Variant microorganism for producing 1,3-propanediol and 1,3-propanediol production method using same

A genetically engineered Escherichia coli strain optimizes 1,3-propanediol production by minimizing byproducts, addressing the inefficiencies of traditional methods and improving sustainability.

WO2026095254A1PCT designated stage Publication Date: 2026-05-07ACTIVON CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
ACTIVON CO LTD
Filing Date
2025-06-30
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Traditional production methods for 1,3-propanediol, such as chemical synthesis and microbial fermentation using glycerol, face challenges with high costs and the generation of harmful byproducts like lactic acid and ethanol, necessitating improved microbial strains for eco-friendly and efficient production.

Method used

A genetically modified Escherichia coli strain with specific gene deletions and enhanced expression of certain genes, including dhaB, gdrAB, yqhD, zwf, and gnd, optimized for high 1,3-propanediol production by altering metabolic pathways to minimize byproducts.

Benefits of technology

The modified strain achieves high concentrations of 1,3-propanediol with reduced byproduct formation, enhancing the efficiency and environmental sustainability of the production process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025009187_07052026_PF_FP_ABST
    Figure KR2025009187_07052026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a variant microorganism for producing 1,3-propanediol and a 1,3-propanediol production method using same. More specifically, genes of a microorganism are modified and recombined to produce 1,3-propanediol, by improving the citric acid cycle (TCA cycle) and the glycoxylate pathway in a strain having improved pentose phosphate (PP) and Entner-Doudoroff (ED) pathways. Therefore, a high concentration of 1,3-propanediol may be produced by using the variant microorganism according to the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

Mutant microorganism producing 1,3-propanediol and method for producing 1,3-propanediol using the same

[0001] The present invention relates to a mutant microorganism that produces 1,3-propanediol and a method for producing 1,3-propanediol using the same.

[0002] 1,3-Propanediol is a polyhydric alcohol with the chemical formula C3H8O2, generally obtained by fermenting corn starch liquid or sugar. 1,3-Propanediol is used in cosmetics as a solvent, skin emollient, preservative, to improve product texture and homogeneity, and to enhance absorption. Compared to 1,2-Propanediol, known as propylene glycol (PG), its manufacturing process is more eco-friendly and it has superior safety in cosmetics, playing an important role in the modern beauty industry.

[0003] Traditional production methods for 1,3-propanediol, which has a wide range of uses, rely mainly on chemical synthesis methods, such as the hydration of acrolein and the hydroformylation of ethylene oxide in the presence of phosphine. However, these chemical production methods have limitations due to high costs and the inclusion of environmentally harmful production processes.

[0004] To overcome these limitations, methods for producing 1,3-propanediol using microorganisms are being developed, typically using glycerol or sugars. However, the production of 1,3-propanediol using microorganisms has the disadvantage of producing various byproducts, such as lactic acid, acetic acid, ethanol, and 2,3-butanediol, through glycerol oxidation metabolism while simultaneously generating 1,3-propanediol as a glycerol reduction metabolite. Although various attempts are being made to increase the production of 1,3-propanediol while reducing these byproducts, much research is still needed to increase the production of 1,3-propanediol while suppressing the generation of byproducts.

[0005] One aspect of the present invention provides an Escherichia coli mutant microorganism having the ability to produce 1,3-propanediol, comprising the dhaB gene, gdrAB gene, and yqhD gene, having deleted the ldhA gene, poxB gene, adhE gene, pta gene, ackA gene, yciA gene, pdhR gene, and pgi gene, having increased expression of the zwf gene and gnd gene, and having deleted one or more of the iclR gene or arcA gene.

[0006] Another aspect of the present invention provides a method for producing 1,3-propanediol, comprising the steps of: culturing an Escherichia coli mutant microorganism in a medium containing glucose; and recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

[0007] One aspect provides an Escherichia coli mutant microorganism having the ability to produce 1,3-propanediol, comprising the dhaB gene, gdrAB gene, and yqhD gene, having deleted the ldhA gene, poxB gene, adhE gene, pta gene, ackA gene, yciA gene, pdhR gene, and pgi gene, having increased expression of the zwf gene and gnd gene, and having deleted one or more of the iclR gene or arcA gene.

[0008] In one embodiment, the Escherichia coli mutant microorganism may have an additional glpK gene deleted.

[0009] In one embodiment, the Escherichia coli mutant microorganism may have increased glpF gene expression.

[0010] Another aspect provides a method for producing 1,3-propanediol comprising the steps of: culturing an Escherichia coli mutant microorganism in a medium containing glucose; and recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

[0011] High concentrations of 1,3-propanediol can be produced by using the mutant microorganism according to the present invention.

[0012] Figure 1 is a schematic diagram showing the plasmid used to construct a strain that produces 1,3-propanediol at a high concentration.

[0013] Figure 2 illustrates the process of culturing a strain and producing 1,3-propanediol, showing a flask test method to confirm strain characteristics and a fermentation test method to confirm the effect by culturing in a fed-batch culture system.

[0014] Figure 3 is a graph showing A) 1,3-propanediol concentration and growth amount of the strain, and B) specific production rate over time when the E. coli PK19-D1Q1 strain was cultured in a fed-batch system.

[0015] One aspect of the present invention provides an Escherichia coli mutant microorganism having the ability to produce 1,3-propanediol (1,3-PDO), comprising the dhaB gene, gdrAB gene, and yqhD gene, having deleted the ldhA gene, poxB gene, adhE gene, pta gene, ackA gene, yciA gene, pdhR gene, and pgi gene, having increased expression of the zwf gene and gnd gene, and having deleted one or more of the iclR gene or arcA gene.

[0016] The above dhaB gene is a gene encoding glycerol dehydratase, and the protein expressed through the said gene may be an enzyme that converts glycerol into 3-HPA (3-hydroxypropionaldehyde).

[0017] The gdrAB gene is a gene encoding glycerol dehydratase reactivase, and the protein expressed through the gene may be an enzyme that converts glycerol to 3-HPA and then reactivates the inactivated glycerol dehydratase.

[0018] The above dhaB gene and gdrAB gene may be the gene sequences of Klebsiella pneumoniae.

[0019] The above yqhD gene is a gene encoding an aldehyde reductase that converts 3-HPA to 1,3-PDO through a reduction reaction, and the protein expressed through the said gene may be an enzyme that converts 3-HPA to 1,3-PDO through a reduction reaction.

[0020] The Escherichia coli mutant microorganism used in the present invention may be derived from the Escherichia coli K12 MG1655 strain.

[0021] The ldhA gene used in the present invention is a gene encoding the lactate dehydrogenase enzyme, and the lactate dehydrogenase is an enzyme that catalyzes the interconversion of pyruvate and lactic acid and the accompanying interconversion of NADH and NAD.

[0022] The poxB gene used in the present invention is a gene encoding pyruvate oxidase, and said pyruvate oxidase is an enzyme that converts pyruvate into acetic acid.

[0023] The adhE gene used in the present invention is a gene encoding bifunctional aldehyde-alcohol dehydrogenase, and said aldehyde-alcohol dehydrogenase is an enzyme that plays the role of oxidizing alcohol to aldehyde or reducing aldehyde to alcohol.

[0024] The pta gene used in the present invention is a gene encoding phosphate acetyltransferase, and said phosphate acetyltransferase is an enzyme that converts acetyl-CoA into acetyl phosphate.

[0025] The ackA gene used in the present invention is a gene encoding acetate kinase, and the acetate kinase is an enzyme that converts acetyl-phosphate and ADP into acetate and ATP.

[0026] The yciA gene used in the present invention is a gene encoding acyl-CoA thioesterase, and said acyl-CoA thioesterase is an enzyme that breaks down acyl-CoA into an acyl group and CoA, and is an enzyme involved in intracellular energy production and fatty acid metabolism.

[0027] As used in the present invention, "deletion" encompasses the modification, substitution, or deletion of part or all bases of a gene to prevent the production of the protein encoded by the gene or to prevent the produced protein from exhibiting its inherent activity. Gene deletion in the present invention blocks the reaction or pathway involving the corresponding gene within the microorganism.

[0028] The pdhR gene used in the present invention is a gene encoding a pyruvate dehydrogenase complex repressor, and said pyruvate dehydrogenase complex repressor inhibits the expression of pyruvate dehydrogenase. Pyruvate dehydrogenase converts pyruvate into acetyl-CoA, and acetyl-CoA enters the TCA cycle, which is one of the important metabolic pathways, or enters the fatty acid production pathway or the acetic acid production pathway.

[0029] The pgi gene used in the present invention is a gene encoding glucose-6-phosphate isomerase, and the glucose-6-phosphate isomerase plays a role in converting glucose-6-phosphate into fructose-6-phosphate. In the present invention, by deleting the pgi gene, glucose does not flow through the EMP (Embden-Meyerhof-Parnase) pathway but flows through the PP (pentose phosphate) pathway and the ED (Entner-Doudoroff) pathway, thereby enabling the production of more reducing power.

[0030] The above zwf gene is a gene encoding glucose-6-phosphate 1-dehydrogenase, which is an enzyme that catalyzes the oxidation of glucose 6-phosphate to 6-phosphogluconolactone.

[0031] Increasing the expression of the above zwf gene may be a process that enhances carbon influx through the ED (Entner-Doudoroff) pathway and the PP (pentose phosphate) pathway. Meanwhile, increasing the expression of the zwf gene may be due to the substitution of a promoter with a potent promoter.

[0032] The above gnd gene is a gene encoding 6-phosphogluconate dehydrogenase, which is an enzyme that converts 6-phosphogluconate into ribulose-5-phosphate and converts NADP+ into NADPH by performing an oxidative dehydrogenation reaction. Meanwhile, further increasing the expression of the above gnd gene may be achieved by replacing the promoter with a potent promoter.

[0033] The promoter used in the present invention is a site on DNA to which RNA polymerase binds to initiate gene transcription, and is located upstream of the mRNA transcription initiation site, that is, 5' upstream. For example, when a prokaryotic cell is used as the host, powerful promoters capable of initiating transcription include the pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, and trc promoter, and preferably, the trc promoter or lac promoter may be used.

[0034] The above iclR gene may play a role in inhibiting the glyoxylate pathway gene in Escherichia coli strains, through which isocitrate is converted to glyoxylate and succinate in the glyoxylate pathway, and this process may activate a carbon-reducing pathway that does not generate CO2.

[0035] The above arcA gene encodes an aerobic respiration regulatory protein in Escherichia coli strains and may play a role in suppressing various genes related to the TCA cycle under oxygen-deficient culture conditions.

[0036] In one embodiment, the deletion of one or more of the iclR gene or arcA gene may be such that both the iclR gene and the arcA gene are deleted.

[0037] In one embodiment, the Escherichia coli mutant microorganism may have an additional glpK gene deleted.

[0038] The above-mentioned glpK gene is a gene encoding glycerol kinase and can play a role in converting glycerol into DHAP. Deletion of the glpK gene may inhibit the consumption of glycerol by glycerol kinase.

[0039] In one embodiment, the Escherichia coli mutant microorganism may have increased glpF gene expression.

[0040] The above-mentioned glpF gene may code for a glycerol uptake facilitator. Meanwhile, further increasing the expression of the above-mentioned glpF gene may be achieved by replacing the promoter with a potent promoter. The potent promoter may be the promoter described above, and preferably, a trc promoter or a lac promoter may be used.

[0041] In one embodiment, the above-mentioned Escherichia coli mutant microorganism may have been deposited at the Korea Biotechnology Research Institute’s Biological Resource Center (KCTC) as KCTC16327BP on May 12, 2025.

[0042]

[0043] Another aspect provides a method for producing 1,3-propanediol comprising the steps of: culturing an Escherichia coli mutant microorganism in a medium containing glucose; and recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.

[0044] The Escherichia coli mutant microorganism used in the present invention may be derived from the Escherichia coli K12 MG1655 strain.

[0045] The above Escherichia coli may be a mutant microorganism having the ability to produce 1,3-propanediol, comprising the dhaB gene, gdrAB gene, and yqhD gene, having deleted the ldhA gene, poxB gene, adhE gene, pta gene, ackA gene, yciA gene, pdhR gene, and pgi gene, having increased expression of the zwf gene and gnd gene, and having deleted one or more of the iclR gene or arcA gene.

[0046] In one embodiment, the Escherichia coli mutant microorganism may have an additional glpK gene deleted.

[0047] In one embodiment, the Escherichia coli mutant microorganism may have increased glpF gene expression.

[0048] In one embodiment, the above-mentioned Escherichia coli mutant microorganism may have been deposited at the Korea Biotechnology Research Institute’s Biological Resource Center (KCTC) as KCTC16327BP on May 12, 2025.

[0049] According to one embodiment of the present invention, the medium must satisfy the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art.

[0050] More specifically, the medium may contain various carbon sources, nitrogen sources, and trace element components. The carbon sources include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These substances may be used individually or as a mixture, but are not limited thereto. The nitrogen sources may include peptone, yeast extract, meat juice, malt extract, corn steep liquid, soybean meal, and urea or inorganic compounds, such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen sources may also be used individually or as a mixture, but are not limited thereto. The above-mentioned source of phosphorus may include, but is not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. Additionally, the medium may contain, but is not limited to, metal salts such as magnesium sulfate or iron sulfate necessary for growth. Furthermore, it may include essential growth substances such as amino acids and vitamins. Suitable precursors may also be used in the medium. The above-mentioned medium or individual components may be added to the culture medium in a batch or continuous manner in a manner suitable for the culture process, but are not limited thereto.

[0051] According to one embodiment, the step of culturing microorganisms may include a step of growing microorganisms; and a step of producing 1,3-propanediol.

[0052] According to one embodiment, the culture medium for the step of growing the microorganism may include glucose, potassium dihydrogen phosphate (KH2PO4), sodium dihydrate (Na2HPO4*2H2O), magnesium sulfate (MgSO4), ammonium sulfate ((NH4)2SO4), trace solution, yeast extract, and antibiotics, but is not limited thereto. Additionally, the antibiotic may be chloramphenicol or kanamycin, but is not limited thereto.

[0053] According to one embodiment, the glucose may be included in the medium at 10 g / L to 30 g / L, 10 g / L to 25 g / L, or 15 g / L to 30 g / L, and specifically at 15 g / L to 25 g / L.

[0054] According to one embodiment, the potassium dihydrogen phosphate may be included in the medium at 1 g / L to 5 g / L, 1 g / L to 4 g / L, or 1 g / L to 3 g / L, and specifically, may be included in the medium at 1 g / L to 2 g / L.

[0055] According to one embodiment, the sodium dihydrate may be included in the medium at 2 g / L to 10 g / L, 2 g / L to 8 g / L, 3 g / L to 9 g / L, or 4 g / L to 9 g / L, and specifically, may be included in the medium at 4 g / L to 8 g / L.

[0056] According to one embodiment, the magnesium sulfate may be included in the medium at an amount of 0.1 g / L to 0.5 g / L, 0.1 g / L to 0.4 g / L, 0.1 g / L to 0.3 g / L, or 0.2 g / L to 0.5 g / L, and specifically, at an amount of 0.2 g / L to 0.3 g / L.

[0057] According to one embodiment, the ammonium sulfate may be included in the medium at 1 g / L to 5 g / L or 1 g / L to 4 g / L, and specifically at 1 g / L to 3 g / L.

[0058] According to one embodiment, the yeast extract may be included in the medium at an amount of 0.1 g / L to 2 g / L, 0.1 g / L to 1.5 g / L, 0.2 g / L to 2 g / L, or 0.2 g / L to 1.5 g / L, and specifically, at an amount of 0.3 g / L to 1 g / L.

[0059] According to one embodiment, the antibiotic may be included in an amount of 0.05 g / L to 0.1 g / L, and one to five types of antibiotics may be used in combination, and a person skilled in the art may adjust the amount appropriately according to the culture medium.

[0060] According to one embodiment, the Trace solution may be added in an amount of 0.1 ml to 3 ml, specifically 0.5 ml to 1.5 ml.

[0061] According to one embodiment, the medium for the step of producing 1,3-propanediol may comprise glucose, potassium dihydrogen phosphate (KH2PO4), sodium dihydrate (Na2HPO4*2H2O or Na2HPO4*7H2O), magnesium sulfate (MgSO4), ammonium sulfate ((NH4)2SO4), trace solution, yeast extract, glycerol, antibiotic, IPTG, and coenzyme-B12, but is not limited thereto. Additionally, the antibiotic may be chloramphenicol or kanamycin, but is not limited thereto.

[0062] According to one embodiment, the glucose may be included in the medium at 10 g / L to 30 g / L, 10 g / L to 25 g / L, or 15 g / L to 30 g / L, and specifically at 15 g / L to 25 g / L.

[0063] According to one embodiment, the potassium dihydrogen phosphate may be included in the medium at 1 g / L to 8 g / L, 1 g / L to 6 g / L, or 1 g / L to 5 g / L, and specifically, may be included in the medium at 1 g / L to 4 g / L.

[0064] According to one embodiment, the sodium dihydrate may be used as Na2HPO4*2H2O or Na2HPO4*7H2O, and may be included in the medium at 3 g / L to 20 g / L, 3 g / L to 18 g / L, 4 g / L to 20 g / L, or 4 g / L to 18 g / L, and specifically, may be included in the medium at 5 g / L to 15 g / L.

[0065] According to one embodiment, the magnesium sulfate may be included in the medium at an amount of 0.1 g / L to 0.5 g / L, 0.1 g / L to 0.4 g / L, 0.1 g / L to 0.3 g / L, or 0.2 g / L to 0.5 g / L, and specifically, at an amount of 0.2 g / L to 0.3 g / L.

[0066] According to one embodiment, the ammonium sulfate may be included in the medium at 1 g / L to 5 g / L or 1 g / L to 4 g / L, and specifically at 1 g / L to 3 g / L.

[0067] According to one embodiment, the yeast extract may be included in the medium at an amount of 0.1 g / L to 2 g / L, 0.1 g / L to 1.5 g / L, 0.2 g / L to 2 g / L, or 0.2 g / L to 1.5 g / L, and specifically, at an amount of 0.3 g / L to 1 g / L.

[0068] According to one embodiment, the glycerol may be included in the medium at 5 g / L to 15 g / L, 5 g / L to 10 g / L, 7 g / L to 15 g / L, or 7 g / L to 13 g / L, and specifically, may be included in the medium at 7 g / L to 10 g / L.

[0069] According to one embodiment, the antibiotic may be included in an amount of 0.05 g / L to 0.1 g / L, and one to five types of antibiotics may be used in combination, and a person skilled in the art may adjust the amount appropriately according to the culture medium.

[0070] According to one embodiment, the Trace solution may be added in an amount of 0.1 ml to 3 ml, specifically 0.5 ml to 1.5 ml.

[0071] According to one embodiment, IPTG can be added in an amount of 0.1 ml to 3 ml, specifically 0.5 ml to 1.5 ml.

[0072] According to one embodiment, the initial concentration of coenzyme-B12 can be added in an amount of 100 µl to 500 µl, 200 µl to 400 µl, and specifically 250 µl to 400 µl.

[0073] In the case of the above glucose, glycerol, and coenzyme-B12, additional doses may be administered as needed.

[0074] According to one embodiment, the step of culturing the microorganism may be to cultivate at 25°C to 40°C, and specifically may be to cultivate at 27°C to 37°C or 29°C to 37°C.

[0075] According to one embodiment, the step of culturing the microorganism may involve administering glycerol 2 to 5 hours after the start of cultivation, or administering it 2 to 4 hours, or 2.5 to 3.5 hours after cultivation. Administering the glycerol may mean an induction process to produce 1,3-propanediol.

[0076] According to one embodiment, the step of recovering 1,3-propanediol may involve removing solids by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0077] According to one embodiment, the step of recovering the 1,3-propanediol may include a process of purifying the 1,3-propanediol.

[0078] One or more specific examples are described in more detail below through embodiments. However, these embodiments are intended to illustrate one or more specific examples and the scope of the present invention is not limited to these embodiments.

[0079]

[0080] One or more specific examples are described in more detail below through embodiments. However, these embodiments are intended to illustrate one or more specific examples and the scope of the present invention is not limited to these embodiments.

[0081]

[0082] Example 1: Materials and Method

[0083] All restriction enzymes, DNA polymerases, and other DNA modifying enzymes for gene cloning were purchased from New England Bio-Labs (Beverly, MA, USA). Plasmid isolation, DNA extraction, and isolation were performed using mini-plasmid isolation kits, DNA gel extraction kits, and genomic DNA isolation kits purchased from Cosmotech Co. Ltd. (Seoul) and Promega (Madison, Wisconsin, USA), respectively. RNA isolation kits were purchased from Qiagen (Mannheim, Germany). The iScript cDNA Synthesis Kit and SyBr green RT-PCR master mix were purchased from BioRad (Seoul, Korea). Oligonucleotide synthesis and DNA sequencing were conducted through Macrogen (Macrogen Co. Ltd., Seoul, Korea). Tryptone and yeast extract were purchased from Difco (Becton Dickinson, Franklin Lakes, NJ, USA). Glycerol, glucose, and all other chemicals and enzymes were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified in this specification.

[0084]

[0085] Example 2: Production of recombinant strain

[0086] The 1,3-propanediol production process is shown in Figure 1. A recombinant strain was constructed considering the 1,3-propanediol production pathway.

[0087] Recombinant strains were prepared and used, including existing strains and plasmids, as listed in Table 1 below. Genetic recombination was performed as follows. Escherichia coli DH5α was used for the development of overexpression and deletion plasmids. Chromosomal genetic manipulation was performed using the in-frame tagged deletion / insertion method. Briefly, 500 bp of the upstream (upstream fragment, A) and downstream (downstream fragment, B) regions of the target gene were PCR amplified and ligated using the nested PCR method. Subsequently, fragments AB were cloned into the pKOV vector at NotI, XbaI, or BamHI restriction sites. Using the resulting plasmids, the target gene was deleted from the chromosomal DNA via homologous recombination. Finally, deletion mutant strains were screened using PCR and verified by sequencing. For the replacement of all target genes, the target gene was first removed, and then the gene of interest was inserted using a similar in-frame tagged method.

[0088] To construct a recombinant strain that produces high levels of 1,3-propanediol, a plasmid was used as shown in Figure 1.

[0089] The recombined strains using the above plasmid are as shown in Table 1 below. In Table 1 below, "Δ" indicates a gene deletion. Also, in Table 1 below, "::" indicates a gene sequence manipulation. For example, "ΔPedd::Ptrc" means that the existing promoter of the edd gene was deleted and replaced with the promoter trc.

[0090] Strain nameGenetic traitPlasmid 1Plasmid 2PK12-D1Q1E.Coli K12 MG1655ΔldhAΔpoxBΔadhEΔpta-ackAΔyciAΔpdhRΔpgiΔPzwf::PtrcΔPgnd::PtrcpDK7-dhaB123-gdrAB (D1)pQE80L-yqhD(Q1)PK15-D1Q1K12 & ΔiclRpDK7-dhaB123-gdrAB (D1)pQE80L-yqhD(Q1)PK16-D1Q1K12 & ΔarcApDK7-dhaB123-gdrAB (D1)pQE80L-yqhD(Q1)PK17-D1Q1K12 & ΔiclRΔarcApDK7-dhaB123-gdrAB (D1)pQE80L-yqhD(Q1)PK18-D1Q1K17 & ΔglpKpDK7-dhaB123-gdrAB (D1)pQE80L-yqhD(Q1)PK19-D1Q1K18 & ΔglpF::placpDK7-dhaB123-gdrAB (D1)pQE80L-yqhD(Q1)

[0091] The restriction enzymes used to modify the above genes, the related genes, and the protein and enzyme information associated with the genes are as shown in Table 2 below, and the primer sequences used to substitute and delete the genes are as shown in Table 3 below.

[0092] Gene restriction enzymes Proteins & Enzymes (Enzyme)ackANotI and XbaIAcetate kinase arcANotI and XbaIAerobic respiration control proteinadhENotI and XbaIBifunctional aldehyde-alcohol dehydrogenase edhaB123NdeI and HindIIIGlycerol dehydratasegdrABNdeI and HindIIIGlycerol dehydratase reactivaseglpFNotI and XbaIGlycerol uptake facilitator proteinglpKNotI and XbaIGlycerol kinaseGndNotI and XbaI6-phosphogluconate dehydrogenaseiclRNotI and XbaIDNA-binding transcriptional repressorldhANotI and XbaID-Lactate dehydrogenasepdhRNotI and XbaIPyruvate dehydrogenase complex repressorpgiNotI and XbaIGlucose-6-phosphogluconate isomerasepoxBNotI and XbaIPyruvate oxidaseptaNotI and XbaIPhosphate acetyltransferaseyciANotI and

[0093] 유전자서열번호프라이머 서열ackA1FP: GATCGCGGCCGCCTGCATCGGCAGGCTCAGCGCAAACAG2RP: CTAGAGGATCCGCGGACTGAATAGCGATTTCCGCCAGadhE3FP: CGGGGATCGCGGCCGCTACATAAAACGCCAATGGCTTATATG4RP: GGTCGACTCTAGACATCAGCCCGGATGGGCAAAGCCGarcA5FP: CCTGACTATCGACAATCCGCAGATCG6RP: GAACCTGAAGCTGAATATGGCCCTGatoB7FP: ATCTAAGCGGCCGCCACCTTACCGTTATGGGTGTTTTC8RP: CTGAAGGATCCAGTCTATTTCTTTGTTGGCGCACTGGdhaB1239FP: GGCGAAAATGAGACGTTGATCATATGATATTGGTCGTATGAATGTG10RP: CTATTAACGGCATGCTGaCCTCCgCTTAGCTTCCTTTACGCAGCTTATGCCGCTGCeda11FP: CCCGGGGATCGCGGCCGCACCACAAACATAACCTGCAAATCAC12RP: GAAATTGAGTTGTCGCGGCGCTGTTTCCTGTGTGAAATTGTTATCCEdd13FP: CCCGGGGATCGCGGCCGCACCACAAACATAACCTGCAAATCAC14RP: GAAATTGAGTTGTCGCGGCGCTGTTTCCTGTGTGAAATTGTTATCCgdrAB15FP: GGAAGCTAAGcGGAGGtCAGCATGCCGTTAATAGCCGGGATTG16RP: CCGCCAAAACAGCCAAGCTTTCTAGATCAGTTTCTCTCACTTAACglpF17FP: GATATTGAATGATAAGAAAGGCACCGCAAGG18RP: CTTCGCTGTCTGGCATACAGGTGAGAATTGglpK19FP: GAAATCAGTGTCATTTGGGGACTGGGGG20RP: CTTCGCTGTCTGGCATACAGGTGAGAATTGGnd21FP: CCCGGGGATCGCGGCCGCCCCGCTTATTCGCACCTTCCTTAATAAAAC22RP:CATTCTCCGGTCGACTCTAGAGTCGGTTGGAGTGGCGATGATGACATAATCgntR23FP: GTACCCGGGGATCGCGGCCGCCAAACAGCTGGTGCTCTCGCC24RP: CATTCTCCGGTCGACTCTAGAAGGCGGCTTTCAATCACATCAAAATCiclR25FP: CCACCAGCCCGTCAAAAGTGATATTACG26RP: CTTGTTTATCAAGAGTGTCTGAGCGTTGAGGldhA27FP: CTACGGATCCTCGCTTCCGCCAGCCTCGGACATTTCCTG28RP: AACAGCGGCCGCGTTTTCCGTCAGATCGACCTGCGCACCCTCpdhR29FP: GGTACCCGGGGATCGCGGCCGCATGCGTGTGTAAGTTTGCAATTCCG30RP: CATTCTCCGGTCGACTCTAGAAAGACTGGAAGGACGCCATATGGCpgi31FP: CGGTACCCGGGGATCGCGGCCGCTTTTCAGCCTTGGCACAAGGGAAG32RP: CCATTCTCCGGTCGACTCTAGAATAACAATTTCCCTTCATTGAATGAATGGpoxB33FP: ATCTAAGCGGCCGCCACCTTACCGTTATGGGTGTTTTC34RP: CTGAAGGATCCAGTCTATTTCTTTGTTGGCGCACTGGpta35FP: GATCGCGGCCGCCTGCATCGGCAGGCTCAGCGCAAACAG36RP: CTAGAGGATCCGCGGACTGAATAGCGATTTCCGCCAGyciA37FP: CCCGGGGATCGCGGCCGCAAGATGGCCCTGATCACTTTTGTTC38RP: GTCGACTCTAGATGGTCATTGAAAAGCCGAAGCCGAAACCyqhD39FP: CCATCACCATCACGGATCCATGAACAACTTTAATCTGCACAC40RP: CAAGCTCAGCTAATTAAGCTTTTAGCGGGCGGCTTCGTATATACzwf41FP: GTACCCGGGGATCGCGGCCGCTCTAGGGCGGCGGATTTGTCC42RP:CCATTCNCCGGTCGACTCTAGACTGGATTCTCACCAATAAAAAACG

[0094]

[0095] Example 3: Culture conditions for strain growth and 1,3-prophanediol production

[0096] The strain prepared in Example 1 above was cultured, and cultured according to the process shown in Figure 2 to produce 1,3-propanediol. Basically, the growth of the strain, by-products, and the concentration of 1,3-propanediol were checked by culturing using the Flask test method, and the strain producing the highest concentration of 1,3-propanediol was finally cultured using the Fermentation test method to confirm that it produces 1,3-propanediol at a high concentration through an incubator.

[0097]

[0098] 3-1. Flask test method culture

[0099] The strain growth media was prepared with the composition of Table 4 below, and the fermentation media for producing 1,3-propanediol was prepared with the composition of Table 5 below and cultured.

[0100] The culture conditions were 37℃ and 220 rpm, glycerol was administered after 3 hours of culture, 100 mM of glucose and glycerol were added 15 hours after inoculation, and 6.6 µl of Co-enzyme B12 was added every 3 hours.

[0101] Chemical(Growth media)g / L1Glucose202KH2PO41.63Na2HPO4*2H2O6.64MgSO4(x1000-250g / L)0.255(NH4)2SO4(500g / L)26Trace solution1ml7Yeast extract(250g / L)0.58Antibiotics(kanamycin)0.059Antibiotics(chloramphenicol)0.025

[0102] Chemical(Production media)g / L1Glucose202KH2PO41.63Na2HPO4*2H2O6.64MgSO4(x1000-250g / L)0.255(NH4)2SO4(500g / L)26Trace solution1 ml7Yeast extract(250g / L)0.58Glycerol9.29Antibiotics(kanamycin)0.0510Antibiotics(chloramphenicol)0.02511IPTG(59.57g / L:0.25M)1 ml12Coenzyme-B12(6,000ug / L)330 ul

[0103]

[0104] 3-2. Culture using the Fermentation Test Method

[0105] The strain growth media was prepared with the composition of Table 4 above, and the fermentation media for producing 1,3-propanediol was prepared with the composition of Table 6 below and cultured.

[0106] The culture conditions were 30℃ and 200–800 rpm, and glycerol was administered after 3 hours of culture. Glucose and glycerol were added intermittently to maintain levels between 30 mM and 250 mM. Co-enzyme B12 was added at a rate of 500 µl every 3 hours.

[0107] Chemical(Fermentor media)g / L1Glucose202KH2PO43.23Na2HPO4*7H2O13.24MgSO4(x1000-250g / L)0.255(NH4)2SO4(500g / L)76Trace solution1 ml7Yeast extract(250g / L)0.58Glycerol9.29Antibiotics(kanamycin)0.0510Antibiotics(chloramphenicol)0.02511IPTG(59.57g / L:0.25M)1 ml12Coenzyme-B12(6,000ug / L)330 ul

[0108]

[0109] Example 4: Comparison of 1,3-Propanediol Productivity through Modification of Citric Acid Cycle (TCA cycle) and Glyoxylate Cycle

[0110] In the production of 1,3-propanediol using microorganisms, glucose is used as a substrate for cell growth and the production of reducing power, and the yield of glucose affects the price of 1,3-propanediol.

[0111] iclR plays a role in inhibiting the expression of the gene aceBAK in the glyoxylate pathway. When aceBAK expression is inhibited, isocitrate is converted into glyoxylate and succinate through the glyoxylate pathway, and this process does not generate CO2, thereby allowing for a reduction in carbon loss. Accordingly, a PK15-D1Q1 strain was constructed by deleting the iclR gene from the K12-Q1D1 strain of Patent Application No. 10-2024-0061005 (hereinafter referred to as "PK12-Q1D1 strain").

[0112] Furthermore, the smooth carbon flow of the citric acid cycle (TCA cycle) prevents the accumulation of pyruvate and other inhibitors in 1,3-propanediol production. The arcA gene encodes a protein regulating aerobic respiration in E. coli and inhibits various genes related to the citric acid cycle under oxygen-deficient conditions during culture. Therefore, it was expected that removing the arcA gene would upregulate the expression of major citric acid cycle genes and glyoxylate bypass pathway genes, thereby increasing TCA pathway activity and facilitating the metabolism of inhibitory glucose-derived intermediates, which would enhance the production of 1,3-propanediol. Accordingly, the PK16-D1Q1 strain was constructed by deleting the arcA gene from the K12-Q1D1 strain. Additionally, the PK17-D1Q1 strain was constructed by simultaneously deleting the iclR and arcA genes from the K12-Q1D1 strain.

[0113] The above strains K12-Q1D1, PK15-D1Q1, PK16-D1Q1, and K17-Q1D1 were cultured to determine the 1,3-propanediol production and glucose yield. As a result, as shown in Table 7 below, the PK15-D1Q1 strain with the iclR gene deleted, the PK16-D1Q1 strain with the arcA gene deleted, and the PK17-D1Q1 strain with both iclR and arcA genes deleted simultaneously showed increased 1,3-propanediol production and increased glucose yield compared to the K12-Q1D1 strain.

[0114] Among the three strains, the PK15-D1Q1 strain had the highest glucose yield but a relatively low 1,3-propanediol production, and the PK16-D1Q1 strain had the highest 1,3-propanediol production but a relatively low glucose yield.

[0115] Through this, PK17-D1Q1, which has a 1,3-propanediol yield of 250 mM or more and a glucose yield of 2 mol / mol or more, was selected as the optimal strain.

[0116] Strain Name1,3-PDO(mM)Glucose Yield(mol / mol)PK12-D1Q11871.71PK15-D1Q12292.08PK16-D1Q12611.90PK17-D1Q12582.07

[0117]

[0118] Example 5: Comparison based on change in glycerol utilization route

[0119] Glycerol is used as an important substrate in microorganisms to perform various physiological and metabolic roles. In particular, in E. coli strains, glycerol is converted to glycerol-3-phosphate by glycerol kinase and enters the glycolysis pathway to be used as a growth and energy source for microorganisms. Therefore, to use glycerol for 1,3-propanediol production, the PK18-D1Q1 strain was constructed by deleting glpK, which codes for glycerol kinase, from the PK17-D1Q1 strain.

[0120] In addition, to facilitate the up-take of glycerol in the PK18-D1Q1 strain, the native promoter of the glpF gene encoding the glycerol uptake facilitator was replaced with the lac promoter to overexpress the glycerol uptake facilitator, thereby constructing the PK19-D1Q1 strain.

[0121] As a result of culturing the above PK17-D1Q1 strain, PK18-D1Q1, and PK19-D1Q1 strains, as shown in Table 8 below, the production of 1,3-propanediol was highest at 264 mM in the PK19-D1Q1 strain, and the glycerol yield was also relatively high at 1.00 mol / mol, so the PK19-D1Q1 strain was selected as the superior strain for producing 1,3-propanediol.

[0122] Strain Name1,3-PDO(mM)Glycerol Yield(mol / mol)PK17-D1Q12580.97PK18-D1Q12550.99PK19-D1Q12641.00

[0123]

[0124] Example 6: Confirmation of 1,3-Propanediol Production in Fed-batch Culture

[0125] Based on the results of Examples 4 and 5 above, the selected PK19-D1Q1 strain was fermented in a fed-batch culture fermenter, and as shown in Figure 3, 1,055 mM of 1,3-propanediol was produced in 48 hours. In addition, a high specific production rate of up to 3.5 mM / hgDCW was confirmed from 6 hours to 18 hours. Furthermore, the yield of 1,3-propanediol from glycerol was confirmed to be 0.99, and the yield of glucose was confirmed to be 2.01.

[0126]

[0127] Accordingly, the above-mentioned mutant strain PK19-D1Q1, which has improved 1,3-propanediol production, was deposited at the Korea Biotechnology Research Institute’s Biological Resource Center (KCTC) under accession number KCTC16327BP.

[0128] [Consignment Number]

[0129] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resource Center (KCTC)

[0130] Trustee Number: 16327BP

[0131] Date of Trust: May 12, 2025

[0132]

Claims

1. Includes the dhaB gene, gdrAB gene, and yqhD gene, and The ldhA, poxB, adhE, pta, ackA, yciA, pdhR, and pgi genes are deleted, The expression of the zwf and gnd genes increases, and One or more of the iclR gene or arcA gene are deleted, Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

2. In Paragraph 1, The above-mentioned Escherichia coli mutant microorganism is one in which the glpK gene is additionally deleted, Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

3. In Paragraph 2, The above-mentioned Escherichia coli mutant microorganism is one in which glpF gene expression is increased, Escherichia coli mutant microorganism capable of producing 1,3-propanediol.

4. A method for producing 1,3-propanediol comprising: a step of culturing the Escherichia coli mutant microorganism of claims 1 to 3 in a medium containing glucose; and a step of recovering 1,3-propanediol from the medium in which the Escherichia coli mutant microorganism is cultured.