Through Protein Kinase C in Paclitaxel-induced Neuropathic Pain. J Biol Chem 291, 19364-19373. 10.1074 / jbc.M116.732347.Huang, Y., Chen, H., Jin, D., Chen, S. R., and Pan, H. L. (2023). NMDA Receptors at Primary Afferent-Excitatory Neuron Synapses Differentially Sustain Chemotherapy- and Nerve Trauma-Induced Chronic Pain. JNeurosci 43, 3933-3948. 10.1523 / jneurosci.0183-23.2023.Orhurhu, V., Orhurhu, M. S., Bhatia, A., and Cohen, S. P. (2019). Ketamine Infusions for Chronic Pain: A Systematic Review and Meta-analysis of Randomized Controlled Trials.Anesth Analg 129, 241-254. 10.1213 / ane.0000000000004185.611624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Sigtermans, M. J., van Hilten, J. J., Bauer, M. C. R., Arbous, S. M., Marinus, J., Sarton, E. Y., and Dahan, A. (2009). Ketamine produces effective and long-term pain relief in patients with Complex Regional Pain Syndrome Type 1. Pain 145, 304-311. 10.1016 / j.pain.2009.06.023.Zhou, H. Y., Chen, S. R., and Pan, H. L. (2011). Targeting N-methyl-D-aspartate receptors for treatment of neuropathic pain. Expert Rev Clin Pharmacol 4, 379-388.Liu, H., Wang, H., Sheng, M., Jan, L. Y., Jan, Y. N., and Basbaum, A. I. (1994). Evidence for presynaptic N-methyl-D-aspartate autoreceptors in the spinal cord dorsal horn. Proc Natl Acad SciU S A 91, 8383-8387.McRoberts, J. A., Ennes, H. S., Marvizon, J. C., Fanselow, M. S., Mayer, E. A., and Vissel, B. (2011). Selective knockdown of NMDA receptors in primary afferent neurons decreases pain during phase 2 of the formalin test. Neuroscience 172, 474-482.10.1016 / j.neuroscience.2010.10.045.Chen, Y., Chen, S. R., Chen, H., Zhang, J., and Pan, H. L. (2019). Increased alpha2delta-l-NMDA receptor coupling potentiates glutamatergic input to spinal dorsal horn neurons in chemotherapy-induced neuropathic pain. Journal of neurochemistry 148, 252-274.10.1111 / jnc.14627.Chen, J., Li, L., Chen, S. R., Chen, H., Xie, J. D., Sirrieh, R. E., MacLean, D. M., Zhang, Y., Zhou, M. H., Jayaraman, V., and Pan, H. L. (2018). The a25-l-NMDA Receptor Complex Is Critically Involved in Neuropathic Pain Development and Gabapentin Therapeutic Actions. Cell Rep 22, 2307-2321. 10.1016 / j.celrep.2018.02.021.Chen, S. R., Hu, Y. M., Chen, H., and Pan, H. L. (2014). Calcineurin inhibitor induces pain hypersensitivity by potentiating pre- and postsynaptic NMDA receptor activity in spinal cords. J Physiol 592, 215-227. 10.1113 / jphysiol.2013.263814.Yamamoto, T., and Yaksh, T. L. (1992). Spinal pharmacology of thermal hyperesthesia induced by constriction injury of sciatic nerve. Excitatory amino acid antagonists. Pain 49, 121-128.621624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WOZahn, P. K., and Brennan, T. J. (1998). Lack of effect of intrathecally administered N-methyl-D-aspartate receptor antagonists in a rat model for postoperative pain. Anesthesiology 88, 143-156.10.1097 / 00000542- 199801000-00022.Syeda, R., Qiu, Z., Dubin, A. E., Murthy, S. E., Florendo, M. N., Mason, D. E., Mathur, J., Cahalan, S. M., Peters, E. C., Montal, M., and Patapoutian, A. (2016). LRRC8 Proteins Form Volume-Regulated Anion Channels that Sense Ionic Strength. Cell 164, 499-511.10.1016 / j.cell.2015.12.031.Qiu, Z., Dubin, A. E., Mathur, J., Tu, B., Reddy, K., Miraglia, L. J., Reinhardt, J., Orth, A. P., and Patapoutian, A. (2014). SWELL 1, a plasma membrane protein, is an essential component of volume-regulated anion channel. Cell 157, 447-458. 10.1016 / j.cell.2014.03.024.Voss, F. K., Ullrich, F., Munch, J., Lazarow, K., Lutter, D., Mah, N., Andrade-Navarro, M. A., von Kries, J. P., Stauber, T., and Jentsch, T. J. (2014). Identification of LRRC8 Heteromers as an Essential Component of the Volume-Regulated Anion Channel VRAC. Science 344, 634-638.10.1126 / science.1252826.Strange, K., Yamada, T., and Denton, J. S. (2019). A 30-year journey from volume-regulated anion currents to molecular structure of the LRRC8 channel. J Gen Physiol 151, 100-117.10.1085 / jgp.201812138.Deneka, D., Sawicka, M., Lam, A. K. M., Paulino, C., and Dutzler, R. (2018). Structure of a volume-regulated anion channel of the LRRC8 family. Nature 558, 254-259. 10.1038 / s41586-018-0134-y.Kefauver, J. M., Saotome, K., Dubin, A. E., Pallesen, J., Cottrell, C. A., Cahalan, S. M., Qiu, Z., Hong, G., Crowley, C. S., Whitwam, T., et al. (2018). Structure of the human volume regulated anion channel. Elife 7, e38461. 10.7554 / eLife.38461.631624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Zhang, Y., Xie, L., Gunasekar, S. K., Tong, D., Mishra, A., Gibson, W. J., Wang, C., Fidler, T., Marthaler, B., Klingelhutz, A., et al. (2017). SWELL1 is a regulator of adipocyte size, insulin signalling and glucose homeostasis. Nat Cell Biol 19, 504-517. 10.1038 / ncb3514.Lu, P., Ding, Q., Li, X., Ji, X., Li, L., Fan, Y., Xia, Y., Tian, D., and Liu, M. (2019). SWELL1 promotes cell growth and metastasis of hepatocellular carcinoma in vitro and in vivo.EBioMedicine 48, 100-116. 10.1016 / j.ebiom.2019.09.007.Zhou, J. J., Luo, Y., Chen, S. R., Shao, J. Y., Sah, R., and Pan, H. L. (2020). LRRC8A-dependent volume-regulated anion channels contribute to ischemia-induced brain injury and glutamatergic input to hippocampal neurons. Exp Neurol 332, 113391. 10.1016 / j.expneurol.2020.113391.Bao, J., Perez, C. J., Kim, J., Zhang, H., Murphy, C. J., Hamidi, T., Jaubert, J., Platt, C. D., Chou, J., Deng, M., et al. (2018). Deficient LRRC8A-dependent volume -regulated anion channel activity is associated with male infertility in mice. JCI Insight 3, e99767.10.1172 / jci.insight.99767.Kang, C., Xie, L., Gunasekar, S. K., Mishra, A., Zhang, Y., Pai, S., Gao, Y., Kumar, A., Norris, A. W., Stephens, S. B., and Sah, R. (2018). SWELL1 is a glucose sensor regulating P-cell excitability and systemic glycaemia. Nat Commun 9, 367. 10.1038 / s41467-017-02664-0.Kumar, A., Xie, L., Ta, C. M., Hinton, A. O., Gunasekar, S. K., Minerath, R. A., Shen, K., Maurer, J. M., Grueter, C. E., Abel, E. D., et al. (2020). SWELL1 regulates skeletal muscle cell size, intracellular signaling, adiposity and glucose metabolism. Elife 9. 10.7554 / eLife.58941.Stuhlmann, T., Planells-Cases, R., and Jentsch, T. J. (2018). LRRC8 / VRAC anion channels enhance P-cell glucose sensing and insulin secretion. Nat Commun 9, 1974. 10.1038 / s41467-018-04353-y.Wang, R. P., Lu, Y. J., Gunasekar, S., Zhang, Y. H., Benson, C. J., Chapleau, M. W., Sah, R., and Abboud, F. M. (2017). The volume-regulated anion channel (LRRC8) in nodose neurons is sensitive to acidic pH. Jci Insight 2. ARTN e90632. 10.1172 / jci.insight.90632.641624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WOGarriga, J., Laumet, G., Chen, S. R., Zhang, Y., Madzo, J., Issa, J. J., Pan, H. L., and Jelinek, J. (2018). Nerve Injury-Induced Chronic Pain Is Associated with Persistent DNA Methylation Reprogramming in Dorsal Root Ganglion. J Neurosci 38, 6090-6101. 10.1523 / jneurosci.2616-17.2018.Laumet, G., Garriga, J., Chen, S. R., Zhang, Y., Li, D. P., Smith, T. M., Dong, Y., Jelinek, J., Cesaroni, M., Issa, J. P., and Pan, H. L. (2015). G9a is essential for epigenetic silencing of K(+) channel genes in acute-to-chronic pain transition. Nat Neurosci 18, 1746-1755.10.1038 / nn.4165.da Silva, S., Hasegawa, H., Scott, A., Zhou, X., Wagner, A. K., Han, B. X., and Wang, F. (2011). Proper formation of whisker barrelettes requires periphery-derived Smad4-dependent TGF-beta signaling. Proc Natl Acad Sci U S A 108, 3395-3400. 10.1073 / pnas.1014411108.Zappia, K. J., O'Hara, C. L., Moehring, F., Kwan, K. Y., and Stucky, C. L. (2017). Sensory Neuron-Specific Deletion of TRPA1 Results in Mechanical Cutaneous Sensory Deficits. eNeuro 4. 10.1523 / eneuro.0069- 16.2017.Kobe, B., and Kajava, A. V. (2001). The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 11, 725-732. 10.1016 / s0959-440x(01)00266-4.Abascal, F., and Zardoya, R. (2012). LRRC8 proteins share a common ancestor with pannexins, and may form hexameric channels involved in cell-cell communication. Bioessays 34, 551-560.10.1002 / bies.201100173.Zhou, M. H., Chen, S. R., Wang, L., Huang, Y., Deng, M., Zhang, J., Zhang, J., Chen, H., Yan, J., and Pan, H. L. (2021). Protein Kinase C-Mediated Phosphorylation and a25-l Interdependently Regulate NMDA Receptor Trafficking and Activity. J Neurosci 41, 6415-6429.10.1523 / jneurosci.0757-21.2021.651624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Platt, C. D., Chou, J., Houlihan, P., Badran, Y. R., Kumar, L., Bainter, W., Poliani, P. L., Perez, C. J., Dent, S. Y. R., Clapham, D. E., et al. (2017). Leucine-rich repeat containing 8A (LRRC8A)-dependent volume-regulated anion channel activity is dispensable for T-cell development and function. Journal of Allergy and Clinical Immunology 140, 1651-+. 10.1016 / j.jaci.2016.12.974. Li, L., Chen, S. R., Chen, H., Wen, L., Hittelman, W. N., Xie, J. D., and Pan, H. L. (2016).Chloride Homeostasis Critically Regulates Synaptic NMDA Receptor Activity in Neuropathic Pain. Cell Rep 15, 1376-1383. 10.1016 / j.celrep.2016.04.039.Yan, J., and Aldrich, R. W. (2012). BK potassium channel modulation by leucine-rich repeatcontaining proteins. Proc Natl Acad Sci U S A 109, 7917-7922. 10.1073 / pnas.1205435109.Deng, M., Chen, S. R., and Pan, H. L. (2019). Presynaptic NMDA receptors control nociceptive transmission at the spinal cord level in neuropathic pain. Cell Mol Life Sci 76, 1889-1899. 10.1007 / s00018-019-03047-y.Zhang, J., Chen, S. R., Zhou, M. H., Jin, D., Chen, H., Wang, L., DePinho, R. A., and Pan, H. L. (2022). HDAC2 in Primary Sensory Neurons Constitutively Restrains Chronic Pain by Repressing a25-l Expression and Associated NMDA Receptor Activity. J Neurosci 42, 8918-8935. 10.1523 / jneurosci.0735-22.2022.Palfi, S., Gurruchaga, J. M., Ralph, G. S., Lepetit, H., Lavisse, S., Buttery, P. C., Watts, C., Miskin, J., Kelleher, M., Deeley, S., et al. (2014). Long-term safety and tolerability of ProSavin, a lentiviral vector-based gene therapy for Parkinson's disease: a dose escalation, open-label, phase 1 / 2 trial. Lancet (London, England) 383, 1138-1146. 10.1016 / s0140-6736(13)61939-x.Liu, J. O., Guan, Y., and Qiu, Z. (2023). ATP-releasing SWELL1 channel in spinal microglia contributes to neuropathic pain. Sci Adv 9, eade9931. 10.1126 / sciadv.ade9931.Chen, C. H., Hsieh, Y. C., Yang, P. M., Liu, Y. R., and Cho, E. C. (2020). Dicoumarol suppresses HMGA2-mediated oncogenic capacities and inhibits cell proliferation by inducing apoptosis in colon cancer. Biochem Biophys Res Commun 524, 1003-1009. 10.1016 / j.bbrc.2020.01.147.661624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WORaabe, J., Arend, C., Steinmeier, J., and Dringen, R. (2019). Dicoumarol Inhibits Multidrug Resistance Protein 1 -Mediated Export Processes in Cultured Primary Rat Astrocytes.NeurochemRes 44, 333-346. 10.1007 / s11064-018-2680-y.Timson, D. J. (2017). Dicoumarol: A Drug which Hits at Least Two Very Different Targets in Vitamin K Metabolism. Curr Drug Targets 18, 500-510.10.2174 / 1389450116666150722141906.Ge, W., Zhang, X., Wang, Q., Mao, J., Jia, P., and Cai, J. (2024). Dicoumarol attenuates NLRP3 inflammasome activation to inhibit inflammation and fibrosis in knee osteoarthritis. Mol Med Rep 29, 100. 10.3892 / mmr.2024.13224.Sung, K. W., Kirby, M., McDonald, M. P., Lovinger, D. M., and Delpire, E. (2000). Abnormal GABAA receptor-mediated currents in dorsal root ganglion neurons isolated from Na-K-2C1 cotransporter null mice. J Neurosci 20, 7531-7538. 10.1523 / jneurosci.20-20-07531.2000.Coull, J. A., Boudreau, D., Bachand, K., Prescott, S. A., Nault, F., Sik, A., De Koninck, P., and De Koninck, Y. (2003). Trans-synaptic shift in anion gradient in spinal lamina I neurons as a mechanism of neuropathic pain. Nature 424, 938-942. 10.1038 / nature01868.Sun, J., Chen, S. R., Chen, H., and Pan, H. L. (2019). p-Opioid receptors in primary sensory neurons are essential for opioid analgesic effect on acute and inflammatory pain and opioid-induced hyperalgesia. J Physiol 597, 1661-1675. 10.1113 / jp277428.Chung, J. M., Kim, H. K., and Chung, K. (2004). Segmental spinal nerve ligation model of neuropathic pain. Methods Mol Med 99, 35-45. 10.1385 / l-59259-770-x:035.Chaplan, S. R., Malmberg, A. B., and Yaksh, T. L. (1997). Efficacy of spinal NMDA receptor antagonism in formalin hyperalgesia and nerve injury evoked allodynia in the rat. J Pharmacol Exp Ther 280, 829-838.671624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Chen, S. R., and Pan, H. L. (2006). Loss of TRPV1 -expressing sensory neurons reduces spinal mu opioid receptors but paradoxically potentiates opioid analgesia. J Neurophysiol 95, 3086-3096. 10.1152 / jn.01343.2005.Xie, J. D., Chen, S. R., Chen, H., and Pan, H. L. (2017). Bortezomib induces neuropathic pain through protein kinase C-mediated activation of presynaptic NMDA receptors in the spinal cord. Neuropharmacology 123, 477-487. 10.1016 / j.neuropharm.2017.06.027.Zhang, Y., Chen, S. R., Laumet, G., Chen, H., and Pan, H. L. (2016). Nerve Injury Diminishes Opioid Analgesia through Lysine Methyltrans ferase-mediated Transcriptional Repression of p-Opioid Receptors in Primary Sensory Neurons. J Biol Chem 291, 8475-8485.10.1074 / jbc.M115.711812.Chen, S. R., and Pan, H. L. (2006). Blocking mu opioid receptors in the spinal cord prevents the analgesic action by subsequent systemic opioids. Brain Res 1081, 119-125.10.1016 / j.brainres.2006.01.053.Chen, S. R., and Pan, H. L. (2001). Spinal endogenous acetylcholine contributes to the analgesic effect of systemic morphine in rats. Anesthesiology 95, 525-530. 10.1097 / 00000542-200108000-00039.Deng, M., Chen, S. R., Chen, H., and Pan, H. L. (2019). alpha2delta- 1 -Bound N-Methyl-D-aspartate Receptors Mediate Morphine-induced Hyperalgesia and Analgesic Tolerance by Potentiating Glutamatergic Input in Rodents. Anesthesiology 130, 804-819.10.1097 / ALN.0000000000002648.Cao, X. H., Chen, S. R., Li, L., and Pan, H. L. (2012). Nerve injury increases brain-derived neurotrophic factor levels to suppress BK channel activity in primary sensory neurons. J Neurochem 121, 944-953. 10.1111 / j.1471-4159.2012.07736.x.681624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO Wu, Z. Z., Chen, S. R., and Pan, H. L. (2005). Transient receptor potential vanilloid type 1 activation down-regulates voltage-gated calcium channels through calcium-dependent calcineurin in sensory neurons. J Biol Chem 280, 18142-18151. 10.1074 / jbc. M501229200.Vydyanathan, A., Wu, Z. Z., Chen, S. R., and Pan, H. L. (2005). A-type voltage-gated K+ currents influence firing properties of isolectin B4-positive but not isolectin B4-negative primary sensory Wu, Z. Z., Chen, S. R., and Pan, H. L. (2004). Differential sensitivity of N- and P / Q-type Ca2+ channel currents to a mu opioid in isolectin B4-positive and -negative dorsal root ganglion neurons. J Pharmacol Exp Ther 311, 939-947. 10.1124 / jpet.104.073429.Zhang, G. F., Chen, S. R., Jin, D., Huang, Y., Chen, H., and Pan, H. L. (2021). a25-l Upregulation in Primary Sensory Neurons Promotes NMDA Receptor-Mediated Glutamatergic Input in Resiniferatoxin-Induced Neuropathy. JNeurosci 41, 5963-5978.10.1523 / jneurosci.0303-21.2021.

[0253] Although the invention has been described with reference to the above examples, it will be understood that modifications and variations are encompassed within the spirit and scope of the invention. Accordingly, the invention is limited only by the following claims.691624915365.2439994.000084

Claims

PATENT ATTORNEY DOCKET NO. MDA1350-1WOWhat Is Claimed Is:

1. A method for treating pain in a subject comprising administering to the subject a therapeutically effective amount of a vector comprising a gene encoding leucine-rich repeatcontaining protein 8A (LRRC8A), wherein expression of the gene provides treatment for the pain.

2. The method of claim 1, wherein the vector is administered intrathecally.

3. The method of claim 1, wherein the pain is neuropathic pain.

4. The method of claim 3, wherein the neuropathic pain is caused by traumatic nerve injury.

5. The method of claim 4, wherein the traumatic nerve injury is spinal nerve ligation.

6. The method of claim 1, wherein the pain originates from tactile stimulus, noxious pressure, thermal stimulus, or a combination thereof.

7. The method of claim 1, wherein expression of LRRC8A from the vector reduces synaptic N-methyl-D-aspartate receptor (NMD AR) activity in the spinal cord of the subject.

8. The method of claim 1, wherein the vector is a lentiviral, adenovirus or adeno-associated virus vector.

9. The method of claim 1, wherein expression of the gene increases LRRC8A protein levels, LRRC8A mRNA levels, or a combination thereof in dorsal root ganglia (DRG) of the subject compared to LRRC8A protein levels, LRRC8A mRNA levels, or a combination thereof in the subject prior to treatment.

10. The method of claim 1, wherein expression of the gene decreases synaptic expression of NMD AR subunits in the spinal cord of the subject compared to synaptic expression of NMD AR subunits in the spinal cord of the subject prior to treatment.

11. The method of claim 1, wherein the pain is characterized by at least one of tactile allodynia and thermal hyperalgesia.

12. The method of claim 1, wherein the gene encodes full-length LRRC8A, LRRC8A N-terminus mutant without VRAC activity, or a functional fragment thereof.

13. A method of modulating NMD A receptor activity in a nervous system of a subject, comprising administering to the subject a therapeutically effective amount of a vector encoding LRRC8A, thereby increasing the level of expression of LRRC8A and modulating NMDAR activity.

14. The method of claim 13, wherein the NMD A receptor activity is NMDAR activity in the spinal cord of the subject.701624915365.2439994.000084PATENT ATTORNEY DOCKET NO. MDA1350-1WO 15. The method of claim 13, wherein the vector is administered intrathecally.

16. The method of claim 13, wherein modulating receptor activity comprises reducing pain symptoms in the subject.

17. A method for treating pain in a subject comprising administering to the subject a therapeutically effective amount of a small molecule that increases expression of LRRC8A, wherein the increased expression of LRRC8A provides treatment for the pain.

18. The method of claim 17, wherein LRRC8A expression levels are increased compared to LRRC8A expression levels in the subject prior to.

19. The method of claim 17, wherein the pain is neuropathic pain.

20. The method of claim 19, wherein the neuropathic pain is caused by traumatic nerve injury.

21. The method of claim 20, wherein the traumatic nerve injury is spinal nerve ligation.

22. The method of claim 17, wherein increasing expression of LRRC8A reduces synaptic NMD AR activity in the spinal cord of the subject.

23. The method of claim 17, wherein increasing expression of LRRC8A increases LRRC8A protein levels in DRG of the subject.

24. The method of claim 17, wherein increasing expression of LRRC8A decreases synaptic expression of NMD AR subunits in the spinal cord of the subject.

25. The method of claim 17, wherein the pain is characterized by at least one of tactile allodynia and thermal hyperalgesia.

26. A method of modulating NMD A receptor activity in a nervous system of a subject, comprising administering to the subject a therapeutically effective amount of a small molecule that increases expression of LRRC8A, thereby increasing the level of expression of LRRC8A and modulating NMD AR activity in the nervous system of the subject.

27. The method of claim 26, wherein LRRC8A expression levels are increased compared to LRRC8A expression levels in the subject prior to treatment.

28. The method of claim 26, wherein the NMDA receptor activity is NMD AR activity in the spinal cord of the subject.711624915365.2439994.000084