Compositions and methods for delivering syntaxin-binding protein-1

AAV particles with AAV9 capsid variants and a WPRE-enhanced genome are developed to deliver STXBP1 to CNS cells, addressing the unmet need for treating STXBP1-related disorders by targeting the root cause of symptoms.

WO2026096599A1PCT designated stage Publication Date: 2026-05-07NEUROCRINE BIOSCIENCES INC +1
View PDF 52 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/053065
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-30
Filing Date
2025-10-29
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

There is a high unmet need for treatments that target the underlying cause of STXBP1 mutations, particularly for delivering syntaxin-binding protein 1 (STXBP1) to central nervous system (CNS) cells to treat STXBP1-related disorders such as STXBP1 Developmental and Epileptic Encephalopathy (DEE), as existing therapies only manage symptoms and not the root cause.

Method used

Development of adeno-associated virus (AAV) particles with specific AAV9 capsid variants and a recombinant viral genome encoding STXBP1, incorporating a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), designed to efficiently deliver STXBP1 to CNS cells.

Benefits of technology

The AAV particles effectively deliver STXBP1 to CNS cells, potentially addressing the underlying cause of STXBP1-related disorders, offering a therapeutic option for managing symptoms and improving patient outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000177_0001
    Figure IMGF000177_0001
  • Figure IMGF000029_0001
    Figure IMGF000029_0001
Patent Text Reader

Abstract

The disclosure relates to adeno-associated (AAV) particles comprising viral genomes encoding syntaxin-binding protein-1 (STXBP1), compositions comprising said AAV particles, and methods for making or delivering said AAV particles to a cell or subject. The AAV particles, compositions, and methods of the present disclosure are useful for the treatment of subjects who have, have been diagnosed with having, or are at risk of having a STXBP1-related disorder, e.g., STXBP1 Developmental and Epileptic Encephalopathy (DEE) and / or other STXBP1-related disorders, or at least one symptom thereof.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS AND METHODS FOR DELIVERING SYNTAXIN-BINDING PROTEIN-1Related Applications

[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 714,095, filed on October 30, 2024, the contents of which are incorporated herein by reference in their entirety.Sequence Listing

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing file, entitled 14640_0301-00304_SL.xml, was created on September 30, 2025, and is 131,523 bytes in size. The information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety.Field

[0003] Described herein are adeno-associated virus (AAV) particles comprising a viral genome (e.g., recombinant viral genome) encoding syntaxin-binding protein-1 (STXBP1). Also described herein are compositions comprising said AAV particles, methods of making said AAV particles, and / or methods of delivering said AAV particles to a cell or subject. In some embodiments, the disclosure provides methods or uses for the treatment of STXBP1 Developmental and Epileptic Encephalopathy (DEE) and / or other STXBP1 -related disorders.Background

[0004] Syntaxin-binding protein 1 (STXBP1), also known as Muncl8-1, is part of the synaptic fusion machinery that enables vesicles to fuse with the plasma membrane. Other names for STXBP1 include P67, DEE4, NSEC1, UNC18, N-Secl, RBSEC1, unc-18A, and uncl8-l.STXBP1 regulates neurotransmitter transmission by interacting with the SNARE complex. The SNARE complex is primarily composed of SNAP-25, vesicular associated membrane protein and syntaxin- 1. SNAP-25 and syntaxin- 1 form the target membrane vesicle protein (T-SNARE), which binds to synaptic vesicle protein (VAMP). STXBP1 has a complex, arched tertiary structure. The arch comprises four closely connected domains, 1, 2, 3a and 3b. Domains 1 and 3a form an arched gap. STXBP1 primarily regulates vesicle fusion by interacting with syntaxin- 1.Domain 3a of STXBP1 is in close contact with the Habc domain of syntaxin- 1, and domain 1 of STXBP1 binds to the N-terminal domain of syntaxin- 1. STXBP1 regulates vesicle docking and fusion by interacting with the SNARE complex. STXBP1 affects the released vesicles and participates in the transmission of neurotransmitters. STXBP1 is prominently involved in the early process of neurotransmitter release.

[0005] STXBP1 is essential for presynaptic vesicle release. It is rapidly phosphorylated by protein kinase C upon neuronal depolarization.

[0006] STXBP1 is encoded by the STXBP1 gene (Ensembl Gene ID No. ENSG00000136854), which is located on chromosome 9. It is expressed in the brain and spinal cord, and highly enriched in axons. Expression of STXBP1 is highest in the retina and cerebellum. STXBP1 is also found outside the brain.

[0007] Mutations in the STXBP1 gene are known to cause disease in human subjects. Abnormal expression of STXBP1 plays a role in the pathogenesis of a variety of neurological diseases, including STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 developmental and epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), and Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

[0008] STXBP1 expression is also abnormal in STXBP1 encephalopathy. There are an estimated 750 known cases of STXBP1 encephalopathy worldwide, and has an estimated incidence of 3.3-3.8 per 100,000 births.

[0009] Patients with STXBP1 mutations and / or STXBP1 encephalopathy often present with epilepsy. Some patients with STXBP1 mutations present with autistic features, including aggressive behavior, self-mutilation, hyperactivity, compulsive symptoms, episodes of psychosis and / or auditory hallucinations. Phenotypes range from severe neonatal epilepsy to infantile-onset epilepsy.

[0010] Many patients with STXBP1 mutations also present with non-epileptic movement disorders, including truncal and limb ataxia, generalized tremors, and dystonia. Patients often present with unremitting epileptic activity.

[0011] Some patients with STXBP1 mutations have only STXBP1 -related neurodevelopment disabilities without seizures. Not all patients with STXBP1 mutations have seizures.

[0012] Patients with STXBP1 encephalopathy are reliant on caregivers for the duration of their lives. Moreover, 40% of patients become non-ambulatory and lifespan is expected to be significantly reduced to about 30 years.

[0013] STXBP1 encephalopathy is caused by haploinsufficiency. Thus, disease may occur where there is a mutation to only a single functional copy of the STXBP1 gene. Disease-causing mutations include missense, nonsense, frameshift, splice-site, and whole gene deletions. There are about 135 known pathogenic variants of the STXBP1 gene.

[0014] STXBP1 Developmental and Epileptic Encephalopathy (DEE) is a severe and early- onset presentation of STXBP1 encephalopathy. Patients typically exhibit early-onset seizures, including infantile spasms, intractable epilepsy, unremitting severe seizures, gross and fine motor changes, and cognitive impairment.

[0015] Interneurons may be more affected by haploinsufficiency than excitatory neurons.

[0016] Studies have demonstrated that heterozygous STXBP1 knock-out mice display impaired glutamate and GABA transmission, increased anxiety, increased aggression, and impaired emotional learning, in addition to modest seizure phenotype.

[0017] Studies in mice demonstrated that normalizing the excitatory synaptic transmission in STXBP1 heterozygotic knockout mice reduces aggression. This indicated a therapeutic option for managing aggressiveness in patients with STXBP1 mutations.

[0018] Existing therapies target the symptoms of STXBP1 encephalopathy. Existing first line treatment comprises anti-epileptic drugs such as levetiracetam and phenobarbital. Existing second line treatment comprises further anti-epileptic drugs such as clobazam, topiramate. Existing third line treatment comprises further anti-epileptic drugs and / or interventions. Known interventions for existing third line treatment include adrenocorticotropic hormone, ketogenic diet and vagal nerve stimulation.

[0019] No approved therapies target the underlying cause of STXBP1 mutations. There is a high unmet need for such treatments driven by the high seizure rate and shortened lifespan of patients with STXBP1 mutations.

[0020] Thus, there remains a long-felt need to develop pharmaceutical compositions and methods that can be delivered to the CNS for the treatment of diseases associated with STXBP1mutations. In particular, a need exists for treatments targeting neurons, including GAB Aergic and glutamatergic neurons.

[0021] Adeno-associated viruses (AAVs) have emerged as a widely studied and utilized viral particles for delivery of therapeutically effective polypeptides to mammalian cells. See, e.g., Tratschin et al., Mol. Cell Biol., 5(ll):3251-3260 (1985) and Grimm et al., Hum. Gene Ther., 10(15):2445-2450 (1999), the relevant contents of each of which are incorporated herein by reference in their entirety.

[0022] However, there remains a need for effective methods of treatment using AAV capsid variants that are capable of delivering STXBP1 to a target cell or tissue, e.g., a CNS cell or tissue.Summary

[0023] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 39) present at amino acids 254- 259 of the amino acid sequence of SEQ ID NO: 45, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 45, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 45.

[0024] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ENVSGSPHSKA (SEQ ID NO: 1) present at amino acidscorresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTENVSGSPHSKAQNQQT (SEQ ID NO: 2 ) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45.

[0025] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 43, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 1) present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 2) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43; and / or (ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 44, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 1) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44, optionally wherein the amino acid sequence comprisesKTENVSGSPHSKAQNQQT (SEQ ID NO: 2) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44.

[0026] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 43; (ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 44; and / or (iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 45.

[0027] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 43; (ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 44; and / or (iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO:

[0028] In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 43; (ii) the amino acid sequence of SEQ ID NO: 44; and / or (iii) the amino acid sequence of SEQ ID NO: 45.

[0029] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 39) present at positions 254-259 of the amino acid sequence of SEQ ID NO: 42, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 42, the amino acid R at position 250, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 42.

[0030] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ERVSGSPHSKA (SEQ ID NO: 3) present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42.

[0031] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 40, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 3) present at amino acids corresponding to positions 451-461 of the amino acidsequence of SEQ ID NO: 40, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40; and / or (ii) an amino acid sequence that is least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 41, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 3) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41.

[0032] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 40; (ii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 41; and / or (iii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 42. In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 99% identical to SEQ ID NO: 40; (ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 41; and / or (iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 42.

[0033] In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 40; (ii) the amino acid sequence of SEQ ID NO: 41; and / or (iii) the amino acid sequence of SEQ ID NO: 42.

[0034] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variantcomprises the amino acid sequence of HDSPHK (SEQ ID NO: 5) present at amino acids positions 252-257 numbered according to SEQ ID NO: 48 and comprises the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 48.

[0035] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of HDSPHK (SEQ ID NO: 5) present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48; optionally wherein the AAV9 capsid variant comprises the amino acid sequence ofKTINGHDSPHKSGQNQQT (SEQ ID NO: 7) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48.

[0036] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 5) present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 7) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46; and / or (ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO:47, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 5) present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 7) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47.

[0037] In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46; (ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 47; and / or (iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 48. In some embodiments, the AAV9 capsid variant comprises: (i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46; (ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47; and / or (iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 48.

[0038] In some embodiments, the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 46; (ii) the amino acid sequence of SEQ ID NO: 47; and / or (iii) the amino acid sequence of SEQ ID NO: 48.

[0039] In some embodiments, the recombinant viral genome encodes wildtype STXBP1. In some embodiments, the recombinant viral genome encodes human STXBP1. In some embodiments, the encoded STXBP1 comprises the amino acid sequence of SEQ ID NO: 8 or any one of SEQ ID NOs: 9-20.

[0040] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21.

[0041] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 96% (e.g., at least 96%, atleast 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22.

[0042] In some embodiments, the WPRE is positioned 3’ relative to the STXBP1 -encoding sequence. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or any one of SEQ ID NOs: 62-66, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 26.

[0043] In some embodiments, the recombinant viral genome further comprises a promoter operably linked to the STXBP1 -encoding sequence. In some embodiments, the promoter is a human synapsin 1 (hSYNl) promoter, a human elongation factor 1 alpha promoter (EFla) promoter, or an endogenous STXBP1 promoter (ePro). In some embodiments, the promoter is a hSYNl promoter. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 23.

[0044] In some embodiments, the recombinant viral genome further comprises a polyadenylation (poly A) sequence. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29.

[0045] In some embodiments, the recombinant viral genome further comprises at least one inverted terminal repeat (ITR). In some embodiments, the at least one ITR comprises a 5’ ITR and a 3’ ITR. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31.

[0046] In some embodiments, the AAV particle further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein optionally the one or more miRbinding sites reduces or prevents expression of STXBP1 in dorsal root ganglia. In some embodiments, the one or more miR binding sites comprises one, two, three, or four miR183 binding sites. In some embodiments, the recombinant viral genome comprises a nucleotide sequence encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical. In some embodiments, each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 27. In some embodiments, each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.

[0047] In some embodiments, the AAV particle further comprises a nucleotide sequence encoding a microRNA183 (miR183) binding site series, wherein the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 28. In some embodiments, the nucleotide sequence encoding the miR183 binding site series consists of the nucleotide sequence of SEQ ID NO: 28.

[0048] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: a) a 5’ inverted terminal repeat (ITR); b) a promoter; c) the STXBP1 -encoding sequence; d) the WPRE; e) a polyadenylation (polyA) sequence; and I) a 3’ ITR.

[0049] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least97%, at least 98%, or at least 99%) identical thereto; and / or f) the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0050] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0051] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0052] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0053] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0054] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0055] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31.

[0056] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31.

[0057] In some embodiments, a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1- encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29; and I) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31.

[0058] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the recombinant viral genome comprises a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 32.

[0059] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia. In some embodiments, the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the nucleotide sequence encoding the one or more miR binding sites encodes four miR binding sites, wherein each of thefour miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 27.

[0060] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 28.

[0061] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid comprises: (i) the amino acid sequence of SEQ ID NO: 43; (ii) the amino acid sequence of SEQ ID NO: 44; and / or (iii) the amino acid sequence of SEQ ID NO: 45; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; I) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

[0062] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

[0063] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 40; (ii) the amino acid sequence of SEQ ID NO: 41 ; and / or (iii) the amino acid sequence of SEQ ID NO: 42; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a woodchuckhepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; I) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

[0064] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 46; (ii) the amino acid sequence of SEQ ID NO: 47; and / or (iii) the amino acid sequence of SEQ ID NO: 48; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; I) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

[0065] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

[0066] In some embodiments, the present disclosure provides a cell comprising an AAV particle disclosed herein. In some embodiments, the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an SI9 cell), or a bacterial cell.

[0067] In some embodiments, the present disclosure provides a method of making an AAV particle disclosed herein, the method comprising: (i) providing a cell comprising the recombinant viral genome comprising an STXBP1 -encoding sequence and a nucleic acid encoding the AAV9capsid variant; and (ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV9 capsid variant; thereby making the AAV particle.

[0068] In some embodiments, (a) the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 43; (ii) the amino acid sequence of SEQ ID NO: 44; and / or (iii) the amino acid sequence of SEQ ID NO: 45; and (b) wherein the recombinant viral genome comprises: a) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; I) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

[0069] In some embodiments, (a) the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 40; (ii) the amino acid sequence of SEQ ID NO: 41; and / or (iii) the amino acid sequence of SEQ ID NO: 42; and (b) the viral genome comprises: a) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; I) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

[0070] In some embodiments, (a) the AAV9 capsid variant comprises: (i) the amino acid sequence of SEQ ID NO: 46; (ii) the amino acid sequence of SEQ ID NO: 47; and / or (iii) the amino acid sequence of SEQ ID NO: 48; and (b) the viral genome comprises: a) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotidesequence of SEQ ID NO: 27; f) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

[0071] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

[0072] In some embodiments, the method further comprises prior to step (i), introducing into the cell a nucleic acid comprising the recombinant viral genome. In some embodiments, the method further comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV9 capsid variant. In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an SI9 cell), or a bacterial cell.

[0073] In some embodiments, the present disclosure provides a pharmaceutical composition comprising an AAV particle disclosed herein and a pharmaceutically acceptable excipient.

[0074] In some embodiments, the present disclosure provides a method of delivering an AAV particle encoding syntaxin-binding protein 1 (STXBP1) to a cell, comprising administering an effective amount of the AAV particle disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the cell is in a subject. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having an STXBP1 -related disorder.

[0075] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or at least one symptom thereof, comprising administering to the subject an effective amount of an AAV particle disclosed herein or a pharmaceutical composition disclosed herein. In some embodiments, the STXBP1 -related disorder is an STXBP1 -related neurodegenerative or neuromuscular disorder. In some embodiments, the STXBP1 -related neurodegenerative or neuromuscular disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

[0076] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or at least one symptom thereof, wherein the STXBP1 -related disorder is STXBP1 encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), or STXBP1 -related neurodevelopmental disabilities without seizures, comprising administering to the subject an effective amount of an AAV particle disclosed herein or a pharmaceutical composition disclosed herein.

[0077] In some embodiments, the subject has one or more mutations in the STXBP1 gene. In some embodiments, the subject has a reduced level of STXBP1 activity as compared to a reference level in an individual who does not have an STXBP1 -related disorder.

[0078] In some embodiments, the treating results in prevention of progression of the disorder or at least one symptom thereof in the subject.

[0079] In some embodiments, the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers. In some embodiments, the one or more biomarkers comprises: (i) increased release of the neurotransmitters glutamate and / or gamma-aminobutyric acid (GABA); or (ii) reduction in abnormal electroencephalographic activity. In some embodiments, the at least one symptom comprises epilepsy, autistic features, ataxia, generalized tremors, developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.

[0080] In some embodiments, the subject is a human.

[0081] In some embodiments, the AAV particle or the pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject. In some embodiments, the cell, tissue, or region of the CNS comprises a cell, tissue, or region of the striatum, thalamus, cerebellum, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, or a combination thereof. In some embodiments, the cell of the CNS comprises a neuron (e.g., a cornu ammonis 1 (CAI) neuron, cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).

[0082] In some embodiments, the AAV particle or the pharmaceutical composition is delivered to the subject via intravenous administration.

[0083] In some embodiments, the method further comprises evaluating, e.g., measuring, the level of STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject. In some embodiments, the level of STXBP1 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, the evaluating the level of STXBP1 gene, mRNA, and / or protein expression is performed before and after administering the AAV particle or pharmaceutical composition, optionally wherein the subject’s level of STXBP1 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of STXBP1 gene, mRNA, and / or protein expression after administration.

[0084] In some embodiments, the method comprises evaluating the level of STXBP1 gene, mRNA, and / or protein expression in a cell or tissue of the CNS in the subject. In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the striatum, thalamus, cerebellum, cortex (e.g., frontal cortex, motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, or a combination thereof. In some embodiments, the cell of the CNS comprises a neuron (e.g., cornu ammonis 1 (CAI) neuron, comu ammonis 2 (CA2) neuron, comu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof). In some embodiments, the subject’s level of STXBP1 expression after administration of the AAV particle or pharmaceutical composition is increased relative to the subject’s level of STXBP1 expression before administration of the AAV particle or pharmaceutical composition.

[0085] In some embodiments, the method further comprises evaluating, e.g., measuring, the level of STXBP1 activity in the subject, e.g., in a cell or tissue of the subject.

[0086] In some embodiments, administering the AAV particle or pharmaceutical composition to the subject results in an increase in: (i) the level of STXBP1 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the striatum, thalamus, cerebellum, cortex, (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG,lumbar DRG, sciatic nerve, cornu ammonis 1 (CAI) neurons, cornu ammonis 2 (CA2) neurons, cornu ammonis 3 (CA3) neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of STXBP1 activity in a cell, tissue, or fluid of an individual with an STXBP1- related disorder who has not been administered the AAV particle or the pharmaceutical composition; (ii) the number and / or level of viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex, (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or (iii) the level of STXBP1 protein, STXBP1 mRNA expression, or STXBP1 gene expression in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex, (e.g., frontal cortex and / or motor cortex , hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of STXBP1 protein, STXBP1 mRNA expression, or STXBP1 gene expression in a cell or tissue of an individual with an STXBP1 -related disorder who has not been administered the AAV particle or the pharmaceutical composition.

[0087] In some embodiments, the method further comprises administering to the subject at least one additional agent and / or therapy suitable for treating the STXBP1 -related disorder or at least one symptom thereof. In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).

[0088] In some embodiments, the method further comprises administering an immunosuppressant to the subject. In some embodiments, the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone),adrenocorticotropic hormone, rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine.

[0089] In some embodiments, the present disclosure provides an AAV particle disclosed herein or a pharmaceutical composition disclosed herein for use in the treatment of an STXBP1 -related disorder or at least one symptom thereof in a subject; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

[0090] In some embodiments, the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder or at least one symptom thereof; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the STXBP1 -related disorder is STXBP1 DEE.

[0091] In some embodiments, the present disclosure provides the use of an AAV particle disclosed herein, a cell disclosed herein, or a pharmaceutical composition disclosed herein in the manufacture of a medicament for the treatment of an STXBP1 -related disorder or at least one symptom thereof in a subject; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder, or at least one symptom thereof; optionally wherein the STXBP1-related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5). In some embodiments, the STXBP1 -related disorder is STXBP1 DEE.

[0092] In some embodiments, the present disclosure provides an AAV particle disclosed herein or a pharmaceutical composition disclosed herein for use in a method of treating a disorder disclosed herein.Brief Description of the Drawings

[0093] FIG. 1A depicts vector genome (VG) quantification (VG / diploid genome) of mice at 28 days post-IV injection of PBS or PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 52), Construct 3 (SEQ ID NO: 34), or Construct 1 (SEQ ID NO: 32). FIG. IB depicts normalized hSTXBPl transgene expression of mice at 28 days post-IV injection of PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 52), Construct 3 (SEQ ID NO: 34), or Construct 1 (SEQ ID NO: 32).

[0094] FIG. 2 A and FIG. 2B depict STXBP1 transgene expression (normalized to Gapdh) by detection of RNA abundance of mice at 28 days post-IV injection of PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 52) or Construct 3 (SEQ ID NO: 34).

[0095] FIG. 3 depicts STXBP1 mRNA levels (normalized to 0-actin) measured in SH-SY5Y neurons 3 days post-transduction with PHP.eB viral particles carrying Construct 4 (SEQ ID NO: 35), Construct 5 (SEQ ID NO: 36), Construct 9 (SEQ ID NO: 56), Construct 10 (SEQ ID NO: 57), or Construct 11 (SEQ ID NO: 58) at MOI le5 or le4.

[0096] FIG. 4 depicts STXBP1 mRNA levels (normalized to 0-actin) measured in GlutaNeurons 3 days post transduction with PHP.eB viral particles carrying Construct 4 (SEQ ID NO: 35), Construct 5 (SEQ ID NO: 36), Construct 9 (SEQ ID NO: 56), Construct 10 (SEQ ID NO: 57), or Construct 11 (SEQ ID NO: 58) at MOI le5 or le4.

[0097] FIG. 5 is an In Situ Hybridization (ISH) analysis of STXBP1 mRNA expression in the brain in wild-type (WT) mice at 28 days post-IV injection of PBS (top left and bottom left panels) or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) (top right and bottom right panels).

[0098] FIG. 6 depicts quantification of ISH analysis of STXBP1 mRNA expression in the brain in WT mice at 28 days post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) in neurons of the cortex (CTX), cornu ammonis 1 (CAI), cornu ammonis 2 (CA2), cornu ammonis 3 (CA3), dentate gyrus (DG), striatum (STR), thalamus (Thai), deep cerebellar nuclei (DCN), or cerebellum (CB).

[0099] FIG. 7 depicts the frequency after 17~18 days post-transduction of miniature excitatory post-synaptic current (mEPSC) in iPSC-derived glutamatergic neurons co-cultured with astrocytes and transduced with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) relative to control. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0100] FIG. 8 A depicts the neocortex and SI pyramidal layer V in which patch clamp studies were conducted. FIG. 8B and FIG. 8C depict results of patch-clamp electrophysiology in neocortical SI layer V pyramidal neurons of control WT mice treated with PBS or WT mice treated with PHP.eB viral particles carrying Construct 10 (SEQ ID NO: 57). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0101] FIG. 9 depicts EEG analysis of spike- wave discharges (SWD) per hour of total recording in heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS. No state is defined. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0102] FIG. 10 depicts analysis of freezing behavior of heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS.

[0103] FIG. HA and FIG. 11B depict analysis of anxiety-like behavior (on-shelter frequency) (FIG. 11 A) or hind limb clasping behavior (% time spent clasping) (FIG. 11B) in heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0104] FIG. 12A and FIG. 12B depict the percentage of hSTXBPH- neurons in the cortex (FIG. 12 A) or hippocampus (FIG. 12B) of heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS. LD = low dose. HD = high dose.

[0105] FIG. 13 depicts analysis of freezing behavior of heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0106] FIG. 14A depicts analysis of anxiety-like behavior (on-shelter frequency) and FIG. 14B depicts analysis of hind limb clasping behavior (% time spent clasping) in juvenile heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0107] FIG. 15 depicts protein analysis of normalized STXBP1 levels in heterozygous (het) STXBP1-KO (mutant) mice injected I.V. with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to het mice or wild-type control mice (WT) administered PBS.

[0108] FIG. 16A depicts protein analysis of normalized STXBP1 levels of mice at 4 weeks post-I.V. injection of PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to mice administered PBS. FIG. 16B depicts vector genome (VG) quantification (VG / diploid genome) in mice at 4 weeks post-I.V. injection of PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to mice administered PBS. FIG. 16C depicts human / mouse STXBP1 cDNA ratio levels in mice at 4 weeks post-I.V. injection of PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to mice administered PBS. FIG. 16D and FIG. 16E depict the percentage of hSTXBPH- neurons in the cortex (FIG. 16D) or hippocampus (FIG. 16E) in mice at 4 weeks post-I.V. injection of PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) as compared to mice administered PBS. *P<0.05.

[0109] FIG. 17 depicts normalized relative STXBP1 expression in NGN2-inducible neurons transduced with TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) at 2-fold serial MOI dilutions and harvested 3 days post-transduction.

[0110] FIG. 18A depicts normalized relative STXBP1 expression in human ALPL overexpressed SH-SY5Y neurons transduced with TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) at 2-fold serial MOI dilutions and harvested 3 days post-transduction. FIG. 18B depicts protein analysis of STXBP1 levels in human ALPL overexpressed SH-SY5Y neurons transduced with TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) at dosesof 5.00e6, 2.50e6, 1.25e6, 6.25e5, 3.13e5, 1.56e5, and 7.81e4 as compared to untreated neurons harvested 6 days post-transduction.

[0111] FIGs. 19A-19D depict viral genome level (vg / kg) (FIG. 19A), mouse STXBP1 cDNA ratios (FIG. 19B), human STXBPl / mouse STXBP1 cDNA ratios (FIG. 19C), and STXBP1 protein levels (FIG. 19D) in wild type and heterozygous mutant mice injected with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 32) at low and high doses.

[0112] FIG. 20 A depicts double staining of NeuN and hSTXBPl in the whole brain, hippocampus, and cortex of juvenile or adult mice injected with PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32). FIG. 20B and FIG. 20C depict the percentage of hSTXBPl+ neurons in the cortex (FIG. 20B) and hippocampus (FIG. 20C) of juvenile and adult mice injected with PHP.eB or TTM-027 viral particles carrying Construct 1.

[0113] FIG. 21A depicts mSTXBPl mRNA levels in mice treated with PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) and shown as normalized to wild type mSTXBPl levels. FIG. 21B depicts STXBP1 protein levels in mice injected with PHP.eB or TTM-027 viral particles carrying Construct 1 (SEQ ID NO: 32) and shown as levels normalized to those in wild type mice treated with vehicle (PBS) control. FIGs. 21C, 21D, and 21E depict, respectively, excitatory (FIG. 21C), inhibitory (FIG. 21D), and excitatory / inhibitory ratios (FIG. 2 IE) determined from whole cell patch-clamp electrophysiology of neurons from mice injected with PHP.eB or TTM-027 viral particles carrying Construct 1.

[0114] FIG. 22A and FIG. 22B show STXBP1 mRNA expression levels in iPSC-derived neurons transduced with TTM-027 AAV particles comprising Construct 1 (SEQ ID NO: 32) as assessed after 2 weeks (FIG. 22 A) and 4 weeks (FIG. 22B) of maturation.

[0115] FIG. 23 A and FIG. 23B show STXBP1 protein expression levels in iPSC-derived neurons transduced with TTM-027 AAV particles comprising Construct 1 (SEQ ID NO: 32) as assessed after 2 weeks (FIG. 23 A) and 4 weeks (FIG. 23 B) of maturation.

[0116] FIG. 24 A and FIG. 24B depict neuronal activity from iPSC-derived neurons transduced with TTM-027 AAV particles comprising Construct 1 (SEQ ID NO: 32). FIG. 24A shows total spikes and FIG. 24B shows total bursts as assessed at 2 weeks of maturation using a multielectrode array (MEA).Detailed DescriptionI. CompositionsA. Nucleic Acids and Viral Genomes1. STXBPl-Encoding Sequence

[0117] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a polynucleotide encoding STXBP1, also referred to as an STXBP1- encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1- encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.

[0118] In some embodiments, the STXBP1 -encoding sequence encodes human STXBP1. In some embodiments, the STXBP1 -encoding sequence encodes wildtype STXBP1. In some embodiments, the STXBP1 -encoding sequence encodes an STXBP1 isoform.

[0119] In some embodiments, the STXBP1 -encoding sequence encodes STXBP1 isoform a, STXBP1 isoform b, STXBP1 isoform c, STXBP1 isoform d, STXBP1 isoform e, STXBP1 isoform f, STXBP1 isoform g, or STXBP1 isoform h. In some embodiments, the STXBP1 comprises the amino acid sequence of any one of SEQ ID NOs: 9-20 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 comprises the amino acid sequence of any one of SEQ ID NOs: 9- 20.

[0120] In some embodiments, the STXBP1 comprises the amino acid sequence of SEQ ID NO: 8 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 98% identical tothe amino acid sequence of SEQ ID NO: 8. In some embodiments, the STXBP1 comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 8. In some embodiments, the STXBP1 comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the STXBP1 consists of the amino acid sequence of SEQ ID NO: 8.

[0121] Non-limiting examples of STXBP1 amino acid sequences are provided in Table 1.Table 1. Exemplary STXBP1 Amino Acid Sequences

[0122] In some embodiments, the STXBP1 -encoding sequence comprises a human STXBP1 nucleotide sequence. In some embodiments, the STXBP1 -encoding sequence comprises a wildtype STXBP1 nucleotide sequence. In some embodiments, the STXBP1 -encoding sequence comprises a codon-optimized STXBP1 nucleotide sequence. In some embodiments, the STXBP1 -encoding sequence comprises one or more CpG motifs. In some embodiments, theSTXBP1 -encoding sequence is CpG-depleted. In some embodiments, the STXBP1 -encoding sequence comprises no CpG motifs (i.e., is CpG-free).

[0123] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO:21. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the STXBP1 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 21.

[0124] In some embodiments, the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO:22. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the STXBP1 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the STXBP1 -encoding sequence comprisesthe nucleotide sequence of SEQ ID NO: 22. In some embodiments, the STXBP1 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 22.

[0125] Non-limiting examples of STXBP1 -encoding sequences are provided in Table 2.Table 2. Exemplary STXBPl-Encoding Sequences2. Promoter

[0126] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a promoter operably linked to an STXBP1 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a promoter operably linked to an STXBP1 -encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.

[0127] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence and (ii) the STXBP1 -encoding sequence.

[0128] In some embodiments, the promoter is or comprises a synapsin 1 promoter. In some embodiments, the promoter is or comprises a human synapsin 1 (“human SYN1” or “hSYNl”) promoter.

[0129] In some embodiments, the promoter is or comprises a human elongation factor 1 alpha (“human Efl a” or “EFla”) promoter.

[0130] In some embodiments, the promoter is or comprises an endogenous STXBP1 promoter (“ePro”).

[0131] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, atleast 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 23.

[0132] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO:24 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 24. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 24.

[0133] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO:25 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the promoter comprises a nucleotidesequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 25.

[0134] Non-limiting examples of promoter sequences are provided in Table 3.Table 3. Exemplary Promoter Sequences3. WPRE

[0135] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising an STXBP1 -encoding sequence and a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and a WPRE and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.

[0136] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a WPRE and an STXBP1 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, an STXBP1 -encoding sequence and a WPRE. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, and (iii) a WPRE.

[0137] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 62 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 62. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 62.

[0138] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 63 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%)identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 63. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 63.

[0139] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 64 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 64. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 64.

[0140] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 65 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 65. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 65.

[0141] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 66 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 66. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 66.

[0142] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the WPRE comprises a nucleotide sequence that is atleast 99% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, theWPRE comprises the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 26.

[0143] A non-limiting example of a WPRE sequence is provided in Table 4.Table 4. Exemplary WPRE Sequence4. MicroRNA Binding Site

[0144] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising an STXBP1 -encoding sequence and a nucleotide sequence encoding at least one microRNA (miR) binding site. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and a nucleotide sequence encoding at least one miR binding site and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.

[0145] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, an STXBP1 -encoding sequence and a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, and (iii) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, (iii) a WPRE, and (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site).

[0146] In some embodiments, the miR binding site prevents, suppresses, or otherwise inhibits expression of STXBP1 in dorsal root ganglia. In some embodiments, the miR binding site is or comprises a miR183 binding site. In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence encoding a miR binding site series comprising at least 2 miR binding sites. In some embodiments, the miR binding site series comprises at least 2, at least 3, at least 4, or at least 5 miR binding sites. In some embodiments, the miR binding site series comprises 1, 2, 3, 4, or 5 miR binding sites. In some embodiments, the miR binding site series consists of 4 miR binding sites. In some embodiments, the miR binding sites of the miR binding site series are continuous. In some embodiments, the miR binding sites of the miR binding site series are separated by aspacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site, wherein each miR183 binding site has the same nucleotide sequence.

[0147] In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence encoding at least one miR183 binding site, wherein the at least one miR183 binding site is encoded by the nucleotide sequence of AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 27) or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein the nucleotide sequence encoding at least one miR 183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 27 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 27 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, at least one miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 27 or a nucleotide sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, but no more than 10, modifications relative to the nucleotide sequence of SEQ ID NO: 27, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has no more than 5 modifications relative to the nucleotide sequence of SEQ ID NO: 27, wherein the nucleotide sequence encoding the at least one miR 183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 2 modifications relative to the nucleotide sequence of SEQ ID NO: 27, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 1 modification relative to the nucleotide sequence of SEQ ID NO: 27, wherein the nucleotide sequence encoding the at least one miR 183 binding site comprises the nucleotide sequence of GTGCCAT.

[0148] In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site consists of the nucleotide sequence of SEQ ID NO: 27.

[0149] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) of the present disclosure comprises a nucleotide sequence encoding multiple miR183 binding sites, which may be referred to as a nucleotide sequence encoding a miR183 binding site series.

[0150] In some embodiments, the miR183 binding site series comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR183 binding sites), wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the miR183 binding site series comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR binding sites), wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 27.

[0151] In some embodiments, the miR 183 binding site series comprises 4 miR binding sites. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 27.

[0152] In some embodiments, each of the miRl 83 binding sites in the miRl 83 binding site series is separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, the spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, three, or four modifications, but no more than four modifications relative to the nucleotide sequence of GATAGGTA. In some embodiments, each spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA. In some embodiments, each spacer is encoded by the nucleotide sequence of GATAGTTA.

[0153] In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, atleast 90%, or at least 95%) identical thereto, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 28, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 28, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 28, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 28, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 28. In some embodiments, the nucleotide sequence encoding the miR183 binding site series consists of the nucleotide sequence of SEQ ID NO: 28.

[0154] A non-limiting example of a nucleotide sequence encoding a miR 183 binding site series is provided in Table 5.Table 5. Exemplary miR183 Binding Site-Encoding Sequence5. Polyadenylation Sequence

[0155] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising an STXBP1 -encoding sequence and a polyadenylation (polyA) sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising an STXBP1 -encoding sequence and a polyA sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.

[0156] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, an STXBP1 -encoding sequence and a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, and (iii) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, (iii) a WPRE, and (iv) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to an STXBP1 -encoding sequence, (ii) the STXBP1 -encoding sequence, (iii) a WPRE, (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site), and (v) a polyA sequence.

[0157] In some embodiments, the polyA sequence is a bovine growth hormone (BGH) polyA sequence.

[0158] In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQID NO: 29. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the polyA sequence consists of the nucleotide sequence of SEQ ID NO: 29.

[0159] A non-limiting example of a polyA sequence is provided in Table 6.Table 6. Exemplary PolyA Sequence6. Inverted Terminal Repeats (ITRs)

[0160] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) disclosed herein further comprises an ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises two ITRs.

[0161] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 3’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR and a 3’ ITR.

[0162] In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the 5’ ITR consists of the nucleotide sequence of SEQ ID NO: 30.

[0163] In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the 3’ ITR consists of the nucleotide sequence of SEQ ID NO: 31.

[0164] Non-limiting examples of ITR sequences are provided in Table 7.Table 7. Exemplary ITR Sequences7. Exemplary ITR-to-ITR Sequences

[0165] In some embodiments, the present disclosure provides a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprising a nucleotide sequence that is at least 80% (e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37.

[0166] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 85% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37.

[0167] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 90% (e.g., atleast 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37.

[0168] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37.

[0169] In some embodiments, the present disclosure provides a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of any one of SEQ ID NOs: 32, 33, 34, 35, 36, and 37. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 37. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 38.

[0170] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) ofConstruct 1. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 2. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 3. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 4. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 5. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 6. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 7.

[0171] Non-limiting ITR-to-ITR sequences (viral genomes) are provided in Table 8 and Table 9.Table 8. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and ComponentsTable 9. Exemplary Viral GenomesB. Adeno-associated virus (AAV) Capsids and Particles

[0172] AAVs typically have a genome of about 5,000 nucleotides in length and contain one open reading frame encoding the (non-structural) proteins responsible for replication (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and another open reading frame encoding the structural proteins of the capsid (VP1, VP2, VP3, encoded by capsid genes or Cap genes). The open reading frames are flanked by two inverted terminal repeat (ITR) sequences, which serve as the origin of replication of the viral genome. The Rep proteins are important for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid. Alternative splicing and alternate initiation codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame. VP1 is the full-length capsid protein sequence and contains the VP2 and VP3 sequences and VP2 and VP3 are shorter components of the whole, with the VP2 sequence containing the VP3 sequence. Though it varies by AAV serotype, as a non-limiting example, for AAV9 / hu.l4 (SEQ ID NO: 123 of US 7,906,111, the relevant contents of which are herein incorporated by reference in their entirety) VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736. With reference to the AAV9 capsid variant TTM-027, TTM-003, or TTM-043, VP1 comprises amino acids 1-742, VP2 comprises amino acids 138-742, and VP3 comprises amino acids 203- 742.

[0173] Changes in the sequence in the VP3 region of a single capsid open reading frame are also changes to VP1 and VP2; however, the percent difference as compared to the parent sequence will be greatest for VP3 since it is the shortest sequence of the three. Though described here in relation to the amino acid sequence, the nucleic acid sequence encoding these proteins can be similarly described. Together, the three capsid proteins assemble to create the AAV capsid. Without being bound by theory, the AAV capsid typically comprises a molar ratio of 1:1:10 of VP1:VP2:VP3.

[0174] The AAV particle typically requires a co-helper (e.g., adenovirus) to undergo productive infection in cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells’ genome.

[0175] AAV particles may be used as a biological tool, including in gene therapy, due to their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into the host genome and without replicating, and their relatively benign immunogenic profile. Moreover, infection with AAV particles has minimal influence on changing the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148, the relevant contents of which are herein incorporated by reference in their entirety). The genome of the virus may be manipulated to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to target a particular tissue and express or deliver a desired payload.

[0176] Typically, AAV particles for STXBP1 delivery may be recombinant viral particles that are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the replication-defective AAV particles may lack most or all coding sequences and essentially only contain one or two AAV ITR sequences and a nucleic acid sequence encoding STXBP1 (e.g., human STXBP1). In some cases, the nucleic acid sequence encoding STXBP1 (e.g., human STXBP1) further comprises one or more regulatory elements to modulate transcription or translation.

[0177] In some embodiments, the AAV particles of the present disclosure may be introduced into mammalian cells.

[0178] AAV particles of the present disclosure may be produced recombinantly and may be based on AAV reference sequences. In addition to single-stranded AAV viral genomes (e.g., ssAAVs), the present disclosure also provides for self-complementary AAV (scAAV) viral genomes. scAAV viral genomes contain DNA strands that anneal together to form doublestranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the transduced cell. In some embodiments, the AAV particle of the present disclosure is an scAAV. In some embodiments, the AAV particle of the present disclosure is an ssAAV.

[0179] Methods for producing and / or modifying AAV particles are disclosed in the art such as pseudotyped AAV particles (International Patent Publication Nos. W0200028004;W0200123001; WO2004112727; W02005005610; and W02005072364, the relevant contents of each of which are incorporated herein by reference in their entirety).

[0180] In some embodiments, an AAV particle of the present disclosure comprises a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV capsid. In some embodiments, the AAV capsid is an AAV capsid variant, wherein the variant comprises a capsid protein that differs from a wildtype AAV capsid protein by one or more insertions, deletions, and / or substitutions. In some embodiments, the AAV capsid or AAV capsid variant comprises a capsid protein selected from the group consisting of: AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV9 K449R, VOY101, VOY201, AAVPHP.A, AAVPHP.B, AAVPHP.B2, AAVPHP.B3, AAVPHP.eB, AAVPHP.N, AAVPHP.S, G2B4, G2B5, CAP-B 10, AAVrhlO, AAVrh32.33, AAVrh74, a capsid protein of an AAV serotype as provided in Table 6 of International Patent Publication No. WO2021230987 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023081648 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023154693 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023235791 (the relevant contents of which are incorporated by reference in their entirety), and a capsid protein disclosed in International Patent Publication No. W02024006741 (the relevant contents of which are incorporated by reference in their entirety), or a variant of any of the foregoing.

[0181] In some embodiments, the AAV capsid variant preferentially targets the brain over the liver. In some embodiments, the AAV capsid variant is AAVPHP.eB or CAP-B10. See, e.g., Goertsen et al. AAV capsid variants with brain-wide transgene expression and decreased liver targeting after intravenous delivery in mouse and marmoset. NatNeurosci 25, 106-115 (2022); Seo et al. Multimodal imaging of capsid and cargo reveals differential brain targeting and liver detargeting of systemically-administered AAVs, Biomaterials 288 (2022). In some embodiments, the AAV capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023081648 or WO2023235791. In some embodiments, the AAV5 capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023154693.

[0182] In some embodiments, the present disclosure provides an AAV particle comprising a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV9 capsid variant. Insome embodiments, the AAV9 capsid variant comprises at least one insertion and / or at least one substitution in hypervariable loop IV relative to a wildtype AAV9 capsid. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP1 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP2 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP3 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop IV is present in a VP1, VP2, and VP3 of the AAV9 capsid variant.

[0183] In some embodiments, the AAV9 capsid variant comprises at least one insertion and / or at least one substitution in hypervariable loop VIII relative to a wildtype AAV9 capsid. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP1 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP2 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP3 of the AAV9 capsid variant. In some embodiments, the at least one insertion and / or at least one substitution in hypervariable loop VIII is present in a VP1, VP2, and VP3 of the AAV9 capsid variant.

[0184] In some embodiments, the at least one insertion and / or at least one substitution may increase distribution of an AAV particle to a cell, region, or tissue of the CNS. The cell of the CNS may be, but is not limited to, neurons (e.g., excitatory, inhibitory, motor, sensory, autonomic, sympathetic, parasympathetic, Purkinje, Betz, etc.), glial cells (e.g., microglia, astrocytes, oligodendrocytes) and / or supporting cells of the brain such as immune cells (e.g., T cells). The tissue of the CNS may be, but is not limited to, the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen. The cell of the CNS may be, but is not limited to, a comu ammonis 1 (CAI) neuron, comu ammonis 2 (CA2) neuron, comu ammonis 3 (CA3) neuron, or deep cerebellar nuclei neuron.

[0185] In some embodiments, the one or more modifications may increase distribution of an AAV particle to the CNS (e.g., the cortex) after intravenous administration. In some embodiments, the one or more modifications may increase distribution of an AAV particle to theCNS (e.g., the cortex) following focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration.

[0186] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of ENVSGSPHSKA (SEQ ID NO: 1) in hypervariable loop IV. In some embodiments, the amino acid sequence of SEQ ID NO: 1 is present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 1 is present in VP1, VP2, and VP3.

[0187] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of SPHSKA (SEQ ID NO: 39) in hypervariable loop IV In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 39 present at positions 254-259 numbered according to the amino acid sequence of SEQ ID NO: 45, comprises the amino acid E at position 249 numbered according to the amino acid sequence of SEQ ID NO: 45, and comprises the amino acid V at position 251 numbered according to the amino acid sequence of SEQ ID NO: 45. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 39 present at positions 319-324 numbered according to the amino acid sequence of SEQ ID NO: 44, comprises the amino acid E at position 314 numbered according to the amino acid sequence of SEQ ID NO: 44, and comprises the amino acid V at position 316 numbered according to the amino acid sequence of SEQ ID NO: 44. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 39 present at positions 456-461 numbered according to the amino acid sequence of SEQ ID NO: 43, comprises the amino acid E at position 451 numbered according to the amino acid sequence of SEQ ID NO: 43, and comprises the amino acid V at position 453 numbered according to the amino acid sequence of SEQ ID NO: 43.

[0188] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises anamino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 249- 259 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 249- 259 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45. In some embodiments, the amino acid sequence of SEQ ID NO: 45 may be referred to as VP3 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 45. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 45.

[0189] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 44 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, orat least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 314- 324 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 314- 324 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 44. In some embodiments, the amino acid sequence of SEQ ID NO: 44 may be referred to as VP2 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequenceof SEQ ID NO: 44. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 44.

[0190] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 43 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 451- 461 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 1 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 43. In some embodiments, the amino acid sequence of SEQ ID NO: 43 may be referred to as VP1 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 43. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 43.

[0191] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of KTENVSGSPHSKAQNQQT (SEQ ID NO: 2) in hypervariable loop IV In some embodiments, the amino acid sequence of SEQ ID NO: 2 is present in VP1 , VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 2 is present in VP1, VP2, and VP3.

[0192] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 247- 264 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 247-264 of the amino acidsequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45 (e.g., present at positions 247- 264 of the amino acid sequence of SEQ ID NO: 45). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45. In some embodiments, the amino acid sequence of SEQ ID NO: 45 may be referred to as VP3 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 45. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 45.

[0193] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 44 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 312-329 of an amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 312-329 of an amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 312- 329 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsidvariant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises an amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises an amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 44, wherein the AAV9 capsid variant comprises an amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44 (e.g., present at positions 312- 329 of the amino acid sequence of SEQ ID NO: 44). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 44. In some embodiments, the amino acid sequence of SEQ ID NO: 44 may be referred to as VP2 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 44. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 44.

[0194] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 43 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96%identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 449- 466 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 43, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 2 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43 (e.g., present at positions 449- 466 of the amino acid sequence of SEQ ID NO: 43). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 43. In some embodiments, the amino acid sequence of SEQ ID NO: 43 may be referred to as VP1 of TTM-027. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 43. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 43.

[0195] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant that is encoded by the nucleotide sequence of SEQ ID NO: 50 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 50. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 50. In some embodiments, the AAV capsid variant is encoded by anucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 50. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 50. In some embodiments, the AAV capsid variant is encoded by the nucleotide sequence of SEQ ID NO: 50.

[0196] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of ERVSGSPHSKA (SEQ ID NO: 3) in hypervariable loop IV In some embodiments, the amino acid sequence of SEQ ID NO: 3 is present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 3 is present in VP1, VP2, and VP3.

[0197] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of SPHSKA (SEQ ID NO: 39) in hypervariable loop IV In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 39 present at positions 254-259 numbered according to the amino acid sequence of SEQ ID NO: 42, comprises the amino acid E at position 249 numbered according to the amino acid sequence of SEQ ID NO: 42, comprises the amino acid R at position 250 numbered according to the amino acid sequence of SEQ ID NO: 42, and comprises the amino acid V at position 251 numbered according to the amino acid sequence of SEQ ID NO: 42. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 39 present at positions 319-324 numbered according to the amino acid sequence of SEQ ID NO: 41, comprises the amino acid E at position 314 numbered according to the amino acid sequence of SEQ ID NO: 41, comprises the amino acid R at position 315 numbered according to the amino acid sequence of SEQ ID NO: 41, and comprises the amino acid V at position 316 numbered according to the amino acid sequence of SEQ ID NO: 41. In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 39 present at positions 456- 461 numbered according to the amino acid sequence of SEQ ID NO: 40, comprises the amino acid E at position 451 numbered according to the amino acid sequence of SEQ ID NO: 40, comprises the amino acid R at position 452 numbered according to the amino acid sequence of SEQ ID NO: 40, and comprises the amino acid V at position 453 numbered according to the amino acid sequence of SEQ ID NO: 40.

[0198] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%,at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 249- 259 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 249-259 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 249- 259 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42. In some embodiments, the amino acid sequence of SEQ ID NO: 42 may be referred to as VP3 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequenceof SEQ ID NO: 42. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 42.

[0199] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 41 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 314- 324 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 314-324 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 41. In some embodiments, the amino acid sequence of SEQ ID NO: 41 may be referred to as VP2 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 41. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 41.

[0200] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 40 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 451- 461 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 451-461 of the amino acid sequence of SEQ ID NO: 40). In someembodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 3 present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 451- 461 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 40. In some embodiments, the amino acid sequence of SEQ ID NO: 40 may be referred to as VP1 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 40. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 40.

[0201] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) in hypervariable loop IV In some embodiments, the amino acid sequence of SEQ ID NO: 4 is present in VP1 , VP2, and / or VP3. In some embodiments, the amino acid sequence of SEQ ID NO: 4 is present in VP1, VP2, and VP3.

[0202] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 247- 264 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsidvariant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 42, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42 (e.g., present at positions 247- 264 of the amino acid sequence of SEQ ID NO: 42). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42. In some embodiments, the amino acid sequence of SEQ ID NO: 42 may be referred to as VP3 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 42. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 42.

[0203] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 41 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96%identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 312- 329 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 41, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41 (e.g., present at positions 312- 329 of the amino acid sequence of SEQ ID NO: 41). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 41. In some embodiments, the amino acid sequence of SEQ ID NO: 41 may be referred to as VP2 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 41. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 41.

[0204] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 40 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 40,wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 449- 466 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 40, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 4 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40 (e.g., present at positions 449- 466 of the amino acid sequence of SEQ ID NO: 40). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 40. In some embodiments, the amino acid sequence of SEQ ID NO: 40 may be referred to as VP1 of TTM-003. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 40. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 40.

[0205] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant that is encoded by the nucleotide sequence of SEQ ID NO: 49 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. Insome embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 49. In some embodiments, the AAV capsid variant is encoded by the nucleotide sequence of SEQ ID NO: 49.

[0206] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV and the amino acid sequence of RQTALQL (SEQ ID NO: 6) in hypervariable loop VIII. In some embodiments, the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 are present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequences of SEQ ID NO: 5 and SEQ ID NO: 6 are present in VP1, VP2, and VP3.

[0207] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV (e.g., present at positions 252-257 numbered according to the amino acid sequence of SEQ ID NO: 48) and three, four, or all of the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and / or the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 48. In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV (e.g., present at positions 252-257 numbered according to the amino acid sequence of SEQ ID NO: 48) and the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 48.

[0208] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV (e.g., present at positions 317-322 numbered according to the amino acid sequence of SEQ ID NO: 47) and three, four, or all of the amino acid R at position 453, the amino acid T at position 455, the amino acid L at position 457, the amino acid Q at position 458,and / or the amino acid L at position 459, each numbered according to the amino acid sequence of SEQ ID NO: 47. In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV (e.g., present at positions 317-322 numbered according to the amino acid sequence of SEQ ID NO: 47) and the amino acid R at position 453, the amino acid T at position 455, the amino acid L at position 457, the amino acid Q at position 458, and the amino acid L at position 459, each numbered according to the amino acid sequence of SEQ ID NO: 47.

[0209] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV (e.g., present at positions 454-459 numbered according to the amino acid sequence of SEQ ID NO: 46) and three, four, or all of the amino acid R at position 590, the amino acid T at position 592, the amino acid L at position 594, the amino acid Q at position 595, and / or the amino acid L at position 596, each numbered according to the amino acid sequence of SEQ ID NO: 46. In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of HDSPHK (SEQ ID NO: 5) in hypervariable loop IV (e.g., present at positions 454-459 numbered according to the amino acid sequence of SEQ ID NO: 46) and the amino acid R at position 590, the amino acid T at position 592, the amino acid L at position 594, the amino acid Q at position 595, and the amino acid L at position 596, each numbered according to the amino acid sequence of SEQ ID NO: 46.

[0210] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding topositions 252-257 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 252- 257 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 388- 394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 252-257 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 252- 257 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence ofSEQ ID NO: 6 present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48. In some embodiments, the amino acid sequence of SEQ ID NO: 48 may be referred to as VP3 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 48. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 48.

[0211] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 317- 322 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 453- 459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of theamino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 317-322 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 317- 322 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47. In some embodiments, the amino acid sequence of SEQ ID NO: 47 may be referred to as VP2 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 47. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 47.

[0212] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, orat least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 454- 459 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 590- 596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 454-459 of theamino acid sequence of SEQ ID NO: 46 (e.g., present at positions 454-459 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 5 present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 454- 459 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of SEQ ID NO: 6 present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46. In some embodiments, the amino acid sequence of SEQ ID NO: 46 may be referred to as VP1 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 46.

[0213] In some embodiments, an AAV particle of the present disclosure comprises an AAV9 capsid variant comprising the amino acid sequence of KTINGHDSPHKSGQNQQT (SEQ ID NO: 7) in hypervariable loop IV and the amino acid sequence of RQTALQL (SEQ ID NO: 6) in hypervariable loop VIII. In some embodiments, the amino acid sequences of SEQ ID NO: 7 and RQTALQL (SEQ ID NO: 6) are present in VP1, VP2, and / or VP3. In some embodiments, the amino acid sequences of SEQ ID NO: 7 and RQTALQL (SEQ ID NO: 6) are present in VP1, VP2, and VP3.

[0214] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of RQTALQL (SEQ IDNO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 247- 264 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 48, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 247-264 of the amino acid sequence of SEQ ID NO: 48) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48 (e.g., present at positions 388-394 of the amino acid sequence of SEQ ID NO: 48). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48. In some embodiments, the amino acid sequence of SEQ ID NO: 48 may be referred to as VP3 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP3 comprising the amino acid sequence of SEQ ID NO: 48. In some embodiments, an AAV particle of the present disclosure comprises a VP3 consisting of the amino acid sequence of SEQ ID NO: 48.

[0215] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variantcomprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 312- 329 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453- 459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 312-329 of the amino acid sequence of SEQ ID NO: 47) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453-459 of the amino acid sequence of SEQ ID NO: 47 (e.g., present at positions 453-459 of the amino acid sequence of SEQ ID NO: 47). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 47. In some embodiments, the amino acid sequence of SEQ ID NO: 47 may be referredto as VP2 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP2 comprising the amino acid sequence of SEQ ID NO: 47. In some embodiments, an AAV particle of the present disclosure comprises a VP2 consisting of the amino acid sequence of SEQ ID NO: 47.

[0216] In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 96% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding topositions 449-466 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 449- 466 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590- 596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46, wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 7 present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 449-466 of the amino acid sequence of SEQ ID NO: 46) and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590-596 of the amino acid sequence of SEQ ID NO: 46 (e.g., present at positions 590-596 of the amino acid sequence of SEQ ID NO: 46). In some embodiments, the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 46. In some embodiments, the amino acid sequence of SEQ ID NO: 46 may be referred to as VP1 of TTM-043. In some embodiments, an AAV particle of the present disclosure comprises a VP1 comprising the amino acid sequence of SEQ ID NO: 46. In some embodiments, an AAV particle of the present disclosure comprises a VP1 consisting of the amino acid sequence of SEQ ID NO: 46.

[0217] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant that is encoded by the nucleotide sequence of SEQ ID NO: 51 or a nucleotide sequence that is at least 70% (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the AAVcapsid variant is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the AAV capsid variant is encoded by a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 51. In some embodiments, the AAV capsid variant is encoded by the nucleotide sequence of SEQ ID NO: 51.

[0218] In some embodiments, an AAV particle of the present disclosure comprises an amino acid sequence provided in Table 10. In some embodiments, an AAV particle of the present disclosure comprises amino acids 2-742 of an amino acid sequence provided in Table 10. In some embodiments, an AAV particle of the present disclosure comprises an amino acid sequence encoded by a nucleotide sequence of Table 11. In some embodiments, an AAV particle of the present disclosure is encoded by a nucleotide sequence of Table 11.

[0219] In some embodiments, the AAV particle comprises the AAV capsid variant TTM-027. In some embodiments, the AAV particle comprises the AAV capsid variant TTM-003. In some embodiments, the AAV particle comprises the AAV capsid variant TTM-043.Table 10. Exemplary Capsid Amino Acid SequencesTable 11. Exemplary Capsid Nucleotide Sequences

[0220] It is common for a first amino acid (AA1), e.g., a first methionine (Metl), encoded by a capsid gene to be expressed in capsid proteins but cleaved during or after polypeptide synthesis by protein processing enzymes such as Met-aminopeptidases. This “Metl / AAl-clipping” process often correlates with a corresponding acetylation of the second amino acid in the polypeptide sequence (e.g., alanine, valine, serine, threonine, etc.). Metl / AAl-clipping commonly occurs with VP1 and VP3 but can also occur with VP2.

[0221] Where the Metl / AAl-clipping is incomplete, a mixture of VP capsid proteins comprising the viral capsid may be produced, some of which include a Metl / AAl amino acid (Met+ / AA+) and some of which may lack a Metl / AAl amino acid as a result of Metl / AAl-clipping (Metl- / AA1-). For further discussion regarding Met 1 / AA1 -clipping in capsid proteins, see Jin, et al. Direct Liquid Chromatography / Mass Spectrometry Analysis for Complete Characterization of Recombinant Adeno- Associated Virus Capsid Proteins. Hum Gene Ther Methods. 2017 Oct. 28(5):255-267; Hwang, et al. N-Terminal Acetylation of Cellular Proteins Creates Specific Degradation Signals. Science. 2010 February 19. 327(5968): 973-977; the relevant contents of each of which are incorporated herein by reference in their entirety.

[0222] According to the present disclosure, references to capsid proteins, e.g., of AAV capsid variants, are not limited to either clipped (Metl- / AA1-) or unclipped (Metl+ / AA1+) and may refer to a mixture of clipped and unclipped capsid proteins. A direct reference to a capsid protein whether by VP1, VP2, or VP3 designation or by SEQ ID NO may encompass VP capsid proteins that include Metl / AAl (Metl+ / AA1+) as well as corresponding VP capsid proteins without Metl / AAl as a result of clipping (Metl- / AA1-).

[0223] Accordingly, in some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl-clipped VP1, VP2, and / or VP3 of TTM-027; in some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl-clipped VP1, VP2, and / or VP3 of TTM- 003; and, in some embodiments, an AAV particle of the present disclosure comprises a Metl / AAl-clipped VP1, VP2, and / or VP3 ofTTM-043.

[0224] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-742 of the amino acid sequence of SEQ ID NO: 43, wherein amino acid 2 of SEQ ID NO: 43 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-605 of the amino acid sequence of SEQ ID NO: 44, wherein amino acid 2 of SEQ ID NO: 44 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-540 of the amino acid sequence of SEQ ID NO: 45, wherein amino acid 2 of SEQ ID NO: 45 is optionally acetylated.

[0225] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-742 of the amino acid sequence of SEQ ID NO: 40, wherein amino acid 2 of SEQ ID NO: 40 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-605 of the amino acid sequence of SEQ ID NO: 41, wherein amino acid 2 of SEQ ID NO: 41 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprisesan AAV capsid variant comprising amino acids 2-540 of the amino acid sequence of SEQ ID NO: 42, wherein amino acid 2 of SEQ ID NO: 42 is optionally acetylated.

[0226] In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-742 of the amino acid sequence of SEQ ID NO: 46, wherein amino acid 2 of SEQ ID NO: 46 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-605 of the amino acid sequence of SEQ ID NO: 47, wherein amino acid 2 of SEQ ID NO: 47 is optionally acetylated. In some embodiments, an AAV particle of the present disclosure comprises an AAV capsid variant comprising amino acids 2-540 of the amino acid sequence of SEQ ID NO: 48, wherein amino acid 2 of SEQ ID NO: 48 is optionally acetylated.C. Exemplary AAV Particles

[0227] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 21, and the nucleotide sequence of SEQ ID NO: 26.

[0228] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 32.

[0229] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 34. In some embodiments, the AAV particle comprises an AAV capsid variantcomprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 34.

[0230] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 38.

[0231] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 22 and the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 22, and the nucleotide sequence of SEQ ID NO: 26.

[0232] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 33.

[0233] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 35. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variantis TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 35.

[0234] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 36. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 36.

[0235] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 37. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 37.

[0236] In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 3. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM- 027 and the viral genome (e.g., recombinant viral genome) of Construct 4. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 5. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 6. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 7.

[0237] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome)comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 26.

[0238] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 32.

[0239] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 34. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 34.

[0240] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 38.

[0241] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 22 and the nucleotidesequence of SEQ ID NO: 26. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 22 and the nucleotide sequence of SEQ ID NO: 26.

[0242] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 33.

[0243] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 35. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 35.

[0244] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 36. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 36.

[0245] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41 , or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 37. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variantis TTM-003) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 37.

[0246] In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 3. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM- 003 and the viral genome (e.g., recombinant viral genome) of Construct 4. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 5. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 6. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 7.

[0247] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 21 and the nucleotide sequence of SEQ ID NO: 26.

[0248] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 32.

[0249] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 34. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 34.

[0250] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 38.

[0251] In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 22 and the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the present disclosure provides an AAV particle that comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising, in 5’ to 3’ order, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 22 and the nucleotide sequence of SEQ ID NO: 26.

[0252] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 33.

[0253] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 35. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 35.

[0254] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 36. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 36.

[0255] In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 37. In some embodiments, the AAV particle comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) consisting of the nucleotide sequence of SEQ ID NO: 37.

[0256] In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 3. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM- 043 and the viral genome (e.g., recombinant viral genome) of Construct 4. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 5. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinantviral genome) of Construct 6. In some embodiments, the AAV particle comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 7.D. Tropism and Biodistribution Properties

[0257] AAV particles and payloads of the disclosure may be delivered to one or more target cells, tissues, organs, or organisms. In some embodiments, the AAV particles demonstrate enhanced tropism for a target cell type, tissue or organ. In some embodiments, the present disclosure provides AAV particles that demonstrate enhanced tropism for a target cell type, tissue or organ, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant TTM-043). As a non-limiting example, an AAV particle of the disclosure may have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively). In some embodiments, the present disclosure provides AAV particles that have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively), wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant TTM-043). In some embodiments, an AAV particle may, in addition, or alternatively, have decreased tropism for a cell-type, tissue or organ.

[0258] AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles of the present disclosure can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.

[0259] In some embodiments, AAV particles may be used to deliver STXBP1 to the central nervous system (see, e.g., U.S. Patent No. 6,180,613; the relevant contents of which are herein incorporated by reference in their entirety) or to specific tissues of the central nervous system. In some embodiments, the present disclosure provides AAV particles that may be used to deliver an STXBP1 -encoding sequence to the central nervous system or to specific tissues of the central nervous system, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO:40, 41, or 42 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO:46, 47, or 48 (e.g., the AAV capsid variant TTM-043).

[0260] In some embodiments, the AAV capsid variant allows for blood brain barrier penetration of the AAV particle following intravenous administration, focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration. In some embodiments, an AAV capsid variant described herein allows for blood brain barrier penetration of the AAV particle following intravenous administration. In some embodiments, the present disclosure provides AAV particles that allow for blood brain barrier penetration of the AAV particle following intravenous administration, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 40,41, or 42 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 46,47, or 48 (e.g., the AAV capsid variant TTM-043).

[0261] In some embodiments the AAV capsid variant allows for increased distribution of the AAV particle to a brain region. In some embodiments, the present disclosure provides AAV particles that allow for increased distribution of the AAV particle to a brain region, wherein the AAV particle comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant TTM-043). In some embodiments, the brain region comprises a frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, putamen, or a combination thereof. In some embodiments, the AAV capsid variant allows for preferential transduction in a brain region relative to the transduction in the dorsal root ganglia (DRG). In some embodiments, the AAV capsid variant allows for preferential transduction in a brain region relative to transduction in the liver. In some embodiments, the AAV capsid variant allows for transduction in neuronal cells. In some embodiments, the AAV capsid variant allows for preferential transduction to GABAergic neurons and / or glutamatergic neurons relative to other cells. In some embodiments, the AAV capsid variant allows for preferential transduction to comu ammonis 1 (CAI) neurons, comu ammonis 2 (CA2) neurons, comu ammonis 3 (CA3) neurons, and / or deep cerebellar nuclei neurons. In someembodiments, the AAV capsid variant allows for transduction in a non-neuronal cell, e.g., a glial cell (e.g., an astrocyte, an oligodendrocyte, or a combination thereof).

[0262] In some embodiments, an AAV capsid variant allows for increased distribution to a spinal cord region. In some embodiments, the present disclosure provides AAV particles that allow for increased distribution to a spinal cord region, wherein the AAV particles comprise the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., AAV capsid variant TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant TTM-043). In some embodiments, the spinal region comprises a cervical spinal cord region, thoracic spinal cord region, and / or lumbar spinal cord region.

[0263] In some embodiments, an AAV capsid variant of the present disclosure allows for increased distribution of the AAV particle to the striatum. In some embodiments, the AAV capsid variant allows for increased distribution of the AAV particle to the thalamus. In some embodiments, the AAV capsid variant allows for increased distribution of the AAV particle to the cerebellum. In some embodiments, the AAV capsid variant allows for increased distribution of the AAV particle to the cortex. In some embodiments, the cortex comprises the motor cortex. In some embodiments, the AAV capsid variant allows for increased distribution of the AAV particle to the hippocampus. In some embodiments, the AAV capsid variant allows for increased distribution of the AAV particle to the dentate gyrus.II. AAV Particle Production

[0264] The present disclosure further provides processes and methods for producing an AAV particle comprising an AAV capsid variant that may be used to contact a target cell to deliver STXBP1.

[0265] In some embodiments, the present disclosure provides a method of making an AAV particle comprising an AAV capsid variant and viral genome (e.g., recombinant viral genome) disclosed herein, wherein the method comprises: (i) providing a cell comprising a nucleic acid comprising a viral genome (e.g., recombinant viral genome) comprising an STXBP1 -encoding sequence and a nucleic acid encoding an AAV capsid variant; and (ii) incubating the cell under conditions suitable to encapsulate the viral genome (e.g., recombinant viral genome) in the AAV capsid variant; thereby making the AAV particle.

[0266] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45.

[0267] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 27 (e.g., a nucleotide sequence encoding a microRNAbinding site series, comprising the nucleotide sequence of SEQ ID NO: 28), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45.

[0268] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 32 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45.

[0269] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 96% (e.g., at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45.

[0270] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 22, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 22, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 27 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 28), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vii) a 3’ ITR sequencecomprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45.

[0271] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 33 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 43, 44, or 45.

[0272] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42.

[0273] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITRcomprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 27 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 28), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42.

[0274] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 32 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42.

[0275] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 96% (e.g., at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42.

[0276] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 22, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 22, (iv) a WPRE comprising the nucleotide sequence ofSEQ ID NO: 26, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 27 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 28), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42.

[0277] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 33 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 40, 41, or 42.

[0278] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 21 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48.

[0279] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21, (iv) a WPRE comprising the nucleotide sequence ofSEQ ID NO: 26, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5 ’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 27 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 28), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48.

[0280] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 32 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48.

[0281] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 96% (e.g., at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, and further comprises a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26); and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48. In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26) and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48.

[0282] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 22, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vi) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48. In someembodiments, the viral genome (e.g., recombinant viral genome) comprises (i) a 5’ITR comprising the nucleotide sequence of SEQ ID NO: 30, (ii) a promoter comprising the nucleotide sequence of SEQ ID NO: 23, (iii) an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 22, (iv) a WPRE comprising the nucleotide sequence of SEQ ID NO: 26, (v) a nucleotide sequence encoding a microRNA binding site, comprising the nucleotide sequence of SEQ ID NO: 27 (e.g., a nucleotide sequence encoding a microRNA binding site series, comprising the nucleotide sequence of SEQ ID NO: 28), (vi) a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 29, and (vii) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31; and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48.

[0283] In some embodiments, the viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 33 and the AAV capsid variant comprises the amino acid sequence of SEQ ID NO: 46, 47, or 48.

[0284] In some embodiments, the method of making an AAV particle comprises, prior to step (i), introducing into the cell the nucleic acid comprising the viral genome (e.g., recombinant viral genome). In some embodiments, the method comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid variant. In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an SI9 cell), or a bacterial cell. In some embodiments, AAV particles are produced in mammalian cells (e.g., HEK293 cells). In some embodiments, AAV particles are produced in insect cells (e.g., SI9 cells). In some embodiments, the AAV particle is an isolated AAV particle. In some embodiments, the AAV particle is a recombinant AAV particle.

[0285] Any method known in the art may be used for the preparation of AAV particles. For example, methods of making AAV particles are described in U.S. Patent Nos. 6204059, 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498, 7491508, 5064764, 6194191, 6566118, and 8137948 and International Patent Publication Nos. WO1996039530, W01998010088, WO1999014354, WO1999015685, WO1999047691, W02000055342, W02000075353, and WO2001023597, as well as in Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991);Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir., 219:37-44 (1996); and Zhao et al., Vir.272:382-93 (2000); the relevant contents of each of which are herein incorporated by reference in their entirety. In some embodiments, the AAV particles are made using the methods described in International Patent Publication No. WO2015191508, the relevant contents of which are herein incorporated by reference in their entirety.III. Pharmaceutical Compositions

[0286] In some embodiments, the present disclosure provides a pharmaceutical composition comprising an AAV particle disclosed herein and a pharmaceutically acceptable excipient. Suitable excipients are known in the art, e.g., as described in Remington: The Science and Practice of Pharmacy (Adeboye Adejare ed., 23rd ed. 2020), the relevant contents of which are incorporated by reference herein in their entirety. In some embodiments, a pharmaceutical composition described herein comprises at least one buffering agent, at least one stabilizing agent, at least one osmotic pressure regulator, at least one protective agent, at least one coating agent, at least one binding agent, and least one disintegrant, at least one preservative, at least one solvent, at least one surfactant, at least one cryoprotectant, at least one lubricant, at least one glidant, and / or at least one filler.

[0287] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 21 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26). In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26).

[0288] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAVparticle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32.

[0289] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33.

[0290] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 37 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 37 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 37.

[0291] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising theamino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38.

[0292] In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 6. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-027 and the viral genome (e.g., recombinant viral genome) of Construct 7.

[0293] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 21 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26). In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26).

[0294] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome)comprising the nucleotide sequence of SEQ ID NO: 37. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38.

[0295] In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 6. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-003 and the viral genome (e.g., recombinant viral genome) of Construct 7.

[0296] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 21 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26). In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 22 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 26).

[0297] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 33. In some embodiments, the AAV particle of the pharmaceutical composition comprises anAAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 37. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 38.

[0298] In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 1. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 2. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 6. In some embodiments, the AAV particle of the pharmaceutical composition comprises the AAV capsid variant of TTM-043 and the viral genome (e.g., recombinant viral genome) of Construct 7.

[0299] Although pharmaceutical compositions provided herein are principally directed to those that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions may be suitable for administration to any other animal, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various non-human animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0300] In some embodiments, pharmaceutical compositions are administered to humans, e.g., human patients or human subjects.

[0301] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unitdoses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.IV. Formulations

[0302] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping, and / or packaging the product into a desired single- or multi-dose unit.

[0303] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient(s), and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise about 0.1% (w / w) to about 100% (w / w) of the active ingredient, e.g., about 0.1% (w / w) to about 99% (w / w), about 0.5% (w / w) to about 50% (w / w), about 1% (w / w) to about 30% (w / w), about 5% (w / w) to about 80% (w / w), or at least 80% (w / w) active ingredient.

[0304] Isolated nucleic acids, recombinant viral genomes, or AAV particles of the disclosure may be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit sustained or delayed release; (4) alter biodistribution (e.g., target the active ingredient to one or more specific tissues or cell types); (5) increase the translation of STXBP1 in vivo,' (6) alter the release profile of STXBP1 in vivo and / or (7) allow for regulatable expression of STXBP1.

[0305] Formulations of the present disclosure may include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics, and combinations thereof. In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles.

[0306] In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated to optimize baricity and / or osmolality. In some embodiments, the baricity and / or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system.

[0307] In some embodiments, a pharmaceutically acceptable excipient of a formulation disclosed herein may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the pharmaceutically acceptable excipient is approved for use for humans and for veterinary use. In some embodiments, the pharmaceutically acceptable excipient is approved by the United States Food and Drug Administration (FDA). In some embodiments, the pharmaceutically acceptable excipient is of pharmaceutical grade. In some embodiments, the pharmaceutically acceptable excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.

[0308] Pharmaceutically acceptable excipients, which, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, may be suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (including but not limited to those provided in Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; the relevant contents of which are herein incorporated by reference in their entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.

[0309] In some embodiments, a formulation of the present disclosure may comprise at least one excipient which is an inactive ingredient. As used herein, the term “inactive ingredient” refers to one or more agents that do not contribute to the activity of the pharmaceutical composition included in formulations. In some embodiments, all, none, or some of the inactive ingredientswhich may be used in the formulations of the present disclosure may be approved by the United States FDA.

[0310] In some embodiments, a formulation of the present disclosure comprises cations or anions. In some embodiments, the formulation includes metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+, or a combination thereof. In some embodiments, the formulation may comprise polymers or polynucleotides complexed with a metal cation (see, e.g., U.S. Patent Nos. 6,265,389 and 6,555,525, the relevant contents of each of which are herein incorporated by reference in their entirety).

[0311] In some embodiments, the disclosure provides a formulation of a pharmaceutical composition comprising an adeno-associated virus (AAV) particle comprising an AAV capsid variant the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 26.

[0312] In some embodiments, a formulation of a pharmaceutical composition comprises an AAV particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32, 33, 37, or 38, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto.

[0313] In some embodiments, a formulation of a pharmaceutical composition comprises an AAV particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32, 33, 37, or 38.V. Uses and Applications

[0314] The compositions of the disclosure may be administered to a subject, e.g., to deliver STXBP1, e.g., to a subject who has, has been diagnosed with having, or is at risk of having a STXBP1 -related disorder. In some embodiments, the subject is a human. In some embodiments, the STXBP1 -related disorder is a neurodegenerative or neuromuscular disorder. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.

[0315] The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a STXBP1 -related disorder (e.g., a STXBP1 -related neurodegenerative or neuromuscular disorder). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 Developmental and Epileptic Encephalopathy (DEE). In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.

[0316] In some embodiments, the disclosure provides a method of delivering STXBP1 to a cell, comprising administering an effective amount of a pharmaceutical composition or AAV particle disclosed herein, thereby delivering STXBP1. In some embodiments, the cell is in a subject.

[0317] In some embodiments, the disclosure provides a method of delivering STXBP1 to a subject, comprising administering to the subject an effective amount of a pharmaceutical composition or AAV particle disclosed herein.

[0318] In some embodiments, delivery is to a cell or tissue of the central nervous system (CNS). In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus thalamus, and / or putamen. In some embodiments, the cell of the CNS is a neuron. In some embodiments, the cell of the CNS comprises a cornu ammonis 1(CAI) neuron, cornu ammonis 2 (CA2) neuron, cornu ammonis 3 (CA3) neuron, or deep cerebellar nuclei neuron. In some embodiments, the subject has an STXBP1 -related disorder. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1- related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.

[0319] In some embodiments, the disclosure provides a method for treating a STXBP1 -related disorder such as a STXBP1 -related neurodegenerative or neuromuscular disorder, comprising administering to a subject an effective amount of an AAV particle or pharmaceutical composition disclosed herein. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a STXBP1 -related disorder (e.g., a STXBP1 -related neurodegenerative or neuromuscular disorder). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.

[0320] In some embodiments, the present disclosure provides an AAV particle or pharmaceutical composition disclosed herein for use in a method of treating a disorder as disclosed herein. In some embodiments, the present disclosure provides an AAV particle or pharmaceutical composition disclosed herein for use in a method of treating an STXBP1 -related disorder. In some embodiments, the present disclosure provides a use of an AAV particle orpharmaceutical composition disclosed herein in the manufacture of a medicament for treating an STXBP1 -related disorder. In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a STXBP1 -related disorder (e.g., a STXBP1 -related neurodegenerative or neuromuscular disorder). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.

[0321] In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a STXBP1 -related disorder such as a STXBP1 -related neurodegenerative or neuromuscular disorder (e.g., STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)). In some embodiments, the STXBP1 -related disorder is STXBP1 encephalopathy. In some embodiments, the STXBP1 -related disorder is STXBP1 DEE. In some embodiments, the STXBP1 -related disorder is only STXBP1 -related neurodevelopment disabilities without seizures.

[0322] In some embodiments, the disclosure provides a method of treating STXBP1 encephalopathy in a subject. In some embodiments, a pharmaceutical composition or AAV particle disclosed herein may be administered to a subject to treat STXBP1 encephalopathy. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having STXBP1 encephalopathy. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having STXBP1 DEE. In some embodiments, the subject has, has beendiagnosed with having, or is at risk of having STXBP1 neurodevelopment disabilities, with or without seizures.

[0323] In some embodiments, the disclosure provides a method of treating STXBP1 DEE in a subject. In some embodiments, a pharmaceutical composition or AAV particle disclosed herein may be administered to a subject to treat STXBP1 DEE. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having STXBP1 DEE.

[0324] A subject may have one or more mutations in the STXBP1 gene. In some embodiments, the subject has lower STXBP1 activity as compared to STXBP1 activity in an individual who does not have an STXBP1 -related disorder.

[0325] Delivery of a pay load construct comprising a STXBP1 -encoding sequence may alleviate or reduce symptoms that result from abnormal level and / or function of a gene product (e.g., an absence or defect in a protein) in a subject in need thereof or that otherwise confers a benefit to a CNS disorder in a subject in need thereof.

[0326] In some embodiments, the treatment may result in prevention of progression of the STXBP1 -related disorder. For example, the treatment may result in in amelioration of at least one symptom of the disorder, and / or a change in one or more biomarkers. In some embodiments, the one or more biomarkers comprises increased release of the neurotransmitter glutamate and / or GABA, reduction in accumulation of neurofilament light chain (e.g., in a biofluid such as cerebrospinal fluid), or reduction in abnormal electroencephalographic activity as evidence of improved STXBP1 activity.

[0327] In some embodiments, the treatment improves at least one symptom of a STXBP1- related disorder. In some embodiments, the at least one symptom comprises epilepsy, autistic features, ataxia, generalized tremors, reduced STXBP1 activity, accumulation of glucocerebroside and other glycolipids, e.g., within immune cells (e.g., macrophages), build-up of synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.

[0328] In some embodiments, the methods disclosed herein further comprise evaluating, e.g., measuring, the level of STXBP1 expression, e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression, in the subject, e.g., in a cell, tissue, or fluid ofthe subject. STXBP1 protein expression may be measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, evaluating the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) is performed before and / or after administration of the AAV particle or pharmaceutical composition, optionally wherein the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) before administration is compared to the level of STXBP1 expression after administration.

[0329] In some embodiments, the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) may be evaluated in a cell or tissue of the CNS. In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus thalamus, and / or putamen. In some embodiments, the cell of the CNS is a neuron. In some embodiments, the cell of the CNS comprises a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron. In some embodiments, the level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) may be evaluated in a cell of a peripheral tissue (e.g., liver, heart, muscle, or spleen).

[0330] In some embodiments, the cell of a peripheral tissue is a muscle cell. In some embodiments, the subject’s level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) after administration is increased relative to the subject’s level of STXBP1 expression (e.g., STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression) before administration.

[0331] In some embodiments, the administration of the effective amount of a pharmaceutical composition or AAV particle disclosed herein results in an increase in the level of STXBP1 activity in a cell, tissue, (e.g., a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), and / or fluid (e.g., CSF and / or serum), of the subject, relative to baseline and / or relative to the level of STXBP1 activity in a cell, tissue, or fluid of an individual with an STXBP1 -related disorder who has not been administered the pharmaceuticalcomposition or AAV particle. In some embodiments, the administration of the effective amount of a pharmaceutical composition or AAV particle disclosed herein results in an increase in the level and / or number of viral genomes (VG) per cell in a tissue of the CNS (e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), of the subject relative to the number and / or level of VG per cell in a peripheral tissue of the subject. In some embodiments, the administration of the effective amount of a pharmaceutical composition or AAV particle disclosed herein results in an increase in the level of STXBP1 mRNA expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), of the subject relative to baseline and / or relative to the level of STXBP1 mRNA expression in a cell or tissue of an individual with an STXBP1 -related disorder who has not been administered the pharmaceutical composition or AAV particle.

[0332] In some embodiments, at least one additional agent and / or therapy suitable for treatment of an STXBP1 -related disorder may be administered together with the effective amount of a pharmaceutical composition or AAV particle disclosed herein. In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).

[0333] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions comprising AAV particles disclosed herein, in combination with agents that may improve their bioavailability, reduce and / or modify their metabolism, and / or modify their distribution within the body.

[0334] In some embodiments, the pharmaceutical compositions described herein are used as research tools, particularly in in vitro investigations using human cell lines such as HEK293T and in vivo testing in nonhuman primates which will occur prior to human clinical trials.

[0335] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating an STXBP1 -related disorder (e.g., STXBP1 DEE), comprising administering an effective amount of the AAV particle comprising acapsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising an STXBP1 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 26.

[0336] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating an STXBP1 -related disorder (e.g., STXBP1 DEE), comprising administering an effective amount of the AAV particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32, 33, 37, or 38, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto.

[0337] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an AAV particle to a subject for treating an STXBP1 -related disorder (e.g., STXBP1 DEE), comprising administering an effective amount of the AAV particle comprising an AAV capsid variant comprising the amino acid sequence of SEQ ID NO: 43, 44, or 45 (e.g., the AAV capsid variant is TTM-027), the amino acid sequence of SEQ ID NO: 40, 41, or 42 (e.g., the AAV capsid variant is TTM-003), or the amino acid sequence of SEQ ID NO: 46, 47, or 48 (e.g., the AAV capsid variant is TTM-043) and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 32, 33, 37, or 38.VI. Delivery of AAV ParticlesA. Delivery to Cells

[0338] In some aspects, the present disclosure provides a method of delivering to a cell or tissue any of the above-described AAV particles, comprising contacting the cell or tissue with said AAV particle or contacting the cell or tissue with a formulation comprising said AAV particle, or contacting the cell or tissue with any of the described compositions, including pharmaceuticalcompositions. The method of delivering the AAV particle to a cell or tissue can be accomplished in vitro, ex vivo, or in vivo.

[0339] In some embodiments, the AAV particles are delivered to a cell, tissue, or region of the CNS. In some embodiments, the AAV particles are delivered to a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron), and / or fluid (e.g., CSF and / or serum) of the subject. In some embodiments, the AAV particles are delivered to a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, and / or putamen. In some embodiments, the AAV particles are delivered to a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron.B. Delivery to Subjects

[0340] In some aspects, the present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described AAV particles comprising administering to the subject said AAV particle, or administering to the subject a formulation comprising said AAV particle, or administering to the subject any of the described compositions, including pharmaceutical compositions.

[0341] In some embodiments, the AAV particles may be delivered to bypass anatomical blockages (e.g., the blood brain barrier).

[0342] In some embodiments, the AAV particles may be formulated and delivered to a subject by a route which increases the speed of drug effect as compared to oral delivery.

[0343] In some embodiments, the AAV particles may be delivered using intrathecal infusion.

[0344] In some embodiments, a subject may be administered the AAV particles described herein using a bolus infusion.

[0345] In some embodiments, the AAV particles may be delivered in a continuous and / or bolus infusion. Each site of delivery may use a different dosing regimen, or the same dosing regimen may be used for each site of delivery. As a non-limiting example, the sites of delivery may be in the cervical and the lumbar region. As another non-limiting example, the sites of delivery may be in the cervical region. As another non-limiting example, the sites of delivery may be in the lumbar region.

[0346] In some embodiments, the AAV particles may be delivered to a subject via a single route of administration.

[0347] In some embodiments, the AAV particles may be delivered to a subject via a multi-site route of administration. For example, a subject may be administered the AAV particles at 2, 3, 4, 5, or more than 5 sites.

[0348] In some embodiments, a subject may be administered the AAV particles described herein using sustained delivery over a period of minutes, hours, or days. The infusion rate may be changed depending on the subject, distribution, formulation, or another delivery parameter known to those in the art.

[0349] In some embodiments, if continuous delivery (continuous infusion) of the AAV particles is used, the continuous infusion may be for 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, or more than 24 hours.

[0350] In some embodiments, the intracranial pressure may be evaluated prior to administration. The route, volume, AAV particle concentration, infusion duration and / or vector titer may be optimized based on the intracranial pressure of a subject.

[0351] In some embodiments, the AAV particles may be delivered by systemic delivery. In some embodiments, the systemic delivery may be by intravascular administration.

[0352] In some embodiments, the AAV particles may be delivered by injection into the CSF pathway. Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventricular administration.

[0353] In some embodiments, the AAV particles may be delivered by direct (intraparenchymal) injection into the substance of an organ, e.g., one or more regions of the brain.

[0354] In some embodiments, the AAV particles may be delivered by subpial injection into the spinal cord. For example, subjects may be placed into a spinal immobilization apparatus. A dorsal laminectomy may be performed to expose the spinal cord. Guiding tubes and XYZ manipulators may be used to assist catheter placement. Subpial catheters may be placed into the subpial space by advancing the catheter from the guiding tube and AAV particles may be injected through the catheter (Miyanohara et al., Mol Ther Methods Clin Dev. 2016; 3: 16046). In somecases, the AAV particles may be injected into the cervical subpial space. In some cases, the AAV particles may be injected into the thoracic subpial space.

[0355] In some embodiments, the AAV particles may be delivered by direct injection to the CNS of a subject. In some embodiments, direct injection is intracerebral injection, intraparenchymal injection, intrathecal injection, intra-cistema magna injection, or any combination thereof. In some embodiments, direct injection to the CNS of a subject comprises convection enhanced delivery (CED). In some embodiments, administration comprises peripheral injection. In some embodiments, peripheral injection is intravenous injection.

[0356] In some embodiments, the AAV particles may be delivered to a subject in order to increase a STXBP1 level in the CNS (e.g., a cell or tissue of the CNS, e.g., the cortex, striatum, thalamus, cerebellum, brainstem, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, and / or spinal cord, and / or fluid (e.g., CSF and / or serum)) as compared to a baseline level in the subject.

[0357] In some embodiments, the AAV particles may be delivered to a subject in order to increase a STXBP1 level in the CNS (e.g., a cell or tissue of the CNS, e.g., the cortex (e.g., frontal cortex and / or motor cortex), striatum, thalamus, cerebellum, hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, and / or brainstem), and / or fluid (e.g., CSF and / or serum) of the subject by transducing cells in these CNS regions. Transduction may also be referred to as the number of cells that are positive for STXBP1.

[0358] In some embodiments, delivery of AAV particles comprising a viral genome encoding STXBP1 as described herein to the CNS (e.g., a cell or tissue of the CNS, e.g., a cell or tissue of the frontal cortex, sensory cortex, motor cortex, caudate, dentate nucleus, dentate gyrus, cerebellar cortex, cerebral cortex, brain stem, hippocampus, thalamus, putamen, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, and / or sciatic nerve; or a CAI neuron, CA2 neuron, CA3 neuron, or deep cerebellar nuclei neuron)), and / or fluid (e.g., CSF and / or serum) of the subject by transducing cells in these CNS regions may lead to an increased expression of STXBP1 in one or more of those regions. In some embodiments, the increased STXBP1 expression may lead to improved survival and / or function of various cell types in these CNS regions and / or improvement of at least one symptom of aSTXBP1 -related disorder, such as an STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE). Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).In some embodiments, the increased STXBP1 expression may lead to improved survival and / or function of various cell types in these CNS regions and / or improvement of at least one symptom of STXBP1 DEE.

[0359] In some embodiments, the AAV particles may be delivered to a subject in order to establish widespread distribution of STXBP1 throughout the CNS, e.g., by administering the AAV particles to the thalamus of the subject. In some embodiments, the increased expression of STXBP1 may lead to a reduction in at least one symptom of a STXBP1 -related disorder such as epilepsy, autistic features, ataxia, generalized tremors, reduced STXBP1 activity, accumulation of glucocerebroside and other glycolipids, e.g., within immune cells (e.g., macrophages), buildup of synuclein aggregates (e.g., Lewy bodies), developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.C. Administration

[0360] In some embodiments, the present disclosure provides methods comprising administering viral vectors in accordance with the disclosure to a subject in need thereof. Viral vector pharmaceutical, diagnostic, or prophylactic compositions thereof, may be administered to a subject using any amount and any route of administration effective for treating, or diagnosing a disease, disorder, and / or condition associated with decreased STXBP1 expression or STXBP1 deficiency. In some embodiments, the disease, disorder, and / or condition is a STXBP1 -related disorder, such as a STXBP1 -related neurodegenerative or neuromuscular disorder (e.g., STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE). Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)).

[0361] Compositions in accordance with the disclosure may be formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present disclosure may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex, and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific protein employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.

[0362] In some embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a “single unit dose” is a dose of any therapeutic composition administered in one dose / at one time / single route / single point of contact, i.e., single administration event. In some embodiments, a single unit dose is provided as a discrete dosage form (e.g., a tablet, capsule, patch, loaded syringe, vial, etc.). As used herein, a “total daily dose” is an amount given or prescribed in 24-hour period. It may be administered as a single unit dose. The viral particles may be formulated in buffer only or in a formulation described herein.

[0363] In some embodiments, a pharmaceutical composition described herein can be formulated into a topical, intranasal, pulmonary, intratracheal, or injectable dosage form. In some embodiments, a pharmaceutical composition described herein can be formulated in a dosage form suitable for intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, and / or subcutaneous administration.

[0364] In some embodiments, delivery of the AAV particles described herein results in minimal serious adverse events (SAEs) as a result of the delivery of the AAV particles.VII. Combinations

[0365] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions, comprising an active agent (e.g., an AAV particle) described herein in combination with one or more agents that may improve the composition or active agent’s bioavailability, reduce and / or modify their metabolism, modify their distribution within the body, and / or elicit or enhance a therapeutic effect. The combination agent may be, without limitation, a therapeutic, prophylactic, diagnostic, or imaging agent.

[0366] The phrase “in combination with,” is not intended to require that the agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, before, or after one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent.

[0367] The therapeutic agents may be approved by the US Food and Drug Administration or may be in clinical trial or at the preclinical research stage. The therapeutic agents may utilize any therapeutic modality known in the art, with non-limiting examples including gene silencing or interference (i.e., miRNA, siRNA, RNAi, shRNA), gene editing (i.e., TALEN, CRISPR / Cas9 systems, zinc finger nucleases), and gene, protein, or enzyme replacement.

[0368] In some embodiments, the combination agent comprises at least one additional therapeutic agent and / or therapy. In some embodiments, the at least one additional therapeutic agent and / or therapy comprises an agent and / or therapy for treating a STXBP1 -related disorder such as a STXBP1 -related neurodegenerative or neuromuscular disorder (e.g., STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic Encephalopathy (DEE). Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gaustaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5)).

[0369] In some embodiments, the at least one additional therapeutic agent and / or therapy comprises an agent and / or therapy for treating STXBP1 DEE.

[0370] In some embodiments, the at least one additional therapeutic agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).

[0371] In some embodiments, the at least one additional therapeutic agent and / or therapy comprises an immunosuppressant. In some embodiments, the immunosuppressant may be administered to the subject prior to administration of an AAV particle or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject simultaneously with administration of an AAV particle or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject after administration of an AAV particle or pharmaceutical composition described herein. In some embodiments, the AAV particle or pharmaceutical composition is administered to a subject who is receiving or has received an immunosuppressant. In some embodiments, the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine. In some embodiments, the corticosteroid comprises prednisone, prednisolone, methylprednisolone, and / or dexamethasone. In some embodiments, the immunosuppressant comprises adrenocorticotropic hormone.VIII. Measurement of Expression

[0372] Expression of STXBP1 from viral genomes may be determined using various met...

Claims

Claims1. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 39) present at amino acids 254-259 of the amino acid sequence of SEQ ID NO: 45, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 45, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 45.

2. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 45 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ENVSGSPHSKA (SEQ ID NO: 1) present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 45, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTENVSGSPHSKAQNQQT (SEQ ID NO: 2) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 45.

3. The AAV particle of claim 1 or claim 2, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 43, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 1) present at amino acids corresponding topositions 451-461 of the amino acid sequence of SEQ ID NO: 43, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 2) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 43; and / or(ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 44, wherein the amino acid sequence comprises ENVSGSPHSKA (SEQ ID NO: 1) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 44, optionally wherein the amino acid sequence comprises KTENVSGSPHSKAQNQQT (SEQ ID NO: 2) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 44.

4. The AAV particle of any one of claims 1-3, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 43;(ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 44; and / or(iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 45.

5. The AAV particle of any one of claims 1-4, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 43;(ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 44; and / or(iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 45.

6. The AAV particle of any one of claims 1-5, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 43;(ii) the amino acid sequence of SEQ ID NO: 44; and / or(iii) the amino acid sequence of SEQ ID NO: 45.

7. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of SPHSKA (SEQ ID NO: 39) present at positions 254-259 of the amino acid sequence of SEQ ID NO: 42, the amino acid E at position 249 of the amino acid sequence of SEQ ID NO: 42, the amino acid R at position 250, and the amino acid V at position 251 of the amino acid sequence of SEQ ID NO: 42.

8. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 42 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of ERVSGSPHSKA (SEQ ID NO: 3) present at amino acids corresponding to positions 249-259 of the amino acid sequence of SEQ ID NO: 42, optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 42.

9. The AAV particle of claim 7 or claim 8, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 40, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 3) present at amino acids corresponding to positions 451-461 of the amino acid sequence of SEQ ID NO: 40, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 40; and / or(ii) an amino acid sequence that is least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 41, wherein the amino acid sequence comprises ERVSGSPHSKA (SEQ ID NO: 3) present at amino acids corresponding to positions 314-324 of the amino acid sequence of SEQ ID NO: 41, optionally wherein the amino acid sequence comprises KTERVSGSPHSKAQNQQT (SEQ ID NO: 4) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 41.

10. The AAV particle of any one of claims 7-9, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 40;(ii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 41; and / or(iii) an amino acid sequence that is at least 95% (at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 42.

11. The AAV particle of any one of claims 7-10, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 99% identical to SEQ ID NO: 40;(ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 41; and / or(iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 42.

12. The AAV particle of any one of claims 7-11, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 40;(ii) the amino acid sequence of SEQ ID NO: 41; and / or(iii) the amino acid sequence of SEQ ID NO: 42.

13. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of HDSPHK (SEQ ID NO: 5) present at amino acids positions 252-257 numbered according to SEQ ID NO: 48 and comprises the amino acid R at position 388, the amino acid T at position 390, the amino acid L at position 392, the amino acid Q at position 393, and the amino acid L at position 394, each numbered according to the amino acid sequence of SEQ ID NO: 48.

14. An adeno-associated virus (AAV) particle comprising an AAV9 capsid variant and a recombinant viral genome comprising a syntaxin-binding protein 1 (STXBPl)-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE); wherein the AAV9 capsid variant comprises the amino acid sequence of SEQ ID NO: 48 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and wherein the AAV9 capsid variant comprises the amino acid sequence of HDSPHK (SEQ ID NO: 5) present at amino acids corresponding to positions 252-257 of the amino acid sequence of SEQ ID NO: 48 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6)present at amino acids corresponding to positions 388-394 of the amino acid sequence of SEQ ID NO: 48; optionally wherein the AAV9 capsid variant comprises the amino acid sequence of KTINGHDSPHKSGQNQQT (SEQ ID NO: 7) present at amino acids corresponding to positions 247-264 of the amino acid sequence of SEQ ID NO: 48.

15. The AAV particle of claim 13 or claim 14, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 46, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 5) present at amino acids corresponding to positions 454-459 of the amino acid sequence of SEQ ID NO: 46 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 590- 596 of the amino acid sequence of SEQ ID NO: 46, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 7) present at amino acids corresponding to positions 449-466 of the amino acid sequence of SEQ ID NO: 46; and / or(ii) an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 47, wherein the amino acid sequence comprises HDSPHK (SEQ ID NO: 5) present at amino acids corresponding to positions 317-322 of the amino acid sequence of SEQ ID NO: 47 and comprises the amino acid sequence of RQTALQL (SEQ ID NO: 6) present at amino acids corresponding to positions 453- 459 of the amino acid sequence of SEQ ID NO: 47, optionally wherein the amino acid sequence comprises KTINGHDSPHKSGQNQQT (SEQ ID NO: 7) present at amino acids corresponding to positions 312-329 of the amino acid sequence of SEQ ID NO: 47.

16. The AAV particle of any one of claims 13-15, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO:(ii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 47; and / or(iii) an amino acid sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the amino acid sequence of SEQ ID NO: 48.

17. The AAV particle of any one of claims 13-16, wherein the AAV9 capsid variant comprises:(i) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 46;(ii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 47; and / or(iii) an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 48.

18. The AAV particle of any one of claims 13-17, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 46;(ii) the amino acid sequence of SEQ ID NO: 47; and / or(iii) the amino acid sequence of SEQ ID NO: 48.

19. The AAV particle of any one of claims 1-18, wherein the recombinant viral genome encodes wildtype STXBP1.

20. The AAV particle of any one of claims 1-19, wherein the recombinant viral genome encodes human STXBP1.

21. The AAV particle of claim 19 or claim 20, wherein the encoded STXBP1 comprises the amino acid sequence of SEQ ID NO: 8 or any one of SEQ ID NOs: 9-20.

22. The AAV particle of any one of claims 1-21, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

23. The AAV particle of any one of claims 1-22, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21.

24. The AAV particle of any one of claims 1-21, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence that is at least 96% (e.g., at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

25. The AAV particle of claim 24, wherein the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22.

26. The AAV particle of any one of claims 1-25, wherein the WPRE is positioned 3’ relative to the STXBP1 -encoding sequence.

27. The AAV particle of any one of claims 1-26, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or any one of SEQ ID NOs: 62-66, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

28. The AAV particle of any one of claims 1-27, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 26.

29. The AAV particle of any one of claims 1-28, wherein the recombinant viral genome further comprises a promoter operably linked to the STXBP1 -encoding sequence.

30. The AAV particle of claim 29, wherein the promoter is a human synapsin 1 (hSYNl) promoter, a human elongation factor 1 alpha promoter (EFla) promoter, or an endogenous STXBP1 promoter (ePro).

31. The AAV particle of claim 30, wherein the promoter is a hSYN 1 promoter.

32. The AAV particle of claim 30 or claim 31 , wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

33. The AAV particle of any one of claims 30-32, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 23.

34. The AAV particle of any one of claims 1-33, wherein the recombinant viral genome further comprises a polyadenylation (polyA) sequence.

35. The AAV particle of claim 34, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

36. The AAV particle of claim 34 or claim 35, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29.

37. The AAV particle of any one of claims 1-36, wherein the recombinant viral genome further comprises at least one inverted terminal repeat (ITR).

38. The AAV particle of claim 37, wherein the at least one ITR comprises a 5’ ITR and a 3’ ITR.

39. The AAV particle of claim 38, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

40. The AAV particle of claim 38 or claim 39, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30.

41. The AAV particle of any one of claims 38-40, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto.

42. The AAV particle of any one of claims 38-41, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31.

43. The AAV particle of any one of claims 1-42, further comprising a nucleotide sequence encoding one or more microRNA (miR) binding sites, optionally wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia.

44. The AAV particle of claim 43, wherein the one or more miR binding sites comprises one, two, three, or four miR183 binding sites.

45. The AAV particle of claim 43 or claim 44, wherein the recombinant viral genome comprises a nucleotide sequence encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical.

46. The AAV particle of claim 45, wherein each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 27.

47. The AAV particle of claim 45 or claim 46, wherein each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 27.

48. The AAV particle of any one of claims 45-47, wherein the miRl 83 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.

49. The AAV particle of any one of claims 1-42, further comprising a nucleotide sequence encoding a microRNA183 (miRl 83) binding site series, wherein the nucleotide sequence encoding the miRl 83 binding site series comprises the nucleotide sequence of SEQ ID NO: 28 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

50. The AAV particle of claim 49, wherein the nucleotide sequence encoding the miRl 83 binding site series comprises the nucleotide sequence of SEQ ID NO: 28.

51. The AAV particle of claim 50, wherein the nucleotide sequence encoding the miRl 83 binding site series consists of the nucleotide sequence of SEQ ID NO: 28.

52. The AAV particle of any one of claims 1-51, wherein the recombinant viral genome comprises, in 5’ to 3’ order: a) a 5’ inverted terminal repeat (ITR); b) a promoter; c) the STXBP1 -encoding sequence; d) the WPRE; e) a polyadenylation (polyA) sequence; andI) a 3’ ITR.

53. The AAV particle of claim 52, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and / or f) the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

54. The AAV particle of claim 52 or claim 53, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

55. The AAV particle of any one of claims 52-54, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

56. The AAV particle of any one of claims 52-55, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

57. The AAV particle of any one of claims 52-56, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

58. The AAV particle of any one of claims 52-57, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23;c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

59. The AAV particle of any one of claims 52-58, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31.

60. The AAV particle of any one of claims 52-59, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 21; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29; andI) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31.

61. The AAV particle of any one of claims 52-60, wherein:a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 30; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 23; c) the STXBP1 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 22; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 26; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 29; andI) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 31.

62. The AAV particle of any one of claims 1-18 and 22-60, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

63. The AAV particle of claim 62, wherein the recombinant viral genome comprises a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to SEQ ID NO: 32.

64. The AAV particle of claim 62 or claim 63, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32.

65. The AAV particle of claim 62 or claim 63, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33.

66. The AAV particle of any one of claims 52-63, wherein the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduces or prevents expression of STXBP1 in dorsal root ganglia.

67. The AAV particle of claim 66, wherein the nucleotide sequence encoding the one or more miR binding sites comprises the nucleotide sequence of SEQ ID NO: 27.

68. The AAV particle of claim 66 or claim 67, wherein the nucleotide sequence encoding one or more miR binding sites encodes four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 27.

69. The AAV particle of any one of claims 52-63, wherein the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 28.

70. The AAV particle of any one of claims 52-60, claim 62, claim 63, or any one of claims 66-69, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38.

71. The AAV particle of any one of claims 52-59, any one of claims 61-63, or any one of claims 66-69, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

72. An adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 43;(ii) the amino acid sequence of SEQ ID NO: 44; and / or(iii) the amino acid sequence of SEQ ID NO: 45; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22;d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; f) a polyadenylation (polyA) sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

73. The AAV particle of claim 72, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32.

74. The AAV particle of claim 72, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38.

75. The AAV particle of claim 72, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33.

76. The AAV particle of claim 72, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

77. An adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 40;(ii) the amino acid sequence of SEQ ID NO: 41; and / or(iii) the amino acid sequence of SEQ ID NO: 42; and wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23;c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; f) a polyadenylation (polyA) sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

78. The AAV particle of claim 77, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32.

79. The AAV particle of claim 77, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38.

80. The AAV particle of claim 77, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33.

81. The AAV particle of claim 77, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

82. An adeno-associated virus (AAV) particle comprising a recombinant viral genome and an AAV9 capsid variant, wherein the AAV9 capsid variant comprises:(i) the amino acid sequence of SEQ ID NO: 46;(ii) the amino acid sequence of SEQ ID NO: 47; and / or(iii) the amino acid sequence of SEQ ID NO: 48; and wherein the recombinant viral genome comprises:a) a 5’ inverted terminal repeat (5’ ITR) comprising the nucleotide sequence of SEQ ID NO: 30; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 23; c) a syntaxin-binding protein 1 (STXBPl)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 21 or SEQ ID NO: 22; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 26; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 27; f) a polyadenylation (polyA) sequence comprising the nucleotide sequence of SEQ ID NO: 29; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 31.

83. The AAV particle of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32.

84. The AAV particle of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38.

85. The AAV particle of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33.

86. The AAV particle of claim 79, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

87. A cell comprising the AAV particle of any one of claims 1-86.

88. The cell of claim 87, wherein the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.

89. A method of making the AAV particle of any one of claims 1-86, the method comprising:(i) providing a cell comprising the recombinant viral genome comprising an STXBP1- encoding sequence and a nucleic acid encoding the AAV9 capsid variant; and(ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV9 capsid variant; thereby making the AAV particle.

90. The method of any one of claims 86-89, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 32.

91. The method of any one of claims 86-89, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 38.

92. The method of any one of claims 86-89, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 33.

93. The method of any one of claims 86-89, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 37.

94. The method of any one of claims 86-93, further comprising, prior to step (i), introducing into the cell a nucleic acid comprising the recombinant viral genome.

95. The method of claim 86-94, further comprising, prior to step (i), introducing into the cell the nucleic acid encoding the AAV9 capsid variant.

96. The method of any one of claims 86-95, wherein the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an SI9 cell), or a bacterial cell.

97. A pharmaceutical composition comprising the AAV particle of any one of claims 1-86 and a pharmaceutically acceptable excipient.

98. A method of delivering an AAV particle encoding syntaxin-binding protein 1 (STXBP1) to a cell, comprising administering an effective amount of the AAV particle of any one of claims 1-86 or the pharmaceutical composition of claim 97.

99. The method of claim 98, wherein the cell is in a subject.

100. The method of claim 99, wherein the subject has, has been diagnosed with having, or is at risk of having an STXBP1 -related disorder.

101. A method of treating a subject having or diagnosed with having an STXBP1 -related disorder, or at least one symptom thereof, comprising administering to the subject an effective amount of the AAV particle of any one of claims 1-86 or the pharmaceutical composition of claim 97.

102. The method of claim 100 or claim 101, wherein the STXBP1 -related disorder is an STXBP1 -related neurodegenerative or neuromuscular disorder.

103. The method of claim 102, wherein the STXBP 1 -related neurodegenerative or neuromuscular disorder is STXBP 1 encephalopathy, epileptic encephalopathy, STXBP 1 Developmental and Epileptic Encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

104. A method of treating a subject having or diagnosed with having an STXBP 1 -related disorder, or at least one symptom thereof, wherein the STXBP 1 -related disorder is STXBP 1 encephalopathy, STXBP 1 Developmental and Epileptic Encephalopathy (DEE), or STXBP 1- related neurodevelopmental disabilities without seizures, comprising administering to the subject an effective amount of the AAV particle of any one of claims 1-86 or the pharmaceutical composition of claim 97.

105. The method of any one of claims 101-104, wherein the subject has one or more mutations in the STXBP1 gene.

106. The method of any one of claims 101-105, wherein the subject has a reduced level of STXBP1 activity as compared to a reference level in an individual who does not have an STXBP1 -related disorder.

107. The method of any one of claims 104-106, wherein the treating results in prevention of progression of the disorder or at least one symptom thereof in the subject.

108. The method of any one of claims 104-107, wherein the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers.

109. The method of claim 108, wherein the one or more biomarkers comprises: (i) increased release of the neurotransmitters glutamate and / or gamma-aminobutyric acid (GABA); or (ii) reduction in abnormal electroencephalographic activity.

110. The method of claim 109, wherein the at least one symptom comprises epilepsy, autistic features, ataxia, generalized tremors, developmental delay, progressive encephalopathy, progressive dementia, ataxia, myoclonus, oculomotor dysfunction, bulbar palsy, generalized weakness, trembling of a limb, depression, visual hallucinations, cognitive decline, dystonia, or a combination thereof.

111. The method of any one of claims 99-110, wherein the subject is a human.

112. The method of any one of claims 99-111, wherein the AAV particle or the pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject.

113. The method of claim 112, wherein the cell, tissue, or region of the CNS comprises a cell, tissue, or region of the striatum, thalamus, cerebellum, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, or a combination thereof.

114. The method of claim 112 or claim 113, wherein the cell of the CNS comprises a neuron (e.g., a comu ammonis 1 (CAI) neuron, comu ammonis 2 (CA2) neuron, comu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).

115. The method of any one of claims 99-114, wherein the AAV particle or the pharmaceutical composition is delivered to the subject via intravenous administration.

116. The method of any one of claims 99-115, further comprising evaluating, e.g., measuring, the level of STXBP1 gene expression, STXBP1 mRNA expression, and / or STXBP1 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject.

117. The method of claim 116, wherein the level of STXBP1 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay.

118. The method of claim 116 or claim 117, wherein the evaluating the level of STXBP 1 gene, mRNA, and / or protein expression is performed before and after administering the AAV particle or pharmaceutical composition, optionally wherein the subject’s level of STXBP 1 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of STXBP 1 gene, mRNA, and / or protein expression after administration.

119. The method of any one of claims 116-118, comprising evaluating the level of STXBP1 gene, mRNA, and / or protein expression in a cell or tissue of the CNS in the subject.

120. The method of claim 119, wherein the cell or tissue of the CNS comprises a cell or tissue of the striatum, thalamus, cerebellum, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, or a combination thereof.

121. The method of claim 119 or claim 120, wherein the cell of the CNS comprises a neuron (e.g., cornu ammonis 1 (CAI) neuron, comu ammonis 2 (CA2) neuron, comu ammonis 3 (CA3) neuron, deep cerebellar nuclei neuron, glutamatergic neuron, GABAergic neuron, or a combination thereof).

122. The method of any one of claims 116-121, wherein the subject’s level of STXBP1 expression after administration of the AAV particle or pharmaceutical composition is increased relative to the subject’s level of STXBP1 expression before administration of the AAV particle or pharmaceutical composition.

123. The method of any one of claims 99-122, further comprising evaluating, e.g., measuring, the level of STXBP1 activity in the subject, e.g., in a cell or tissue of the subject.

124. The method of any one of claims 99-123, wherein administering the AAV particle or pharmaceutical composition to the subject results in an increase in:(i) the level of STXBP1 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the striatum, thalamus, cerebellum, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, comu ammonis 1 (CAI) neurons, comu ammonis 2 (CA2) neurons, comu ammonis 3 (CA3) neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of STXBP1 activity in a cell, tissue, or fluid of an individual with an STXBP1 -related disorder who has not been administered the AAV particle or the pharmaceutical composition;(ii) the number and / or level of viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or(iii) the level of STXBP1 protein, STXBP1 mRNA expression, or STXBP1 gene expression in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., striatum, thalamus, cerebellum, cortex (e.g., frontal cortex and / or motor cortex), hippocampus, dentate gyrus, caudate, putamen, dentate nucleus, cervical spinal cord, thoracic spinal cord, lumbar spinal cord, cervical DRG, thoracic DRG, lumbar DRG, sciatic nerve, CAI neurons, CA2 neurons, CA3 neurons, deep cerebellar nuclei neurons, glutamatergic neurons, GABAergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of STXBP1 protein, STXBP1 mRNA expression, or STXBP1 gene expression in a cell or tissue of an individual with an STXBP1 -related disorder who has not been administered the AAV particle or the pharmaceutical composition.

125. The method of any one of claims 99-124, further comprising administering to the subject at least one additional agent and / or therapy suitable for treating the STXBP1 -related disorder or at least one symptom thereof.

126. The method of claim 125, wherein the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).

127. The method of any one of claims 99-126, further comprising administering an immunosuppressant to the subject.

128. The method of claim 127, wherein the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), adrenocorticotropichormone, rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine.

129. The AAV particle of any one of claims 1-86 or the pharmaceutical composition of claim 97, for use in the treatment of an STXBP1 -related disorder or at least one symptom thereof in a subject; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

130. The AAV particle or pharmaceutical composition of claim 129, wherein the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder or at least one symptom thereof; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

131. The AAV particle or pharmaceutical composition of claim 129 or claim 130, wherein the STXBP1 -related disorder is STXBP1 DEE.

132. Use of the AAV particle of any one of claims 1-86, the cell of claim 87 or claim 88, or the pharmaceutical composition of claim 97 in the manufacture of a medicament for the treatment of an STXBP1 -related disorder or at least one symptom thereof in a subject; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally furthermutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

133. The use of claim 132, wherein the subject has, has been diagnosed with having, or is at risk of having the STXBP1 -related disorder, or at least one symptom thereof; optionally wherein the STXBP1 -related disorder is STXBP1 encephalopathy, epileptic encephalopathy, STXBP1 Developmental and Epileptic encephalopathy (DEE), Ohtahara syndrome, developmental encephalopathy, West syndrome, early myoclonic epileptic encephalopathy, Lennox-Gastaut syndrome, autism (e.g., autism with STXBP1 mutations and optionally further mutations), Dravet syndrome (not caused by mutations in SCN1 A), or Rett syndrome phenotype (not caused by mutation of MECP2 or CDKL5).

134. The use of claim 132 or claim 133, wherein the STXBP1 -related disorder is STXBP1 DEE.

135. The AAV particle of any one of claims 1-86 or the pharmaceutical composition of claim 97 for use in a method of treating a disorder according to any one of claims 101-128.

Citation Information

Patent Citations

  • Mineral hollow fiber bioreactor for the cultivation of animal cells

    US5064764A

  • Method for improved transduction by recombinant adeno-associated viruses

    US5756283A

  • AAV-mediated delivery of DNA to cells of the nervous system

    US6180613B1

  • An improved method for the production and purification of adenoviral vectors

    US6194191B1

  • AAV capsid vehicles for molecular transfer

    US6204059B1