Compositions and methods for delivering cyclin-dependent kinase-like 5 protein
AAV particles with AAV9 capsid variants and a CDKL5-encoding sequence, enhanced by a WPRE, provide a promising approach to deliver CDKL5 to CNS cells, targeting the cause of CDKL5 deficiency disorder and improving treatment efficacy.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- NEUROCRINE BIOSCIENCES INC
- Filing Date
- 2025-10-29
- Publication Date
- 2026-05-07
Smart Images

Figure IMGF000029_0001 
Figure IMGF000030_0001 
Figure IMGF000030_0002
Abstract
Description
COMPOSITIONS AND METHODS FOR DELIVERING CYCLIN-DEPENDENT KINASE-LIKE 5 PROTEINRelated Applications
[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 714,108, filed on October 30, 2024, the contents of which are incorporated herein by reference in their entirety.Sequence Listing
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing file, entitled 14640_0304-00304_SL.xml, was created on October 3, 2025, and is 137,503 bytes in size. The information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety.Field
[0003] Described herein are adeno-associated virus (AAV) particles comprising a viral genome (e.g., recombinant viral genome) encoding cyclin-dependent kinase-like 5 (CDKL5) proteins and peptides. Also described herein are compositions comprising said AAV particles, methods of making said AAV particles, and / or methods of delivering said AAV particles to a cell or subject. In some embodiments, the disclosure provides methods or uses for the treatment of CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome and / or other CDKL5-related disorders.Background
[0004] Cyclin-dependent kinase-like 5 (CDKL5) is a serine / threonine protein kinase and is also known as serine / threonine kinase 9 (STK9). Other aliases for CDKL5 include EIEE2, ISSX, CFAP247, and DEE2. It is encoded by the gene CDKL5 (Ensembl Gene ID No. ENSG00000008086), which is located on the X chromosome.
[0005] The CDKL5 protein is an enzyme and is thought to play an important role in brain development and regulation of response to oxidative stress. CDKL5 is thought to be expressed throughout the cell, including in the nucleus and cytoplasm of soma and dendrites.
[0006] CDKL5 is responsible for phosphorylation of a number of targets. CDKL5 may target and phosphorylate the gene MECP2, which has been characterized as important in thefunction of neurons and other brain cells, and in the maintenance of neuronal synapses, and is thought to be the causative agent for Rett syndrome. CDKL5 may also target and phosphorylate CEP131, which is thought to play a role in cell proliferation. CDKL5 may also target and phosphorylate MAP IS, DLG5, EB2, and / or ARHGEF, which are microtubule associated proteins, thought to play roles in neuronal division, differentiation, migration, and neurite growth. CDKL5 may also target and phosphorylate AKT and mTOR, which are thought to play roles in cell proliferation, migration and development.
[0007] Without being bound by theory, CDKL5 may be involved in the formation, growth, and migration of neurons. It may also play a role in cell division and / or transmission of chemical signals at neuronal synapses.
[0008] Mutations in CDKL5 are known to cause disease in subjects, e.g., human subjects. CDKL5 mutations lead to CDKL5 deficiency disorder (CDD). CDD is a neurodevelopmental disorder. It is characterized by nervous system symptoms including epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties and / or visual impairment. It is also characterized by low muscle tone and gastrointestinal reflux.
[0009] CDD can manifest with a broad array of clinical manifestations. Clinical manifestations of CDD comprise behavioral symptoms such as episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep. Clinical manifestations also comprise facial appearance changes including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than normal space between the nose and upper lip; an upturned nose; fuller lips; and / or widely-spaced teeth. Further clinical manifestations include difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, and cortical visual impairment or cortical blindness. Other manifestations include bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small, focused hand movements, gastroesophageal reflux and constipation.
[0010] CDD has an incidence of 1 in 42000 births in the USA, and 85% of cases occur in females. Typically, CDD patients are fully reliant on caregivers for the duration of their lives.
[0011] CDD is typically caused by de novo mutations in CDKL5. CDKL5 mutations in CDD patients result in a reduced amount of functional CDKL5 protein.
[0012] Existing treatments for patients with CDD focus on alleviating symptoms such as seizures. To date, there are limited treatments available for patients with CDD, and deliveryof treatments to the central nervous system (CNS) remains a significant challenge in the development of new and effective therapies.
[0013] The current standard of care for CDD is first line treatment with an anti-epileptic drug. Anti-epileptic drugs are known in the art, and include valproate and levetiracetam. Second line treatment for refractory patients comprises first line treatment plus additional anti-epileptic drugs such as clobazam and / or lamotrigine in combination with ganaxolone. However, ganaxolone has been reported to have short durability in treating subjects with CDD. Third line treatment introduces additional anti-epileptic drugs, such as topiramate, and / or alternative interventions, such as ketogenic diet and / or vagal nerve stimulation. However, seizures in CDD are commonly refractory to known treatments.
[0014] Therefore, a need remains for improved therapies and treatments that target the cause of CDD. In particular, there remains a need for pharmaceutical compositions and methods to treat CDD that can be delivered to the CNS for the treatment of CDD, and to ameliorate deficiencies of CDKL5 in subjects, e.g., human subjects.
[0015] Prior attempts at providing AAV capsids with improved properties, e.g., improved tropism suitable for delivery to the brain or CNS, have met with limited success. As such, there remains a need for effective methods of treatment using AAV capsid variants that are capable of delivering a payload of interest, e.g., CDKL5, to a target cell or tissue, e.g., a CNS cell or tissue.Summary
[0016] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 5) present at amino acids corresponding to positions 254-259 of the amino acid sequence of SEQ ID NO: 25, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 25, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 25.
[0017] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genomecomprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ENVSGSPHSKA (SEQ ID NO: 8) present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25.
[0018] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 1, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 8) present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1; and / or (ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 24, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 8) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24.
[0019] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 1; (ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 24; and / or (iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 25.
[0020] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 1; (ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 24; and / or (iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 25. In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 1; (ii) the amino acid sequence of SEQ ID NO: 24; and / or (iii) the amino acid sequence of SEQ ID NO: 25.
[0021] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 5) present at amino acids corresponding to positions 254-259 of the amino acid sequence of SEQ ID NO: 27, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 27, the amino acid R at position 250 numbered according to the amino acid sequence of SEQ ID NO: 27, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 27.
[0022] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ERVSGSPHSKA (SEQ ID NO: 10) present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 27, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27.
[0023] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 4, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 10) present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4; and / or (ii) an amino acid sequence that is least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 26, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 10) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26.
[0024] In some embodiments, AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 4; (ii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 26; and / or (iii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 27. In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 99% identical to SEQ ID NO: 4; (ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 26; and / or (iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 27. In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 4; (ii) the amino acid sequence of SEQ ID NO: 26; and / or (iii) the amino acid sequence of SEQ ID NO: 27.
[0025] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; andwherein the AAV9 capsid variant comprises HDSPHK (SEQ ID NO: 12) present at amino acids 252-257 of the amino acid sequence of SEQ ID NO: 47 and comprises the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 47.
[0026] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises HDSPHK (SEQ ID NO: 12) present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47.
[0027] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 45, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 12) present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45; and / or (ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 12) present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 and comprises the aminoacid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46.
[0028] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 45; (ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46; and / or (iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 47. In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45; (ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46; and / or (iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47. In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 45; (ii) the amino acid sequence of SEQ ID NO: 46; and / or (iii) the amino acid sequence of SEQ ID NO: 47.
[0029] In some embodiments, the recombinant viral genome encodes a wildtype CDKL5 protein. In some embodiments, the recombinant viral genome encodes a human CDKL5 protein.
[0030] In some embodiments, the encoded CDKL5 comprises the amino acid sequence of SEQ ID NO: 14 or any one of SEQ ID NOs: 34-37.
[0031] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identicalthereto. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15.
[0032] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16 or a nucleotide sequence that is at least 98% (e.g., at least 98% or at least 99%) identical thereto. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16.
[0033] In some embodiments, the WPRE is positioned 3’ relative to the CDKL5-encoding sequence. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or any one of SEQ ID NOs: 58-62, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 19.
[0034] In some embodiments, the recombinant viral genome further comprises a promoter operably linked to the CDKL5-encoding sequence. In some embodiments, the promoter is a human synapsin 1 (hSYNl) promoter or a chicken P-actin hybrid (CBh) promoter. In some embodiments, the promoter is a hSYNl promoter. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 18.
[0035] In some embodiments, the recombinant viral genome further comprises a polyadenylation (poly A) sequence. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20.
[0036] In some embodiments, the recombinant viral genome further comprises at least one inverted terminal repeat (ITR). In some embodiments, the at least one ITR comprises a 5’ ITR and a 3’ ITR. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21.
[0037] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one or more miR binding sites reduces or prevents expression of CDKL5 in dorsal root ganglia. In some embodiments, the one or more miR binding sites comprises one, two, three, or four miR183 binding sites. In some embodiments, the recombinant viral genome comprises a nucleotide sequence encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical. In some embodiments, each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 6. In some embodiments, each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.
[0038] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA183 (miR183) binding site series, wherein the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the miR183 binding site series consists of the nucleotide sequence of SEQ ID NO: 7.
[0039] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) a 5’ inverted terminal repeat (ITR); (b) a promoter; (c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence; (d) a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); (e) a polyadenylation (poly A) sequence; and (f) a 3’ ITR.
[0040] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (c) the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (e) the polyA sequence comprises the nucleotide sequence of SEQ IDNO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and / or (f) the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0041] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (c) the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0042] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (c) the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0043] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (c) the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0044] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0045] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0046] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21.
[0047] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order:(a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21.
[0048] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order:(a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21.
[0049] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the recombinant viral genome comprises a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 22.
[0050] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22.
[0051] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23.
[0052] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one ormore miR binding sites reduces or prevents expression of CDKL5 in dorsal root ganglia. In some embodiments, the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the nucleotide sequence encoding the one or more miR binding sites encodes four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 7.
[0053] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
[0054] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 1; (ii) the amino acid sequence of SEQ ID NO: 24; and / or (iii) the amino acid sequence of SEQ ID NO: 25; and wherein the recombinant viral genome comprises: (a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 17; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; (c) a cyclin-dependent kinase-like 5 (CDKL5)- encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19; (e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 6; (f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 20; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
[0055] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
[0056] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 4; (ii) the amino acid sequence of SEQ ID NO: 26; and / or (iii) the amino acid sequence of SEQ ID NO: 27; and wherein the recombinant viral genome comprises: (a) a 5’ inverted terminal repeat (5’ITR) comprising the nucleotide sequence of SEQ ID NO: 17; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; (c) a cyclin-dependent kinase-like 5 (CDKL5)- encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19; (e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; (f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 20; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
[0057] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
[0058] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 45; (ii) the amino acid sequence of SEQ ID NO: 46; and / or (iii) the amino acid sequence of SEQ ID NO: 47; and wherein the recombinant viral genome comprises: (a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 17; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; (c) a cyclin-dependent kinase-like 5 (CDKL5)- encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19; (e) optionally a nucleotide sequence encoding a microRNA binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; (f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 20; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
[0059] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
[0060] In some embodiments, the present disclosure provides a cell comprising the AAV particle described herein. In some embodiments, the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
[0061] In some embodiments, the present disclosure provides a method of making the AAV particle described herein, the method comprising: (i) providing a cell comprising the recombinant viral genome comprising a CDKL5-encoding sequence and a nucleic acid encoding the AAV9 capsid variant; and (ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV9 capsid variant; thereby making the AAV particle.
[0062] In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 1; (ii) the amino acid sequence of SEQ ID NO: 24; and / or (iii) the amino acid sequence of SEQ ID NO: 25; and the recombinant viral genome comprises: (a) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; (c) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19; (e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; (f) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
[0063] In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 4; (ii) the amino acid sequence of SEQ ID NO: 26; and / or (iii) the amino acid sequence of SEQ ID NO: 27; and the recombinant viral genome comprises: (a) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; (c) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; (d) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19; (e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; (f) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
[0064] In some embodiments, the present disclosure provides the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 45; (ii) the amino acid sequence of SEQ ID NO: 46; and / or (iii) the amino acid sequence of SEQ ID NO: 47; and the recombinant viral genome comprises: (a) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; (c) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQID NO: 16; (d) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19; (e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; (f) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
[0065] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
[0066] In some embodiments, the method of making further comprises, prior to step (i), introducing a nucleic acid comprising the recombinant viral genome into the cell. In some embodiments, the method of making further comprises, prior to step (i), introducing the nucleic acid encoding the AAV9 capsid variant into the cell. In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
[0067] In some embodiments, the present disclosure provides a pharmaceutical composition comprising the AAV particle described herein and a pharmaceutically acceptable excipient.
[0068] In some embodiments, the present disclosure provides a method of delivering an AAV particle encoding cyclin-dependent kinase-like 5 (CDKL5) to a cell, comprising administering an effective amount of the AAV particle described herein or the pharmaceutical composition described herein. In some embodiments, the cell is in a subject. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder.
[0069] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having a CDKL5-related disorder, or at least one symptom thereof, comprising administering to the subject an effective amount of the AAV particle described herein or the pharmaceutical composition described herein. In some embodiments, the CDKL5-related disorder is a CDKL5-related neurodegenerative or neuromuscular disorder. In some embodiments, the CDKL5-related neurodegenerative or neuromuscular disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome. In some embodiments, the present disclosure provides a method of treating a subject having or having or diagnosed with having a CDKL5-related disorder, or treating at least one symptom thereof, wherein the CDKL5-related disorder is CDKL5deficiency disorder (CDD), comprising administering to the subject an effective amount of the AAV particle described herein or the pharmaceutical composition described herein.
[0070] In some embodiments, the subject has one or more mutations in a CDKL5 gene. In some embodiments, the subject has a reduced level of CDKL5 activity as compared to a reference level in an individual who does not have a CDKL5-related disorder. In some embodiments, the treating results in prevention or progression of the disorder or at least one symptom thereof in the subject. In some embodiments, the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers. In some embodiments, the one or more biomarkers comprises neurofilament light chain or a marker of CDKL5 activity, e.g., as measured by phosphorylation levels of substrate proteins, e.g., MECP2, or as measured by mass spectrometry.
[0071] In some embodiments, the at least one symptom comprises epilepsy (e.g., early- onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than-normal space between the nose and upper lip; an upturned nose; full lips and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof.
[0072] In some embodiments, the subject is a human.
[0073] In some embodiments, the AAV particle or the pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject. In some embodiments, the cell, tissue, or region of the CNS comprises: the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, the cell, tissue, or region of the CNS is a cell, tissue, or region of the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum, and / or wherein the cell of the CNS is a glutamatergic neuron and / or GABAergic neuron.
[0074] In some embodiments, the AAV particle or pharmaceutical composition is delivered to the subject via intravenous administration.
[0075] In some embodiments, the method of delivering or treating further comprises evaluating, e.g., measuring, the level of CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject. In some embodiments, the level of CDKL5 protein expression is measured by an enzyme- linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, evaluating the level of CDKL5 gene, mRNA, and / or protein expression is performed before and after administering the AAV particle or pharmaceutical composition, optionally wherein the subject’s level of CDKL5 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of CDKL5 gene, mRNA, and / or protein expression after administration.
[0076] In some embodiments, the present disclosure provides the level of CDKL5 gene, mRNA, and / or protein expression is evaluated in a cell or tissue of the CNS in the subject. In some embodiments, the cell or tissue of the CNS comprises: the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, the cell or tissue of the CNS is a cell or tissue of the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum, and / or wherein the cell of the CNS is a glutamatergic neuron and / or GABAergic neuron.
[0077] In some embodiments, the subject’s level of CDKL5 protein expression after administration of the AAV particle or pharmaceutical composition is increased relative to the subject’s level of CDKL5 protein expression before administration of the AAV particle or pharmaceutical composition.
[0078] In some embodiments, the method of treating or delivering further comprises evaluating, e.g., measuring, the level of CDKL5 protein activity in the subject, e.g., in a cell or tissue of the subject. In some embodiments, the method of treating or delivering further comprises administering the AAV particle or pharmaceutical composition to the subject results in an increase in: (i) the level of CDKL5 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of CDKL5 activity in a cell, tissue, or fluid of an individual with a CDKL5-related disorder who has not been administered the AAV particle or pharmaceutical composition; (ii) the number and / or level of recombinant viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus,cerebellum, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or (iii) the level of CDKL5 protein expression, CDKL5 mRNA expression, or CDKL5 gene expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of CDKL5 protein expression, CDKL5 mRNA expression, or CDKL5 gene expression in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the AAV particle or pharmaceutical composition.
[0079] In some embodiments, the method of delivering or treating further comprises administering to the subject at least one additional agent and / or therapy suitable for treating the CDKL5-related disorder or at least one symptom thereof. In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0080] In some embodiments, the method of delivering or treating further comprises administering an immunosuppressant to the subject. In some embodiments, the immunosuppressant comprises adrenocorticotropic hormone, a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
[0081] In some embodiments, the present disclosure provides the AAV particle described herein or the pharmaceutical composition described herein, for use in the treatment of a CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0082] In some embodiments, the present disclosure provides the AAV particle or pharmaceutical composition described herein, wherein the subject has, has been diagnosed with having, or is at risk of having the CDKL5-related disorder or at least one symptom thereof; optionally wherein the CDKL5-related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0083] In some embodiments, the present disclosure provides use of the AAV particle described herein, or the pharmaceutical composition described herein, in the manufacture of a medicament for the treatment of an CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder(CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having the CDKL5-related disorder or at least one symptom thereof; optionally wherein the CDKL5- related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0084] In some embodiments, the present disclosure provides the AAV particle described herein or the pharmaceutical composition described herein for use in a method of treating a disorder described herein.Brief Description of the Drawings
[0085] FIGs. 1A-1E depict vector genome (VG) quantification (VG / diploid genome (DNA)) for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 38), Construct 1 (SEQ ID NO: 22), Construct 4 (SEQ ID NO: 39), Construct 7 (SEQ ID NO: 29), or Construct 6 (SEQ ID NO: 41). FIG. 1A depicts expression levels of human CDKL5 (hCDKL5) DNA relative to P-actin. FIG. IB depicts expression levels ofWPRE DNA relative to P-actin. FIG. 1C depicts expression levels of hCDKL5 DNA relative to mouse Cdkl5 (mCdkl5). FIG. ID depicts expression levels ofWPRE DNA relative to mCdkl5. FIG. IE depicts expression levels of mCdkl5 DNA relative to P-actin.
[0086] FIGs. 2A-2E depict transgene expression levels measured by RT-qPCR analysis of bulk RNA for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 38), Construct 1 (SEQ ID NO: 22), Construct 4 (SEQ ID NO: 39), Construct 7 (SEQ ID NO: 29), or Construct 6 (SEQ ID NO: 41). FIG. 2A depicts the mRNA levels of hCDKL5 relative to P-actin. FIG. 2B depicts the mRNA levels ofWPRE relative to P-actin. FIG. 2C depicts the mRNA levels of hCDKL5 relative to mCdkl5. FIG. 2D depicts the mRNA levels ofWPRE relative to mCdkl5. FIG. 2E depicts the mRNA levels of mCdkl5 relative to P-actin.
[0087] FIGs. 3A-3D depict the percentage of neurons that were hCDKL5-positive for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 5 (SEQ ID NO: 42), or Construct 8 (SEQ ID NO: 38), where a cell was considered hCDKL5 -positive if the hCDKL5 fluorescent area was greater than 0 pm2. FIG. 3A depicts the percentage of hCDKL5-positive neurons in the cortex. FIG. 3B depicts the percentage of hCDKL5-positive neurons in the CAI hippocampal region. FIG. 3C depicts the percentage of hCDKL5-positive neurons in the CA2 hippocampal region. FIG. 3D depicts the percentage of hCDKL5-positive neurons in the CA3 hippocampal region.
[0088] FIGs. 4A-4D depict the percentage of neurons that were hCDKL5-positive for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 5 (SEQ ID NO: 42), or Construct 8 (SEQ ID NO: 38), where a cell was considered hCDKL5-positive if the cell’s hCDKL5 fluorescent area was greater than the 25thpercentile of mCdkl5 fluorescent area. FIG. 4A depicts the percentage of hCDKL5-positive neurons in the cortex. FIG. 4B depicts the percentage of hCDKL5 -positive neurons in the CAI hippocampal region. FIG. 4C depicts the percentage of hCDKL5 -positive neurons in the CA2 hippocampal region. FIG. 4D depicts the percentage of hCDKL5-positive neurons in the CA3 hippocampal region.
[0089] FIGs. 5A-5D show the percentage of neurons that were mCdkl 5 -positive for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 5 (SEQ ID NO: 42), or Construct 8 (SEQ ID NO: 38), where a cell was considered mCdkl5-positive if the cell’s mCdkl5 fluorescent area was greater than 0 pm2. FIG. 5A depicts the percentage of mCdkl5-positive neurons in the cortex. FIG. 5B depicts the percentage of mCdkl5-positive neurons in the CAI hippocampal region. FIG. 5C depicts the percentage of mCdkl5-positive neurons in the CA2 hippocampal region. FIG. 5D depicts the percentage of mCdkl5-positive neurons in the CA3 hippocampal region.
[0090] FIGs. 6A-6D depict the percentage of mCdkl5-positive neurons that were hCDKL5- positive (i.e., the percentage of mCdkl5 / NeuN double-stained neurons that were hCDKL5 / mCdkl5 / NeuN triple stained) for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 5 (SEQ ID NO: 42), or Construct 8 (SEQ ID NO: 38). FIG. 6A depicts the percentage of mCdkl5-positive neurons that were hCDKL5-positive in the cortex. FIG. 6B depicts the percentage of mCdkl5-positive neurons that were hCDKL5 -positive in the CAI hippocampal region. FIG. 6C depicts the percentage of mCdkl 5 -positive neurons that were hCDKL5 -positive in the CA2 hippocampal region. FIG. 6D depicts the percentage of mCdkl5-positive neurons that were hCDKL5 -positive in the CA3 hippocampal region.
[0091] FIGs. 7A-7D depict the percentage of neurons expressing WPRE for mice at 4- weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22) or Construct 7 (SEQ ID NO: 29). FIG. 7A depicts the percentage of neurons with WPRE mRNA in the cortex. FIG. 7B depicts the percentage of neurons with WPRE mRNA in the CAI hippocampal region. FIG. 7C depicts the percentage of neurons with WPRE mRNA in the CA2 hippocampal region. FIG. 7D depicts the percentage of neurons with WPRE mRNA in the CA3 hippocampal region. 1
[0092] FIGs. 8A-8E depict CDKL5 transgene expression in the hippocampus (HPC), cortex (CTX), striatum (STR), and thalamus (Thai) 4 weeks after dosing mice via IV injection with PBS (Veh) or PHP.eB viral particles (denoted as AAV) carrying Construct 1 (SEQ ID NO: 22). FIG. 8A depicts mCdkl5 expression in a wildtype (WT) mouse. FIG. 8B depicts hCDKL5 expression in a mouse administered PHP.eB-Construct 1. FIG. 8C depicts a lack of hCDKL5 expression in a PBS-treated mouse. The percentage of neurons positive for mCDKL5 or hCDKL5 for mice treated with PBS or PHP.eB-Construct 1 are reported in FIG. 8D (mCDKL5) and FIG. 8E (hCDKL5). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0093] FIGs. 9A-9B depict transgene expression driven by the human synapsin (hSynl) promoter in Construct 1 (SEQ ID NO: 22). FIG. 9 A shows the injection site in the thalamus and FIG. 9B depicts hCDKL5 expression at the injection compared to a contralateral site 19 days post-injection.
[0094] FIGs. 10A-10C depict neuronal expression of hCDKL5 following injection with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 10A depicts hCDKL5 staining. FIG. 10B depicts NeuN staining. FIG. 10C depicts colocalization of hCDKL5 and NeuN staining.
[0095] FIG. HA depicts DAPI staining of neurons at an injection site following administration of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 11B depicts hCDKL5 -positive cells in the injection site. FIG. 11C depicts DAPI staining of a contralateral site. FIG. 11D depicts a lack of hCDKL5-positive cells in the contralateral site.
[0096] FIGs. 12A-12E depict expression results in the cerebellum 4 weeks following IV injection of wildtype or CDKL5-KO mice with PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 12A depicts vector genome copy. FIG. 12B depicts hCDKL5 mRNA. FIG. 12C depicts the percentage of hCDKL5-positive neurons in the cortex and hippocampus, as measured by in situ hybridization. FIG. 12D depicts CDKL5 protein concentration. FIG. 12E depicts kinase activity of the CDKL5 protein. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0097] FIGs. 13A and 13B depict the effects of administration of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 4 (SEQ ID NO: 39), or Construct 8 (SEQ ID NO: 38) in wildtype and CDKL5-KO mice. FIG. 13A depicts the occurrence of sudden unexpected death in epilepsy (SUDEP). FIG. 13B depicts the severity of seizures as measured using the Racine scale. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001
[0098] FIGs. 14A-14F depict effects on motor function in CDKL5-KO mice when a WPRE or Myc tag is included in payloads. FIG. 14A depicts aggregate scores of hindlimb claspingbehavior. FIG. 14B depicts individual scores for wildtype (WT) mice administered PBS (Veh). FIG. 14C depicts individual scores for CDKL5-K0 mice administered PBS (Veh). FIG. 14D depicts individual scores for CDKL5-K0 mice administered PHP.eB viral particles carrying Construct 4 (SEQ ID NO: 39). FIG. 14E depicts individual scores for CDKL5-K0 mice administered PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 14F depicts individual scores for CDKL-KO mice administered PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 38). Wk = week. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0099] FIGs. 15A-15B depict results from recordings of ex vivo neural hyperactivity in mice administered PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 15A depicts a whole cell patch clamp in the CA2 region of the hippocampus from a mouse. FIG. 15B depicts a comparison of the decay time of NMDA current in CDKL5-KO mice as compared to wildtype (WT) mice following administration of PBS (Veh) or PHP.eB viral particles carrying Construct 1 (AAV). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0100] FIGs. 16A-16B depict a reduction in seizure susceptibility and mortality in CDKL5 KO mice following administration of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 4 (SEQ ID NO: 39), or Construct 8 (SEQ ID NO: 38). FIG. 16A depicts percent mortality. FIG. 16B depicts maximum seizure scores. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0101] FIGs. 17A-17B depict expression of CDKL5 in CDKL5-KO mice dosed with vehicle or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22), Construct 4 (SEQ ID NO: 39), or Construct 8 (SEQ ID NO: 38). FIG. 17A depicts the hCDKL5 in total protein (pg / g). FIG. 17B depicts hCDKL5 in total protein, measured as a percentage of hCDKL5 protein in the wildtype (WT) mice dosed with vehicle. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001.
[0102] FIGs. 18A-18E depict effects of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22) on CDKL5 KO mice. FIG. 18A depicts mortality during seizures. FIG. 18B depicts the latency to death. FIG. 18C depicts the hindlimb clasping behavior score before dosing. FIG. 18D depicts the hindlimb clasping behavior score after dosing. FIG. 18E depicts a summary of hindlimb clasping behavior scores. Veh = Vehicle; WT = wildtype. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0103] FIG. 19A depicts vector genome copies per diploid genome in CDKL5-KO mouse cerebrum following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 19B depicts normalized CDKL5 protein expression in CDKL5-KO mouse cerebrum following administration of various doses of PHP.eB viralparticles carrying Construct 1 (SEQ ID NO: 22). FIG. 19C depicts the percentage of neurons in CDKL5-K0 mouse cortex that are hCDKL5-positive following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 19D depicts the percentage of neurons in CDKL5-K0 mouse hippocampus that are hCDKL5-positive following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 22). Veh = Vehicle; WT = wildtype.
[0104] FIGs. 20A-20D depict results at 4-weeks post-IV injection of PBS or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 22) in wildtype (WT) or CDKL5-KO mice. FIG. 20A depicts the percentage of neurons that are hCDKL5-positive in the cortex. FIG. 20B depicts the percentage of neurons that are hCDKL5-positive in the hippocampus. FIG. 20C depicts hindlimb clasping behavior for all groups of mice after dosing. FIG. 20D depicts hindlimb clasping behavior before and after dosing. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001.
[0105] FIGs. 21A-21D depict survival and latency to seizure data obtained from either wildtype (WT) or CDKL5-KO mice at 4-weeks post-IV injection of PBS or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 22). FIG. 21A depicts probability of survival (KM survival analysis). FIG. 21B depicts percent mortality during seizure. FIG. 21C depicts latency to death. FIG. 21D depicts the latency to seizure.
[0106] FIG. 22 depicts CDKL5 protein expression in wildtype C57 mice at 4-weeks post-IV injection of vehicle-PBS, PHP.eB, or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 22) or Construct 8 (SEQ ID NO: 38).Detailed DescriptionI. CompositionsA. Nucleic Acids and Viral Genomes1. CDKL5-Encoding Sequence
[0107] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a polynucleotide encoding CDKL5, also referred to as a CDKL5-encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5-encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0108] In some embodiments, the CDKL5 -encoding sequence encodes human CDKL5. In some embodiments, the CDKL5 -encoding sequence encodes wildtype CDKL5. In some embodiments, the CDKL5 -encoding sequence encodes a CDKL5 isoform.
[0109] In some embodiments, the CDKL5 -encoding sequence encodes CDKL5 isoform 1 (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 34), CDKL5 isoform 2 (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 35), CDKL5 isoform CRA A (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 36), or CDKL5 isoform CRA b (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 37). In some embodiments, the CDKL5 comprises the amino acid sequence of any one of SEQ ID NOs: 34-37 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5 comprises the amino acid sequence of any one of SEQ ID NOs: 34-37.
[0110] In some embodiments, the CDKL5 -encoding sequence encodes a CDKL5 protein comprising the amino acid sequence of SEQ ID NO: 14 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CDKL5 protein comprises the amino acid sequence of SEQ ID NO: 14. In some embodiments, the CDKL5 protein consists of the amino acid sequence of SEQ ID NO: 14.
[0111] In some embodiments, the CDKL5 -encoding sequence comprises a human CDKL5 nucleotide sequence. In some embodiments, the CDKL5 -encoding sequence comprises a wildtype CDKL5 nucleotide sequence. In some embodiments, the CDKL5-encoding sequence comprises a codon-optimized CDKL5 nucleotide sequence. In some embodiments, the CDKL5-encoding sequence comprises one or more CpG motifs. In some embodiments,the CDKL5 -encoding sequence is CpG-depleted. In some embodiments, the CDKL5- encoding sequence comprises no CpG motifs (i.e., is CpG-free).
[0112] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:15. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 15.
[0113] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:16. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16. In some embodiments, the CDKL5 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 16.
[0114] Non-limiting examples of CDKL5 amino acid sequences are provided in Table 1.
[0115] Non-limiting examples of CDKL5 -encoding sequences are provided in Table 2A.
[0116] The present disclosure provides nucleic acids (e.g., an isolated nucleic acids) or viral genomes (e.g., recombinant viral genomes) encoding a Myc-tagged CDKL5 protein. In some embodiments, the tag is a Myc tag. In some embodiments, the Myc tag is linked to the CDKL5 protein by a GGGS (SEQ ID NO: 44) spacer sequence. In some embodiments, the Myc tag and spacer (e.g., of amino acid sequence EQKLISEEDLGGGGS (SEQ ID NO: 31)) is located immediately after the N-terminal methionine of the encoded CDKL5. Table 2B provides exemplary nucleotide sequences that encode Myc-tagged CDKL5.Table 1. Exemplary CDKL5 Amino Acid SequencesTable 2A. Exemplary CDKL5-Encoding SequencesTable 2B. Exemplary Sequences Encoding Tagged CDKL5 Protein2. Promoter
[0117] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a promoter operably linked to a CDKL5-encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a promoter operably linked to a CDKL5-encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0118] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5-encoding sequence and (ii) the CDKL5 -encoding sequence.
[0119] In some embodiments, the promoter is or comprises a synapsin 1 promoter. In some embodiments, the promoter is or comprises a human synapsin 1 (“human SYN1,” “hSYNl,” “hSYN,” “hSyn,” or “hSynl”) promoter.
[0120] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical tothe nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 18.
[0121] In some embodiments, the promoter is or comprises a chicken P-actin hybrid promoter (“CBh promoter”). In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 33 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 33.
[0122] Non-limiting examples of promoter sequences are provided in Table 3.Table 3. Exemplary Promoter Sequences3. WPRE
[0123] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a CDKL5-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5 -encoding sequence and a WPRE and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0124] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a WPRE and a CDKL5 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a CDKL5 -encoding sequence and a WPRE. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5- encoding sequence, and (iii) a WPRE.
[0125] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:58 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 58. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 58.
[0126] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:59 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 59. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 59.
[0127] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:60 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 60. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 60.
[0128] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:61 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 61. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 61.
[0129] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:62 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 62. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 62.
[0130] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the WPRE comprises the nucleotide sequence ofSEQ ID NO: 19. In some embodiments, the WPRE consists of the nucleotide sequence ofSEQ ID NO: 19.
[0131] A non-limiting example of a WPRE sequence is provided in Table 4.Table 4. Exemplary WPRE Sequence4. MicroRNA Binding Site
[0132] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a CDKL5-encoding sequence and a nucleotide sequence encoding at least one microRNA (miR) binding site. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5-encoding sequence and a nucleotide sequence encoding at least one miR binding site and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0133] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a CDKL5-encoding sequence and a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5 -encoding sequence, and (iii) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5 -encoding sequence, (iii) a WPRE, and (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site).
[0134] In some embodiments, the miR binding site prevents, suppresses, or otherwise inhibits expression of CDKL5 in dorsal root ganglia. In some embodiments, the miR binding site is or comprises a microRNA 183 (miR183) binding site. In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) encodes a miR binding site series comprising at least 2 miR binding sites. In some embodiments, the miR binding site series comprises at least 2, at least 3, at least 4, or at least 5 miR binding sites. In some embodiments, the miR binding site series comprises 1, 2, 3, 4, or 5 miR binding sites. In some embodiments, the miR binding sites of the miR binding site series are continuous. In some embodiments, the miR binding sites of the miR binding siteseries are separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site, wherein each miR183 binding site has the same nucleotide sequence.
[0135] In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence encoding at least one miR183 binding site, wherein the at least one miR183 binding site is encoded by the nucleotide sequence of AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 6) or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 6 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 6 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, but no more than 10, modifications relative to the nucleotide sequence of SEQ ID NO: 6, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has no more than 5 modifications relative to the nucleotide sequence of SEQ ID NO: 6, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 2 modifications relative to the nucleotide sequence of SEQ ID NO: 6, wherein nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 1 modification relative to the nucleotide sequence of SEQ ID NO: 6, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT.
[0136] In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, thenucleotide sequence encoding the at least one miR183 binding site consists of the nucleotide sequence of SEQ ID NO: 6.
[0137] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) of the present disclosure comprises a nucleotide sequence encoding multiple miR183 binding sites, which may be referred to as a nucleotide sequence encoding a miR183 binding site series.
[0138] In some embodiments, the at least one miR183 binding site comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR183 binding sites), wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the miR183 binding site series comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR183 binding sites), wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 6.
[0139] In some embodiments, the miR183 binding site series comprises 4 miR binding sites. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 6.
[0140] In some embodiments, each of the miR183 binding sites in the miR183 binding site series is separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, the spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, three, or four modifications, but no more than four modifications relative to the nucleotide sequence of GATAGGTA. In some embodiments, each spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA. In some embodiments, each spacer is encoded by the nucleotide sequence of GATAGTTA.
[0141] In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 50% (e.g., atleast 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 7, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 7, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 7, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 7, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the nucleotide sequence encoding the miR183 binding site series consists of the nucleotide sequence of SEQ ID NO: 7.
[0142] A non-limiting example of a nucleotide sequence encoding a miR183 binding site series is provided in Table 5.Table 5. Exemplary miR183 Binding Site-Encoding Sequence5. Polyadenylation Sequence
[0143] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a CDKL5-encoding sequence and a polyadenylation (poly A) sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5- encoding sequence and a polyA sequence and, in some embodiments, the present disclosureprovides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0144] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a CDKL5-encoding sequence and a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5-encoding sequence, and (iii) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5-encoding sequence, (ii) the CDKL5- encoding sequence, (iii) a WPRE, and (iv) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5-encoding sequence, (iii) a WPRE, (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site), and (v) a polyA sequence.
[0145] In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the polyA sequence consists of the nucleotide sequence of SEQ ID NO: 20.
[0146] A non-limiting example of a polyA sequence is provided in Table 6.Table 6. Exemplary PolyA Sequence6. Inverted Terminal Repeats (ITRs)
[0147] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) disclosed herein further comprises an ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises two ITRs.
[0148] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 3’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR and a 3’ ITR.
[0149] In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17. In some embodiments, the 5’ ITR consists of the nucleotide sequence of SEQ ID NO: 17.
[0150] In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the 3’ ITR consists of the nucleotide sequence of SEQ ID NO: 21.
[0151] Non-limiting examples of ITR sequences are provided in Table 7.Table 7. Exemplary ITR Sequences7. Exemplary ITR-to-ITR Sequences
[0152] In some embodiments, the present disclosure provides a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprising a nucleotide sequence that is at least 80% (e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42.
[0153] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 85% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42.
[0154] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42.
[0155] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38- 42. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42. In someembodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42.
[0156] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) consists of the nucleotide sequence of any one of SEQ ID NOs: 22, 23, 29, 30, and 38-42.
[0157] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) disclosed herein comprises a 5’ ITR comprising the nucleotide sequence of SEQ ID NO: 17; a promoter comprising the nucleotide sequence of SEQ ID NO: 18; a CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or 16; a WPRE comprising the nucleotide sequence of SEQ ID NO: 19; a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) further comprises a nucleotide sequence encoding a miR183 binding site series, comprising the nucleotide sequence of SEQ ID NO: 7.
[0158] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO:22.
[0159] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO:23.
[0160] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 30.
[0161] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 1. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence(the viral genome) of Construct 2. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 3.
[0162] Without being bound by theory, in some embodiments, the nucleic acid (e.g., isolated nucleic acid) comprising the ITR-to-ITR components limits overexpression of CDKL5 in the presence of endogenous expression of functional CDKL5. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) comprising the ITR-to-ITR components results in a post- translational mechanism that limits overexpression of CDKL5 in the presence of endogenous expression of functional CDKL5.
[0163] Exemplary ITR-to-ITR sequences (viral genomes) are summarized in Tables 8A-8C and Table 9. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) may comprise any nucleotide sequence or combination thereof, from the nucleotide sequences in Tables 8A-8C or Table 9.Table 8A. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and ComponentsTable 8B. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and Components (Continued)Table 8C. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and Components (Continued)Table 9. Exemplary Viral GenomesB. Associated Virus (AAV) Capsids and Particles
[0164] AAVs typically have a genome of about 5,000 nucleotides in length and contain one open reading frame encoding the (non-structural) proteins responsible for replication (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and another open reading frame encoding the structural proteins of the capsid (VP1, VP2, VP3, encoded by capsid genes or Cap genes).The open reading frames are flanked by two inverted terminal repeat (ITR) sequences, which serve as the origin of replication of the viral genome. The Rep proteins are important for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid. Alternative splicing and alternate initiation codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame. VP1 is the full- length capsid protein sequence and contains the VP2 and VP3 sequences and VP2 and VP3 are shorter components of the whole, with the VP2 sequence containing the VP3 sequence. Though it varies by AAV serotype, as a non-limiting example, for AAV9 / hu.14 (SEQ ID NO: 123 of US 7,906,111, the relevant contents of which are herein incorporated by reference in their entirety) VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. With reference to the AAV9 capsid variant TTM-027, TTM- 003, or TTM-043, VP1 comprises amino acids 1-742, VP2 comprises amino acids 138-742, and VP3 comprises amino acids 203-742.
[0165] Changes in the sequence in the VP3 region of a single capsid open reading frame are also changes to VP1 and VP2; however, the percent difference as compared to the parent sequence will be greatest for VP3 since it is the shortest sequence of the three. Though described here in relation to the amino acid sequence, the nucleic acid sequence encoding these proteins can be similarly described. Together, the three capsid proteins assemble to create the AAV capsid. Without being bound by theory, the AAV capsid typically comprises a molar ratio of 1 : 1 : 10 of VP1 :VP2:VP3.
[0166] The AAV particle typically requires a co-helper (e.g., adenovirus) to undergo productive infection in cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells’ genome.
[0167] AAV particles may be used as a biological tool, including in gene therapy, due to their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into the host genome and without replicating, and their relatively benign immunogenic profile. Moreover, infection with AAV particles has minimal influence on changing the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148, the relevant contents of which are herein incorporated by reference in their entirety). The genome of the virus may be manipulated to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to target a particular tissue and express or deliver a desired payload.
[0168] Typically, AAV particles for CDKL5 delivery may be recombinant viral particles that are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the replication-defective AAV particles may lack most or all coding sequences and essentially only contain one or two AAV ITR sequences and a nucleic acid sequence encoding CDKL5. In some cases, the nucleic acid sequence encoding CDKL5 further comprises one or more regulatory elements to modulate transcription.
[0169] In some embodiments, the AAV particles of the present disclosure may be introduced into mammalian cells.
[0170] AAV particles of the present disclosure may be produced recombinantly and may be based on AAV reference sequences. In addition to single-stranded AAV viral genomes (e.g., ssAAVs), the present disclosure also provides for self-complementary AAV (scAAV) viral genomes. scAAV viral genomes contain DNA strands that anneal together to form doublestranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the transduced cell. In some embodiments, the AAV particle of the present disclosure is an scAAV. In some embodiments, the AAV particle of the present disclosure is an ssAAV.
[0171] Methods for producing and / or modifying AAV particles are disclosed in the art such as pseudotyped AAV particles (International Patent Publication Nos. W0200028004; W0200123001; WO2004112727; W02005005610; and W02005072364, the relevant contents of each of which are incorporated herein by reference in their entirety).
[0172] In some embodiments, an AAV particle of the present disclosure comprises a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV capsid. In some embodiments, the AAV capsid is an AAV capsid variant, wherein the variant comprises a capsid protein that differs from a wildtype AAV capsid protein by one or more insertions, deletions, and / or substitutions. In some embodiments, the AAV capsid or AAV capsid variant comprises a capsid protein selected from the group consisting of: AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV9 K449R, VOY101, VOY201, AAVPHP.A, AAVPHP.B, AAVPHP.B2, AAVPHP.B3, AAVPHP.eB, AAVPHP.N, AAVPHP.S, G2B4, G2B5, CAP-B10, AAVrhlO, AAVrh32.33, AAVrh74, a capsid protein of an AAV serotype as provided in Table 6 of International Patent Publication No.WO2021230987 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023081648 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023154693 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosedin International Patent Publication No. WO2023235791 (the relevant contents of which are incorporated by reference in their entirety), and a capsid protein disclosed in International Patent Publication No. W02024006741 (the relevant contents of which are incorporated by reference in their entirety), or a variant of any of the foregoing.
[0173] In some embodiments, the AAV capsid variant preferentially targets the brain over the liver. In some embodiments, the AAV capsid variant is AAVPHP.eB or CAP -B 10. See, e.g., Goertsen et al. AAV capsid variants with brain-wide transgene expression and decreased liver targeting after intravenous delivery in mouse and marmoset. Nat Neurosci 25, 106-115 (2022); Seo et al. Multimodal imaging of capsid and cargo reveals differential brain targeting and liver detargeting of systemically-administered AAVs, Biomaterials 288 (2022). In some embodiments, the AAV capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023081648 or WO2023235791. In some embodiments, the AAV5 capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023154693.
[0174] In some embodiments, the present disclosure provides an AAV particle comprising a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV9 capsid variant. In some embodiments, the AAV9 capsid variant comprises at least one insertion and / or at least one substitution in hypervariable loop IV relative to a wildtype AAV9 capsid. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP1 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP2 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP3 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP1, VP2, and VP3 of the AAV9 capsid variant.
[0175] In some embodiments, the AAV9 capsid variant comprises at least one insertion and / or at least one substitution in hypervariable loop VIII relative to a wildtype AAV9 capsid. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP1 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP2 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP3 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least onesubstitution in hypervariable loop VIII is present in a VP1, VP2, and VP3 of the AAV9 capsid variant.
[0176] In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to a cell, region, or tissue of the CNS. The cell of the CNS may be, but is not limited to, neurons (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), glial cells (e.g., microglia, astrocytes, oligodendrocytes) and / or supporting cells of the brain such as immune cells (e.g., T cells). The tissue of the CNS may be, but is not limited to, the cortex (e.g., frontal, parietal, occipital, and / or temporal), thalamus, hypothalamus, striatum, putamen, caudate nucleus, hippocampus, entorhinal cortex, basal ganglia, or deep cerebellar nuclei.
[0177] In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the cortex (e.g., the motor cortex). In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the hippocampus. In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the striatum. In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the thalamus. In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the cerebellum. In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to a glutamatergic neuron. In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to a GABAergic neuron.
[0178] In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the CNS (e.g., the cortex) after intravenous administration. In some embodiments, the at least one insertion and / or at least one substitution increases distribution of an AAV particle to the CNS (e.g., the cortex) following focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration.
[0179] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of ENVSGSPHSKA (SEQ ID NO: 8) in hypervariable loop IV. In some embodiments, the amino acid sequence of SEQ ID NO: 8 is present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 8 is present in VP1, VP2, and VP3.
[0180] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of SPHSKA (SEQ ID NO: 5) in hypervariable loop IV. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at positions 254-259 numbered according to the amino acid sequence of SEQ ID NO: 25, comprises the amino acid E at position 249 numbered according to the amino acid sequence of SEQ ID NO: 25, and comprises the amino acid V at position 251 numbered according to the amino acid sequence of SEQ ID NO: 25. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at positions 319-324 numbered according to the amino acid sequence of SEQ ID NO: 24, comprises the amino acid E at position 314 numbered according to the amino acid sequence of SEQ ID NO: 24, and comprises the amino acid V at position 316 numbered according to the amino acid sequence of SEQ ID NO: 24. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at positions 456- 461 numbered according to the amino acid sequence of SEQ ID NO: 1, comprises the amino acid E at position 451 numbered according to the amino acid sequence of SEQ ID NO: 1, and comprises the amino acid V at position 453 numbered according to the amino acid sequence of SEQ ID NO: 1.
[0181] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequencethat is at least 97% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25. In some embodiments, the amino acid sequence of SEQ ID NO: 25 may be referred to as VP3 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 25. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 25.
[0182] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 24 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 314-324 of the amino acid sequence ofSEQ ID NO: 24 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 24. In some embodiments, the amino acid sequence of SEQ ID NO: 24 may be referred to as VP2 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 24. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 24.
[0183] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 1, whereinthe AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 8 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, the amino acid sequence of SEQ ID NO: 1 may be referred to as VP1 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 1. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 1.
[0184] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) in hypervariable loop IV. In some embodiments, the amino acid sequence of SEQ ID NO: 9 is present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 9 is present in VP1, VP2, and VP3.
[0185] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 247-264 ofthe amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 25, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 25). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25. In some embodiments, the amino acid sequence of SEQ ID NO: 25 may be referred to as VP3 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 25. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 25.
[0186] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 24 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises theamino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 312-329 of an amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 312-329 of an amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises an amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises an amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 24, wherein the AAV9 capsid variant comprises an amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 24). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 24. In some embodiments, the amino acid sequence of SEQ ID NO: 24 may be referred to as VP2 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 24. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 24.
[0187] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 1, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 9 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 1). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, the amino acid sequence of SEQ ID NO: 1 may be referred to as VP1 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 1. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 1.
[0188] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant that is encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the AAV capsid variant is encoded by the nucleotide sequence of SEQ ID NO: 2.
[0189] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of ERVSGSPHSKA (SEQ ID NO: 10) in hypervariable loop IV. In some embodiments, the amino acid sequence of SEQ ID NO: 10 is present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 10 is present in VP1, VP2, and VP3.
[0190] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of SPHSKA (SEQ ID NO: 5) in hypervariable loop IV. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at positions 254-259 numbered according to the amino acid sequence of SEQ ID NO: 27, comprises the amino acid E at position 249 numbered according to the amino acid sequence of SEQ ID NO: 27, comprises the amino acid R at position 250 numbered according to the amino acid sequence of SEQ ID NO: 27, and comprises the amino acid V at position 251 numbered according to the amino acid sequence of SEQ ID NO: 27. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at positions 319-324 numbered according to the amino acid sequence of SEQ ID NO: 26, comprises the amino acid E at position 314 numbered according to the amino acid sequence of SEQ ID NO: 26, comprises the amino acid R at position 315 numbered according to the amino acid sequence of SEQ ID NO: 26, and comprises the amino acid V at position 316 numbered according to the amino acid sequence of SEQ ID NO: 26. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at positions 456-461 numbered according tothe amino acid sequence of SEQ ID NO: 4, comprises the amino acid E at position 451 numbered according to the amino acid sequence of SEQ ID NO: 4, comprises the amino acid R at position 452 numbered according to the amino acid sequence of SEQ ID NO: 4, and comprises the amino acid V at position 453 numbered according to the amino acid sequence of SEQ ID NO: 4.
[0191] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 249-259 of theamino acid sequence of SEQ ID NO: 27 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27. In some embodiments, the amino acid sequence of SEQ ID NO: 27 may be referred to as VP3 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 27. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 27.
[0192] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the aminoacid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 26. In some embodiments, the amino acid sequence of SEQ ID NO: 26 may be referred to as VP2 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 26. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 26.
[0193] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 451-461 of the amino acidsequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 10 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the amino acid sequence of SEQ ID NO: 4 may be referred to as VP1 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 4. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 4.
[0194] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) in hypervariable loop IV. In some embodiments, the amino acid sequence of SEQ ID NO: 11 is present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 11 is present in VP1, VP2, and VP3.
[0195] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 27, wherein theAAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 27, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 27). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27. In some embodiments, the amino acid sequence of SEQ ID NO: 27 may be referred to as VP3 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 27. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 27.
[0196] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 312-329 of the amino acid sequence of SEQ IDNO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 26, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 26). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 26. In some embodiments, the amino acid sequence of SEQ ID NO: 26 may be referred to as VP2 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 26. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 26.
[0197] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present atamino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 4, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 11 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 4). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the amino acid sequence of SEQ ID NO: 4 may be referred to as VP1 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 4. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 4.
[0198] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant that is encoded by the nucleotide sequence of SEQ ID NO: 3 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 99% identical to the nucleotide sequence ofSEQ ID NO: 3. In some embodiments, the AAV capsid variant is encoded by the nucleotide sequence of SEQ ID NO: 3.
[0199] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV and the amino acid sequence of RQTALQL (SEQ ID NO: 49) in hypervariable loop VIII. In some embodiments, the amino acid sequences of SEQ ID NO: 12 and SEQ ID NO: 49 are present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequences of SEQ ID NO: 12 and SEQ ID NO: 49 are present in VP1, VP2, and VP3.
[0200] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV (e.g., present at positions 252-257 numbered according to the amino acid sequence of SEQ ID NO: 47) and three, four, or all of the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and / or the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 47. In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV (e.g., present at positions 252-257 numbered according to the amino acid sequence of SEQ ID NO: 47) and the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 47.
[0201] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV (e.g., present at positions 317-322 numbered according to the amino acid sequence of SEQ ID NO: 46) and three, four, or all of the amino acid R at position 453, the amino acid T at position 455, the amino acid L at position 457, the amino acid Q at position 458, and / or the amino acid L at position 459, each numbered according to the amino acid sequence of SEQ ID NO: 46. In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV (e.g., present at positions 317-322 numbered according to the amino acid sequence of SEQ ID NO: 46) and the amino acid R at position 453, the amino acid T at position 455, the amino acid L at position 457, the amino acid Q at position 458, and the amino acid L at position 459, each numbered according to the amino acid sequence of SEQ ID NO: 46.
[0202] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV (e.g., present at positions 454-459 numbered according to the amino acid sequence of SEQ ID NO: 45) and three, four, or all of the amino acid R at position 590, the amino acid T at position 592, the amino acid L at position 594, the amino acid Q at position 595, and / or the amino acid L at position 596, each numbered according to the amino acid sequence of SEQ ID NO: 45. In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 12) in hypervariable loop IV (e.g., present at positions 454-459 numbered according to the amino acid sequence of SEQ ID NO: 45) and the amino acid R at position 590, the amino acid T at position 592, the amino acid L at position 594, the amino acid Q at position 595, and the amino acid L at position 596, each numbered according to the amino acid sequence of SEQ ID NO: 45.
[0203] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions252-257 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47. In some embodiments, the amino acid sequence of SEQ ID NO: 47 may be referred to as VP3 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 47. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 47.
[0204] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions317-322 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46. In some embodiments, the amino acid sequence of SEQ ID NO: 46 may be referred to as VP2 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 46.
[0205] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In someembodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 12 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of SEQ ID NO: 49 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45. In some embodiments, the amino acid sequence of SEQ ID NO: 45 may be referred to as VP1 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 45. In some embodiments, anAAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 45.
[0206] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) in hypervariable loop IV and the amino acid sequence of RQTALQL (SEQ ID NO: 49) in hypervariable loop VIII. In some embodiments, the amino acid sequences of SEQ ID NO: 13 and RQTALQL (SEQ ID NO: 49) are present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequences of SEQ ID NO: 13 and RQTALQL (SEQ ID NO: 49) are present in VP1, VP2, and VP3.
[0207] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In someembodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47. In some embodiments, the amino acid sequence of SEQ ID NO: 47 may be referred to as VP3 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 47. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 47.
[0208] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions312-329 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence ofSEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46. In some embodiments, the amino acid sequence of SEQ ID NO: 46 may be referred to as VP2 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 46.
[0209] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsidvariant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 13 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 45) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45. In some embodiments, the amino acid sequence of SEQ ID NO: 45 may be referred to as VP1 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 45. In some embodiments, anAAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 45.
[0210] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant that is encoded by the nucleotide sequence of SEQ ID NO: 48 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 48. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 48. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 48. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 48. In some embodiments, the AAV capsid variant is encoded by the nucleotide sequence of SEQ ID NO: 48.
[0211] In some embodiments, an AAV particle of the present disclosure comprises an amino acid sequence provided in Table 10. In some embodiments, an AAV particle of the present disclosure comprises amino acids 2-742 of an amino acid sequence provided in Table 10. In some embodiments, an AAV particle of the present disclosure comprises an amino acid sequence encoded by a nucleotide sequence of Table 11. In some embodiments, an AAV particle of the present disclosure is encoded by a nucleotide sequence of Table 11.
[0212] In some embodiments, the AAV particle comprises the AAV capsid variant TTM- 027.
[0213] In some embodiments, the AAV particle comprises the AAV capsid variant TTM- 003.
[0214] In some embodiments, the AAV particle comprises the AAV capsid variant TTM- 043.Table 10. Exemplary Capsid Amino Acid SequencesTable 11. Exemplary Capsid Nucleotide Sequences
[0215] It is common for a first amino acid (AA1), e.g., a first methionine (Metl), encoded by a capsid gene to be expressed in capsid proteins but cleaved during or after polypeptide synthesis by protein processing enzymes such as Met-aminopeptidases. This “Metl / AAl- clipping” process often correlates with a corresponding acetylation of the second amino acid in the polypeptide sequence (e.g., alanine, valine, serine, threonine, etc.). Metl / AAl -clipping commonly occurs with VP1 and VP3 but can also occur with VP2.
[0216] Where the Metl / AAl -clipping is incomplete, a mixture of VP capsid proteins comprising the viral capsid may be produced, some of which include a Metl / AAl amino acid (Met+ / AA+) and some of which may lack a Metl / AAl amino acid as a result of Metl / AAl- clipping (Metl- / AA1-). For further discussion regarding Metl / AAl -clipping in capsid proteins, see Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno- Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct. 28(5):255-267; Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19. 327(5968): 973-977; the relevant contents of each of which are incorporated herein by reference in their entirety.
[0217] According to the present disclosure, references to capsid proteins, e.g., of AAV capsid variants, is not limited to either clipped (Metl- / AA1-) or unclipped (Metl+ / AA1+) and may refer to a mixture of clipped and unclipped capsid proteins. A direct reference to a capsid protein whether by VP1, VP2, or VP3 designation or by SEQ ID NO may encompassVP capsid proteins that include Metl / AAl (Metl+ / AA1+) as well as corresponding VP capsid proteins without Metl / AAl as a result of clipping (Metl- / AA1-).
[0218] Accordingly, in some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl -clipped VP1, VP2, and / or VP3 of an AAV9 capsid variant described herein. In some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl-clipped VP1, VP2, and / or VP3 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl-clipped VP1, VP2, and / or VP3 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl-clipped VP1, VP2, and / or VP3 of TTM-043.
[0219] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-742 of the amino acid sequence of SEQ ID NO: 1, wherein amino acid 2 of SEQ ID NO: 1 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-605 of the amino acid sequence of SEQ ID NO: 24, wherein amino acid 2 of SEQ ID NO: 24 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-540 of the amino acid sequence of SEQ ID NO: 25, wherein amino acid 2 of SEQ ID NO: 25 is optionally acetylated.
[0220] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-742 of the amino acid sequence of SEQ ID NO: 4, wherein amino acid 2 of SEQ ID NO: 4 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-605 of the amino acid sequence of SEQ ID NO: 26, wherein amino acid 2 of SEQ ID NO: 26 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-540 of the amino acid sequence of SEQ ID NO: 27, wherein amino acid 2 of SEQ ID NO: 27 is optionally acetylated.
[0221] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-742 of the amino acid sequence of SEQ ID NO: 45, wherein amino acid 2 of SEQ ID NO: 45 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-605 of the amino acid sequence of SEQ ID NO: 46, wherein amino acid 2 of SEQ ID NO: 46 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-540 of the amino acidsequence of SEQ ID NO: 47, wherein amino acid 2 of SEQ ID NO: 47 is optionally acetylated.C. Exemplary AAV Particles
[0222] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 18^the nucleotide sequence of SEQ ID NO: 15iand the nucleotide sequence of SEQ ID NO: 19.
[0223] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 18^the nucleotide sequence of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 19.
[0224] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, a 5’ ITR comprising the nucleotide sequence of SEQ ID NO: 17; a promoter comprising the nucleotide sequence of SEQ ID NO: 18; a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; a WPRE comprising the nucleotide sequence of SEQ ID NO: 19; optionally a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 6; a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the nucleotide sequence encoding the microRNA binding site comprises the nucleotide sequence of SEQ ID NO: 7.
[0225] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30.
[0226] In some embodiments, the AAV particle comprises the AAV capsid variant of TTM- 027 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 3.
[0227] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 18, the nucleotide sequence of SEQ ID NO: 15, and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM- 003) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 18, the nucleotide sequence of SEQ ID NO: I 6iand the nucleotide sequence of SEQ ID NO: 19.
[0228] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising a 5’ ITR comprising the nucleotide sequence of SEQ ID NO: 17; a promoter comprising the nucleotide sequence of SEQ ID NO: 18; a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; a WPRE comprising the nucleotide sequence of SEQ ID NO: 19; optionally a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 6; a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the nucleotide sequence encoding the microRNA binding site comprises the nucleotide sequence of SEQ ID NO: 7.
[0229] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30.
[0230] In some embodiments, the AAV particle comprises the AAV capsid variant of TTM- 003 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 3.
[0231] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g.,recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 18^the nucleotide sequence of SEQ ID NO: 15xand the nucleotide sequence of SEQ ID NO: 19.
[0232] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 and the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 18^the nucleotide sequence of SEQ ID NO: 16, and the nucleotide sequence of SEQ ID NO: 19.
[0233] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising a 5’ ITR comprising the nucleotide sequence of SEQ ID NO: 17; a promoter comprising the nucleotide sequence of SEQ ID NO: 18; a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19; optionally a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 6; a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20; and a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the nucleotide sequence encoding the microRNA binding site comprises the nucleotide sequence of SEQ ID NO: 7.
[0234] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30.
[0235] In some embodiments, the AAV particle comprises the AAV capsid variant of TTM- 043 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 3.D. Tropism and Biodistribution Properties
[0236] AAV particles and payloads of the disclosure may be delivered to one or more target cells, tissues, organs, or organisms. In some embodiments, the AAV particles demonstrate enhanced tropism for a target cell type, tissue or organ. In some embodiments, the present disclosure provides AAV particles that demonstrate enhanced tropism for a target cell type, tissue or organ, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant TTM-043). As a non-limiting example, an AAV particle of the disclosure may have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively). In some embodiments, the present disclosure provides AAV particles that have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively), wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant TTM-043). In some embodiments, an AAV particle may, in addition, or alternatively, have decreased tropism for a cell-type, tissue or organ.
[0237] AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles of the present disclosure can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.
[0238] In some embodiments, AAV particles may be used to deliver a CDKL5 -encoding sequence to the central nervous system (see, e.g., U.S. Patent No. 6,180,613; the relevant contents of which are herein incorporated by reference in their entirety) or to specific tissues of the central nervous system. In some embodiments, the present disclosure provides AAV particles that may be used to deliver a CDKL5-encoding sequence to the central nervous system or to specific tissues of the central nervous system, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variantTTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant TTM-043).
[0239] In some embodiments, the AAV capsid variant allows for blood brain barrier penetration of the AAV particle following intravenous administration, focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration. In some embodiments, an AAV capsid variant described herein allows for blood brain barrier penetration of the AAV particle following intravenous administration. In some embodiments, the present disclosure provides AAV particles that allow for blood brain barrier penetration of the AAV particle following intravenous administration, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant TTM-043).
[0240] In some embodiments the AAV capsid variant allows for increased distribution of the AAV particle to a brain region. In some embodiments, the present disclosure provides AAV particles that allow for increased distribution of the AAV particle to a brain region, wherein the AAV particle comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant TTM-043). In some embodiments, the brain region comprises a frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, putamen, or a combination thereof. In some embodiments, the AAV capsid variant allows for preferential transduction in a brain region relative to the transduction in the dorsal root ganglia (DRG). In some embodiments, the AAV capsid variant allows for preferential transduction in a brain region relative to transduction in the liver. In some embodiments, the AAV capsid variant allows for transduction in neuronal cells. In some embodiments, the AAV capsid variant allows for preferential transduction to GABAergic neurons and / or glutamatergic neurons relative to other cells. In some embodiments, the AAV capsid variant allows for transduction in a nonneuronal cell, e.g., a glial cell (e.g., an astrocyte, an oligodendrocyte, or a combination thereof).
[0241] In some embodiments, an AAV capsid variant allows for increased distribution to a spinal cord region. In some embodiments, the present disclosure provides AAV particles thatallow for increased distribution to a spinal cord region, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant TTM- 027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., AAV capsid variant TTM- 003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant TTM-043). In some embodiments, the spinal region comprises a cervical spinal cord region, thoracic spinal cord region, and / or lumbar spinal cord region.
[0242] In some embodiments, an AAV capsid variant of the present disclosure allows for increased distribution of the AAV particle to the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, the AAV capsid variant allows for increased distribution of the AAV particle to the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum.II. AAV Particle Production
[0243] The present disclosure further provides processes and methods for producing an AAV particle comprising an AAV capsid variant that may be used to contact a target cell to deliver CDKL5.
[0244] In some embodiments, the present disclosure provides a method of making an AAV particle comprising an AAV capsid variant and viral genome (e.g., recombinant viral genome) disclosed herein, wherein the method comprises: (i) providing a cell comprising a nucleic acid comprising a viral genome (e.g., recombinant viral genome) comprising a CDKL5- encoding sequence and a nucleic acid encoding an AAV capsid variant; and (ii) incubating the cell under conditions suitable to encapsulate the viral genome (e.g., recombinant viral genome) in the AAV capsid variant; thereby making the AAV particle.
[0245] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19); and the AAV capsid variantcomprises the amino acid sequence of SEQ ID NO: 1, 24, or 25. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25.
[0246] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 18, (iii) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 18, (iii) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 6 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 7), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25. In some embodiments, the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16.
[0247] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25.
[0248] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 23 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25.
[0249] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 30 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 1, 24, or 25.
[0250] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27.
[0251] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 18, (iii) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21; and the AAV capsid variant comprises the amino acid sequenceof SEQ ID NO: 4, 26, or 27. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 18, (iii) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 6 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 7), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16.
[0252] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27.
[0253] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 23 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27.
[0254] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 30 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 4, 26, or 27.
[0255] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ IDNO: 15 or SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47.
[0256] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises(i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 18, (iii) a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 17,(ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 18, (iii) a CDKL5- encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 19, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 6 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 7), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 20, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47. In some embodiments, the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16.
[0257] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47.
[0258] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 23 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47.
[0259] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 30 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 45, 46, or 47.
[0260] In some embodiments, the method of making an AAV particle comprises, prior to step (i), introducing into the cell the nucleic acid comprising the viral genome (e.g., recombinant viral genome). In some embodiments, the method comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid variant. In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell. In some embodiments, AAV particles are produced in mammalian cells (e.g., HEK293 cells). In some embodiments, AAV particles are produced in insect cells (e.g., Sf9 cells). In some embodiments, the AAV particle is an isolated AAV particle. In some embodiments, the AAV particle is a recombinant AAV particle.
[0261] Any method known in the art may be used for the preparation of AAV particles. For example, methods of making AAV particles are described in U.S. Patent Nos. 6204059, 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498, 7491508, 5064764, 6194191, 6566118, and 8137948 and International Patent Publication Nos. WO1996039530, W01998010088, WO1999014354, WO1999015685, WO1999047691, W02000055342, W02000075353, and WO200 1023597, as well as in Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir., 219:37-44 (1996); and Zhao et al., Vir.272:382-93 (2000); the relevant contents of each of which are herein incorporated by reference in their entirety. In some embodiments, the AAV particles are made using the methods described in International Patent Publication No. W02015191508, the relevant contents of which are herein incorporated by reference in their entirety.III. Pharmaceutical Compositions
[0262] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a CDKL5 -encoding sequence and a pharmaceutically acceptable excipient. Suitable excipients are known in the art, e.g., as described in Remington: The Science andPractice of Pharmacy (Adeboye Adejare ed., 23rd ed. 2020), the relevant contents of which are incorporated by reference herein in their entirety. In some embodiments, a pharmaceutical composition described herein comprises at least one buffering agent, at least one stabilizing agent, at least one osmotic pressure regulator, at least one protective agent, at least one coating agent, at least one binding agent, and least one disintegrant, at least one preservative, at least one solvent, at least one surfactant, at least one cryoprotectant, at least one lubricant, at least one glidant, and / or at least one filler.
[0263] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19). In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19).
[0264] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30.
[0265] In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle of thepharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 3.
[0266] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19). In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19).
[0267] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22.
[0268] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23.
[0269] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viralgenome) comprising the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30.
[0270] In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 3.
[0271] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19). In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 16 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 19).
[0272] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22.Il l
[0273] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 23.
[0274] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 30.
[0275] In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 3.
[0276] Although pharmaceutical compositions provided herein are principally directed to those that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions may be suitable for administration to any other animal, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various non-human animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any,experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.
[0277] In some embodiments, pharmaceutical compositions are administered to humans, e.g., human patients or human subjects.
[0278] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.IV. Formulations
[0279] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping, and / or packaging the product into a desired single- or multi-dose unit.
[0280] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient(s), and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise about 0.1% (w / w) to about 100% (w / w) of the active ingredient, e.g., about 0.1% (w / w) to about 99% (w / w), about 0.5% (w / w) to about 50% (w / w), about 1% (w / w) to about 30% (w / w), about 5% (w / w) to about 80% (w / w), or at least 80% (w / w) active ingredient.
[0281] Isolated nucleic acids, recombinant viral genomes, or AAV particles of the disclosure may be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit sustained or delayed release; (4) alter biodistribution (e.g., target the active ingredient to one or more specific tissues or cell types); (5) increase thetranslation of encoded protein in vivo, (6) alter the release profile of encoded protein in vivo and / or (7) allow for regulatable expression of CDKL5.
[0282] Formulations of the present disclosure may include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics, and combinations thereof. In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles.
[0283] In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated to optimize baricity and / or osmolality. In some embodiments, the baricity and / or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system.
[0284] In some embodiments, a pharmaceutically acceptable excipient of a formulation disclosed herein may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the pharmaceutically acceptable excipient is approved for use for humans and for veterinary use. In some embodiments, the pharmaceutically acceptable excipient is approved by the United States Food and Drug Administration (FDA). In some embodiments, the pharmaceutically acceptable excipient is of pharmaceutical grade. In some embodiments, the pharmaceutically acceptable excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.
[0285] Pharmaceutically acceptable excipients, which, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, may be suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (including but not limited to those provided in Remington: The Science and Practice of Pharmacy, 23rd Edition; the relevant contents of which are herein incorporated by reference in their entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
[0286] In some embodiments, a formulation of the present disclosure may comprise at least one excipient which is an inactive ingredient. As used herein, the term “inactive ingredient” refers to one or more agents that do not contribute to the activity of the pharmaceutical composition included in formulations. In some embodiments, all, none, or some of the inactive ingredients which may be used in the formulations of the present disclosure may be approved by the United States FDA.
[0287] In some embodiments, a formulation of the present disclosure comprises cations or anions. In some embodiments, the formulation includes metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+, or a combination thereof. In some embodiments, the formulation may comprise polymers or polynucleotides complexed with a metal cation (see, e.g., U.S. Patent Nos. 6,265,389 and 6,555,525, the relevant contents of each of which are herein incorporated by reference in their entirety).
[0288] In some embodiments, the disclosure provides a formulation of a pharmaceutical composition comprising an adeno-associated virus (AAV) particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043), and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 30, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto.
[0289] In some embodiments, the disclosure provides a formulation of a pharmaceutical composition comprising an adeno-associated virus (AAV) particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043), and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, or SEQ ID NO: 30.V. Uses and Applications
[0290] The compositions of the disclosure (e.g., AAV particles or pharmaceutical compositions) may be administered to a subject or used in the manufacture of a medicament for administration to a subject having a CDKL5-related disorder. The CDKL5-relateddisorder may be a disorder of the central nervous system, and / or a neurological and / or neuromuscular disorder. Also contemplated herein is a CDKL5-related neurodegenerative or neuromuscular disorder. In some embodiments, the CDKL5-related disorder is CDKL5 deficiency disorder (CDD). Other CDKL5-related disorders include but are not limited to developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0291] The present disclosure addresses the need for new technologies by providing CDKL5-related treatment deliverable by AAV-based compositions and complexes for the treatment of CDKL5-related disorders.
[0292] The compositions of the disclosure may be administered to a subject, e.g., to deliver CDKL5, e.g., to a subject who has, has been diagnosed with having, or is at risk of having CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome). The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0293] In some embodiments, the disclosure provides a method of delivering a CDKL5 protein to a cell, comprising administering an effective amount of a pharmaceutical composition or AAV particle disclosed herein, thereby delivering CDKL5. In some embodiments, the cell is in a subject. In some embodiments, the disclosure provides a method of delivering a CDKL5 protein to a subject, comprising administering to the subject an effective amount of a pharmaceutical composition or AAV particle disclosed herein.
[0294] In some embodiments, delivery is to a cell or tissue of the central nervous system (CNS). In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the parenchyma, the cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem caudate-putamen, thalamus, superior colliculus, the spinal cord, or a combination thereof, and / or the cell of the CNS is a neuron (e.g. GABAergic neuron, glutamatergic neuron, or a combination thereof). In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder, or a symptom thereof. In some embodiments, the CDKL5-related disorder is a CDKL5-related neurodegenerative or neuromuscular disorder. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2. In some embodiments, the CDKL5-related disorder is atypical Rett syndrome.
[0295] In some embodiments, the disclosure provides a method for treating a CDKL5- related disorder, or a symptom thereof, in a subject, comprising administering to the subjectan effective amount of an AAV particle or pharmaceutical composition disclosed herein. In some embodiments, the present disclosure provides an AAV particle or pharmaceutical composition disclosed herein for use in a method of treating a disorder or symptom as disclosed herein. In some embodiments, the disclosure provides an AAV particle or pharmaceutical composition disclosed herein for treating a CDKL5-related disorder or symptom thereof. In some embodiments, the disclosure provides a use of an AAV particle or pharmaceutical composition disclosed herein in the manufacture of a medicament for the treatment of a CDKL5-related disorder, or a symptom thereof, in a subject. In some embodiments, the CDKL5-related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0296] In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome).
[0297] In some embodiments, the disclosure provides a method of treating CDD, or a symptom thereof, in a subject, comprising administering to the subject an effective amount of an AAV particle or pharmaceutical composition disclosed herein. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having CDD.
[0298] In some embodiments, the disclosure provides a method of treating developmental and epileptic encephalopathy 2, or a symptom thereof, in a subject, comprising administering to the subject an effective amount of an AAV particle or pharmaceutical composition disclosed herein. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having developmental and epileptic encephalopathy 2.
[0299] In some embodiments, the disclosure provides a method of treating atypical Rett syndrome, or a symptom thereof, in a subject, comprising administering to the subject an effective amount of an AAV particle or pharmaceutical composition disclosed herein. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having atypical Rett syndrome.
[0300] In some embodiments, the AAV particle or pharmaceutical composition disclosed herein is administered to a subject who has one or more mutations in the CDKL5 gene. In some embodiments, the subject has a reduced level of CDKL5 activity as compared to a reference level in an individual who does not have a CDKL5-related disorder.
[0301] In some embodiments, the treatment results in an increase in the subject’s CDKL5 level as compared to baseline. In some embodiments, the treatment results in an increase in the subject’s CDKL5 level as compared to an individual with the CDKL5-related disorder(e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome) who has not received treatment an AAV particle or pharmaceutical composition disclosed herein.
[0302] In some embodiments, the treatment may result in prevention of progression of a CDKL5-related disorder. In some embodiments, treatment may result in prevention of progression of at least one symptom of a CDKL5-related disorder. As a non-limiting example, progression of the disorder or symptom may be assessed by tests or diagnostic tools known to those skilled in the art or by a change in the pathological features of the brain, CSF, muscle, or other tissues of the subject. In some embodiments, the treatment may result in stabilizing the condition of a subject who has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder. In some embodiments, the treatment may result in stabilizing the condition of at least one symptom of a CDKL5-related disorder. In some embodiments, the treatment may result in amelioration (e.g., reducing the severity of) at least one symptom of a CDKL5-related disorder. In some embodiments, the treatment reverses or partially reverses at least one symptom of a CDKL5-related disorder. In some embodiments, the treatment may prevent or delay the onset of one or more symptoms of a CDKL5-related disorder. In some embodiments, the treatment improves at least one symptom of a CDKL5- related disorder. In some embodiments, the CDKL5-related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome. In some embodiments, the CDKL 5 -related disorder is CDD.
[0303] In some embodiments, at least one symptom comprises epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than-normal space between the nose and upper lip; an upturned nose; full lips; and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof. In some embodiments, amelioration of at least one symptom and / or prevention of progression of the disorder is assessed by one or more biomarkers in the subject. In some embodiments, the one or more biomarkers comprises neurofilament light chain or a marker of CDKL5 activity, e.g., as measured byphosphorylation levels of substrate proteins, e.g., MECP2, or as measured by mass spectrometry.
[0304] In some embodiments, the methods disclosed herein further comprise evaluating, e.g., measuring, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject. In some embodiments, the level of CDKL5 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, evaluating the level of CDKL5 gene, mRNA, and / or protein expression is performed before and after administering the AAV particle or pharmaceutical composition, optionally wherein the subject’s level of CDKL5 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of CDKL5 gene, mRNA, and / or protein expression after administration. In some embodiments, a level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue of the CNS is evaluated in the subject. In some embodiments, the level of CDKL5 gene, mRNA, and / or protein expression is evaluated in a cell or tissue of the central nervous system. In some embodiments, subject’s level of CDKL5 gene, mRNA, and / or protein expression after administration is increased relative to the subject’s level of CDKL5 gene, mRNA, and / or protein expression before administration.
[0305] In some embodiments, the level of CDKL5 activity in the subject (e.g., in a cell or tissue of the subject) is evaluated, e.g., measured.
[0306] In some embodiments, administering to a subject an AAV particle or pharmaceutical composition disclosed herein results in an increase in CDKL5 expression in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., the parenchyma, the cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, superior colliculus, the spinal cord, or a combination thereof) and / or in a neuron (e.g. GABAergic neuron, glutamatergic neuron, or a combination thereof) of the subject, relative to baseline and / or relative to the level of CDKL5 in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the AAV particle or pharmaceutical composition.
[0307] In some embodiments, administering to a subject administering to a subject an AAV particle or pharmaceutical composition disclosed herein results in an increase in the number and / or level of recombinant viral genomes (VG) per cell level in a tissue of the CNS (e.g., the parenchyma, the cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, superior colliculus, the spinal cord, or a combination thereof) and / or in a neuron (e.g. GABAergic neuron, glutamatergic neuron, or acombination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral tissue of the subject.
[0308] In some embodiments, administering to a subject an AAV particle or pharmaceutical composition disclosed herein results in an increase in CDKL5 protein, mRNA, or gene expression in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., the parenchyma, the cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem caudate-putamen, thalamus, superior colliculus, the spinal cord, or a combination thereof) and / or to neurons (e.g. GABAergic neurons, glutamatergic neurons, or a combination thereof)) of the subject relative to baseline and / or relative to the level of CDKL5 protein, mRNA, or gene expression in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the AAV particle or pharmaceutical composition.
[0309] In some embodiments, a method of delivery or treatment provided herein further comprises administering at least one additional agent for treating a CDKL5-related disorder to the subject. In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0310] In some embodiments, a method of delivery or treatment provided herein further comprises administering an immunosuppressant to the subject. In some embodiments, the immunosuppressant comprises adrenocorticotropic hormone, a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
[0311] In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human subject.
[0312] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions comprising AAV particles disclosed herein, in combination with agents that may improve their bioavailability, reduce and / or modify their metabolism, and / or modify their distribution within the body.
[0313] In some embodiments, an AAV particle or pharmaceutical composition described herein is used as a research tool. In some embodiments, the research tool is used in in vitro investigations using human cell lines such as HEK293T and in vivo testing in nonhuman primates that occur prior to human clinical trials.
[0314] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome),comprising administering to the subject an effective amount of an AAV particle comprising a capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043), and a viral genome (e.g., recombinant viral genome) comprising a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome), comprising administering to the subject an effective amount of an AAV particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043), and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22, 23, or 30, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto.
[0315] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome), comprising administering to the subject an effective amount of an AAV particle comprising a capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043), and a viral genome (e.g., recombinant viral genome) comprising a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 19. In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome), comprising administering to the subject an effective amount of an AAV particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 1, 24, or 25 (e.g.,the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 4, 26, or 27 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 45, 46, or 47 (e.g., the AAV capsid variant is TTM-043), and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22, 23, or 30.VI. Delivery of AAV ParticlesA. Delivery to Cells
[0316] In some embodiments, the present disclosure provides a method of delivering to a cell or tissue an active agent (e.g., an AAV particle comprising a viral genome comprising a CDKL5 -encoding sequence) described herein, the method comprising contacting the cell or tissue with the active agent or contacting the cell or tissue with a formulation or composition (e.g., pharmaceutical composition) comprising the active agent. In some embodiments, the method is an in vitro method of delivering to a cell or tissue. In some embodiments, the method is an in vivo method of delivering to a cell or tissue. In some embodiments, the method is an ex vivo method of delivering to a cell or tissue.
[0317] In some embodiments, delivery is to a cell, tissue, or region of the CNS. In some embodiments, delivery is to a cell, tissue, or region of the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate- putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, delivery is to a cell, tissue, or region of the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum, and / or wherein the cell of the CNS is a glutamatergic neuron and / or GABAergic neuron.
[0318] In some embodiments, delivery is to a cell, tissue, or region of the PNS.B. Delivery to Subjects
[0319] In some embodiments, the present disclosure provides a method of delivering to a subject, such as a mammalian subject, an active agent (e.g., an AAV particle comprising a viral genome comprising a CDKL5-encoding sequence) described herein, or administering to the subject a formulation or composition (e.g., pharmaceutical composition) comprising the active agent.
[0320] In some embodiments, delivery bypasses anatomical blockages (e.g., the blood brain barrier). In some embodiments, delivery uses intrathecal infusion. In some embodiments, delivery uses bolus infusion. In some embodiments, delivery uses continuous and / or bolus infusion.
[0321] Each site of delivery may use a different dosing regimen, or the same dosing regimen may be used for each site of delivery. As a non-limiting example, the sites of delivery may be in the cervical and the lumbar region. As another non-limiting example, the sites of delivery may be in the cervical region. As another non-limiting example, the sites of delivery may be in the lumbar region.
[0322] In some embodiments, delivery uses a single route of administration.
[0323] In some embodiments, delivery uses a multi-site route of administration. In some embodiments, a subject may be administered the agent, formulation, or composition at 2, 3, 4, 5, or more than 5 sites.
[0324] In some embodiments, delivery comprises sustained delivery over a period of minutes, hours, or days. The infusion rate may be changed depending on the subject, distribution, formulation, or another delivery parameter known to those in the art.
[0325] In some embodiments, if continuous delivery (continuous infusion) is used, the continuous infusion may be for 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, or more than 24 hours.
[0326] In some embodiments, the subject’s intracranial pressure may be evaluated prior to administration. The route, volume, active agent (e.g., AAV particle) concentration, infusion duration and / or titer may be optimized based on the intracranial pressure of a subject.
[0327] In some embodiments, the method uses systemic delivery. In some embodiments, the systemic delivery is by intravascular administration. In some embodiments, the systemic delivery is by intravenous administration.
[0328] In some embodiments, the method uses delivery by injection into the CSF pathway. Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventri cul ar admini strati on .
[0329] In some embodiments, the method uses intravenous administration.
[0330] In some embodiments, the method uses delivery by direct (intraparenchymal) injection into the substance of an organ, e.g., one or more regions of the brain.
[0331] In some embodiments, delivery is by subpial injection into the spinal cord. For example, subjects may be placed into a spinal immobilization apparatus. A dorsal laminectomy may be performed to expose the spinal cord. Guiding tubes and XYZ manipulators may be used to assist catheter placement. Subpial catheters may be placed into the subpial space by advancing the catheter from the guiding tube and AAV particles may beinjected through the catheter (Miyanohara et al., Mol Ther Methods Clin Dev. 2016; 3: 16046). In some cases, the active agent, formulation, or composition may be injected into the cervical subpial space. In some cases, the active agent, formulation, or composition may be injected into the thoracic subpial space.
[0332] In some embodiments, delivery is by direct injection to the CNS of a subject. In some embodiments, direct injection is intracerebral injection, intraparenchymal injection, intrathecal injection, intra-ci sterna magna injection, or any combination thereof. In some embodiments, direct injection to the CNS of a subject comprises convection enhanced delivery (CED). In some embodiments, delivery comprises peripheral injection. In some embodiments, peripheral injection is intravenous injection.
[0333] In some embodiments, the delivery results in an increase a CDKL5 level in the CNS (e.g., the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, the delivery results in an increase in a CDKL5 level in the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum.
[0334] In some embodiments, the delivery results in increased CDKL5 gene, mRNA, and / or protein expression in the CNS (e.g., the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof) as compared to a baseline level in the subject. In some embodiments, the delivery results in increased CDKL5 gene, mRNA, and / or protein expression in the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum.
[0335] In some embodiments, delivery comprises transducing cells in these CNS regions. Transduction may also be referred to as the number of cells that are positive for CDKL5.
[0336] In some embodiments, the active agent, formulation, or composition is delivered to neurons in the brain (e.g., neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof) in the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus) may lead to an increased CDKL5 expression in one or more of those neurons. In some embodiments, the increased CDKL5 expression may lead to improved survival and / or function of various cell types in these CNS regions and / or improvement of atleast one symptom of a CDKL5-related disorder in a subject. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0337] In some embodiments, delivery may be used to achieve widespread distribution of CDKL5 throughout the CNS, e.g., by administering to the thalamus of the subject. In some embodiments, the increased expression of CDKL5 may lead to a reduction in at least one symptom of a CDKL5-related disorder in a subject (e.g., CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome). In some embodiments, the at least one symptom comprises epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly, a high, broad forehead, large, deep-set eyes, smaller-than-normal space between the nose and upper lip, an upturned nose, full lips and widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small, focused hand movements, gastroesophageal reflux, constipation, or a combination thereof.C. Administration
[0338] In some embodiments, the present disclosure provides methods comprising administering an active agent (e.g., an AAV particle comprising a viral genome comprising a CDKL5 -encoding sequence) or a formulation or composition (e.g., pharmaceutical composition) comprising the active agent to a subject in need thereof. In some embodiments, the active agent, formulation or composition is administered to a subject using an amount and a route of administration effective for treating a CDKL5-related disorder. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5- related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0339] Compositions in accordance with the disclosure may be formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present disclosure may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular subject will depend upon a variety of factors including the disorder being treated and theseverity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex, and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific agent employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
[0340] In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a “single unit dose” is a dose of any therapeutic composition administered in one dose / at one time / single route / single point of contact, e.g, single administration event. In some embodiments, a single unit dose is provided as a discrete dosage form (e.g., a tablet, capsule, patch, loaded syringe, vial, efc.). As used herein, a “total daily dose” is an amount given or prescribed in 24-hour period. In some embodiments, the total daily dose may be administered as a single unit dose. In some embodiments, an active agent or pharmaceutical composition described herein may be formulated in buffer only or in a formulation described herein.
[0341] In some embodiments, an active agent or pharmaceutical composition described herein can be formulated into a topical, intranasal, pulmonary, intratracheal, or injectable dosage form. In some embodiments, an active agent or pharmaceutical composition described herein can be formulated in a dosage form suitable for intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, and / or subcutaneous administration.
[0342] In some embodiments, delivery of an active agent, formulation, or composition (e.g., pharmaceutical composition) described herein results in minimal serious adverse events (SAEs) as a result of the delivery.VII. Combinations
[0343] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions, comprising an active agent (e.g., an AAV particle comprising a viral genome comprising a CDKL5-encoding sequence) described herein in combination with one or more agents that may improve the composition or active agent’s bioavailability, reduce and / or modify their metabolism, modify their distribution within the body, and / or elicit or enhance a therapeutic effect. Thecombination agent may be, without limitation, a therapeutic, prophylactic, diagnostic, or imaging agent.
[0344] The phrase “in combination with,” is not intended to require that the agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, before, or after one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent.
[0345] The therapeutic agents may be approved by the US Food and Drug Administration or may be in clinical trial or at the preclinical research stage. The therapeutic agents may utilize any therapeutic modality known in the art, with non-limiting examples including gene silencing or interference ( / .< ., miRNA, siRNA, RNAi, shRNA), gene editing ( / .< ., TALEN, CRISPR / Cas9 systems, zinc finger nucleases), and gene, protein, or enzyme replacement.
[0346] In some embodiments, the combination agent comprises at least one additional therapeutic agent and / or therapy, e.g., suitable for treating a CDKL5-related disorder or at least one symptom thereof.
[0347] In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0348] In some embodiments, the combination agent comprises one or more of: growth and trophic factors, cytokines, hormones, neurotransmitters, enzymes, anti-apoptotic factors, angiogenic factors, modulatory polynucleotides, and any protein known to be mutated in pathological disorders such as CDKL5-related disorders.
[0349] In some embodiments, the combination agent comprises an immunosuppressant. In some embodiments, the immunosuppressant may be administered to the subject before administration of an AAV particle or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject simultaneously with administration of an AAV particle or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject after administration of an AAV particle or pharmaceutical composition described herein.
[0350] In some embodiments, the AAV particle or pharmaceutical composition is administered to a subject who is receiving or has received an immunosuppressant.
[0351] In some embodiments, the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine.VIII. Measurement of Expression
[0352] In some embodiments, expression of the CDKL5 gene, CDKL5 mRNA, and / or CDKL5 protein may be determined using various methods known in the art such as, but not limited to immunochemistry (e.g., IHC), enzyme-linked immunosorbent assay (ELISA), affinity ELISA, ELISPOT, flow cytometry, immunocytology, surface plasmon resonance analysis, kinetic exclusion assay, liquid chromatography-mass spectrometry (LCMS), high- performance liquid chromatography (HPLC), BCA assay, immunoelectrophoresis, Western blot, SDS-PAGE, protein immunoprecipitation, PCR, and / or in situ hybridization (ISH).
[0353] In some embodiments, CDKL5 protein is detectable by an ELISA. In some embodiments, CDKL5 protein is detectable by an immunohistochemistry assay. In some embodiments, CDKL5 protein is detectable by Western blot.
[0354] In some embodiments, expression of CDKL5 mRNA and / or CDKL5 protein is measured in a cell or tissue of a subject who is receiving or has received a CDKL5-encoding sequence, isolated nucleic acid encoding CDKL5, recombinant viral genome encoding CDKL5, AAV particle. In some embodiments, expression is measured in a cell or tissue of the CNS, such as the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, expression is measured in a cell or tissue of the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum.
[0355] In some embodiments, expression is measured in the brainstem. In some embodiments, expression is measured in the cerebellum. In some embodiments, expression is measured in a peripheral cell or tissue, such as the liver, heart, kidney, pancreas, and / or muscle.IX. Kits and DevicesA. Kits
[0356] In some aspects, the present disclosure provides a variety of kits for conveniently and / or effectively carrying out methods of the present disclosure. Typically, kits will comprise sufficient amounts and / or numbers of components to allow a user to perform multiple treatments of a subject(s) and / or to perform multiple experiments.
[0357] Any of the active agents or compositions comprising active agents (e.g., AAV particles) of the present disclosure may be comprised in a kit. In some embodiments, kits may further include reagents and / or instructions for creating and / or synthesizing compounds and / or compositions of the present disclosure. In some embodiments, kits may also include one or more buffers. In some embodiments, kits of the disclosure may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.
[0358] In some embodiments, kit components may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various combinations of components may be comprised in one or more vial. Kits of the present disclosure may also typically include means for containing active agents and / or compositions of the present disclosure and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which desired vials are retained.
[0359] In some embodiments, kit components are provided in one and / or more liquid solutions. In some embodiments, liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly used. In some embodiments, kit components may be provided as dried powder(s). When reagents and / or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent. In some embodiments, it is envisioned that solvents may also be provided in another container means. In some embodiments, labeling dyes are provided as dried powders. In some embodiments, it is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits of the disclosure. In such embodiments, dye may then be resuspended in any suitable solvent, such as DMSO.
[0360] In some embodiments, kits may include instructions for employing kit components as well as the use of any other reagent not included in the kit. Instructions may include variations that may be implemented.B. Devices
[0361] In some embodiments, active agents and / or compositions of the present disclosure may be combined with, coated onto or embedded in a device. Devices may include, but are not limited to, dental implants, stents, bone replacements, artificial joints, valves, pacemakers and / or other implantable therapeutic device.
[0362] The present disclosure provides for devices which may incorporate AAV particles comprising a viral genome (e.g., recombinant viral genome) that encodes CDKL5. These devices contain the AAV particles in a stable formulation, which may be immediately delivered to a subject in need thereof, such as a human patient.
[0363] Devices for administration may be employed to deliver the nucleic acid and / or AAV particles according to single, multi- or split-dosing regimens taught herein.
[0364] Methods and devices known in the art for multi-administration to cells, organs and tissues are contemplated for use in conjunction with the methods and compositions disclosed herein as embodiments of the present disclosure.X. Definitions
[0365] At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual sub-combination of the members of such groups and ranges. The following is a non-limiting list of term definitions.
[0366] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0367] The articles “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process.
[0368] The term “comprising” is intended to be open and permits but does not require the inclusion of additional elements or steps.
[0369] Where ranges are given, endpoints are included. Furthermore, it is to be understood that, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0370] Active Agent: As used herein, the term “active agent” refers to an agent (e.g., a nucleic acid and / or viral genome) that encodes a CDKL5 protein or comprises or encapsulates said agent (e.g., an AAV particle).
[0371] Adeno-Associated Virus: As used herein, the term “adeno-associated virus” or “AAV” refers to a member of the dependovirus genus or a functional variant thereof. Unless stated otherwise, “AAV” may refer to wildtype (i.e., naturally occurring) AAV or recombinant AAV (e.g., an AAV comprising a variant AAV capsid).
[0372] Adeno-Associated Virus (AAV) Particle'. As used herein, an “AAV particle” refers to a particle (also a “virion”) comprising an AAV capsid, e.g., an AAV capsid variant (such as a parent capsid sequence with at least one peptide insertion and / or with at least one substitution), and a polynucleotide, e.g., a viral genome, e.g., a recombinant viral genome. The AAV particle may be capable of delivering a CDKL5 -encoding sequence to cells. The cells may be mammalian cells, e.g., human cells. In some embodiments, an AAV particle of the present disclosure may be produced recombinantly. An AAV particle may be derived from any serotype, described herein or known in the art, including combinations of serotypes (e.g., “pseudotyped” AAV) or from various genomes (e.g., single stranded or self-complementary). In some embodiments, the AAV particle may be replication defective and / or targeted. In some embodiments, the AAV particle may comprise a peptide present in, e.g., inserted into and / or replacing a wildtype amino acid of, a capsid to enhance tropism for a desired target tissue.
[0373] Administering'. As used herein, the term “administering” refers to providing an agent (e.g., an active agent or pharmaceutical composition) to a subject.
[0374] Amelioration'. As used herein, the term “amelioration” or “ameliorating” refers to a lessening of severity of at least one indicator of a disease, disorder, or condition. For example, in the context of a neurodegenerative disorder, amelioration includes the reduction or stabilization of neuron loss.
[0375] Approximately: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is within 10% of a stated reference value.
[0376] Baseline'. The term “baseline,” when used to describe a measurement in a subject receiving or about to receive a treatment, refers to a measurement made before starting the treatment.
[0377] Capsid. As used herein, the term “capsid” refers to the exterior, e.g., a protein shell, of a virus particle, e.g., an AAV particle, that is substantially (e.g., >50%, >60%, >70%, >80%, >90%, >95%, >99%, or 100%) protein. In some embodiments, the capsid is an AAV capsid comprising an AAV capsid protein described herein, e.g., a VP1, VP2, and / or VP3 polypeptide. The AAV capsid protein can be a wild-type AAV capsid protein or a variant, e.g., a structural and / or functional variant from a wild-type or a reference capsid protein, referred to herein as an “AAV capsid variant.” For example, and without limitation, an AAV capsid variant may refer to at least a VP1 protein, a VP2 protein, or a VP3 protein (e.g., all of the VP1, VP2, and VP3 proteins forming the AAV capsid) as will be clear from context. In some embodiments, the AAV capsid variant described herein may comprise a peptide and / or amino acid insertion and / or substitution. The terms “substitution” and “replacement” are used interchangeably in this context. In some embodiments, the AAV capsid variant described herein has the ability to encapsulate (i.e., encapsidate) a viral genome (e.g., a recombinant viral genome) and / or is capable of entry into a cell, e.g., a mammalian cell. In some embodiments, the AAV capsid variant described herein may have modified tropism compared to that of a wild-type AAV capsid, e.g., the corresponding wild-type capsid.
[0378] CDKL5-related disorder: As used herein, a “CDKL5-related disorder” refers to a disease, disorder, or condition in which one or more symptoms is caused by or associated with a deficiency of cyclin-dependent kinase-like 5 (CDKL5) in a subject.
[0379] Central Nervous System (CNS): As used herein, “central nervous system” or “CNS” refers to the brain and spinal cord, and sub-structures of the brain and spinal cord. Cells found in the CNS include but are not limited to neurons and sub-types thereof, glial cells (microglia, oligodendrocytes, ependymal cells, and astrocytes), choroid plexus cells, and cells related to blood vessels and coverings. Non-limiting examples of neurons include sensory neurons, motor neurons, interneurons, unipolar cells, bipolar cells, multipolar cells, pseudounipolar cells, pyramidal cells, basket cells, stellate cells, Purkinje cells, Betz cells, amacrine cells, granule cell, ovoid cell, medium aspiny neurons and large aspiny neurons, GABAergic neurons and / or glutamatergic neurons.
[0380] Corresponding to As used herein, the phrase “corresponding to,” in the context of an amino acid sequence, refers to the location of an amino acid in a reference sequence or the equivalent position in a modified sequence when aligned.
[0381] Effective amount. As used herein, the term “effective amount” or “therapeutically effective amount” of an agent is an amount sufficient to effect benefi...
Claims
ClaimsWe claim:
1. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 5) present at amino acids corresponding to positions 254-259 of the amino acid sequence of SEQ ID NO: 25, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 25, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 25.
2. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 25 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ENVSGSPHSKA (SEQ ID NO: 8) present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 25, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 25.
3. The AAV particle of claim 1 or claim 2, wherein the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 1, wherein theamino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 8) present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 1, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 1; and / or(ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 24, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 8) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 24, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 9) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 24.
4. The AAV particle of any one of claims 1-3, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 1;(ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 24; and / or(iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 25.
5. The AAV particle of any one of claims 1-4, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 1;(ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 24; and / or(iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 25.
6. The AAV particle of any one of claims 1-5, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 1;(ii) the amino acid sequence of SEQ ID NO: 24; and / or(iii) the amino acid sequence of SEQ ID NO: 25.
7. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 5) present at amino acids corresponding to positions 254-259 of the amino acid sequence of SEQ ID NO: 27, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 27, the amino acid R at position 250 numbered according to the amino acid sequence of SEQ ID NO: 27, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 27.
8. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ERVSGSPHSKA (SEQ ID NO: 10) present at amino acids corresponding to positions 249- 259 of the amino acid sequence of SEQ ID NO: 27, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 27.
9. The AAV particle of claim 7 or claim 8, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 4, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 10) present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 4, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 4; and / or(ii) an amino acid sequence that is least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 26, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 10) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 26, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 11) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 26.
10. The AAV particle of any one of claims 7-9, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 4;(ii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 26; and / or(iii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 27.
11. The AAV particle of any one of claims 7-10, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 99% identical to SEQ ID NO: 4;(ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 26; and / or(iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 27.
12. The AAV particle of any one of claims 7-11, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 4;(ii) the amino acid sequence of SEQ ID NO: 26; and / or(iii) the amino acid sequence of SEQ ID NO: 27.
13. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises HDSPHK (SEQ ID NO: 12) present at amino acids 252-257 of the amino acid sequence of SEQ ID NO: 47 and comprises the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 47.
14. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises HDSPHK (SEQ ID NO: 12) present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO:47 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 47; optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 47.
15. The AAV particle of claim 13 or claim 14, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 45, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 12) present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 45 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 45, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 45; and / or(ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 12) present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 46 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 49) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 46, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 13) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 46.
16. The AAV particle of any one of claims 13-15, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 45;(ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46; and / or(iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 47.
17. The AAV particle of any one of claims 13-16, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45;(ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46; and / or(iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47.
18. The AAV particle of any one of claims 13-17, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 45;(ii) the amino acid sequence of SEQ ID NO: 46; and / or(iii) the amino acid sequence of SEQ ID NO: 47.
19. The AAV particle of any one of claims 1-18, wherein the recombinant viral genome encodes a wildtype CDKL5 protein.
20. The AAV particle of any one of claims 1-19, wherein the recombinant viral genome encodes a human CDKL5 protein.
21. The AAV particle of claim 19 or claim 20, wherein the encoded CDKL5 comprises the amino acid sequence of SEQ ID NO: 14 or any one of SEQ ID NOs: 34-37.
22. The AAV particle of any one of claims 1-21, wherein the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, atleast 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
23. The AAV particle of any one of claims 1-22, wherein the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
24. The AAV particle of any one of claims 1-23, wherein the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15.
25. The AAV particle of any one of claims 1-21, wherein the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16 or a nucleotide sequence that is at least 98% (e.g., at least 98% or at least 99%) identical thereto.
26. The AAV particle of claim 25, wherein the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16.
27. The AAV particle of any one of claims 1-26, wherein the WPRE is positioned 3’ relative to the CDKL5 -encoding sequence.
28. The AAV particle of any one of claims 1-27, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or any one of SEQ ID NOs: 58-62, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
29. The AAV particle of any one of claims 1-28, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 19.
30. The AAV particle of any one of claims 1-29, wherein the recombinant viral genome further comprises a promoter operably linked to the CDKL5-encoding sequence.
31. The AAV particle of claim 30, wherein the promoter is a human synapsin 1 (hSYNl) promoter or a chicken P-actin hybrid (CBh) promoter.
32. The AAV particle of claim 30 or claim 31, wherein the promoter is a hSYNl promoter.
33. The AAV particle of any one of claims 30-32, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
34. The AAV particle of any one of claims 30-33, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 18.
35. The AAV particle of any one of claims 1-34, wherein the recombinant viral genome further comprises a polyadenylation (poly A) sequence.
36. The AAV particle of claim 35, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
37. The AAV particle of claim 35 or claim 36, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20.
38. The AAV particle of any one of claims 1-37, wherein the recombinant viral genome further comprises at least one inverted terminal repeat (ITR).
39. The AAV particle of claim 38, wherein the at least one ITR comprises a 5’ ITR and a 3’ ITR.
640. The AAV particle of claim 39, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
41. The AAV particle of claim 39 or claim 40, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17.
42. The AAV particle of any one of claims 39-41, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto.
43. The AAV particle of any one of claims 39-42, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21.
44. The AAV particle of any one of claims 1-43, wherein the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one or more miR binding sites reduces or prevents expression of CDKL5 in dorsal root ganglia.
45. The AAV particle of claim 44, wherein the one or more miR binding sites comprises one, two, three, or four miR183 binding sites.
46. The AAV particle of claim 44 or claim 45, wherein the recombinant viral genome comprises a nucleotide sequence encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical.
47. The AAV particle of claim 46, wherein each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 6.
48. The AAV particle of claim 47, wherein each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 6.
49. The AAV particle of any one of claims 46-48, wherein the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.
50. The AAV particle of any one of claims 1-49, wherein the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA183 (miR183) binding siteseries, wherein the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
51. The AAV particle of claim 50, wherein the nucleotide sequence encoding the miRl 83 binding site series comprises the nucleotide sequence of SEQ ID NO: 7.
52. The AAV particle of claim 51, wherein the nucleotide sequence encoding the miRl 83 binding site series consists of the nucleotide sequence of SEQ ID NO: 7.
53. The AAV particle of any one of claims 1-52, wherein the recombinant viral genome comprises, in 5’ to 3’ order: a) a 5’ inverted terminal repeat (ITR); b) a promoter; c) the CDKL5 -encoding sequence; d) the WPRE; e) a polyadenylation (poly A) sequence; and f) a 3’ ITR.
54. The AAV particle of claim 53, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and / or f) the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
55. The AAV particle of claim 53 or claim 54, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
56. The AAV particle of any one of claims 53-55, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
57. The AAV particle of any one of claims 53-56, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
58. The AAV particle of any one of claims 53-57, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18;c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
59. The AAV particle of any one of claims 53-58, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
60. The AAV particle of any one of claims 53-59, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21.
61. The AAV particle of any one of claims 53-60, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 15; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21.
62. The AAV particle of any one of claims 53-61, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 17; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 18; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 16; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 19; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 20; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 21.
63. The AAV particle of any one of claims 1-62, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
64. The AAV particle of claim 63, wherein the recombinant viral genome comprises a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 22.
65. The AAV particle of claim 63 or claim 64, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22.
66. The AAV particle of claim 63 or claim 64, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23.
67. The AAV particle of any one of claims 1-66, wherein the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one or more miR binding sites reduces or prevents expression of CDKL5 in dorsal root ganglia.
68. The AAV particle of claim 67, wherein the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 6.
69. The AAV particle of claim 67 or claim 68, wherein the nucleotide sequence encoding the one or more miR binding sites encodes four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 6.
70. The AAV particle of any one of claims 1-69, wherein the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 7.
71. The AAV particle of any one of claims 53-61, 63, 64, or 67-70, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
72. An adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 1;(ii) the amino acid sequence of SEQ ID NO: 24; and / or(iii) the amino acid sequence of SEQ ID NO: 25; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 17; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16;d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 20; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
73. The AAV particle of claim 69, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22.
74. The AAV particle of claim 69, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23.
75. The AAV particle of claim 69, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
76. An adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 4;(ii) the amino acid sequence of SEQ ID NO: 26; and / or(iii) the amino acid sequence of SEQ ID NO: 27; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 17; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19;e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 20; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
77. The AAV particle of claim 73, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22.
78. The AAV particle of claim 73, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23.
79. The AAV particle of claim 73, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
80. An adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 45;(ii) the amino acid sequence of SEQ ID NO: 46; and / or(iii) the amino acid sequence of SEQ ID NO: 47; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 17; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 18; c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 19; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 6;f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 20; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 21.
81. The AAV particle of claim 80, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22.
82. The AAV particle of claim 80, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23.
83. The AAV particle of claim 80, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
84. A cell comprising the AAV particle of any one of claims 1-83.
85. The cell of claim 84, wherein the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
86. A method of making the AAV particle of any one of claims 1-83, the method comprising:(i) providing a cell comprising the recombinant viral genome comprising a CDKL5- encoding sequence and a nucleic acid encoding the AAV9 capsid variant; and(ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV9 capsid variant; thereby making the AAV particle.
87. The method of claim 86, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 22.
88. The method of claim 86, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 23.
89. The method of claim 86, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 30.
90. The method of any one of claims 86-89, further comprising, prior to step (i), introducing a nucleic acid comprising the recombinant viral genome into the cell.
91. The method of any one of claims 86-90, further comprising, prior to step (i), introducing the nucleic acid encoding the AAV9 capsid variant into the cell.
92. The method of any one of claims 86-91, wherein the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
93. A pharmaceutical composition comprising the AAV particle of any one of claims 1- 83 and a pharmaceutically acceptable excipient.
94. A method of delivering an AAV particle encoding a cyclin-dependent kinase-like 5 (CDKL5) to a cell, comprising administering an effective amount of the AAV particle of any one of claims 1-83 or the pharmaceutical composition of claim 93.
95. The method of claim 94, wherein the cell is in a subject.
96. The method of claim 95, wherein the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder.
97. A method of treating a subject having or diagnosed with having a CDKL5-related disorder, or at least one symptom thereof, comprising administering to the subject an effective amount of the AAV particle of any one of claims 1-83 or the pharmaceutical composition of claim 93.
98. The method of claim 96 or claim 97, wherein the CDKL5-related disorder is a CDKL5-related neurodegenerative or neuromuscular disorder.
99. The method of claim 98, wherein the CDKL5-related neurodegenerative or neuromuscular disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
100. A method of treating a subject having or having or diagnosed with having a CDKL5- related disorder, or treating at least one symptom thereof, wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), comprising administering to the subject an effective amount of the AAV particle of any one of claims 1-83 or the pharmaceutical composition of claim 93.
101. The method of any one of claims 95-100, wherein the subject has one or more mutations in a CDKL5 gene.
102. The method of any one of claims 95-101, wherein the subject has a reduced level of CDKL5 activity as compared to a reference level in an individual who does not have a CDKL5-related disorder.
103. The method of any one of claims 97-102, wherein the treating results in prevention or progression of the disorder or at least one symptom thereof in the subject.
104. The method of any one of claims 97-103, wherein the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers.
105. The method of claim 104, wherein the one or more biomarkers comprises neurofilament light chain or a marker of CDKL5 activity, e.g., as measured by phosphorylation levels of substrate proteins, e.g., MECP2, or as measured by mass spectrometry.
106. The method of any one of claims 97-105, wherein the at least one symptom comprises epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than-normal space between the nose and upper lip; an upturned nose; full lips and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absentspeech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof.
107. The method of any one of claims 95-106, wherein the subject is a human.
108. The method of any one of claims 95-107, wherein the AAV particle or the pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject.
109. The method of claim 108, wherein the cell, tissue, or region of the CNS comprises: the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof).
110. The method of claim 108 or claim 109, wherein the cell, tissue, or region of the CNS is a cell, tissue, or region of the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum, and / or wherein the cell of the CNS is a glutamatergic neuron and / or GABAergic neuron.
111. The method of any one of claims 95-110, wherein the AAV particle or pharmaceutical composition is delivered to the subject via intravenous administration.
112. The method of any one of claims 95-111, further comprising evaluating, e.g., measuring, the level of CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject.
113. The method of claim 112, wherein the level of CDKL5 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay.
114. The method of claim 112 or claim 113, wherein the evaluating the level of CDKL5 gene, mRNA, and / or protein expression is performed before and after administering the AAV particle or pharmaceutical composition, optionally wherein the subject’s level of CDKL5gene, mRNA, and / or protein expression before administration is compared to the subject’s level of CDKL5 gene, mRNA, and / or protein expression after administration.
115. The method of any one of claims 112-114, comprising evaluating the level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue of the CNS in the subject.
116. The method of claim 115, wherein the cell or tissue of the CNS comprises: the parenchyma, cortex, substantia nigra, caudate cerebellum, striatum, corpus callosum, cerebellum, brain stem, caudate-putamen, thalamus, hippocampus, superior colliculus, spinal cord, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof).
117. The method of claim 115 or claim 116, wherein the cell or tissue of the CNS is a cell or tissue of the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum, and / or wherein the cell of the CNS is a glutamatergic neuron and / or GABAergic neuron.
118. The method of any one of claims 112-117, wherein the subject’s level of CDKL5 protein expression after administration of the AAV particle or pharmaceutical composition is increased relative to the subject’s level of CDKL5 protein expression before administration of the AAV particle or pharmaceutical composition.
119. The method of any one of claims 95-118, further comprising evaluating, e.g., measuring, the level of CDKL5 protein activity in the subject, e.g., in a cell or tissue of the subject.
120. The method of any one of claims 95-119, wherein administering the AAV particle or pharmaceutical composition to the subject results in an increase in:(i) the level of CDKL5 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of CDKL5 activity in a cell, tissue, or fluid of an individual with a CDKL5-related disorder who has not been administered the AAV particle or pharmaceutical composition;(ii) the number and / or level of recombinant viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or(iii) the level of CDKL5 protein expression, CDKL5 mRNA expression, or CDKL5 gene expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of CDKL5 protein expression, CDKL5 mRNA expression, or CDKL5 gene expression in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the AAV particle or pharmaceutical composition..
121. The method of any one of claims 97-120, further comprising administering to the subject at least one additional agent and / or therapy suitable for treating the CDKL5-related disorder or at least one symptom thereof.
122. The method of claim 121, wherein the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
123. The method of any one of claims 95-122, further comprising administering an immunosuppressant to the subject.
124. The method of claim 123, wherein the immunosuppressant comprises adrenocorticotropic hormone, a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
125. The AAV particle of any one of claims 1-83 or the pharmaceutical composition of claim 93, for use in the treatment of a CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
126. The AAV particle or pharmaceutical composition of claim 125, wherein the subject has, has been diagnosed with having, or is at risk of having the CDKL5-related disorder or at least one symptom thereof; optionally wherein the CDKL5-related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
127. Use of the AAV particle of any one of claims 1-83, the cell of claim 84 or claim 85, or the pharmaceutical composition of claim 93 in the manufacture of a medicament for the treatment of an CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
128. The use of claim 127, wherein the subject has, has been diagnosed with having, or is at risk of having the CDKL5-related disorder or at least one symptom thereof; optionally wherein the CDKL5-related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
129. The AAV particle of any one of claims 1-83 or the pharmaceutical composition of claim 93 for use in a method of treating a disorder according to any one of claims 97-124.
Citation Information
Patent Citations
TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES (AAVs)
US20170166926A1
Mineral hollow fiber bioreactor for the cultivation of animal cells
US5064764A
Method for improved transduction by recombinant adeno-associated viruses
US5756283A
AAV-mediated delivery of DNA to cells of the nervous system
US6180613B1
An improved method for the production and purification of adenoviral vectors
US6194191B1