Nucleic acid molecule inhibiting expression of tslp
Nucleic acid molecules designed to inhibit TSLP expression through targeted mRNA interference provide a therapeutic solution for diseases associated with TSLP, effectively reducing inflammation and hyperresponsiveness in conditions such as severe asthma.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MOCHIDA PHARM CO LTD
- Filing Date
- 2025-10-30
- Publication Date
- 2026-05-07
Smart Images

Figure JPOXMLDOC01-APPB-C000012 
Figure JPOXMLDOC01-APPB-C000013 
Figure JPOXMLDOC01-APPB-C000014
Abstract
Description
Nucleic acid molecules that inhibit TSLP expression
[0001] The present invention relates to a pharmaceutical composition characterized by containing a nucleic acid molecule or salt thereof that inhibits the expression of thymic stromal lymphopositin (TSLP), or a solvate thereof, and one or more thereof as an active ingredient. The present invention also relates to a preventive and / or therapeutic agent for diseases or symptoms in which thymic stromal lymphopositin is suspected to be involved (for example, bronchial asthma (severe or refractory asthma), etc.).
[0002] TSLP is a cytokine primarily produced by epithelial cells (thymus, tonsils, trachea, skin, gastrointestinal epithelial cells, etc.), belonging to the IL-2 family, and is the cytokine with the highest homology to IL-7. TSLP production is enhanced by external factors such as respiratory infections, allergens, tobacco, exhaust fumes, and cold air. Produced TSLP is known to activate multiple inflammatory pathways through its effects on adaptive immune cells (differentiation of Th2 cells, induction / enhancement of Th2-type immune responses) and innate immune cells, as well as inducing airway hyperresponsiveness, and is associated with the exacerbation of severe asthma in patients.
[0003] TSLP receptors are primarily expressed in myeloid dendritic cells, type 2 innate lymphoid cells, mast cells, basophils, and eosinophils. TSLP binds to its receptor chain and forms a complex with the IL-7 receptor α chain, thereby inducing intracellular signal transduction and activating inflammatory pathways. Therefore, if drugs that can inhibit TSLP expression are found, it is expected that prevention and / or treatment of diseases or symptoms suspected to be related to TSLP will become possible.
[0004] International Publication No. 2024 / 173520 discloses an RNAi agent that inhibits TSLP expression (Patent Document 1). International Publication No. 2020 / 142693 discloses a composition comprising an oligonucleotide that targets TSLP (Patent Document 2). International Publication No. 2020 / 027641 discloses a pharmaceutical composition for the prevention or treatment of atopic diseases comprising silica particles supported with nucleic acid molecules complementaryly binding to TSLP mRNA (Patent Document 3). International Publication No. 2015 / 009996 discloses a method for treating a disease or disorder, comprising administering an effective amount of a TSLP-targeting agent (Patent Document 4). International Publication No. 2010 / 111490 discloses a method for treating a human subject suffering from a condition mediated by the action or loss of action of TSLP, and a double-stranded siRNA molecule used in said method (Patent Document 5). U.S. Patent Publication No. 2009 / 0053169 discloses siRNA against TSLP that can be prepared as a powder for pulmonary administration (Patent Document 6). Korean Patent Publication No. 2017 / 0057194 discloses siRNA oligonucleotides that inhibit the expression of human TSLP as a cosmetic composition (Patent Document 7). Korean Patent Publication No. 2017 / 0029449 discloses a pharmaceutical composition for the prevention or treatment of atopic dermatitis containing a double-stranded RNA oligonucleotide (Patent Document 8). Korean Patent Publication No. 2016 / 0016475 discloses a method for inhibiting the expression of human TSLP in cells, comprising contacting cells with an oligonucleotide that specifically hybridizes with a nucleic acid molecule encoding human TSLP (Patent Document 9). International Publication No. 2025 / 040005 discloses RNAi agents that inhibit the expression of TSLP (Patent Document 10).
[0005] Clin Exp Ophthalmol. 2016 Aug;44(6):492-501. discloses TSLP siRNA in relation to Aspergillus fumigatus, which promotes the T helper type 2 response via TSLP production by human corneal epithelial cells (Non-Patent Literature 1). Exp Lung Res. 2019 Oct;45(8):221-235 discloses that TSLP induces the early stages of epithelial-mesenchymal transition in human bronchial epithelial cells through TGFβ1 upregulation, and also discloses TSLP siRNA (Non-Patent Literature 2). Immunology. 2009 Sep;128(1 Suppl):e849-57. discloses that phthalate-inducible TSLP mediates allergic dermatitis in mice, and also discloses TSLP siRNA (Non-Patent Literature 3). J Immunol. 2014 May 1;192(9):4025-4031. discloses the important role of TSLP in nickel-induced allergy and also discloses TSLP siRNA (Non-Patent Literature 4). Exp Eye Res. 2018 Jun:171:120-130. discloses that TSLP-activated dendritic cells induce T helper type 2 inflammation in Aspergillus fumigatus keratitis and also discloses TSLP siRNA (Non-Patent Literature 5). Exp Eye Res. 2019 May:182:19-29. discloses that the interaction between TSLP and TLR2 and TLR4 regulates antifungal innate immunity in Aspergillus fumigatus-induced corneal infection and also discloses TSLP siRNA (Non-Patent Literature 6). J Clin Med. 2019 Sep 1;8(9):1350. discloses that TSLP exacerbates septic inflammation via the Murine Double Minute 2 (MDM2) signaling pathway and also discloses TSLP siRNA (Non-Patent Literature 7).InVest Ophthalmol Vis Sci. 2020 Dec 1;61(14):24. discloses that TSLP produced by Aspergillus fumigatus-stimulated DCs promotes the Th17 response via the JAK / STAT signaling pathway in fungal keratitis, and also discloses TSLP siRNA (Non-Patent Literature 8). Int J Ophthalmol. 2021 Oct 18;14(10):1473-1483. discloses the interaction of TSLP and IL-4 in adaptive immunity in Aspergillus fumigatus keratitis, and also discloses TSLP siRNA (Non-Patent Literature 9). Immunol Cell Biol. 2011 Feb;89(2):231-238. discloses that TSLP derived from RSV-stimulated rat airway epithelial cells activates myeloid dendritic cells, and also discloses TSLP siRNA (Non-Patent Literature 10). J Neuroinflammation. 2023 Sep 2;20(1):200. discloses that TSLP in DRG neurons causes the development of neuropathic pain via T cells, and also discloses TSLP siRNA (Non-Patent Literature 11).
[0006] International Publication No. 2024 / 173520, International Publication No. 2020 / 142693, International Publication No. 2020 / 027641, International Publication No. 2015 / 009996, International Publication No. 2010 / 111490, U.S. Patent Publication No. 2009 / 0053169, Korean Patent Publication No. 2017 / 0057194, Korean Patent Publication No. 2017 / 0029449, Korean Patent Publication No. 2016 / 0016475, International Publication No. 2025 / 040005
[0007] Clin Exp Ophthalmol. 2016 Aug;44(6):492-501.Exp Lung Res. 2019 Oct;45(8):221-235Immunology. 2009 Sep;128(1 Suppl):e849-57.J Immunol. 2014 May 1;192(9):4025-4031.Exp Eye Res. 2018 Jun:171:120-130.Exp Eye Res. 2019 May:182:19-29.J Clin Med. 2019 Sep 1;8(9):1350.InVest Ophthalmol Vis Sci. 2020 Dec 1;61(14):24.Int J Ophthalmol. 2021 Oct 18;14(10):1473-1483.Immunol Cell Biol. 2011 Feb;89(2):231-238.J Neuroinflammation. 2023 Sep 2;20(1):200.
[0008] In the circumstances described above, the present invention aims to provide nucleic acid molecules or salts thereof, or solvates thereof, that can inhibit the expression of thymic interstitial lymphocyte necrosis factor (TSLP), and pharmaceutical compositions characterized by containing one or more thereof as active ingredients, and their pharmaceutical uses, in particular, preventive and / or therapeutic agents for diseases or symptoms in which TSLP is suspected to be involved (e.g., bronchial asthma (severe or refractory asthma), etc.). Furthermore, an object of the present invention is also to provide a method for producing the nucleic acid molecules or salts thereof, or solvates thereof.
[0009] As a result of diligent research, the present inventors have discovered a nucleic acid molecule or a salt thereof, or a solvate thereof, that can inhibit the expression of thymic interstitial lymphocyte necrotizing factor (TSLP) having the characteristics described below. Specifically, the present invention is characterized by a nucleic acid molecule for inhibiting the expression of TSLP, wherein the nucleic acid molecule includes a double-stranded region formed from a sense strand and an antisense strand complementary to the sense strand, the sense strand and antisense strand each contain 19 to 23 nucleotides, the antisense strand includes a region complementary to a part of the mRNA encoding TSLP, and the nucleotides of the sense strand and antisense strand may contain at least one modified nucleotide.
[0010] The nucleic acid molecules, salts thereof, or solvates thereof that can inhibit the expression of thymic interstitial lymphocyte necrosis factor (TSLP) according to the present invention may have an ameliorative effect on diseases or symptoms in which TSLP is suspected to be involved (e.g., bronchial asthma (severe or refractory asthma)) because they can inhibit TSLP expression. Based on this finding, the inventors have completed the present invention.
[0011] The present invention relates to a nucleic acid molecule or salt thereof, or a solvate thereof, that can inhibit the expression of thymic interstitial lymphocyte necrosis factor (TSLP) as shown in the following embodiments, and to a pharmaceutical composition characterized by containing one or more thereof as an active ingredient, and to pharmaceutical uses thereof, more specifically as described in [1] to [6-1] below.
[0012] [1] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand, wherein the strands form a double-stranded region, and the sense strand and the antisense strand contain nucleotide sequences selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table below. In the table, A is adenosine-3'-phosphate; C is cytidine-3'-phosphate; G is guanosine-3'-phosphate; U is uridine-3'-phosphate; dA is 2'-deoxyadenosine-3'-phosphate; dC is 2'-deoxycytidine-3'-phosphate; dG is 2'-deoxyguanosine-3'-phosphate; dT or dt is thymidine-3'-phosphate.
[0013] [1-1] A nucleic acid molecule or a salt thereof according to embodiment [1], wherein the sense strand comprises 19 to 21 nucleotides in length and the antisense strand comprises 19 to 23 nucleotides in length.
[0014] [1-2] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-1], wherein the sense strand and the antisense strand include nucleotide sequences selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table below. The letters of the nucleotide sequences in the table have the same definition as in embodiment [1].
[0015] [1-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-1], wherein the sense strand and the antisense strand are nucleotide sequences selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table described in embodiment [1-2].
[0016] [1-4] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-3], wherein the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (Sequence ID 1 shows the nucleic acid sequence of human TSLP mRNA; hereinafter simply referred to as "Sequence ID 1"). [1-4-1] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-3], wherein the nucleic acid base sequence of the antisense strand has at least about 90% complementarity with the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (Sequence ID 1). [1-4-2] A nucleic acid molecule or a salt thereof according to any one of embodiments [1] to [1-3], wherein the nucleic acid base sequence of the antisense strand has 100% complementarity with the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (Sequence ID 1). [1-4-3] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-4] to [1-4-2], wherein the region of the antisense strand that is complementary to the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (Sequence ID 1) is 19 to 23 nucleotides long.
[0017] [1-5] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 19 to 21 nucleotides in length, and the antisense strand comprises 19 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand, counting from the 5' position of the mRNA encoding TSLP (SEQ ID NO: 1), is 257, 260, 261, 264, 265, 268, 272, 308, 312, 314, 315, 316, 317, 320, 326, 330, 399, 402, 403, 404, 406, 407 A nucleic acid molecule or a salt thereof, or a solvate thereof, having at least about 80% complementarity to the nucleic acid base sequence portion starting from 408, 409, 410, 413, 414, 415, 417, 418, 419, 420, 444, 498, 501, 502, 504, 505, 506, 507, 508, 509, 510, 511, 514, 517, 521, 523, 525, 528, 529, 564, 566, 568, 575, 576, 579, 580, 582, 586, 587, 588, 589, 591, 592, 609, or 613.
[0018] [1-5A] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 19 to 21 nucleotides in length, and the antisense strand comprises 19 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand, counting from the 5' position of the mRNA encoding TSLP (SEQ ID NO: 1), is 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 266, 267, 268, 269, 270, 271, 273, 274, 308, 310, 311, 312, 31 A nucleic acid molecule or a salt thereof, or a solvate thereof, having at least about 80% complementarity to the nucleic acid base sequence portion beginning at position 3, 314, 316, 317, 318, 319, 320, 321, 323, 324, 327, 328, 329, 330, 401, 403, 409, 416, 440, 441, 499, 501, 502, 503, 504, 512, 513, 524, 525, 526, 527, 528, 534, 561, 565, 567, 573, 574, 575, 576, 577, 578, 582, 590, 610, 611, or 765.
[0019] [1-5-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 19 to 21 nucleotides in length, the antisense strand comprises 19 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the nucleic acid base sequence portion of mRNA encoding the TSLP shown below (SEQ ID NO: 1). Nucleic acid base sequence portion of Sequence ID No. 1: 257-279, 260-278, 261-279, 264-282, 265-283, 265-287, 268-286, 272-294, 308-330, 312-330, 314-332, 314-336, 315-333, 316-338, 317-339, 320-338, 326-34 8, 330-348, 399-421, 402-420, 403-421, 403-425, 404-422, 406-424, 407-425, 408-426, 409-431, 410-432, 413-431, 414-432, 415-433, 415-437, 417-435, 418-436, 419-437, 420-4 38, 444-462, 498-520, 501-523, 502-520, 504-526, 505-523, 506-524, 507-525, 507-529, 508-526, 509-527, 510-528, 511-529, 514-532, 517-539, 521-539, 523-541, 525-547, 528 ~546, 529~547, 564~586, 566~584, 568~586, 575~597, 576~598, 579~597, 580~598, 582~604, 586~604, 587~605, 587~609, 588~606, 589~607, 591~609, 592~610, 609~631, or 613~631.
[0020] [1-5-1A] A nucleic acid molecule or a salt thereof, or a solvate thereof, comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises 19 to 21 nucleotides in length, the antisense strand comprises 19 to 23 nucleotides in length, and the nucleic acid base sequence of the antisense strand has at least about 80% complementarity with the nucleic acid base sequence portion of mRNA encoding the TSLP shown below (SEQ ID NO: 1). Nucleic acid base sequence portion of Sequence ID No. 1: 254-276, 256-278, 257-279, 258-279, 258-280, 259-277, 259-279, 260-282, 261-283, 262-284, 263-281, 264-286, 266-284, 266-288, 267-285, 267-289, 268-290, 269-291, 270-292, 271- 293, 273-295, 274-296, 308-330, 310-332, 311-333, 312-334, 313-331, 313-335, 314-336, 316-338, 317-339, 318-340, 319-337, 319-341, 320-342, 321-343, 323-345, 324-346, 327-349, 328-346, 328-350, 329-347, 329-351, 330-348, 330-352, 401-419, 403-421, 409-427, 409-431, 416-434, 440-462, 441-463, 499-521, 501-519, 502-520, 502-524, 503-521, 503-525, 504-522, 512-530, 513-531, 524-542, 525- 543, 526-544, 526-548, 527-545, 527-549, 528-550, 534-552, 561-579, 565-583, 567-585, 573-591, 574-592, 575-593, 576-594, 577-595, 577-599, 578-596, 582-604, 590-608, 610-632, 611-633, or 765-783.
[0021] [1-5-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-5] to [1-5-1A], wherein the nucleic acid base sequence of the antisense strand has at least about 90% complementarity with the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (Sequence ID 1). [1-5-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-5] to [1-5-1A], wherein the nucleic acid base sequence of the antisense strand has 100% complementarity with the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (Sequence ID 1). [1-5-4] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-5] to [1-5-3], wherein the antisense strand region complementary to the isolength portion of the mRNA encoding thymic interstitial lymphocyte necrosis factor (TSLP) (Sequence ID 1) is 19 to 22 nucleotides long. [1-5-5] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-5] to [1-5-3], wherein the antisense strand region complementary to the isolength portion of the mRNA encoding thymic interstitial lymphocyte necrosis factor (TSLP) (Sequence ID 1) is 19 to 21 nucleotides long.
[0022] [1-6] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 1 to 8 nucleotides in length at its 5' end and / or 3' end. [1-6-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 1 to 3 nucleotides in length at its 5' end and / or 3' end. [1-6-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein at least one of the sense strand and the antisense strand has an overhang (protrusion) consisting of a single strand of 2 nucleotides in length at its 5' end and / or 3' end. [1-6-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1] to [1-5-5], wherein the 5' end and / or 3' end overhangs (protrusions) are stabilized against decomposition.
[0023] [1-7] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein at least one of the sense strand and the antisense strand contains at least one modified nucleotide. [1-7-1] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein substantially all of the nucleotides of the sense strand contain a modified nucleotide. [1-7-2] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein substantially all of the nucleotides of the antisense strand contain a modified nucleotide. [1-7-3] A nucleic acid molecule or salt thereof according to any one of embodiments [1] to [1-6-3], or a solvate thereof, wherein substantially all of the nucleotides of the sense strand and the antisense strand contain a modified nucleotide. [1-7-4] A phosphate group (P(O)(OH) is attached to the hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or the antisense strand. 2) or thiophosphate group (P(S)(OH) 2 A nucleic acid molecule or a salt thereof according to any one of the embodiments [1] to [1-6-3], comprising a nucleotide substituted with ).
[0024] [1-8] The modified nucleotide is a 2'-deoxynucleotide, a 2'-O-alkyl modified nucleotide (2'-O-methyl(2'-OMe) modified nucleotide, 2'-O-C 16 H 33 Modified nucleotides, etc.), 2'-OCH 2 CH 2 OCH 3 A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-7-4], comprising modification of one or more sugar groups selected from the group consisting of (2'-OMOE) modified nucleotides, 2'-deoxy-2'-fluoro(2'-F) modified nucleotides, 2'-deoxy-2'-NHAc(2'-NHAc) modified nucleotides, cross-linked nucleotides (e.g., LNA), acyclic nucleotides (e.g., selinol nucleic acid), and debasalized nucleotides.
[0025] [1-9] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of embodiments [1-7] to [1-8], wherein the modified nucleotide includes modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds, phosphorodithioate bonds, and boranophosphate bonds. [1-9-1] A nucleic acid molecule or salt thereof, or a solvate thereof, according to embodiment [1-9], wherein the modified nucleotide includes modification of an internucleoside bond which is a phosphorothioate bond or a phosphorodithioate bond.
[0026] [1-9-2] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond or phosphorodithioate bond at its 5' end. [1-9-3] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond or phosphorodithioate bond at its 3' end. [1-9-4] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the sense strand and the antisense strand contain at least one phosphorothioate bond or phosphorodithioate bond at their 5' and 3' ends. [1-9-5] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the sense chain and the antisense chain each contain two phosphorothioate bonds at their 5' and 3' ends.
[0027] [1-9-6] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein at least one of the sense strand and the antisense strand contains at least one phosphorodithioate bond at its 5' end. [1-9-7] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein at least one of the sense strand and the antisense strand contains at least one phosphorodithioate bond at its 3' end. [1-9-8] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the sense strand contains two phosphorodithioate bonds at its 3' end. [1-9-9] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], comprising two phosphorothioate bonds at the 3' end of the antisense chain, or a solvate thereof. [1-9-10] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], comprising two phosphorothioate bonds at the 5' end of the sense chain and two phosphorothioate bonds at the 3' end.
[0028] [1-9-11] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the antisense chain contains two phosphorothioate bonds at its 5' end and two phosphorodithioate bonds at its 3' end. [1-9-12] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the antisense chain contains one phosphorothioate bond and one phosphorodithioate bond at its 5' end and two phosphorothioate bonds at its 3' end. [1-9-13] A nucleic acid molecule or a salt thereof according to any one of embodiments [1-7] to [1-9-1], wherein the antisense chain contains two phosphorothioate bonds at its 5' end and one phosphorothioate bond and one phosphorodithioate bond at its 3' end.
[0029] [1-10] The modified nucleotide includes a modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotide, 2'-O-methyl (2'-OMe) modified nucleotide, and 2'-deoxy-fluoro (2'-F) modified nucleotide, and further includes a modification of the internucleoside bond, which is a phosphorothioate bond, at least one at each of the 5'-end and 3'-end of the sense strand and / or the antisense strand. The nucleic acid molecule or its salt according to any one of the above aspects [1-7] to [1-9-5], or their solvate.
[0030] [1-10-1] The modified nucleotide includes a modification of one or more sugar groups selected from the group consisting of 2'-deoxynucleotide, 2'-O-methyl (2'-OMe) modified nucleotide, 2'-O-C 16 H 33 modified nucleotide, 2'-OCH 2 CH 2 OCH 3 (2'-OMOE) modified nucleotide, 2'-deoxy-fluoro (2'-F) modified nucleotide, 2'-deoxy-2'-NHAc (2'-NHAc) modified nucleotide, bridged nucleotide (for example, LNA, etc.), acyclic nucleotide (for example, serinol nucleic acid, etc.), and abasic nucleotide, and further includes a modification of the internucleoside bond, which is a phosphorothioate bond or a phosphorodithioate bond, at least one at each of the 5'-end and 3'-end of the sense strand and / or the antisense strand. The nucleic acid molecule or its salt according to any one of the above aspects [1-7] to [1-9-13], or their solvate.
[0031] [1-11] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-10-1], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table below. In the nucleotide sequences in the table, A is adenosine-3'-phosphate; C is cytidine-3'-phosphate; G is guanosine-3'-phosphate; U is uridine-3'-phosphate; dA or a is 2'-deoxyadenosine -3'-phosphate; dC is 2'-deoxycytidine-3'-phosphate; dG or g is 2'-deoxyguanosine-3'-phosphate; dT or dt or t is thymidine-3'-phosphate; Am is 2'-O-methyladenosine-3'-phosphate; Cm is 2'-O-methylcytidine-3'-phosphate; Gm is 2'-O-methylguanosine-3'-phosphate; Um is 2'-O-methyluridine- 3'-phosphate; Af is 2'-deoxy-2'-fluoroadenosine-3'-phosphate; Cf is 2'-deoxy-2'-fluorocytidine-3'-phosphate; Gf is 2'-deoxy-2'-fluoroguanosine-3'-phosphate; Uf is 2'-deoxy-2'-fluorouridine-3'-phosphate; inVAb is inverted debasic deoxyribose (inverted non-base nucleotide); T(MOE) is 2'-O-CH 2 CH 2 OCH 3 -Thymidine-3'-phosphate; A(C16) is 2'-O-C 16 H 33 -Adenosine-3'-phosphate; A(LNA) is (2'-O-CH 2 -4')-adenosine-3'-phosphate; T(LNA) is (2'-O-CH 2 -4')-thymidine-3'-phosphate; 5mC(LNA) is (2'-O-CH 2 -4')-5-methylcytosine-3'-phosphate; U(NAcVp) is 2'-deoxy-2'-NHAc-uridine-3'-phosphate-4'-vinyl phosphate; C(SNA) is an acyclic nucleotide represented by the following formula (serinol nucleic acid (SNA): [The formula includes the phosphodiester bond between nucleosides] (when the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula, and when the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); A (SNA) is an acyclic nucleotide (serinol nucleic acid) represented by the following formula: [The formula includes the phosphodiester bond between nucleosides] (When the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula; when the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); T(SNA) is an acyclic nucleotide (serinol nucleic acid) represented by the following formula: [The formula includes the phosphodiester bond between nucleosides] (If the substitution is at the 5' end of the sequence, a hydroxyl group is substituted at position 1 in the formula; if the substitution is at the 3' end, a hydroxyl group is substituted at position 3 in the formula); = represents a phosphorothioate bond (5'-3' bond); ¥ represents a phosphorodithioate bond (5'-3' bond); p represents a phosphate residue (-P(O)(OH) 2 ); p = thiophosphate residue (-P(S)(OH) 2 This indicates that, in nucleic acid sequence notation, when there is no "=" or "¥" between two adjacent nucleosides, the nucleoside bond (5'-3' bond) between those two nucleosides is a phosphodiester bond.
[0032] [1-11-1] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-10-1], wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from the combinations indicated by the identification numbers in the table below. The letters of the nucleotide sequences in the table have the same definition as in embodiment [1-11].
[0033] [1-11-2] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1-7] to [1-10-1], wherein the sense strand and the antisense strand are modified nucleotide sequences selected from combinations of sense strands and antisense strands indicated by the identification numbers in the table described in embodiment [1-11-1].
[0034] [1-11-3] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of embodiments [1-7] to [1-11-2], wherein a functional molecule is bound to the sense chain. [1-11-4] A nucleic acid molecule or a salt thereof, or a solvate thereof, according to embodiment [1-11-3], wherein the functional molecule is selected from lipids, proteins, peptides, antibodies, glycans, low molecular weight compounds, etc.
[0035] [1-12] A nucleic acid molecule or salt thereof according to any one of the embodiments [1] to [1-11-4], or a solvate thereof, which inhibits the expression of thymic interstitial lymphocyte necrosis factor (TSLP). [1-12-1] Inhibition rate IC of thymic interstitial lymphocyte necrosis factor (TSLP) expression 50 However, 0 < IC 50 [1-12-2] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-11-4], wherein the concentration is ≤ approximately 1000 pM. [1-12-2] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-11-4], wherein the inhibition rate of thymic stromal lymphocyte necrosis factor (TSLP) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more. [1-12-3] A nucleic acid molecule or salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-11-4], wherein the inhibition rate of thymic stromal lymphocyte necrosis factor (TSLP) expression is approximately 80% or more, approximately 90% or more, or approximately 95% or more. [1-12-4] The inhibition rate of thymic interstitial lymphocyte necrosis factor (TSLP) expression is approximately 80% or higher, or the inhibition rate of TSLP expression IC 50 However, 0 < IC50 Nucleic acid molecules or salts thereof according to any one of the embodiments [1] to [1-11-4], or solvates thereof, having a concentration of approximately 1000 pM. [1-12-5] The inhibition rate of thymic interstitial lymphocyte necrosis factor (TSLP) expression is approximately 50% or more, or the inhibition rate of TSLP expression IC 50 However, 0 < IC 50 Nucleic acid molecules or salts thereof according to any one of the embodiments [1] to [1-11-4], or solvates thereof, having a concentration of approximately 1000 pM. [1-12-6] The inhibition rate of thymic interstitial lymphocyte necrosis factor (TSLP) expression is approximately 30% or more, or the inhibition rate of TSLP expression IC 50 However, 0 < IC 50 A nucleic acid molecule or a salt thereof, or a solvate thereof, according to any one of the embodiments [1] to [1-11-4], having a concentration of approximately ≤ 1000 pM.
[0036] [1-13] A nucleic acid molecule or a salt thereof according to any one of the embodiments [1] to [1-12-6], comprising one or two mismatched bases (non-complementary nucleic acid bases) at any position in the double-stranded region.
[0037] [1-14] A nucleic acid molecule or a salt thereof according to any one of the embodiments [1] to [1-13], wherein the nucleic acid molecule is siRNA.
[0038] [2] A pharmaceutical composition comprising a nucleic acid molecule or a salt thereof, or a solvate thereof, as described in any one of the embodiments [1] to [1-14], and a pharmaceutically acceptable carrier. [2-1] The pharmaceutical composition according to embodiment [2], wherein the nucleic acid molecule is siRNA.
[0039] [3] The pharmaceutical composition according to embodiment [2] or [2-1], for use in the treatment of a disease in which the involvement of thymic interstitial lymphocyte necrotizing factor (TSLP) is presumed. [3-1] The pharmaceutical composition according to embodiment [3], wherein the disease or symptom in which the involvement of thymic interstitial lymphocyte necrotizing factor (TSLP) is presumed is a disease such as bronchial asthma, chronic obstructive pulmonary disease (COPD), eosinophilic cough, sarcoidosis, pulmonary fibrosis, rhinitis, sinusitis, etc. [3-2] The pharmaceutical composition according to embodiment [3], wherein the disease in which the involvement of thymic interstitial lymphocyte necrotizing factor (TSLP) is presumed is bronchial asthma.
[0040] [4] A method for inhibiting the expression of thymic stromal lymphocyte necrosis factor (TSLP) in cells, comprising contacting the cells with a nucleic acid molecule or a salt thereof described in any one of embodiments [1] to [1-14], or a solvate thereof, or with a pharmaceutical composition described in embodiment [2] or [2-1]. [4-1] The method according to embodiment [4], wherein the nucleic acid molecule is siRNA. [4-2] The method according to embodiment [4] or [4-1], wherein the cells are present in a living organism of a subject. [4-3] The method according to embodiment [4-2], wherein the subject is a human. [4-4] The method according to any one of embodiments [4] to [4-3], wherein the inhibition rate of thymic stromal lymphocyte necrosis factor (TSLP) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more. [4-5] Inhibition rate of thymic interstitial lymphocyte neogenesis factor (TSLP) expression IC 50 However, 0 < IC 50 The method according to any one of the embodiments [4] to [4-3], wherein the concentration is ≤ approximately 1000 pM.
[0041] [5] A method for inhibiting the expression of thymic interstitial lymphocyte necrotizing factor (TSLP) in a subject, comprising administering to the subject in a therapeutically effective amount a nucleic acid molecule or a salt thereof, or a solvate thereof, as described in any one of embodiments [1] to [1-14], or a pharmaceutical composition as described in embodiment [2] or [2-1]. [5-1] The method according to embodiment [5], wherein the nucleic acid molecule is siRNA. [5-2] The method according to embodiment [5] or [5-1], wherein the subject is human. [5-3] The method according to any one of embodiments [5] to [5-2], wherein the inhibition rate of thymic interstitial lymphocyte necrotizing factor (TSLP) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more. [5-4] Inhibition rate of thymic interstitial lymphocyte neogenesis factor (TSLP) expression IC 50 However, 0 < IC 50 The method according to any one of the embodiments [5] to [5-2], wherein the concentration is ≤ approximately 1000 pM.
[0042] [6] A method for treating a subject suffering from a disease involving thymic interstitial lymphocyte necrosis factor (TSLP), comprising administering to the subject a therapeutically effective amount of a nucleic acid molecule or salt thereof, or a solvate thereof, as described in any one of embodiments [1] to [1-14], or a pharmaceutical composition as described in embodiment [2] or [2-1]. [6-1] The method according to embodiment [6], wherein the nucleic acid molecule is siRNA. [6-2] The method according to embodiment [6] or [6-1], wherein the subject is a human.
[0043] [7] A nucleic acid molecule comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded region, the sense strand is 21 nucleotides long, and the antisense strand is 23 nucleotides long and contains 7 to 11 2'-deoxy-2'-fluoro-modified nucleotides (2'-F modified nucleotides). [7-1] The nucleic acid molecule according to embodiment [7], wherein the antisense strand contains 7 to 10, 7 to 9, 7 to 8, or 7 2'-F modified nucleotides. [7-2] The nucleic acid molecule according to embodiment [7], wherein the 1st and 21st positions of the sense strand and the 21st and 1st positions of the antisense strand are complementary, respectively.
[0044] [8] The nucleic acid molecule according to embodiment [7], wherein the sense strand contains five 2'-F modified nucleotides. [8-1] The nucleic acid molecule according to embodiment [8], wherein the sense strand contains 2'-F modified nucleotides at positions 9, 10, 11 and 15 in the 5'→3' direction of its sequence.
[0045] [9] The nucleic acid molecule according to embodiment [7], wherein the sense strand comprises five 2'-F modified nucleotides and sixteen 2'-O-methyl (2'OMe) modified nucleotides (2'-OMe modified nucleotides). [9-1] The nucleic acid molecule according to embodiment [9], wherein the sense strand comprises 2'-F modified nucleotides at positions 9, 10, 11 and 15 in the 5'→3' direction of its sequence.
[0046]
[10] The nucleic acid molecule according to embodiment [7], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides. [10-1] The nucleic acid molecule according to embodiment [7], wherein in the sense strand, only the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [10-2] The nucleic acid molecule according to embodiment [7], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides.
[0047]
[11] The nucleic acid molecule according to embodiment [7], wherein the antisense chain comprises 2 to 16 2'-OMe modified nucleotides.
[0048]
[12] The nucleic acid molecule according to embodiment [7], wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and any nucleotide at positions 4, 8, 9, 10, 12, 18, 20 or 22 may also be 2'-F modified nucleotides, and the antisense strand contains 7 to 11 2'-F modified nucleotides. [12-1] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and two or more nucleotides selected from positions 4, 8, 9, 10 and 12 include 2'-F modified nucleotides.
[0049] [12-2-1] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and three or more nucleotides selected from positions 4, 8, 9, 10 and 12 include 2'-F modified nucleotides, and the antisense strand contains 7 to 10 2'-F modified nucleotides. [12-2-2] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and three nucleotides selected from positions 4, 8, 9, 10 and 12 include 2'-F modified nucleotides, and the antisense strand contains 7 2'-F modified nucleotides.
[0050] [12-3-1] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [12-3-2] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [12-3-3] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0051] [12-3-4] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [12-3-5] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0052] [12-3-6] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [12-3-7] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [12-3-8] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0053] [12-4-1] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [12-4-2] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0054] [12-4-3] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense chain, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [12-4-4] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0055] [12-4-5] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [12-4-6] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0056] [12-4-7] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [12-4-8] The nucleic acid molecule according to embodiment
[12] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0057] [12-4-9] The nucleic acid molecule according to any one of embodiments [12-4-1] to [12-4-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense strand contains a nucleotide other than a 2'-F modified nucleotide. [12-4-10] The nucleic acid molecule according to any one of embodiments [12-4-1] to [12-4-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense strand contains a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT or dt).
[0058] [12-4-11] The nucleic acid molecule according to any one of embodiments [12-4-1] to [12-4-8], wherein the antisense chain further comprises a 5' phosphorus-stabilizing moiety at the 5' end. [12-4-12] The nucleic acid molecule according to embodiment [12-4-11], wherein the 5' phosphorus-stabilizing moiety is a 5'-vinylphosphonate-modified nucleotide.
[0059]
[13] The nucleic acid molecule according to embodiment [7], wherein the antisense strand contains a nucleotide at position 7 in the 5'→3' direction of its sequence that is a 2'-OMe modified nucleotide, and the sense strand contains a 2'-F modified nucleotide complementary to the nucleotide at position 7 in the 5'→3' direction of the sequence of the antisense strand. [13-1] The nucleic acid molecule according to embodiment
[13] , wherein the antisense strand contains a nucleotide at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence that is a 2'-F modified nucleotide, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 contain a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group.
[0060] [13-2] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-3] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0061] [13-4] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-5] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense chain, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0062] [13-6] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-7] The nucleic acid molecule according to embodiment
[13] , wherein the antisense chain contains nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 contain nucleotides with 2'-OMe modification, and 0 to 3 of the 2'-OMe modification nucleotides may contain nucleotides in which the 2' position is modified with any group.
[0063] [13-8] The nucleic acid molecule according to embodiment
[13] , wherein in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [13-9] The nucleic acid molecule according to any one of embodiments [13-1] to [13-8], wherein in the antisense strand, the nucleotide at position 1 in the 5'→3' direction of its sequence includes a nucleotide other than a 2'-F modified nucleotide.
[0064] [13-10] The nucleic acid molecule according to any one of embodiments [13-1] to [13-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain comprises a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT or dt). [13-11] The nucleic acid molecule according to any one of embodiments [13-1] to [13-8], wherein the antisense chain further comprises a 5'-phosphorus stabilizing moiety at the 5' end. [13-12] The nucleic acid molecule according to embodiment [13-11], wherein the 5'-phosphorus stabilizing moiety is a 5'-vinylphosphonate modified nucleotide.
[0065]
[14] The nucleic acid molecule according to embodiment [7], wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and any nucleotide at positions 4, 8-10, 12, 18, 20 or 22 may be a 2'-F modified nucleotide, and the antisense strand contains 7 to 11 2'-F modified nucleotides. [14-1-1] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0066] [14-1-2] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [14-1-3] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0067] [14-1-4] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [14-1-5] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0068] [14-1-6] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [14-1-7] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0069] [14-1-8] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OMe modified nucleotides, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0070] [14-2-1] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-2-2] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0071] [14-2-3] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-2-4] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0072] [14-2-5] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-2-6] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0073] [14-2-7] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [14-2-8] The nucleic acid molecule according to embodiment
[14] , wherein in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0074] [14-2-9] The nucleic acid molecule according to any one of embodiments [14-2-1] to [14-2-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain includes a nucleotide other than a 2'-F modified nucleotide. [14-2-10] The nucleic acid molecule according to any one of embodiments [14-2-1] to [14-2-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain includes a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT or dt). [14-2-11] The nucleic acid molecule according to any one of embodiments [14-2-1] to [14-2-8], wherein the antisense chain further includes a 5'-phosphorus stabilizing moiety at the 5' end. [14-2-12] The nucleic acid molecule according to embodiment [14-2-11], wherein the 5'-phosphorus stabilizing portion is a 5'-vinylphosphonate modified nucleotide.
[0075]
[15] The sense strand is arranged in order from the 3' side to the 5' side of the sense strand as 3'-A-B-C-D-E-F-G-H-I-5' and comprises a nucleotide unit consisting of: 2'-F modified nucleotide A; three consecutive 2'-OMe modified nucleotides B to D; three consecutive 2'-F modified nucleotides E to G; 2'-OMe modified nucleotide H; and 2'-F modified nucleotide I; the antisense strand comprises: a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide A; a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide E; a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide G; a 2'-F modified nucleotide complementary to 2'-OMe modified nucleotide H; and a 2'-OMe modified nucleotide complementary to 2'-F modified nucleotide I; The nucleic acid molecule according to embodiment [7], wherein the sense strand and the antisense strand may each independently contain nucleotides whose 2' position is modified with any group instead of 0 to 3 2'-OMe modified nucleotides. [15-1] The nucleic acid molecule according to embodiment
[15] , wherein the antisense strand contains a 2'-F modified nucleotide that complements the 2'-F modified nucleotide F of the sense strand.
[0076]
[16] The nucleic acid molecule according to embodiment [7], wherein the antisense chain includes alternating units in which 2'-F modified nucleotides and 2'-OMe modified nucleotides are arranged alternately, and three or more of the alternating units are arranged consecutively, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0077]
[17] The nucleic acid molecule according to embodiment [7], wherein the antisense strand, in the 5'→3' direction of its sequence, contains alternating repeats of 2'-F modified nucleotides and 2'-OMe modified nucleotides at positions 12 to 21, contains a 2'-F modified nucleotide or a 2'-OMe modified nucleotide at position 22, contains a 2'-OMe modified nucleotide at position 23, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides whose 2' position is modified with any group, and positions 22 and 23 are overhang regions.
[0078] [18-1] The nucleic acid molecule according to embodiment [7], wherein the sense strand and the antisense strand each contain one or more, two or more, four or more, or four phosphorothioate bonds. [18-2] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence.
[0079] [19-1] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [19-2] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0080] [19-3] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [19-4] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0081] [19-5] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [19-6] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0082] [19-7] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides. [19-8] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the antisense strand, only the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence contain 2'-F modified nucleotides, and the other nucleotides do not contain 2'-F modified nucleotides.
[0083] [20-1] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-O A nucleic acid molecule according to embodiment [7], comprising a Me-modified nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence comprise a 2'-F modified nucleotide, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 comprise a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may comprise nucleotides in which the 2' position is modified with any group. [20-2] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides. A nucleic acid molecule according to embodiment [7], comprising a decorative nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0084] [20-3] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'-OM modified nucleotides. The nucleic acid molecule according to embodiment [7], comprising an e-modified nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence contain a 2'-F modified nucleotide, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 contain a 2'-OMe modified nucleotide, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group. [20-4] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence contain 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 contain 2'- A nucleic acid molecule according to embodiment [7], comprising an OMe-modified nucleotide, wherein in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence comprise a 2'-F-modified nucleotide, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 comprise a 2'-OMe-modified nucleotide, and 0 to 3 of the 2'-OMe-modified nucleotides may comprise nucleotides in which the 2' position is modified with any group.
[0085] [20-5] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides. The nucleic acid molecule according to embodiment [7], wherein the antisense strand comprises nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, and 22 in the 5'→3' direction of its sequence, and nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group. [20-6] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleos A nucleic acid molecule according to embodiment [7], comprising nucleotides, wherein in the antisense chain, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group.
[0086] [20-7] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides. A nucleic acid molecule according to embodiment [7], comprising an ocide, wherein in the antisense chain, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides in which the 2' position is modified with any group. [20-8] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides A nucleic acid molecule according to embodiment [7], comprising a creotide, wherein the antisense chain contains 2'-F modified nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of its sequence, and 2'-OMe modified nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21, and 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides in which the 2' position is modified with any group.
[0087] [20-8-1] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 8-9, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides. [20-8-2] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14, 16 and 18 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11-13, 15, 17 and 19-23 include 2'-OMe modified nucleotides.
[0088] [20-8-3] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 12, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7-8, 11, 13, 15 and 17-23 include 2'-OMe modified nucleotides. [20-8-4] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 9-10, 14 and 16 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3-5, 7, 11-13, 15 and 17-23 include 2'-OMe modified nucleotides.
[0089] [20-8-5] In the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and 1-6, 8, 12-14 and 1 The nucleic acid molecule according to embodiment [7], wherein the nucleotides at positions 6 to 21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides. [20-8-6] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18, 20 and 22 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19, 21 and 23 include 2'-OMe modified nucleotides.
[0090] [20-8-7] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides. [20-8-8] The nucleic acid molecule according to embodiment [7], wherein in the sense strand and antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence, and in the sense strand, the nucleotides at positions 7, 9, 10, 11 and 15 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 1-6, 8, 12-14 and 16-21 include 2'-OMe modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 4, 6, 12, 14, 16, 18 and 20 in the 5'→3' direction of the sequence include 2'-F modified nucleotides, and the nucleotides at positions 3, 5, 7-10, 11, 13, 15, 17, 19 and 21 include 2'-OMe modified nucleotides.
[0091] [20-9] The nucleic acid molecule according to any one of embodiments [20-1] to [20-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a nucleotide other than a 2'-F modified nucleotide. [20-10] The nucleic acid molecule according to any one of embodiments [20-1] to [20-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain contains a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT or dt).
[0092] [20-10-1] The nucleic acid molecule according to any one of embodiments [20-8-1] to [20-8-8], wherein the nucleotide at position 1 in the 5'→3' direction of the antisense chain comprises a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT or dt). [20-11] The nucleic acid molecule according to any one of embodiments [20-1] to [20-8-8], wherein the antisense chain further comprises a 5'-phosphorus stabilizing moiety at the 5' end. [20-12] The nucleic acid molecule according to embodiment [20-11], wherein the 5'-phosphorus stabilizing moiety is a 5'-vinylphosphonate modified nucleotide.
[0093]
[21] A nucleic acid molecule comprising a sense strand and an antisense strand complementary to the sense strand, wherein the sense strand includes the sequence of formula I in the 5'→3' direction of its sequence, and the antisense strand includes the sequence of formula II-(1) in the 5'→3' direction of its sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-M-3' Formula II-(1): 5'-A1-B1-C1-D1-3' In formula II-(1), A1 is represented by X-F-M-Y-M-F, B1 is represented by M-F-F-M, M-M-F-F, M-F-M-F, or M-M-M-M, and C1 is represented by M-Y-M-F-M-F D1 is represented as M-Y-M-Y-M-Y-M, where in each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, X is independently a nucleotide modified with any group, and Y is independently F or M, and 0 to 3 of the 2'-OMe modified nucleotides may include nucleotides whose 2' position is modified with any group.
[0094] [21-1] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand and the antisense strand each contain four phosphorothioate bonds. [21-2] The nucleic acid molecule according to embodiment
[21] , wherein in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence, and between nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence.
[0095]
[22] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand includes the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand includes the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F or X-F-M-F-M-F, B2 is represented as M-F-F-M, M-M-F-F, M-F-M-F, or M-M-M-M, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M, M-F-M-M-M-M-M, M-F-M-F-M-M-M, or M-F-M-F-M-F-M, where F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, and X is independently any modified nucleotide.
[0096] [22-1] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 is represented as M-F-F-M or M-M-F-F, C2 is represented as M-F-M-F-M-F or M-M-M-F-M-F, D2 is represented as M-M-M-M-M-M-M or M-F-M-M-M-M-M, in each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0097] [22-2] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-F-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0098] [22-3] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-F-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0099] [22-4] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-M-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0100] [22-5] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-F-F-M, C2 as M-M-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0101] [22-6] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-F-M-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-F-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0102] [22-7] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-F-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0103] [22-8] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-M-M-F-M-F, and D2 as M-M-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0104] [22-9] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-M-M-F, B2 as M-M-F-F, C2 as M-M-M-F-M-F, and D2 as M-F-M-M-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0105] [22-10] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 is represented as M-F-M-F or M-M-M-M, C2 is represented as M-F-M-F-M-F, D2 is represented as M-F-M-F-M-M-M or M-F-M-F-M-F-M, in each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0106] [22-11] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-M-M-M, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0107] [22-12] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-M-M-M, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-F-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0108] [22-13] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-F-M-F, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-M-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0109] [22-14] The nucleic acid molecule according to embodiment
[21] , wherein the sense strand contains the sequence of formula I in the 5'→3' direction of its sequence, the antisense strand contains the sequence of formula II-(2) in the 5'→3' direction of its sequence, the sense strand and the antisense strand each contain four phosphorothioate bonds, and in the sense strand and the antisense strand, the positions of the phosphorothioate bonds are between the nucleotides at positions 1-2 and 2-3 in the 5'→3' direction of each sequence and between the nucleotides at positions 1-2 and 2-3 in the 3'→5' direction of each sequence; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-M-F-M-M-M-M-M-3' Formula II-(2): 5'-A2-B2-C2-D2-3' In formula II-(2), A2 is represented as X-F-M-F-M-F, B2 as M-F-M-F, C2 as M-F-M-F-M-F, and D2 as M-F-M-F-M-F-M. In each of the above formulas, F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide.
[0110]
[23] The nucleic acid molecule according to
[21] wherein the sense strand includes the sequence of formula I below in the 5'→3' direction of its sequence, the antisense strand includes the sequence of formula III below in the 5'→3' direction of its sequence, the 22nd and 23rd positions being overhang regions, and the antisense strand comprises 10 or fewer 2'-OMe modified nucleotides; Formula I: 5'-M-M-M-M-M-F-M-F-F-F-M-M-F-M-M-M-M-M-M-3' Formula III: 5'-X-F-M-Y-M-F-M-Y-Y-Y-M-Y-M-F-M-F-M-Y-M-Y-M-3' In each of the above formulas, F is a 2'-F modified nucleotide, M is a 2'-OMe modified nucleotide, and X is independently any modified nucleotide. Y is independently either F or M.
[0111] [24-1] The nucleic acid molecule according to any one of embodiments
[21] to
[23] , wherein the antisense chain comprises any modified nucleotide except F. [24-2] The nucleic acid molecule according to any one of embodiments
[21] to
[23] , wherein the antisense chain comprises a 2'-OMe modified nucleotide, a 5'-vinylphosphonate modified nucleotide, a 2'-acetamide-5'-vinylphosphonate modified nucleotide, or thymidine-3'-phosphate (dT or dt).
[0112]
[25] A nucleic acid molecule comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-stranded region, the sense strand is 21 nucleotides long and contains 5 2'-F modified nucleotides, and the antisense strand is 23 nucleotides long and contains 7 to 11 2'-F modified nucleotides, wherein in the sense strand, the nucleotide at position 15 in the 5'→3' direction of its sequence is represented by F, and in the antisense strand, the nucleotide at position 7 in the 5'→3' direction of its sequence is represented by M, where F is a 2'-F modified nucleotide, and M is a 2'-OMe modified nucleotide, wherein 0 to 3 of the 2'-OMe modified nucleotides may contain nucleotides whose 2' position is modified with any group, and positions 1 and 21 of the sense strand and positions 21 and 1 of the antisense strand are complementary, respectively.
[0113] [25-1] The nucleic acid molecule according to embodiment
[25] , wherein in the antisense strand, the nucleotides at positions 6 to 8 in the 5'→3' direction of the sequence are represented as F-M-M or F-M-F. [25-2] The nucleic acid molecule according to embodiment
[25] , wherein in the sense strand, the nucleotides at positions 14 to 18 in the 5'→3' direction of the sequence are represented as M-F-M-M-M, and in the antisense strand, the nucleotides at positions 6 to 8 in the 5'→3' direction of the sequence are represented as F-M-M or F-M-F. [25-3] The nucleic acid molecule according to embodiment
[25] , wherein in the sense strand, the nucleotides at positions 13 to 20 in the 5'→3' direction of its sequence are represented as M-M-F-M-M-M-M-M, and in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of its sequence are represented as F-M-M-F-M-M-F, F-M-M-F-M-F-F, F-M-F-M-F-M-M-M, or F-M-F-M-F-M-F-M.
[0114] [25-3-1] The nucleic acid molecule according to embodiment [25-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-M-F-M-M-F, and the antisense strand contains seven 2'-F modified nucleotides. [25-3-2] The nucleic acid molecule according to embodiment [25-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-M-M-F-M-F-F, and the antisense strand contains seven 2'-F modified nucleotides.
[0115] [25-3-3] The nucleic acid molecule according to embodiment [25-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-F-M-F-M-M-M, and the antisense strand contains 8 or 9 2'-F modified nucleotides. [25-3-4] The nucleic acid molecule according to embodiment [25-3], wherein in the antisense strand, the nucleotides at positions 2 to 9 in the 5'→3' direction of the sequence are represented as F-M-F-M-F-M-F-M, and the antisense strand contains 10 or 11 2'-F modified nucleotides.
[0116] [26-1] The nucleotide modified at the 2' position with any group is independently a 2'-deoxyribonucleotide or a 2'-O-alkyl-modified nucleotide (in this embodiment, for example, the alkyl is a carbon chain C 1-18 A nucleic acid molecule according to any one of the embodiments [12-4-1] to [12-4-12], [13-1] to [13-12], [14-2-1] to [14-2-12],
[15] to [15-1],
[21] to [25-3-4], which also includes 2'-O-alkyl modified nucleotides that are alkyl groups. [26-2] A nucleic acid molecule according to any one of the embodiments [12-4-1] to [12-4-12], [13-1] to [13-12], [14-2-1] to [14-2-12],
[15] to [15-1],
[21] to [25-3-4], wherein a nucleotide modified with an arbitrary group at the 2' position is present in the sense strand.
[0117] [26-2-1] A nucleotide in the sense chain whose 2' position is modified with any group is independently a 2'-O-alkyl modified nucleotide (in this embodiment, for example, the alkyl is a carbon chain C 1-18 A nucleic acid molecule according to embodiment [26-2], which also includes a 2'-O-alkyl modified nucleotide that is an alkyl group. [26-3] A nucleic acid molecule according to any one of embodiments [12-4-1] to [12-4-12], [13-1] to [13-12], [14-2-1] to [14-2-12],
[15] to [15-1],
[21] to [25-3-4], wherein a nucleotide modified with an arbitrary group at the 2' position is present in the antisense chain.
[0118] [26-3-1] The nucleic acid molecule according to embodiment [26-3], wherein each nucleotide in the antisense chain whose 2' position is modified with an arbitrary group is independently a 2'-deoxyribonucleotide. [26-4] The nucleic acid molecule according to any one of embodiments [12-4-1] to [12-4-12], [13-1] to [13-12], [14-2-1] to [14-2-12],
[15] to [15-1],
[21] to [25-3-4], wherein there are zero nucleotides whose 2' position is modified with an arbitrary group.
[0119]
[27] A nucleic acid molecule comprising a sense strand and an antisense strand that can inhibit the expression of a target protein or target gene, wherein the sense strand is 21 nucleotides long, and the antisense strand is 21, 22, or 23 nucleotides long, the sense strand comprises a 2'-F modified nucleotide and a modified nucleotide, the 2'-F modified nucleotide being located at positions 7, 9, 10, 11, and 15 from the 5' end of the sense strand, and the modified nucleotide independently having a 2'-OR at the 2' position of the nucleotide. 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'-N 3 , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 A nucleic acid molecule comprising a nucleotide, deoxynucleotide, or cross-linked nucleotide such as LNA, which is substituted with a group selected from the group consisting of (where is alkyl).
[0120] [27-1] The nucleic acid molecule according to embodiment
[27] , wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the sense strand are 2'-O-alkyl modified nucleotides. [27-2] The nucleic acid molecule according to embodiment
[27] , wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the sense strand are 2'-OMe modified nucleotides.
[0121] [27-3] The nucleic acid molecule according to embodiment
[27] , wherein the sense strand and antisense strand have a double-stranded region with a blunt end at the 3' end of the sense strand, and when the antisense strand is 21 nucleotides long, the sequence of formula IV-(1-1) in the 5'→3' direction of the antisense strand is, when the antisense strand is 22 nucleotides long, the sequence of formula IV-(1-2) in the 5'→3' direction of the antisense strand is, and when the antisense strand is 23 nucleotides long, the sequence of formula IV-(1-3) in the 5'→3' direction of the antisense strand; formula IV-(1-1): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z'-3' Formula IV-(1-2): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'-3' Formula IV-(1-3): 5'-Z-F-Z-Z'-Z-F-Z-Z'-Z'-Z'-Z'-Z'-Z'-Z'-Z'-F-Z-F-Z-Z'-Z'-Z'-Z'-Z'-3' In each of the above formulas, F is a 2'-F modified nucleotide, Z' and Z are modified nucleotides, and Z' independently has a 2'-OR at the 2' position of the nucleotide 1 , 2'-R 1 , 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'- N 3 , 2'-CN, 2'-F, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 A modified nucleotide comprising a nucleotide, deoxynucleotide, or cross-linked nucleotide such as LNA, substituted with a group selected from the group consisting of (where is alkyl), wherein Z is independently a nucleotide whose 2' position is 2'-OR 1 , 2'-R 1, 2'-R 2 OR 1 , 2'-SH, 2'-SR 1 , 2'-NH 2 , 2'-NHR 1 , 2'-NHAc, 2'-NR 1 2 , 2'- N 3 , 2'-CN, 2'-Cl, 2'-Br, 2'-I, 2'-R 2 C (O) XR 3 (In each group, R 1 R is alkyl or aryl; 2 is an alkylene; X is an oxygen atom, NH or NR 1 And; R 3 Modified nucleotides, including nucleotides, deoxynucleotides, or cross-linked nucleotides such as LNAs, that are substituted with a group selected from the group consisting of (where is alkyl).
[0122] [27-3-1] The nucleic acid molecule according to embodiment [27-3] wherein the sense strand and antisense strand are complementary at positions 1-8, 2-8, 3-8, 4-8, 5-8, 6-8, or 7-8 from the following positional relationships: position 1 from the 3' end of the sense strand and position 1 from the 5' end of the antisense strand; position 2 from the 3' end of the sense strand and position 2 from the 5' end of the antisense strand; position 3 from the 3' end of the sense strand and position 3 from the 5' end of the antisense strand; position 4 from the 3' end of the sense strand and position 4 from the 5' end of the antisense strand; position 5 from the 3' end of the sense strand and position 5 from the 5' end of the antisense strand; position 6 from the 3' end of the sense strand and position 6 from the 5' end of the antisense strand; position 7 from the 3' end of the sense strand and position 7 from the 5' end of the antisense strand; The 3' end to position 8 of the sense strand, and the 5' end to position 8 of the antisense strand.
[0123] [27-4] The nucleic acid molecule according to embodiment [27-3], wherein the Z' at position 12 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [27-5] The nucleic acid molecule according to embodiment [27-3], wherein the Z' at positions 9 and 10 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F. [27-6] The nucleic acid molecule according to embodiment [27-3], wherein the Z' at positions 8 and 9 in the 5'→3' direction of formulas IV-(1-1) to (1-3) is F.
[0124] [27-7] The nucleic acid molecule according to embodiment [27-3], wherein Z' at the 8th, 9th, and 10th positions in the 5'→3' direction of formula IV-(1-1) to (1-3) is F. [27-8] Z' is a dehydronucleotide, or the 2' position of a nucleotide is 2'-OR 1 A nucleotide modified with a group selected from the group consisting of , and 2'-F, wherein Z is a dehydronucleotide, or the 2' position of the nucleotide is 2'-OR 1 A nucleic acid molecule according to any one of the embodiments [27-3] to [27-7], which is a nucleotide modified with
[0125] [27-9] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes a sequence represented by any one of the following formulas IV-(2-1) to (2-3) in the direction of its 5'→3': Formula IV-(2-1): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-3', Formula IV-(2-2): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(2-3): 5'-Z-F-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0126] [27-10] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(3-1) to (3-3) below in the 5'→3' direction of its sequence; Formula IV-(3-1): 5'-Z-F-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-3', Formula IV-(3-2): 5'-Z-F-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-3', Formula IV-(3-3): 5'-Z-F-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0127] [27-11] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(4-1) to (4-3) below in the 5'→3' direction of its sequence; Formula IV-(4-1): 5'-Z-F-Z-Z-Z-F-Z-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(4-2): 5'-Z-F-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-3', Formula IV-(4-3): 5'-Z-F-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0128] [27-12] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(5-1) to (5-3) below in the 5'→3' direction of its sequence; Formula IV-(5-1): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-Z-F-Z-Z-F-Z-Z-Z-Z-Z-3', Formula IV-(5-2): 5'-Z-F-Z-Z-Z-Z-F-Z-F-Z-F-Z-Z-F-Z-Z-Z-Z-Z-Z-Z-3', Formula IV-(5-3): 5'-Z-F-Z-Z-Z-F-Z-F-F-Z-F-Z-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0129] [27-13] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(6-1) to (6-3) below in the 5'→3' direction of its sequence; Formula IV-(6-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(6-2): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(6-3): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0130] [27-14] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(7-1) to (7-3) below in the 5'→3' direction of its sequence; Formula IV-(7-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(7-2): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(7-3): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-F-Z-F-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0131] [27-15] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(8-1) to (8-3) below in the 5'→3' direction of its sequence; Formula IV-(8-1): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(8-2): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-3', Formula IV-(8-3): 5'-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-F-Z-Z-F-Z-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0132] [27-16] The nucleic acid molecule according to any one of the embodiments [27-3] to [27-8], wherein the antisense chain includes the sequence of formulas IV-(9-1) to (9-3) below in the 5'→3' direction of its sequence; Formula IV-(9-1): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-Z-F-Z-F-Z-3', Formula IV-(9-2): 5'-Z-F-Z-F-Z-F-Z-Z-Z-Z-Z-Z-F-Z-Z-F-Z-Z-F-Z-Z-3', Formula IV-(9-3): 5'-Z-F-Z-F-Z-Z-Z-Z-Z-Z-Z-Z-Z-F-Z-F-Z-Z-F-Z-Z-3'. The definitions of Z and F in the above format are the same as the definitions in the above embodiment [27-3].
[0133] [27-16-1] The nucleic acid molecule according to any one of embodiments [27-3] to [27-8], wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the antisense chain are 2'-O-alkyl modified nucleotides. [27-16-2] The nucleic acid molecule according to any one of embodiments [27-3] to [27-8], wherein at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of the modified nucleotides of the antisense chain are 2'-OMe modified nucleotides.
[0134] [27-17] The nucleic acid molecule according to any one of embodiments
[27] to [27-16-2], wherein the modified nucleotide comprises modification of one or more internucleoside bonds selected from the group consisting of phosphorothioate bonds and phosphorodithioate bonds. [27-18] A phosphate group (P(O)(OH)) is attached to the hydroxyl groups at the 3' and / or 5' positions of the nucleotides at the 3' and / or 5' ends of the sense strand and / or antisense strand. 2 ) or thiophosphate group (P(S)(OH) 2 A nucleic acid molecule according to any one of the embodiments
[27] to [27-17], comprising a nucleotide in which ) is substituted.
[0135] [27-19] A nucleic acid molecule according to any one of embodiments
[27] to [27-18], wherein the nucleotide at position 1 from the 5' and / or 3' end of the sense strand and / or antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamide-5'-vinylphosphonate-modified nucleotide, or a thymidine-3'-phosphate (dT, dt, or t). [27-20] A nucleic acid molecule according to any one of embodiments
[27] to [27-19], wherein a functional molecule, a debasalized nucleotide (inVAb), a nucleotide, a modified nucleotide, or a combination thereof is bound to the nucleotide at the 5' or 3' end of the sense strand and / or antisense strand.
[0136] [27-20-1] A nucleic acid molecule in which one or two functional molecules are bound to the nucleotides at the 5' and / or 3' ends of the antisense strand of the nucleic acid molecule according to any one of the embodiments
[27] to [27-19]. [27-20-1-2] A nucleic acid molecule in which one or two functional molecules are bound to the nucleotides at the 5' and / or 3' ends of the sense strand of the nucleic acid molecule according to any one of the embodiments
[27] to [27-19]. [27-20-2] A nucleic acid molecule in which one to ten, one to eight, one to five, one to four, one to three, one to two, or one debasalized nucleotide is bound to the nucleotides at the 5' and / or 3' ends of the sense strand and / or antisense strand of the nucleic acid molecule according to any one of the embodiments
[27] to [27-19].
[0137] [27-20-3] A nucleic acid molecule in which 1 to 10, 1 to 8, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 nucleotide is bound to the nucleotide at the 5'-end and / or 3'-end of the sense strand and / or the antisense strand of the nucleic acid molecule according to any one of the above aspects
[27] to [27-19]. [27-20-4] A nucleic acid molecule in which 1 to 10, 1 to 8, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 modified nucleotide is bound to the nucleotide at the 5'-end and / or 3'-end of the sense strand and / or the antisense strand of the nucleic acid molecule according to any one of the above aspects
[27] to [27-19]. [27-20-4-1] The nucleic acid molecule according to any one of the above aspects [27-20] to [27-20-4], wherein the sense strand and / or the antisense strand contains a modification of one or more internucleoside linkages selected from the group consisting of phosphorothioate linkages and phosphorodithioate linkages.
[0138] [27-20-4-2] A nucleic acid molecule according to any one of the above aspects [27-20] to [27-20-4-1], wherein the hydroxyl group at the 3'-position and / or 5'-position of the nucleotide at the 3'-end and / or 5'-end of the sense strand and / or the antisense strand is substituted with a phosphate group (P(O)(OH) 2 ) or a thiophosphate group (P(S)(OH) 2 ). [27-20-4-3] A nucleic acid molecule according to any one of the above aspects [27-20] to [27-20-4-2], wherein the nucleotide at the 1st position from the 5'-end and / or 3'-end of the sense strand and / or the antisense strand is a deoxynucleotide, a 5'-vinylphosphonate-modified nucleotide, a 2'-acetamido-5'-vinylphosphonate-modified nucleotide, or thymidine-3'-phosphate (dT or dt or t).
[0139]
[28] A nucleic acid molecule according to any one of the above aspects [7] to [27-20-4-3] that inhibits the expression of thymic stromal lymphopoietin (TSLP). [28-1] The inhibition rate IC 50 of the expression of thymic stromal lymphopoietin (TSLP) is such that 0 < IC 50A nucleic acid molecule according to any one of the embodiments [7] to [27-20-4-3], wherein the concentration is ≤ approximately 1000 pM. [28-2] A nucleic acid molecule according to any one of the embodiments [7] to [27-20-4-3], wherein the inhibition rate of thymic interstitial lymphocyte neogenesis factor (TSLP) expression is approximately 30% or more, approximately 40% or more, approximately 50% or more, approximately 60% or more, approximately 70% or more, approximately 80% or more, approximately 90% or more, or approximately 95% or more.
[0140]
[29] A nucleic acid molecule according to any one of embodiments [7] to [28-2], wherein the nucleic acid molecule is siRNA.
[30] A nucleic acid molecule or a salt of siRNA according to any one of embodiments [7] to
[29] , or a solvate thereof.
[31] A pharmaceutical composition comprising a nucleic acid molecule or siRNA according to any one of embodiments [7] to
[30] , or a salt thereof, or a solvate thereof, and a pharmaceutically acceptable carrier.
[0141] The present invention provides nucleic acid molecules or salts thereof that can inhibit the expression of thymic interstitial lymphocyte necrotizing factor (TSLP), or solvates thereof, and pharmaceutical compositions containing one or more thereof. Furthermore, nucleic acid molecules or pharmaceutically acceptable salts thereof that can inhibit the expression of TSLP contain a region complementary to a part of the gene (mRNA) encoding TSLP, and by inhibiting the expression of TSLP in conjunction with the gene, they have the effect of preventing and / or treating diseases or symptoms in which the involvement of thymic interstitial lymphocyte necrotizing factor is suspected.
[0142] By using the nucleic acid molecule of the present invention, it becomes possible to target genes involved in TSLP expression in mammals and degrade those genes. In in vitro tests of the nucleic acid molecule shown in the examples described below, it was demonstrated that the nucleic acid molecule of the present invention that can inhibit TSLP expression significantly inhibits TSLP mRNA expression (in other words, TSLP expression). Therefore, the nucleic acid molecule of the present invention that can inhibit TSLP expression is a useful nucleic acid molecule for the prevention or treatment of diseases or symptoms in which thymic interstitial lymphocyte necrotizing factor is suspected to be involved, such as bronchial asthma (severe or refractory asthma). Embodiments for carrying out the present invention
[0143] The embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described below, and can be implemented in any form without departing from the spirit of the invention. Furthermore, preferred and more preferred embodiments exemplified below can be combined with each other as appropriate, regardless of expressions such as "for example," "preferred," and "more preferred." In addition, the numerical ranges are described as examples, and the upper or lower limits of each range can be combined with the numerical values described in the examples as appropriate.
[0144] Definitions: "Nucleic acid" refers to a molecule composed of monomeric nucleotides. "Nucleic acid molecule" is not particularly limited, but may include, for example, oligonucleotides, ASOs, siRNA, shRNA, miRNA, single-stranded nucleic acid molecules, double-stranded nucleic acid molecules, RNA, DNA, etc. The nucleic acid molecule is capable of mediating RNA interference with TSLP gene expression, and is preferably siRNA. "Target protein" refers to a protein whose regulation is desired.
[0145] A "target nucleic acid" (sometimes called a "target sequence") refers to a nucleic acid that can be targeted by a nucleic acid molecule.
[0146] "Target segment" means the sequence of nucleotides of a target nucleic acid that is targeted by the siRNA or nucleic acid molecule of the present invention.
[0147] "Nucleic acid base sequence" refers to a continuous sequence of nucleic acid bases independent of any sugar moiety, binding site, or modified nucleic acid base. "Nucleoside" refers to a compound in which a nucleic acid base and a sugar moiety are bonded. "Ribonucleoside" refers to a nucleoside in which the sugar moiety is ribose. "Deoxyribonucleoside" refers to a nucleoside in which the sugar moiety is D-2-deoxyribose. "Nucleotide" refers to a compound in which a phosphate group is bonded to the sugar moiety of a nucleoside. "Oligononucleotide" refers to a compound having a structure in which nucleotides are polymerized by phosphodiester bonds or modified phosphodiester bonds. Naturally occurring oligonucleotides include, for example, 2'-deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and oligonucleotides in which the sugar moiety, phosphate moiety, or nucleic acid base moiety are modified independently of each other.
[0148] RNA interference (RNAi) refers to sequence-specific post-transcriptional gene silencing in animals mediated by small interfering RNA (siRNA). It has been reported that intracellular RNAi responses are induced by double-stranded RNA (dsRNA). Certain intracellular dsRNAs are affected by the enzymes Dicer and ribonuclease III. Dicer can cleave dsRNA into short fragments, producing siRNA.
[0149] siRNA is known to be involved in the endonuclease complex, which is part of the RNA-induced silencing complex (RISC). siRNA possesses an AS (also called the guide strand) that is incorporated into the RISC, and this AS mediates the cleavage of target mRNA with a complementary sequence. The other strand of the AS in siRNA is called the SS (also called the passenger strand). Cleavage of the target nucleic acid occurs near the region complementary to the AS of the siRNA. siRNA has been reported to downregulate or knock down gene expression by mediating sequence-specific RNA interference.
[0150] A "double-stranded region (dsRNA)" refers to a region that has a double-stranded structure containing two complementary, antiparallel nucleic acid strands (sense strand / antisense strand).
[0151] The "sense strand (sometimes abbreviated as SS)" refers to the nucleotide sequence of a nucleic acid molecule that is partially or completely complementary to at least a portion of the corresponding antisense strand of the nucleic acid molecule (for example, siRNA, more specifically, siRNA capable of inhibiting TSLP expression (hereinafter sometimes referred to as TSLP siRNA); the same applies to the hereafter defined "nucleic acid molecule"). The sense strand of a nucleic acid molecule may include a nucleic acid sequence homologous to the base sequence of the target nucleic acid.
[0152] The “antisense strand (sometimes abbreviated as AS)” refers to the nucleotide sequence of a nucleic acid molecule that is partially or completely complementary to at least a portion of the base sequence of the target nucleic acid. The antisense strand of a nucleic acid molecule may include a nucleic acid sequence that is at least partially or completely complementary to the corresponding sense strand of the nucleic acid molecule. If the complementary region is not completely complementary to the target sequence (referred to as a “mismatch”), such mismatch may be located, for example, within the 10, 9, 8, 7, 6, 5, 4, 3, or 2 nucleotides at the 5' and / or 3' ends.
[0153] "Complementarity" refers to the ability of an oligonucleotide or polynucleotide containing a second nucleotide sequence to hybridize with an oligonucleotide or polynucleotide containing a first nucleotide sequence to form a double-stranded structure under specific conditions (specifically, stringent conditions). Examples include the ability to form base pairs (hybridization) between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the corresponding nucleic acid bases in the target nucleic acid, and the ability to form base pairs between the nucleic acid bases of the antisense strand of a nucleic acid molecule and the nucleic acid bases of the sense strand. Base pairs are formed by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between the corresponding nucleic acid bases. Methods for determining whether the antisense strand and sense strand of a nucleic acid molecule, or the antisense strand of a nucleic acid molecule and the target nucleic acid, are specifically capable of hybridization are well known in the art. "Complementarity" is sometimes also referred to as "base complementarity."
[0154] "Complementary" nucleotide sequences may include base pairs formed from non-Watson-Crick base pairs, non-natural and modified nucleotides, as long as the requirements for hybridization are met. Examples of such non-Watson-Crick base pairs include, but are not limited to, G-U fluctuations and Hoogsteen-type base pairs.
[0155] The "subject" may include, but is not limited to, humans, non-human mammals (e.g., dogs, cats, rats, mice, rabbits, monkeys, chimpanzees, cows, horses, pigs, sheep, goats, etc.), birds (e.g., chickens), etc. The "subject" is preferably humans.
[0156] A "mismatched base (non-complementary nucleic acid base)" refers to a nucleic acid base of a first nucleic acid that cannot pair with the corresponding nucleic acid base of a second nucleic acid or target nucleic acid. Introducing a mismatched base into the antisense strand of a nucleic acid molecule involves (i) substituting some nucleic acid bases of the antisense strand with nucleic acid bases that cannot pair with the target nucleic acid, (ii) including some nucleic acid bases of the antisense strand with nucleic acid bases that cannot pair with the target nucleic acid, resulting in an increase in the length of the consecutive nucleotides by the amount of those nucleic acid bases (insertion), and (iii) in the complementary portion of the antisense strand and the target nucleic acid, the oligonucleotides of the antisense strand lack nucleic acid bases that can pair with the target nucleic acid, resulting in a decrease in the length of the consecutive nucleotides by the amount of those nucleic acid bases (deletion).
[0157] The term "equal-length portion" refers to the portion formed by the hybridization of the antisense strand of the nucleic acid molecule and the corresponding nucleic acid base of the target nucleic acid. If the mismatched base described above is not introduced into the antisense strand of the nucleic acid molecule, the length (number of nucleosides) of the nucleotides of the antisense strand and the target segment are the same. If the mismatched base described in (i) above is introduced into the antisense strand of the nucleic acid molecule, the length (number of nucleosides) of the nucleotides of the antisense strand and the target segment are the same. If the insertion described in (ii) above is introduced into the antisense strand of the nucleic acid molecule, the equal-length portion of the target nucleic acid is shorter than the nucleotides of the antisense strand by the amount of the insertion base (also referred to as having a reduced number of nucleosides). If the deletion described in (iii) above is introduced into the antisense strand of the nucleic acid molecule, the equal-length portion of the target nucleic acid is longer than the nucleotides of the antisense strand by the amount of the deletion base (also referred to as having an increased number of nucleosides).
[0158] "Expression" may refer to gene expression or target protein expression. The presence or level of such expression can be measured by the methods described in the examples of this specification, or by methods known to those skilled in the art. Expression includes all functions by which the information encoded by a gene is converted into structures that exist and function within the cell. Such structures may include, but are not limited to, the products of transcription and translation.
[0159] "Inhibition" means that a certain event is reduced compared to a control condition. For example, it means that the level of gene expression or mRNA encoding one or more proteins, or the activity of one or more encoded proteins, measured in the presence of nucleic acid molecules, is lower than the activity measured in the absence of nucleic acid molecules.
[0160] For example, the level of expression, mRNA level, or encoded protein activity level is reduced by at least approximately 5%, at least approximately 10%, at least approximately 30%, at least approximately 50%, at least approximately 70%, at least approximately 90%, and at least approximately 95% compared to the activity level observed in the absence of the nucleic acid molecule. Note that "inhibit" can also be expressed as "suppress" or "downregulate."
[0161] When describing a product as "inhibiting TSLP expression," it may also include "inhibiting TSLP mRNA expression," and vice versa.
[0162] The nucleic acid molecule of the present invention is a compound capable of regulating the expression of TSLP or TSLP mRNA.
[0163] "Expression regulation" refers to the ability of oligonucleotides to alter the amount of TSLP protein or TSLP mRNA compared to the amount of TSLP or TSLP mRNA before administration of a nucleic acid molecule. Expression regulation is determined by comparison with a control. One form of "regulation" is understood as the ability of oligonucleotides to inhibit, downregulate, reduce, suppress, remove, stop, block, prevent, decrease, reduce, avoid, or terminate TSLP expression, for example, by degrading or blocking the translation of TSLP mRNA.
[0164] "Modified nucleotides" refer to nucleotides having modifications to the sugar group of a nucleotide, modifications to the internucleoside bond, modifications to the nucleic acid base of a nucleotide, and / or modifications to the structure of one or more nucleotides at the end of a nucleic acid molecule, or combinations thereof. "Modification of sugar group" refers to substitution, conversion, etc., from the natural sugar portion.
[0165] A "modified oligonucleotide" refers to an oligonucleotide containing at least one modified nucleoside bond, modified sugar, modified nucleic acid base, etc.
[0166] A nucleotide is a nucleoside containing a phosphate group covalently bonded to the sugar portion of the nucleoside. In nucleosides containing pentofuranosyl sugars, the phosphate group can be bonded to the 2', 3', or 5' hydroxyl portion of the sugar. Oligonucleotides are formed through covalent bonds between adjacent nucleosides, forming linear polymers. Within the oligonucleotide structure, the phosphate group typically forms internucleoside bonds. "Internucleoside bond" refers to a chemical bond between nucleosides. The natural internucleoside bond in RNA or DNA is a 3'-to-5' phosphodiester bond. Oligonucleotides having one or more modified internucleoside bonds may be used to obtain desirable properties such as high intracellular uptake, high affinity for target nucleic acids, and high stability in the presence of nucleases.
[0167] "5'-vinylphosphonate modified nucleotide" is a nucleotide with -CH at the 4' position. 2 The OH group is -CH=CH-P(O)(OH) 2 This refers to a modified nucleotide in which a base has been substituted. Furthermore, "2'-acetamide-5'-vinylphosphonate modified nucleotide" refers to a modified nucleotide in which the 2' position of "5'-vinylphosphonate modified nucleotide" is 2'-deoxy-2'-NHAc. For example, in this specification, "U(NAcVp)" is 2'-deoxy-2'-NHAc-uridine-4'-vinyl phosphate, and is represented by the following structural formula (excluding the part outside the dashed line in the formula).
[0168] The "5'-phosphorus stabilization moiety" refers to a nucleotide structure in which a phosphate residue containing a phosphate ester or modified phosphate ester (e.g., phosphorothioate, phosphodiester, etc.) is substituted at the 5' end. Examples of the 5'-phosphorus stabilization moiety structure are shown in the following formulas (PSt1) to (PSt3): Examples of substructures represented by the formula [wherein Base represents a nucleic acid base; X represents any substituent; Y represents a hydrogen atom, alkyl group, hydroxyl group protecting group, etc. (excluding the area outside the dashed line)] include, but are not limited to, these.
[0169] "Bridged nucleotide" means any nucleotide in which the sugar moiety (ribofuranose ring) of a nucleic acid is bridged with a methylene group or the like. For example, "LNA", which is one of the "bridged nucleotides", bridges the oxygen atom at the 2'-position and the carbon atom at the 4'-position of a ribonucleotide (RNA) with a methylene group (4'-CH 2 -O-2' bridge), and means a bridged modified nucleic acid (Locked Nucleic Acid) in which ribose is fixed. For example, its nucleoside structure is represented by the following formula: [In the formula, Base represents a nucleic acid base; outside the broken line, it can be bonded to other nucleosides via a phosphodiester bond or the like]. For example, in this specification, "A(LNA)" is (2'-O-CH 2 -4')-adenosine-3'-phosphate; "T(LNA)" is (2'-O-CH 2 -4')-thymidine-3'-phosphate; "5mC(LNA)" means (2'-O-CH 2 -4')-5-methylcytosine-3'-phosphate (the nucleoside structure of each bridged modified nucleic acid has the following formula, and outside the broken line, it can be bonded to other nucleosides via a phosphodiester bond or the like). As each bridged modified nucleic acid other than LNA, for example, ENA (4'-(CH 2 ) 2 -O-2' bridge), cEt (4'-CH(CH 3 )-O-2' bridge), AmNA (4'-C(=O)-N(CH 3 )-2' bridge), scpBNA (4'-C(-CH 2 CH 2 -)-O-2' bridge), etc. are known.
[0170] "Acyclic nucleotide" means, for example, any nucleotide having an acyclic ribose sugar in which the ribose ring, which is the main chain structure of a nucleotide, is modified into an acyclic structure. Specifically, the acyclic nucleotide is, for example, the following formulas (Ncn1) to (Ncn3): [Each formula includes and shows the phosphodiester bond of the internucleoside bond. In the formula, Base is a nucleic acid base; R 1 and R 2These are independently hydrogen atoms, halogen atoms, alkyl groups, and -OR groups. 3 and R 3 is a hydrogen atom, alkyl, C 3-8 Cycloalkyl, C 6-10 Examples include, but are not limited to, substructures represented by [aryl, aralkyl, heteroaryl, or sugar; capable of binding to other nucleotides outside the dashed line]. In this specification, formula (Ncn-1) may also be referred to as serinol nucleic acid (SNA).
[0171] Unless otherwise specified, "alkyl" refers to groups such as methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, and hexyl, but is not limited to these. Also, unless otherwise specified, "alkyl" includes linear or branched groups. 1-18 "Alkyl" refers to a linear or branched alkyl group having 1 to 18 carbon atoms, and in addition to the alkyl groups exemplified above, heptyl (C) 7 ), Octyl (C 8 ), nonil (C 9 ), Decyl (C 10 ), Undecyl (C 11 ), dodecyl (C 12 ), tridecyl (C 13 ), tetradecyl (C 14 ), pentadecyl (C 15 ), hexadecyl (C 16 ), heptadecyl (C 17 ), octadecyl (C 18 Examples of groups include the following. The alkyl group may be substituted with, for example, one to three halogens, alkoxy (-O-alkyl), cyano, nitro, etc.
[0172] "Aryl" or "C" 6-10Unless otherwise specified, "aryl" refers to groups such as phenyl, naphthyl, and indanyl, but is not limited to these. Unless otherwise specified, "heteroaryl" refers to 5-6 membered unsaturated heterocycles such as triazolyl, pyridyl, pyridadinyl, pyrimidinyl, and pyrazinyl, but is not limited to these. "Aralkyl" refers to a group in which "aryl" is substituted with "alkyl," and unless otherwise specified, refers to groups such as benzyl and phenethyl, but is not limited to these. 3-8 "Cycloalkyl" refers to a cyclic alkyl group having 3 to 8 carbon atoms, and unless otherwise specified, examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. The aforementioned aryl, heteroaryl, aralkyl or C 3-8 The cycloalkyl group may be substituted with, for example, one to three halogens, alkoxy (-O-alkyl), cyano, or nitro atoms.
[0173] Unless otherwise specified, "halogens" include, but are not limited to, fluorine atoms, chlorine atoms, bromine atoms, and iodine atoms.
[0174] Unless otherwise specified, "alkylene" is defined by formula - (CH 2 ) n This refers to a group represented by - (for example, n = 1 to 18). 1-18 Specifically, "alkylene" includes, but is not limited to, methylene, ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, 2-(ethyl)trimethylene, 1-(methyl)tetramethylene, heptylene, octylene, nonylene, decylene, undecylene, dodecylene, tridecylene, tetradecylene, pentadecylene, etc. The hydrogen atoms of the alkylene may be substituted with, for example, one to three halogens, alkoxy (-O-alkyl), cyano, nitro, etc.
[0175] "Diseases or symptoms in which thymic-interstitial lymphocyte neoplastic factor is suspected to be involved" include, but are not limited to, the diseases or symptoms listed in "8. Diseases or symptoms involving thymic-interstitial lymphocyte neoplastic factor" below.
[0176] "Effective dose" refers to the amount of siRNA that is effective in achieving the desired pharmacological, prophylactic, therapeutic, or inhibitory effect.
[0177] "Pharmacologically acceptable carrier" refers to a carrier for administering a prophylactic or therapeutic drug.
[0178] Unless otherwise specified, "improvement" means a change in the state of the disease or symptoms, prevention or delay of the worsening of the disease or symptoms, reversal, prevention or delay of the progression of the disease or symptoms, or treatment of the disease or symptoms.
[0179] Unless otherwise specified, "prevention" means preventing or delaying the onset of a disease or symptom in the subject, or reducing the risk of developing a disease or symptom.
[0180] Unless otherwise specified, "treatment" means any treatment of a disease or symptom in the subject (e.g., improvement of the disease or symptom, reduction of the disease or symptom, recovery from the disease or symptom, alleviation of the disease or symptom, suppression of the progression of the disease or symptom, etc.). It may also include preventing the onset and / or progression of the disease or symptom in the subject.
[0181] The term "approximately" may include values up to ±20% of the given value, preferably up to ±10%. For example, when stating "TSLP expression was inhibited by approximately 80%", the level of inhibition may include inhibition within the range of 64% to 96%, preferably within the range of 72% to 88%.
[0182] "Substantially" means that the scope or degree of what is being covered is complete or nearly complete. For example, "substantially all" means 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.
[0183] 1. Nucleic acid molecule that inhibits the expression of thymic interstitial lymphocyte necrotizing factor The nucleic acid molecule of the present invention has inhibitory activity against the expression of thymic interstitial lymphocyte necrotizing factor (TSLP) and contains a nucleic acid base sequence complementary to the TSLP mRNA transcribed from the gene encoding TSLP. Furthermore, the nucleic acid molecule of the present invention can downregulate the expression of the gene encoding TSLP. Furthermore, the nucleic acid molecule of the present invention contains a nucleotide sequence that can mediate the silencing of TSLP gene expression. In some embodiments, the nucleic acid molecule of the present invention has a double-stranded region (dsRNA) of 19 to 21 nucleotides in length, and includes an elongation strand of 19 to 21 nucleotides in length and an antisense strand of 19 to 23 nucleotides in length. One embodiment of the nucleic acid molecule of the present invention is siRNA, and the description of the nucleic acid molecule herein also applies to siRNA.
[0184] In some embodiments, the double-stranded region of the nucleic acid molecule of the present invention may contain 19 or more, 20 or more, or 21 or more base pairs; 21 or less, 20 or less, 19 or less; or 19, 20, or 21 base pairs.
[0185] Generally, the sense and antisense strands of siRNA can be designed to be, for example, 19 to 23 nucleotides long, and may include base pairs in double-stranded regions with nucleotide lengths of, for example, 19 or more, 20 or more, 21 or more, 22 or more, or 23 or more, or 23 or less, 22 or less, 21 or less, 20 or less, or 19 or less.
[0186] Generally, the majority of nucleotides in the sense and antisense strands are ribonucleotides, but one or both of these strands may contain at least one non-ribonucleotide, such as a deoxyribonucleotide and / or a modified nucleotide.
[0187] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 19 to 21 nucleotides in length of antisense strands in its double-stranded region, which is complementary to the sequence of TSLP mRNA transcribed from a gene encoding TSLP.
[0188] In some embodiments, the nucleic acid molecule of the present invention may have a continuous region of 19 to 23 nucleotides in length of antisense strand that is complementary to the sequence of TSLP mRNA transcribed from a gene encoding TSLP.
[0189] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention may have a nucleotide length of 19 or more, 20 or more, 21 or more, 22 or more, 23 or more; 23 or less, 22 or less, 21 or less, 20 or less, 19 or less; 19, 20, 21, 22, or 23, and the sense strand may have a nucleotide length of 19 or more, 20 or more, 21 or more; 21 or less, 20 or less, 19 or less; 19, 20, or 21.
[0190] The sense strand of the nucleic acid molecule of the present invention is SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 It may contain 19, 20, or 21 consecutive nucleotides as shown in 76, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 208, 209, 210, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, or 222.
[0191] The sense strand of the nucleic acid molecule of the present invention is sequence numbers 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 289, 290, 291, 292, 294, 295, 296, 297, 298, 299, 300, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 335, 417, 418, 432, 433, 434, 435, 436 It may contain 19, 20, or 21 consecutive nucleotides as shown in 437, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, or 463.
[0192] The antisense strands of the nucleic acid molecules of the present invention are SEQ ID NOs: 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 125, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142 It may contain 19, 20, 21, 22, or 23 consecutive nucleotides as shown in 143, 144, 145, 146, 147, 148, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 202, 203, 204, 205, 206, 207, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, or 242.
[0193] The antisense chains of the nucleic acid molecules of the present invention are SEQ ID NOs: 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 37 9, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 419, 420, 421, 422, 423, 424, 425, 427, 428, 429, 430, 43 1, 464, 465, 466, 467, 468, 469, 470, 472, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 51 It may contain 19, 20, 21, 22, or 23 consecutive nucleotides as shown in 4, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 543, 544, 545, 546, 547, 548, 549, 550, or 551.
[0194] In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 3 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 77 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 4 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 78 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 5 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 79 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 6 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 80 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 16 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 90 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 191 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 79 or a fragment thereof. In another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 194 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 79 or a fragment thereof. In another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 198 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 205 or a fragment thereof. In another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 199 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 206 or a fragment thereof.In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 200 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 206 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 335 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 202 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 417 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 79 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 418 or a fragment thereof, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence shown in SEQ ID NO: 79 or a fragment thereof. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence or fragment thereof of the sense strand sequence number corresponding to any identification number listed in the table of embodiment [1] or [1-2], and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence or fragment thereof of the antisense strand sequence number corresponding to the identification number.
[0195] In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 151, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 171. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 152, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 172. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 153, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 173. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 154, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 174. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 163, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 183. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 208, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 223. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 211, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 228. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 214, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 234. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 216, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 235.In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 217, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 236. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 218, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 489. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 449, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 223. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 454, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 504. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 456, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment shown in SEQ ID NO: 173. In one embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 457, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 512. In another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 460, and the antisense strand of the nucleic acid molecule may consist of the nucleic acid sequence or fragment thereof shown in SEQ ID NO: 518. In another embodiment, the sense strand of a nucleic acid molecule may consist of the nucleic acid base sequence or fragment thereof of the sense strand SEQ ID NO: sequence number corresponding to any identification number listed in the table of embodiments [1-11] or [1-11-1], and the antisense strand of the nucleic acid molecule may consist of the nucleic acid base sequence or fragment thereof of the antisense strand SEQ ID NO: sequence number corresponding to the identification number.
[0196] In some embodiments, the nucleic acid molecule of the present invention comprises a sense strand selected from the sequences shown in Tables 1-1 to 1-7, Tables 2-1 to 2-4, Tables 3-1 to 3-13 and Tables 4-1 to 4-6, or 19, 20, or 21 nucleotide fragments thereof, and an antisense strand selected from the sequences shown in Tables 1-1 to 1-7, Tables 2-1 to 2-4, Tables 3-1 to 3-13 and Tables 4-1 to 4-6, or 19, 20, 21, 22, or 23 nucleotide fragments thereof.
[0197] The nucleic acid molecule of the present invention may have a blunt end. The nucleic acid molecule of the present invention may have one or more 3' overhangs.
[0198] The nucleic acid molecule of the present invention is a compound that, when administered to a target, can inhibit the expression of TSLP or the expression of the gene encoding TSLP in the target cells, tissues, organs, etc. Therefore, as a result of administration, the expression of TSLP in the target cells, tissues, organs, etc. can be inhibited, thereby inhibiting the action of TSLP.
[0199] In some embodiments, the nucleic acid base sequence of the antisense strand of the nucleic acid molecule of the present invention has complementarity to the isolength portion of the gene (mRNA) encoding TSLP (SEQ ID NO: 1) of, for example, at least 80%, at least 85%, at least 90%, at least 95%, or 100%; preferably at least 85%, at least 90%, at least 95%, or 100%; more preferably at least 90%, at least 95%, or 100%.
[0200] The antisense or sense strand of a nucleic acid molecule can have its continuous nucleotide length increased or decreased, and it is also possible to introduce mismatched bases (non-complementary nucleic acid bases) while maintaining activity.
[0201] The antisense strand of the nucleic acid molecule of the present invention may contain nucleotide sequences in the isolength portion of the mRNA encoding the target nucleic acid TSLP (SEQ ID NO: 1) that have complete complementarity (100%) or substantial complementarity (for example, at least 80% to 100%, at least 85% to 100%, at least 90% to 100%, or at least 95% to 100%) with consecutive nucleic acid bases of the nucleotide sequence. "Consecutive nucleic acid bases" refers to nucleic acid bases that are directly adjacent to each other.
[0202] In some embodiments, the nucleic acid molecules of the present invention can inhibit the expression of TSLP mRNA by, for example, about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, and about 95% or more. The degree of inhibition of TSLP mRNA expression can be considered as the inhibition rate of TSLP expression.
[0203] The inhibition rates of TSLP expression are, for example, approximately 5-100%, 15-100%, 30-100%, 50-100%, 70-100%, 80-100%, and 90-100%. In the examples described later, the degree of inhibition of TSLP mRNA expression (the degree of inhibition of TSLP expression) is confirmed by measuring the expression level of TSLP mRNA in cells.
[0204] The nucleic acid molecule of the present invention exhibits an IC50 of less than approximately 1000 pM in in vitro tests. 50 It possesses the ability to advantageously inhibit the expression of mRNA encoding TSLP. Furthermore, some can inhibit the expression level of mRNA encoding TSLP by at least approximately 80%.
[0205] In some embodiments, the nucleic acid molecule of the present invention is, for example, a highly active IC at less than about 1000 pM, less than about 500 pM, less than about 300 pM, or less than about 100 pM. 50 It has a value that can inhibit the expression of TSLP mRNA.
[0206] Nucleic acid molecules can be constructed from separate polynucleotide chains (SS and AS). The SS and AS are at least partially complementary. The SS and AS can form a double-stranded region having, for example, 19 to 21 base pairs.
[0207] The nucleic acid molecule of the present invention can target genes encoding TSLP. For example, any homologous sequence of a gene encoding TSLP can be targeted using a complementary sequence or a sequence incorporating a non-standard base pair (e.g., a mismatched base pair).
[0208] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 23, and the nucleic acid base sequence of the AS is such that, in the nucleic acid base sequence of Sequence ID No. 1 (human TSLP mRNA nucleic acid sequence (GenBank accession number: NM_033035.5)), counting from the 5' position, for example, 257, 260, 261, 264, 265, 268, 272, 308, 312, 314, 315, 316, 317, 320, 326, 330, 399, 402, 403, 404, 406, 407, 408, 409, 410, 413, 414, 415, 417, 418, 419, 420, 444, 498, 501, 502, 504, 505, 506, The bases starting from positions 507, 508, 509, 510, 511, 514, 517, 521, 523, 525, 528, 529, 564, 566, 568, 575, 576, 579, 580, 582, 586, 587, 588, 589, 591, 592, 609, or 613 are complementary by 19 to 23 lengths. Furthermore, this complementarity is, for example, approximately 80% to 100%, approximately 85% to 100%, approximately 90% to 100%, or approximately 95% to 100%.
[0209] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 23, and the nucleic acid base sequence of the AS is such that, in the nucleic acid base sequence of Sequence ID No. 1 (Human TSLP mRNA nucleic acid sequence (GenBank accession number: NM_033035.5)), counting from the 5' position, for example, 254, 256, 257, 258, 259, 260, 261, 262, 263, 264, 266, 267, 268, 269, 270, 271, 273, 274, 308, 310, 311, 312, 313, 314, 316, 317, 318, 319, 320, 321, 323, 324, 327, 328, 329, 330, 401, 403, 409, 416, The bases starting at positions 440, 441, 499, 501, 502, 503, 504, 512, 513, 524, 525, 526, 527, 528, 534, 561, 565, 567, 573, 574, 575, 576, 577, 578, 582, 590, 610, 611, or 765 are complementary by 19 to 23 lengths. Furthermore, this complementarity is, for example, approximately 80% to 100%, approximately 85% to 100%, approximately 90% to 100%, or approximately 95% to 100%.
[0210] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 23, and the nucleic acid base sequence of the AS is such that, in the nucleic acid base sequence of the human TSLP mRNA (GenBank accession number: NM_033035.5) of Sequence ID No. 1, for example, 257 to 279, 260 to 278, 261 to 279, 264 to 282, 265 to 283, 265 to 287, 268 to 286, 272 to 294, 308 to 330, 312 to 330, 314 to 332, 314 to 336, 315 to 333, 316 to 338, 317 to 339, 320 to 338, 326 to 348, 330 to 348, 399-421, 402-420, 403-421, 403-425, 404-422, 406-424, 407-425, 408-426, 409-431, 410-432, 413-431, 414-432, 415-433, 415-437, 417-435, 418-436, 419-437, 420-438, 444-462, 498-520, 501-523, 502-520, 504-526, 505-523, 506-524, 507-525, 507-529, 508-526, 509-527, 510-528, 511-529, 514-532, 517-539, 521-539, 523-541, 525-547, 528-546, 529-547, 564-586, 566-584, 568-586, 575-597, 576- It is complementary to the base portions 598, 579–597, 580–598, 582–604, 586–604, 587–605, 587–609, 588–606, 589–607, 591–609, 592–610, 609–631, or 613–631. Furthermore, the complementarity is, for example, approximately 80%–100%, approximately 85%–100%, approximately 90%–100%, or approximately 95%–100%.
[0211] The antisense strand (AS) of the nucleic acid molecule of the present invention comprises, for example, an oligonucleotide of length 19 to 23, and the nucleic acid base sequence of the AS is such that, in the nucleic acid base sequence of Sequence ID No. 1 (Human TSLP mRNA nucleic acid sequence (GenBank Accession Number: NM_033035.5), for example, 254-276, 256-278, 257-279, 258-279, 258-280, 259-277, 259-279, 260-282, 261-283, 262-284, 263-281, 264-286, 266-284, 266-288, 267-285, 267-289, 268-290, 269-291, 270-292, 271-293, 27 3-295, 274-296, 308-330, 310-332, 311-333, 312-334, 313-331, 313-335, 314-336, 316-338, 317-339, 318-340, 319-337, 319-341, 320-342, 321-343, 323-345, 324-346, 327-349, 328-346, 328-350, 329-347, 329-351, 330-348, 330- 352, 401-419, 403-421, 409-427, 409-431, 416-434, 440-462, 441-463, 499-521, 501-519, 502-520, 502-524, 503-521, 503-525, 504-522, 512-530, 513-531, 524-542, 525-543, 526-544, 526-548, 527-545, 527-549, 528-550, 534-5 It is complementary to the base portions 52, 561-579, 565-583, 567-585, 573-591, 574-592, 575-593, 576-594, 577-595, 577-599, 578-596, 582-604, 590-608, 610-632, 611-633, or 765-783. Furthermore, the complementarity is, for example, about 80%-100%, about 85%-100%, about 90%-100%, or about 95%-100%.
[0212] Thymic interstitial lymphocyte neogenesis factor (TSLP) may include TSLP derived from any species. Examples of species include humans or non-human mammals (dogs, cats, rats, mice, monkeys, cattle, horses, pigs, sheep, etc.), preferably humans or non-human mammals (rats or mice), and more preferably humans.
[0213] 2. Modification The antisense strand (AS) and sense strand (SS) of the nucleic acid molecule of the present invention may each independently contain at least one (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) modified nucleotides. Such modifications may yield properties such as increased gene silencing activity and potency. Specifically, it may be possible to obtain siRNA with excellent serum stability without loss of siRNA activity (potency), or siRNA with reduced off-target effects.
[0214] In some embodiments, the present invention may provide nucleic acid molecules having various modifications (including chemical modifications) that can enhance the stability and potency of the nucleic acid molecules.
[0215] The nucleic acid molecules of the present invention may have chemical modifications in the antisense strand (AS) or sense strand (SS), such as "modification of the sugar group of the nucleotide," "modification of the internucleoside bond," or "modification of the nucleic acid base of the nucleotide." In some embodiments, the chemical modifications in the nucleic acid molecule can be included in all oligonucleotides of the nucleic acid molecule.
[0216] "Modification of the sugar group of a nucleotide" includes, for example, 2'-deoxynucleotides, 2'-O-alkyl-modified nucleotides, 2'-O-methyl (2'-OMe)-modified nucleotides, and 2'-O-C 16 H 33 Modified nucleotides, etc.), 2'-OCH 2 CH 2 OCH 3Examples include, but are not limited to, (2'-OMOE) modified nucleotides, 2'-deoxy-2'-fluoro(2'-F) modified nucleotides, 2'-deoxy-2'-NHAc(2'-NHAc) modified nucleotides, cross-linked nucleotides (e.g., LNA), acyclic nucleotides (serinol nucleic acids), debasic nucleotides, or any combination thereof.
[0217] The hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or antisense strand of the nucleic acid molecule of the present invention is a phosphate group (P(O)(OH) 2 ) or thiophosphate group (P(S)(OH) 2 It is possible to substitute with ). For example, in the antisense strand of sequence number 494, pUm=Gf=AmAmGmGfUmUfAfGmGmCfUmCfUmGfGmAmUmUmUm=Cm=Am, the notation of pUm at the 5' end of the sequence is -O-P(O)(OH) at the 5' position of Um. 2 This means that substitution has occurred, and in the antisense strand of sequence number 492, p=Um=Gf=AmAmGmGfUmUfAfGmGmCfUmCfUmGfGmAmUmUmUm=Cm=Am, the notation of p=Um at the 5' end of the sequence is -O-P(S)(OH) at the 5' position of Um. 2 This means that a phosphate group or thiophosphate group is substituted. Compounds substituted with such phosphate or thiophosphate groups can be obtained according to methods known in the literature, for example, by the synthesis method in the scheme below.
[0218] Modifications of nucleoside bonds include, but are not limited to, phosphorothioate bonds, phosphorodithioate bonds, boranophosphate bonds, or any combination thereof. Preferably, the modification of the nucleoside bond is a phosphorothioate bond or a phosphorodithioate bond.
[0219] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are also modified with phosphorothioate bonds.
[0220] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified by phosphorodithioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are also modified by phosphorodithioate bonds.
[0221] In some embodiments, the nucleic acid molecule of the present invention may have an antisense strand (AS) and a sense strand (SS) in which positions 1 and 2 from the 5' end of the AS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds and phosphorodithioate bonds, and positions 1 and 2 from the 5' end of the SS and / or positions 1 and 2 from the 3' end are modified with phosphorothioate bonds and phosphorodithioate bonds.
[0222] The nucleic acid bases of the nucleotides constituting the oligonucleotide are not particularly limited, but for example, adenine (A), guanine (G), thymine (T), cytosine (C), uracil (U), hypoxanthine, or modified nucleic acid bases thereof can be used.
[0223] Modifications of the nucleic acid bases of nucleotides include, but are not limited to, 5-alkylcytosine, 5-alkyluracil, or any combination thereof.
[0224] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications at the 5' end, 3' end, or both ends of the AS or SS.
[0225] In some embodiments, the nucleic acid molecule of the present invention may have multiple deoxynucleotides (e.g., deoxythymidine (dT), inverted debasic deoxyribose (inVAb)) attached to the 3' end of AS or SS.
[0226] In some embodiments, the nucleic acid molecule of the present invention may have an inverted non-basic nucleotide (inVAb) attached to the 5' or 3' end of the SS.
[0227] In some embodiments, the nucleic acid molecules of the present invention may include, for example, nucleic acid molecules having modifications that result in a mismatch in complementarity between AS and SS.
[0228] The nucleic acid molecule of the present invention may include one or more overhangs from the double-stranded region formed from AS and SS. An overhang is a single-stranded region in which no base pairs are formed. In some embodiments, the length of the overhang may be, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. The overhang may be a 3'-terminal overhang at the 3' end of AS or SS having a single-stranded region of, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides, or a 5'-terminal overhang at the 5' end of AS or SS having a single-stranded region of, for example, 1 to 8 nucleotides, 1 to 5 nucleotides, 1 to 3 nucleotides, or 1 to 2 nucleotides. Furthermore, the lengths of each overhang may be the same or different.
[0229] The nucleic acid molecule of the present invention may have one or more blunt ends in which the double-stranded region ends without an overhang and the AS and SS bases are base-paired to the end of the double-stranded region. The nucleic acid molecule of the present invention may have one or more blunt ends, or one or more overhangs, or a combination of blunt ends and overhangs.
[0230] In some embodiments, the nucleic acid molecule of the present invention may contain at least one modified nucleotide (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) within the double-stranded region formed from AS and SS.
[0231] In some embodiments, the nucleic acid molecule of the present invention is a nucleic acid molecule for inhibiting the expression of thymic stromal lymphocyte necrosis factor (TSLP), comprising a sense strand and an antisense strand forming a double-stranded region, each independently comprising 19 to 29 nucleotides in length (preferably, the sense strand being 19 to 21 nucleotides long and the antisense strand being 19 to 23 nucleotides long), wherein the sense strand and antisense strand each contain at least a nucleotide sequence selected from the combinations of sense strands and antisense strands indicated by the identification numbers in Tables 1-1 to 1-7, Tables 2-1 to 2-4, Tables 3-1 to 3-13 and Tables 4-1 to 4-6, and the nucleic acid base sequence of the antisense strand has at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% complementarity with respect to the isolength portion of mRNA encoding thymic stromal lymphocyte necrosis factor (TSLP) (SEQ ID NO: 1). The nucleic acid molecules may include salts thereof or solvates thereof.
[0232] 3. Salts and Solvates The nucleic acid molecules of the present invention may form salts. Such salts are not particularly limited as long as they are pharmaceutically acceptable, but examples include alkali metal salts such as sodium salts, potassium salts, and lithium salts; alkaline earth metal salts such as calcium salts and magnesium salts; metal salts such as aluminum salts, iron salts, zinc salts, copper salts, nickel salts, and cobalt salts; ammonium salts; t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucamine salts, guanidine salts, diethylamine salts, triethylamine salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, procaine salts, diethanolamine salts, and N-benzylphenethylamine salts. Examples include organic amine salts such as piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salt; hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, and hydroiodide; inorganic salts such as nitrates, perchlorates, sulfates, and phosphates; lower alkanesulfonates such as methanesulfonates, trifluoromethanesulfonates, and ethanesulfonates; arylsulfonates such as benzenesulfonates and p-toluenesulfonates; organic salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, and maleates; and amino acid salts such as glycine salts, lysine salts, arginine salts, ornithine salts, glutamates, and aspartates. These salts can be produced by known methods.
[0233] The nucleic acid molecules of the present invention, or salts thereof, may exist in non-solvated or solvated forms. In this specification, "solvate" means a molecular complex comprising the nucleic acid molecule of the present invention, or a salt thereof, and one or more pharmaceutically acceptable solvent molecules (e.g., water, ethanol, etc.). When the solvent molecule is water, it is specifically referred to as a "hydrate." These solvates can be prepared by known methods.
[0234] The description of nucleic acid molecules in this invention may include descriptions of salts of nucleic acid molecules, solvates of nucleic acid molecules, and solvates of salts of nucleic acid molecules.
[0235] 4. Nucleic acid molecules can also be bound with any functional molecule to enhance their activity, intracellular distribution, intracellular uptake, delivery to specific organs (target sites), etc. The functional molecule may be directly bound to the oxygen atom at the 3' position of the nucleotide at the 3' end of the oligonucleotide of the sense strand (SS) of the nucleic acid molecule, or to the oxygen atom at the 5' position of the nucleotide at the 5' end, or the functional molecule may be bound to the aforementioned site of the oligonucleotide of the SS via a binding group (e.g., a degradable group, a non-degradable group, etc.), or via a binding group and an optional linker. Methods for binding functional molecules to oligonucleotides can be found by referring to methods described in known literature, etc.
[0236] Functional molecules are not particularly limited, but they are molecules that, when bound, impart a desired function to nucleic acid molecules. Desired functions include, for example, delivery to target sites (various organs, tissues, cells, etc.). Functional molecules are not particularly limited, but include a wide variety of molecules such as lipids, proteins, peptides, antibodies, glycans, and small molecule compounds.
[0237] 5. Target nucleic acids of thymic stromal lymphocyte necrosis factor (TSLP) Genes encoding thymic stromal lymphocyte necrosis factor (TSLP) from species such as humans, rats, and mice have been cloned and sequenced and are available from GenBank. Nucleic acid sequences encoding human TSLP are available, such as the nucleic acid sequence of human TSLP mRNA (GenBank accession number: NM_033035.5 [Homo sapiens thymic stromal lymphopoietin (TSLP), transcript Variant 1, mRNA NCBI Reference Sequence]) (incorporated herein as SEQ ID NO: 1), and nucleotide sequences encoding cynomolgus monkey TSLP are available, such as the nucleic acid sequence of cynomolgus monkey TSLP mRNA (GenBank accession number: XM_005557498.3 [Macaca fascicularis thymic stromal lymphopoietin (TSLP), mRNA NCBI Reference Sequence]) (incorporated herein as SEQ ID NO: 2), but are not limited to these. Since reported sequences may change over time, those skilled in the art can incorporate necessary changes into the nucleic acid molecules herein accordingly.
[0238] The nucleic acid molecule of the present invention is sequenced such that its antisense strand (AS) can complement (hybridize) at least one target region of a target nucleic acid to achieve the desired effect.
[0239] In some embodiments, the desired effect is, for example, a decrease in the expression level of TSLP, a decrease in the expression level of mRNA encoding TSLP, or a decrease in the amount of protein encoded by TSLP mRNA, but is not limited to these.
[0240] The target region may contain one or more target segments. The antisense strand (AS) of a nucleic acid molecule can complement at least one target segment within the target region. Furthermore, the antisense strand (AS) of a nucleic acid molecule may complement multiple target segments.
[0241] In some embodiments, the target segment within the target region may consist of, for example, 10 to 20, 15 to 25, 19 to 29, or 20 to 30 nucleotides on the target nucleic acid, and may be the same length as or different from the nucleotide length of the antisense strand (AS) of the siRNA.
[0242] In some embodiments, a decrease in TSLP mRNA expression indicates inhibition of TSLP expression. A decrease in TSLP protein expression indicates inhibition of TSLP mRNA expression. For example, improvement, prevention, or treatment of diseases or symptoms involving TSLP can be achieved by inhibiting TSLP expression or inhibiting TSLP mRNA expression.
[0243] 6. Complementarity with Target Genes The antisense strand (AS) of the nucleic acid molecule of the present invention specifically hybridizes with the nucleic acid (mRNA) encoding the target nucleic acid TSLP to form a double-stranded structure. The antisense strand of the nucleic acid molecule of the present invention becomes fully complementary or substantially complementary to each other if a sufficient number of its nucleic acid bases can form hydrogen bonds with the corresponding nucleic acid bases of the target nucleic acid. As a result, the desired effects described above are obtained.
[0244] In some embodiments, the complementary region of the AS of the nucleic acid molecule of the present invention has a length of at least 19, 20, or 21 nucleotides. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 77. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 78. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 79. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 80. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 90. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid base sequence shown in SEQ ID NO: 202. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid sequence shown in SEQ ID NO: 203. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid sequence shown in SEQ ID NO: 205. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid sequence shown in SEQ ID NO: 206. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid sequence shown in SEQ ID NO: 207. In some embodiments, the complementary region includes 19, 20, or 21 consecutive nucleotides of the nucleic acid sequence shown in the SEQ ID NO of any antisense strand listed in the table of embodiments [1] or [1-2].
[0245] In some embodiments, the AS of the nucleic acid molecule of the present invention or a particular portion thereof is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the target nucleic acid, its target region, target segment, or particular portion.
[0246] The complementarity (%) between the AS of the nucleic acid molecule of the present invention and a certain region of the target nucleic acid can be calculated using known methods in the art. For example, if 18 of the 20 nucleic acid bases of the oligonucleotide contained in the AS complement the target region of the target nucleic acid and can specifically hybridize, then the AS will have a 90% complementarity.
[0247] In some embodiments, the AS of the nucleic acid molecule of the present invention or a specific portion thereof may be completely complementary (i.e., 100% complementary) to the target nucleic acid or a specific portion thereof. "Completely complementary (100% complementary)" means that each nucleic acid base of the AS can form a complete base pair with the corresponding nucleic acid base of the target nucleic acid.
[0248] Non-complementary nucleic acid bases (mismatched bases) may be located at the 5' or 3' end of the asthma nucleotide (AS), or they may be located within the AS. If two or more non-complementary nucleic acid bases are present, they may be consecutive or discontinuous.
[0249] In some embodiments, the antisense strand of the nucleic acid molecule of the present invention may contain, for example, four or fewer, three or fewer, two or fewer, or one or fewer non-complementary nucleic acid bases relative to the target nucleic acid or a specific portion thereof.
[0250] 7. Design and Manufacturing Method of Nucleic Acid Molecules When the nucleic acid molecule of the present invention is siRNA, the nucleic acid sequence of GenBank's human TSLP mRNA (NM_033035.5) and the nucleic acid sequence of cynomolgus monkey TSLP mRNA (XM_005557498.3) can be used. For example, the siRNA can be designed to contain an antisense strand with approximately 80% to 100% homology to each of these TSLP genes.
[0251] siRNA according to one aspect of the present invention can be prepared by appropriately selecting a method known to those skilled in the art. For example, after synthesizing the antisense strand and sense strand according to the method described in the examples below, siRNA can be obtained by performing annealing according to a known method. Even when the nucleic acid molecule of the present invention is something other than siRNA, it can be prepared by appropriately selecting a method known to those skilled in the art.
[0252] 8. Diseases or symptoms suspected to be related to thymic interstitial lymphocyte neogenesis factor Thymic interstitial lymphocyte neogenesis factor (TSLP) is expressed in cells, tissues, organs, etc. in the body, and a variety of diseases or symptoms can develop due to its physiological effects. Therefore, if the nucleic acid molecule of the present invention can be administered to target sites such as cells, tissues, organs, etc. in the body, thereby inhibiting the expression of TSLP or the gene encoding TSLP (TSLP mRNA), it may be possible to prevent, improve, and / or treat diseases or symptoms suspected to be related to TSLP.
[0253] Diseases or symptoms in which thymic interstitial lymphocyte necrotizing factor (TSLP) is suspected to be involved are not limited to those mentioned above, but include, for example, bronchial asthma, chronic obstructive pulmonary disease (COPD), eosinophilic cough, sarcoidosis, pulmonary fibrosis, rhinitis, and sinusitis (see table below).
[0254]
[0255] 9. Composition, Preventive / Therapeutic Agent The present invention provides a pharmaceutical composition characterized by containing a nucleic acid molecule that inhibits TSLP expression as an active ingredient.
[0256] In some embodiments, a pharmaceutical composition is provided characterized by containing at least one of the nucleic acid molecules of the present invention or salts thereof, or solvates thereof, as an active ingredient. Furthermore, the present invention can provide a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof that inhibits TSLP expression, or solvates thereof, as an active ingredient, and further containing a pharmaceutically acceptable carrier.
[0257] The nucleic acid molecules or salts thereof, or solvates thereof, and pharmaceutical compositions containing nucleic acid molecules or salts thereof, or solvates thereof, are useful for the prevention or treatment of diseases or symptoms related to TSLP. The nucleic acid molecules or salts thereof, or solvates thereof, and pharmaceutical compositions containing nucleic acid molecules or salts thereof, or solvates thereof, can be administered to subjects requiring them in an effective amount (therapeutic effective amount) sufficient to inhibit the expression of the TSLP gene.
[0258] In some embodiments, pharmaceutical compositions are provided for preventing, improving and / or treating diseases or symptoms in which TSLP is suspected to be involved, comprising at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient.
[0259] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention is provided for the manufacture of agents for preventing, improving and / or treating diseases or conditions in which TSLP is suspected to be involved.
[0260] In some embodiments, an agent for preventing, improving, and / or treating diseases or symptoms in which TSLP is suspected to be involved is provided, characterized by containing at least one nucleic acid molecule or salt thereof, or solvate thereof, as an active ingredient.
[0261] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, are provided for the prevention, improvement and / or treatment of diseases or symptoms in which TSLP is suspected to be involved.
[0262] In some embodiments, a TSLP expression inhibitor is provided that contains at least one of the nucleic acid molecules of the present invention or salts thereof, or solvates thereof.
[0263] In some embodiments, nucleic acid molecules or salts thereof, or solvates thereof, for inhibiting TSLP expression are provided.
[0264] In some embodiments, the use of a pharmaceutical composition containing at least one of the nucleic acid molecules or salts thereof of the present invention, or solvates thereof, as an active ingredient is provided for the manufacture of a drug for preventing, improving and / or treating a disease or condition in which TSLP is suspected to be involved.
[0265] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, as at least one pharmaceutical (including pharmaceutical compositions; the same applies hereinafter) is provided.
[0266] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention for the manufacture of pharmaceuticals is provided.
[0267] In some embodiments, the use of at least one nucleic acid molecule or salt thereof, or solvate thereof, as a TSLP expression inhibitor is provided.
[0268] In some embodiments, the use of nucleic acid molecules or salts thereof, or solvates thereof, of the present invention is provided for the production of TSLP expression inhibitors.
[0269] In some embodiments, a method is provided for preventing, improving and / or treating a disease or symptom in which TSLP is suspected to be involved, comprising administering a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient to a subject in need of prevention, improvement and / or treatment of the said disease or symptom.
[0270] In some embodiments, a method is provided for preventing and / or treating a disease or symptom in which TSLP is suspected to be involved, comprising administering a pharmaceutical composition containing at least one nucleic acid molecule or salt thereof of the present invention, or a solvate thereof, as an active ingredient to a subject in need of prevention and / or treatment of the said disease or symptom.
[0271] In some embodiments, a method is provided for preventing, improving and / or treating a disease or condition in which TSLP is suspected to be involved, comprising administering a nucleic acid molecule or salt thereof, or a solvate thereof, to a subject in need of prevention, improvement and / or treatment of the disease or condition.
[0272] In some embodiments, a method is provided for preventing and / or treating a disease or condition in which TSLP is suspected to be involved, comprising administering a nucleic acid molecule or salt thereof, or a solvate thereof, of the present invention to a subject in need of prevention and / or treatment of the said disease or condition.
[0273] Treatment methods for diseases or symptoms mediated by TSLP expression (diseases or symptoms in which TSLP involvement is suspected) include administering a therapeutically effective amount of nucleic acid molecules targeting TSLP to the subject in need of such treatment. The dosage of the nucleic acid molecule will be determined after considering the indication disease, the characteristics of the subject, etc., to ensure that a therapeutically effective amount is administered to the subject.
[0274] Examples of "pharmaceutically acceptable carriers" include, but are not limited to, sterile water, physiological saline, PBS, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, flavoring agents, fragrances, excipients, vehicles, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffering agents, coating agents, lubricants, colorants, sweeteners, viscosity modifiers, flavor and odor modifiers, solubilizers, and other additives, as well as combinations thereof. Furthermore, such carriers may include, for example, inert solid diluents or fillers, sterile aqueous solutions, and various organic solvents.
[0275] The administration method of the composition containing the nucleic acid molecule of the present invention is not particularly limited as long as it is a pharmaceutically acceptable administration method, and examples include oral administration, intravenous administration, intra-arterial administration, intramuscular administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intratissue administration, transdermal administration, intra-airway administration, transpulmonary administration, rectal administration, administration by intravenous fluid, and transnasal administration, which can be selected according to the treatment method.
[0276] The composition containing nucleic acid molecules of the present invention can be formulated by known pharmaceutical methods. The dosage form is not particularly limited and includes, for example, tablets, capsules, granules, fine granules, powders, pills, aerosols, inhalants, ointments, patches, topical preparations, transdermal preparations, lotions, suppositories, injections, lozenges, liquids, alcoholic preparations, suspensions, extracts, elixirs, lyophilized preparations, etc., which can be selected according to the method of administration.
[0277] The aqueous solvent that can be used to dissolve the nucleic acid molecules of the present invention is not particularly limited as long as it is pharmaceutically acceptable. Examples include aqueous solvents such as water for injection, distilled water for injection, electrolyte solutions such as PBS and physiological saline, glucose solution, and maltose solution.
[0278] The dosage of the composition of the present invention should preferably be adjusted considering the type of nucleic acid molecule contained in the present invention, the dosage form, the age, weight, and condition of the recipient, the route of administration, and the nature and severity of the disease or symptom. The dosage may also vary depending on the type of disease or symptom targeted, the form of administration, and the target molecule. Furthermore, the number of administrations will be appropriately selected depending on whether it is for prevention or treatment.
[0279] The nucleic acid molecule of the present invention is expected to be a nucleic acid molecule that can improve, for example, activity level, stability, toxicity, resistance to enzymatic degradation, target tissue targeting, intracellular distribution, cytoplasmic distribution, pharmacokinetics, and administration method.
[0280] The present invention will be described in more detail below with reference to examples, but the embodiments of the present invention are not limited to the following examples.
[0281] (Example of siRNA production) Single-chain RNA was produced by solid-phase synthesis on a scale of 1 μmol using an NTS-M8 synthesizer (Nippon Techno Service Co., Ltd.), the corresponding phosphoramidite, and controlled-pore glass (Glen UnySupport® 1000, Glen Research) as a solid support. For solid-phase synthesis, a standard nucleoside phosphoramidite chemical reaction, as described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, was used. Furthermore, the iodine oxidizing agent solution was replaced with a solution of DDTT (CAS: 1192027-04-5) (pyridine / acetonitrile = 6 / 4) to introduce a phosphorothioate bond.
[0282] Crude oligoribonucleotides were purified and deprotected using the Presep® DNA / RNA Type A reverse-phase solid-phase extraction column, following established procedures. Yield and concentration were determined by UV absorption of each RNA solution at a wavelength of 260 nm using a spectrophotometer (NanoDrop 1000, Thermo Fisher Scientific Inc.). Double-stranded RNA was generated by mixing equimolar solutions of complementary strands in water (0.1 mM), heating at 90°C for 5 minutes, and cooling to room temperature over approximately 30 minutes. The annealed RNA solutions were freeze-dried and stored in a freezer.
[0283] The manufactured siRNAs are shown in the table below by their identification numbers, along with the sequence information for their sense and antisense strands. In the table, identification numbers beginning with "TSN-" represent siRNAs consisting of a natural nucleic acid base sequence without chemical modification, while identification numbers beginning with "TSM-" represent siRNAs consisting of a nucleic acid base sequence with some or all chemical modification. In the table, the chemical structure (modified) sense strand (5'→3') or chemical structure (modified) antisense strand (5'→3') indicates the modification form of the sugar portion, nucleoside bond, or nucleic acid base portion of the oligonucleotide. The nucleic acid base sequence and modified nucleic acid base sequence are described in the 5' to 3' direction. Furthermore, "U" in the table is represented as "T" in the sequence listing attached to this specification.
[0284]
[0285] (#1) This refers to the start position of the complementary region of the antisense strand of TSLP siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1). (#2) This refers to the end position of the complementary region of the antisense strand of TSLP siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1).
[0286]
[0287] (#1) This refers to the start position of the complementary region of the antisense strand of TSLP siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1). (#2) This refers to the end position of the complementary region of the antisense strand of TSLP siRNA, counted from the 5' position of the target nucleic acid (SEQ ID NO: 1).
[0288] In the notation of nucleic acid base sequences and chemical structures in the examples, the nucleotide monomers used are represented by the following abbreviations: A is adenosine-3'-phosphate; C is cytidine-3'-phosphate; G is guanosine-3'-phosphate; U is uridine-3'-phosphate; dA or a is 2'-deoxyadenosine-3'-phosphate; dC is 2'-deoxycytidine-3'-phosphate; dG or g is 2'-deoxyguanosine-3'-phosphate; dT or dt or t is thymidine-3'-phosphate; Am is 2'-O-methyladenosine-3'-phosphate; Cm is 2'-O-methylcytidine-3'-phosphate; Gm is 2'-O-methylguanosine-3'-phosphate; Um is 2'-O-methyluridine n-3'-phosphate; Af is 2'-deoxy-2'-fluoroadenosine-3'-phosphate; Cf is 2'-deoxy-2'-fluorocytidine-3'-phosphate; Gf is 2'-deoxy-2'-fluoroguanosine-3'-phosphate; Uf is 2'-deoxy-2'-fluorouridine-3'-phosphate; inVAb is inverted debase deoxyribose; T(MOE) is 2'-O-CH 2 CH 2 OCH 3 -Thymidine-3'-phosphate; A(C16) is 2'-O-C 16 H 33 -Adenosine-3'-phosphate; A(LNA) is (2'-O-CH 2 -4')-adenosine-3'-phosphate; T(LNA) is (2'-O-CH 2 -4')-thymidine-3'-phosphate; 5mC(LNA) is (2'-O-CH 2-4')-5-methylcytosine-3'-phosphate; U(NAcVp) represents 2'-deoxy-2'-NHAc-uridine-3'-phosphate-4'-vinyl phosphate (the specific structures of T(MOE), A(C16), A(LNA), T(LNA), 5mC(LNA), and U(NAcVp) are as described in the relevant section of the "Definitions"). Also, C(SNA), A(SNA), and T(SNA) are nucleotides with the structures described in the above embodiment [1-11]; = represents a phosphorothioate bond (5'-3' bond), \ represents a phosphorodithioate bond (5'-3' bond); p represents a phosphate residue (-P(O)(OH) 2 ); p = thiophosphate residue (-P(S)(OH) 2 This indicates that, in the chemical structure notation in the examples, when "=" (phosphorothioate bond) is not indicated between two adjacent nucleosides, the internucleoside bond (5'-3' bond) between those two nucleosides represents a phosphodiester bond.
[0289] (In Vitro Activity Evaluation) 1. Evaluation of TSLP mRNA expression suppression in human cells Normal human bronchial epithelial cells (NHBE, LONZA, catalog number CC-2540) were used. Using Opti-MEM (registered trademark) (Thermo Fisher Scientific, catalog numbers 31985062 or 31985070) as a medium, siRNA and LipofectamineRNAiMax (Thermo Fisher Scientific, catalog numbers 13778075 or 13778150) were mixed and incubated at room temperature for 5 minutes, then added to a 96-well plate at a concentration of 20 μL per well. Next, 100 μL of NHBE cells suspended in bronchial epithelial growth medium (LONZA, catalog number CC-3170) is added to each well in a 1.5 x 10⁶ 4 Transfection was performed by adding the siRNA to form cells. Single-concentration experiments were conducted at 10 nM, and dose-response experiments were conducted at final siRNA concentrations ranging from 0.002 to 10 nM. (37°C, 5% CO2) 2After culturing for two days under these conditions, culture was restarted by adding 20 μL of bronchial epithelial growth medium containing Poly(I:C) (Tocris Bioscience, catalog number 4287 / 10) per well, and 10 μg / mL Poly(I:C) stimulation was initiated. Four hours after Poly(I:C) stimulation, RNA was isolated from the cells, and the human TSLP mRNA expression level was measured by real-time PCR. RNA was extracted from the cells using RNeasy® Mini Kit (QIAGEN, catalog number 74106), and cDNA was obtained by DNase treatment and reverse transcription reaction using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500). Using the obtained cDNA as a template, real-time PCR was performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) was used as the real-time PCR reagent, and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, catalog numbers 4331182, 4351372, 4351370, or 4351368) was used as the primer-probe set to measure human TSLP and human B2M. The measurement results were analyzed using the ΔΔCt method with human B2M as the reference gene. The expression level (%) (ii) and expression inhibition rate (%) (100%-ii) were calculated, with the expression level (i) of human TSLP mRNA in siRNA-untreated cells with only the transfection reagent added set to 100%. The expression level (%) (expression inhibition rate (%)) and IC of human TSLP at 10 nM obtained by this method using the example compound were calculated. 50 The values are listed in Tables 8-1 to 8-2 and Tables 9 to 15.
[0290] (In Vivo Test (1)) 1. Effect on bronchial asthma Mice in which bronchial asthma is induced by administration of ovalbumin (OVA) are used. The example compound of the present invention is administered transpulmonaryly at a frequency of once every week to once every month, and airway hyperresponsiveness, the number of inflammatory cells in bronchoalveolar lavage fluid (BALF), etc. are evaluated. The mice used are hTSLP / hTSLPR / hIL7R knock-in mice (Common Name: B-hTSLP / hTSLPR mice plus, Stock Number: 112744) purchased from Biocytogene Pharmaceuticals (Beijing).
[0291] 2. Evaluation of mRNA expression in tissues TSLP mRNA expression in mouse tissues (lungs, liver, kidneys) collected after administration of the example compound was evaluated using real-time PCR. RNA was extracted from the tissue using TRIZOL® Reagent (Thermo Fisher Scientific, catalog number 15596) and RNeasy® Mini Kit (QIAGEN, catalog number 74106). Then, DNase treatment and reverse transcription were performed using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500) to obtain cDNA. Using the obtained cDNA as a template, real-time PCR is performed using the QuantStudio® 3 Real-Time PCR System (Thermo Fisher Scientific). TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) is used as the real-time PCR reagent, and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, one of catalog numbers 4331182, 4351372, 4351370, or 4351368) is used as the primer-probe set to measure human TSLP and mouse ACTB. The measurement results were analyzed using the ΔΔCt method with a reference gene, and the expression level of TSLP mRNA was shown with the expression in the control animal set to 100%.
[0292] (In Vivo Study (2)) 1. In vivo intratracheal administration of siRNA in mice was performed using hTSLP / hTSLPR / hIL7R knock-in mice (Common Name: B-hTSLP / hTSLPR mice plus, Stock Number: 112744) purchased from Biocytogene Pharmaceuticals (Beijing). Female mice were administered 50 μL of isotonic saline and 5.0 mg / kg of siRNA identified as TSM-2 and TSM-3 in Table 7-1 via an intratracheal inhalation device (Toray Precision, model number FPS-050-A1). Five mice were administered per group. On the fifth day after administration, 50 μL of Alternaria extract (ITEA, 4-AT-001, 2 mg / mL PBS solution) was administered via an endotracheal inhaler to induce TSLP mRNA expression in the lungs. Four hours after administration of the Alternaria extract, the animals were euthanized, and lung tissue was collected. The collected lung tissue was immersed in RNAlater® Stabilization Solution (Thermo Fisher Scientific, catalog number AM7021) and stored under refrigeration.
[0293] 2. Evaluation of mRNA Expression in Tissue TSLP mRNA expression in mouse lung tissue collected after administration of the example compound was evaluated using real-time PCR. RNA was extracted from the tissue using TRIZOL® Reagent (Thermo Fisher Scientific, catalog number 15596018), chloroform (Fujifilm Wako Pure Chemical Industries, 038-02606), and RNeasy® Mini Kit (QIAGEN, catalog number 74106). Then, DNase treatment and reverse transcription were performed using SuperScriptIV VILO master mix (Thermo Fisher Scientific, catalog number 11766500) to obtain cDNA. Real-time PCR was performed using the obtained cDNA as a template with the QuantStudio® 3 Real-time PCR System (Thermo Fisher Scientific). TaqMan® Fast Advanced Master Mix (Thermo Fisher Scientific, catalog number 4444557) was used as the real-time PCR reagent, and TaqMan® Gene Expression Assays (Thermo Fisher Scientific, catalog number 4351368) was used as the primer-probe set to measure TSLP and B2M in mice. The measurement results were analyzed using the ΔΔCt method with a reference gene, and the TSLP mRNA expression level was shown with the expression in the control animal set to 100%. The results are shown in the table below.
[0294]
[0295] As shown in the data in Table 16 above, administration of 5.0 mg / kg of TSM-2 and TSM-3 siRNA resulted in knockdown of TSLP mRNA expression in the lungs.
[0296] Accession No. 1: Nucleic Acid Sequence of Human TSLP mRNA 1 atcagggaga ctccaactta aggcaacagc atgggtgaat aagggcttcc tgtggactgg 61 caatgagagg caaaacctgg tgcttgagca ctggccccta aggcaggcct tacagatctc 121 ttacactcgt ggtgggaaga gtttagtgtg aaactggggt ggaattgggt gtccacgtat 181 gttccctttt gccttactat atgttctgtc agtttctttc aggaaaatct tcatcttaca 241 acttgtaggg ctggtgttaa cttacgactt cactaactgt gactttgaga agattaaagc 301 agcctatctc agtactattt ctaaagacct gattacatat atgagtggga ccaaaagtac 361 cgagttcaac aacaccgtct cttgtagcaa tcggccacat tgccttactg aaatccagag 421 cctaaccttc aatcccaccg ccggctgcgc gtcgctcgcc aaagaaatgt tcgccatgaa 481 aactaaggct gccttagcta tctggtgccc aggctattcg gaaactcaga taaatgctac 541 tcaggcaatg aagaagagga gaaaaaggaa agtcacaacc aataaatgtc tggaacaagt 601 gtcacaatta caaggattgt ggcgtcgctt caatcgacct ttactgaaac aacagtaaac 661 catctttatt atggtcatat ttcacagcac caaaataaat catctttatt aagtagatga 721 aacattaact ctaactgtga caaagaagac cacaaatagt tatcttttaa ttacagaaga 781 gtttcttaac ttacttttgt aagtttttat tgtgtaagtt tataatgcag gggaagtact841 actcctcaa tgttgaggga agcttccata acatgatga ctggctcat ggcagtaatt 901 ctcggctgta gttgcataag cattgctca gaggaaaatc caaagtgca gcaggagaac 961 tcttccct gaaaattagaattaattaaccatta aaccaata 1021 aagacagaca ttccttctac atgtaatgac acttcttgtg ttaaactaaa atttacaag 1081 agaagaagt gaaagcaat ggggttcac aaatagttgt aatatagtg aagcaatttg 1141 aaatatttt caagcaaagat tattctaagat cattctagt 1201 acagacaaga gtgtatata caagtagatc ctgagaagta cctttgttac agctactata 1261 atatacata taaattatag atctacttt atttattt gtgaacactt ttgaaatgt 1321 acatgctttct ttgtattcga aaat3attttc cttatgaatc atctccaa tctagttaga caatttgcac acatactttt ctaagggaca 1441 ttatctcct tcaggttt acctccactc cccactgact gctcccctt 1501 atacctgttg gccctgccta taggagaa taggagg6cagtggatga tgcaatcatc ctttcttaa attatgtcac tagtcttta tttttcccc tcttgaactt 1621 tcctcacacc tggaagaac aaagtaggaa aaagtgaaca ggggatgtca aatcgattct 1681tgaattcccg ctgcaagcta gagccgcagg caccctctca ctcaatttcc actcagaacc 1741 ctataaacac cagtgggaag ggcaacccac tgcacgtggg aatgcactga tttttcctag 1801 gagtagacat gttcctctaa ttactcctg agggttac 1861 gtggggaagt tcaatgtcct taaatccatc ttacttgcca acaggtaaga ggaagcttac 1921 attacatgtc cagtccacat ttaaagagca cttactgtgg aacaagcctt cagccaaaca 1981 atggggatag aaaagtaggt aagactcagc agactgtc aataggcagt ttcttttgtc ctgaggaaaa tcaggacatg cctgctttct aaaaatcttc 2101 ctctgaagac ctgacccaag ctcttaaatg ctattgtaag agaaatttct ttgtctatta 2161 actccatttt agtagggatt cactgactag attttactga actatgaattatacaatt 221tacaattt caaaattttg ggcccaattc ccctaaaaga attgaggatt agggagaaag 2281 gagacaactc aaagtcatcc cattaagtgc agtttctttg aatcttctgc tttatcttta 2341 aaaatttgta taatttatat attttattct atgtgttcca tagatatctt 2401 tacaatt tcaattaaaa gtaatgggca agagattgca tcatactaat 2461 ttagtaagaa cgttcccaaa tgttgtaaca atgtggatca tacatctctg gttttttaaa 2521tgtattgagg ctttcttggt ggactagtat agtatacggt cagttatgtc atgtttcat 2581 gtcataaa aaggaagttg caaattgtga
[0297] Accession Number 2: Nucleic Acid Sequence of Cynomolgus Monkey TSLP mRNA 1 agaatagact tctttttcaa tgaatgctgt ggtgacttga gtacaacaca tgaagaattc 61 cagaaaagag ccacttttga agtcagcggt gaatcagagg ttttctgact ctctccagtg 121 ccttctatga aaaagagttc aactctggct tcagtttgtc ccttacgctt ttccggaatc 181 cctcgacatt tcctgctctt tttcccgggc actgtatggc ctgtgacatt tgctgggact 241 cacacacggc gtccaacctc cttgctccga gcgatgactc ctaggaactt ccctagtacc 301 agagcgatgc aggctctgac acgcgagggc ggggggcggg gtgggggagg gggtggggga 361 tgaacgggga agcggaaggg aaggagagag aaaggggacc tgggtgtaga gagggcccag 421 ggcagcatga gccaagctag ggcggagcag ggggttcgtc tcagcaacgt gatcagtgtc 481 agcctttccc tcccttcaac gctccattgg tgctgctgga actcggaaga ctgctagaca 541 gacatcctcc agggagctct ccctgactgc ccttttaagc actcttttct ggatcaacaa 601 tagtttgcta gcacaaatct gagcccgcca tctcgttgct tctcctgtct ctaaaacctg 661 tgcccgcgct caggccccag gtgacagacg ttttccagtc tatgctgcgc agggctaagc 721 ctctgggagg cagagctcac gaaaacgtgc gccgcctctg ggaaagctga gctcaggaca 781 gcatcctctc cttgcgctca ccgctaggca tccagcagag cggtctcctcaagtttaaca 841 ctggctttaa gagtgggact gtgaaggtgg ctggcactg gatttgtgg ttttaaagt 901 tctgacacc tactagaag tgtagagga cccttcagcc cctaggtgc ccctagtcac 961 caagacttgaccta cgtagtcagg aaaagtagga ttttgagaa 1021 caagcacat cagatctttc cccattatt tcaacctt atcgttcctg cccctaggt 1081 tctgtcacg gttgcacatt taatgcttc acatggaagt gctgttgaag actgagactg ccactaac1cacctac141 caccatact gcacagtttc ttactagcca aggagaaggg 1201 aaagcattag ttgaaggcgg ccacacgaaa ttctcaaaga tgttcaggat gcatgggaca 1261 gtagcaagg actccaatc cttacagtgg gatgctggttt cagaaggtgt 1 ttcaaccaaaa tgaaatgccc tgtgggagaa agacactggt atccatttct 1381 taaaggacat taacacatat gagagttta gggcaagta aaaaggagga agttcttc 1441 aggaattct tcatcttca acttgtaggg ctggtggtaa1cactactacgactt1cactacgactt agattgaagc agactactc cgtactattt ctaaagacct gattacatat 1561 atgagtggga ctaaaagtac cgactcaac aacaccgtct cctgtagca tcggccac 1621 tgccttactg aaatccagag cctaaccttc aatcccactc ccccgtcgctcgcc 1681 aaggaaatgt tcgccaggaa aacttaggctc tctgtgccc aggtattcg 1741 gaaactcaga taaatgctac tcaggcaatg agagagga gaaaaggaa agtcacaacctg g ataacaacc 1801 ctaggattgt ggcgtcgctt cattcgaact 1861 ttactgaaaa aacagtaaat catctttatt atggtcatat ttcacagcac caataaatc 1921 atctttatta agtagatgaa acattaactc taactgtgac acagagatta1 acaat8tacatagtt tatttttcta agttttatt gtttaataca 2041 aatttataat gcagggaag tactactctt aaatgttga gggaagctc cgtaacattg 2101 atgactggct taattggcag taattccag ccgtattgc ataagcatta ctcaagaat gccaactaggag ccaataactgag 2041 tccttgaaaa aggaaaaata ctgaactaaa 2221 tgatagctcc taaacttaca tttaaaggc agacattcct tctacatgta atgacacttc 2281 ttgtgttaaa ctaaaaattt acagagaag aaagtgaaag caatggtagatata tacaata3 tacaata attttcaagc aaatattgt gaaagtattc 2401 taagctaagt tttaatatt acctacaga CAagagtggt atataatag tagatcctga 2461 gaagtacctt tgttacagct accataata tatatagaga gatgtactttaatttattt 2521 tgtgaatgct tttgaaaatg tatatgttcc tttgtaattg acactatata tttcttaata 2581 aaataattct caaatttg
Claims
A nucleic acid molecule containing a sense strand and an antisense strand, or a salt thereof, or a solvate thereof, A nucleic acid molecule or a salt thereof, or a solvate thereof, wherein the strands form a double-stranded region, and the sense strand and the antisense strand contain nucleotide sequences selected from combinations of sense strands and antisense strands shown in the identification numbers in Tables 1-1 to 1-7. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 1, wherein the sense strand comprises 19 to 21 nucleotides in length and the antisense strand comprises 19 to 23 nucleotides in length. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 1, wherein at least one of the sense strand and the antisense strand comprises at least one modified nucleotide. A phosphate group (P(O)(OH)) is attached to the hydroxyl group at the 5' position of the nucleotide at the 5' end of the sense strand or the antisense strand. 2 ) or thiophosphate group (P(S)(OH) 2 A nucleic acid molecule or a salt thereof according to claim 3, or a solvate thereof, comprising a nucleotide substituted with ). The modified nucleotides are 2'-deoxynucleotides, 2'-O-methyl (2'-OMe) modified nucleotides, and 2'-O-C 16 H 33 Modified nucleotide, 2'-OCH 2 CH 2 OCH 3 A nucleic acid molecule or a salt thereof according to claim 3, comprising modification of one or more sugar groups selected from the group consisting of (2'-OMOE) modified nucleotides, 2'-deoxy-2'-fluoro(2'-F) modified nucleotides, 2'-deoxy-2'-NHAc(2'-NHAc) modified nucleotides, cross-linked nucleotides, acyclic nucleotides, and debasalized nucleotides, or a solvate thereof. The nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 3, wherein the modified nucleotide comprises modification of an internucleoside bond which is a phosphorothioate bond or a phosphorodithioate bond. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 3, wherein at least one of the sense strand and the antisense strand contains at least one phosphorothioate bond at its 5' end and 3' end, respectively. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 3, wherein at least one of the sense strand and the antisense strand contains at least one phosphorodithioate bond at its 5' or 3' end. The nucleic acid molecule or salt thereof, or solvates thereof, according to claim 3, wherein the sense strand and the antisense strand include a modified nucleotide sequence selected from the combinations of sense strands and antisense strands indicated by the identification numbers in Tables 3-1 to 3-13. A nucleic acid molecule or a salt thereof, or a solvate thereof, according to claim 8, wherein a functional molecule is bound to the sense chain. A nucleic acid molecule or salt thereof according to any one of claims 1 to 10, or a solvate thereof, which inhibits the expression of thymic interstitial lymphocyte necrosis factor (TSLP). A nucleic acid molecule or a salt thereof according to any one of claims 1 to 11, or a solvate thereof, comprising one or two mismatched bases at any position in the double-stranded region. The nucleic acid molecule according to any one of claims 1 to 12, or a salt thereof, or a solvate thereof, wherein the nucleic acid molecule is siRNA. A pharmaceutical composition comprising a nucleic acid molecule or siRNA or a salt thereof according to any one of claims 1 to 13, or a solvate thereof, and a pharmaceutically acceptable carrier. The pharmaceutical composition according to claim 14, used for treating diseases or symptoms involving thymic interstitial lymphocyte neogenesis factor (TSLP). The pharmaceutical composition according to claim 15, wherein the disease or symptom involving the thymic interstitial lymphocyte neogenesis factor (TSLP) is selected from the group consisting of bronchial asthma, chronic obstructive pulmonary disease (COPD), eosinophilic cough, sarcoidosis, pulmonary fibrosis, rhinitis, and sinusitis.
Citation Information
Patent Citations
RNA interference-mediated inhibition of thymic interstitial lymphocyte neogenesis factor (TSLP) gene expression using small interfering nucleic acids (siNAs).
JP2012521764A
Pharmaceutical compositions for the prevention or treatment of atopic diseases
JP2021533133A
Oligonucleotides down-regulating the expression of TSLP and the composites for cosmetic or pharmaceutical
KR1020160016475A
Oligonucleotides down-regulating the expression of TSLP and the composites for cosmetic or pharmaceutical
KR1020170029449A
Oligonucleotides down-regulating the expression of TSLP and the composites for cosmetic or pharmaceutical
KR1020170057194A