Compositions and methods for delivering cyclin-dependent kinase-like 5 protein
Recombinant viral genomes are used to deliver CDKL5-encoding sequences to the CNS, addressing the lack of effective treatments for CDD by increasing CDKL5 protein levels and activity, thereby ameliorating associated symptoms.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- NEUROCRINE BIOSCIENCES INC
- Filing Date
- 2025-10-29
- Publication Date
- 2026-05-07
AI Technical Summary
Current treatments for CDKL5 deficiency disorder (CDD) primarily focus on alleviating symptoms like seizures, with limited therapies available for delivering CDKL5 protein to the central nervous system (CNS) to address the underlying cause of the disorder.
Development of pharmaceutical compositions and methods using recombinant viral genomes, such as adeno-associated virus (AAV) particles, to deliver CDKL5-encoding sequences, including specific nucleotide sequences and regulatory elements, to target cells within the CNS, enhancing CDKL5 expression and activity.
The approach increases CDKL5 protein levels and activity in targeted CNS cells, potentially ameliorating symptoms of CDD and other CDKL5-related disorders, including epilepsy, autism, and cognitive deficits, by effectively delivering functional CDKL5 protein.
Smart Images

Figure IMGF000020_0001 
Figure IMGF000021_0001 
Figure IMGF000023_0001
Abstract
Description
Attorney Docket No. 14640.0303-00304COMPOSITIONS AND METHODS FOR DELIVERING CYCLIN-DEPENDENT KINASE-LIKE 5 PROTEINRelated Applications
[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 714,099, filed on October 30, 2024, the contents of which are incorporated herein by reference in their entirety.Sequence Listing
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing file, entitled 14640_0303-00304_SL.xml, was created on September 19, 2025, and is 105,336 bytes in size. The information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety.Field
[0003] Described herein are polynucleotides, e.g., viral genomes encoding cyclin-dependent kinase-like 5 (CDKL5). Also described herein are vectors, e.g., adeno-associated virus (AAV) particles, comprising said polynucleotides, and related compositions, methods of making, and / or methods of delivery to a cell or subject. In some embodiments, the disclosure provides methods or uses for the treatment of CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, atypical Rett syndrome, and / or other CDKL5-related disorders.Background
[0004] Cyclin-dependent kinase-like 5 (CDKL5) is a serine / threonine protein kinase and is also known as serine / threonine kinase 9 (STK9). Other aliases for CDKL5 include EIEE2, ISSX, CFAP247, and DEE2. It is encoded by the gene CDKL5 (Ensembl Gene ID No. ENSG00000008086), which is located on the X chromosome.
[0005] The CDKL5 protein is an enzyme and is thought to play an important role in brain development and regulation of response to oxidative stress. CDKL5 is thought to be expressed throughout the cell, including in the nucleus and cytoplasm of soma and dendrites.
[0006] CDKL5 is responsible for phosphorylation of a number of targets. CDKL5 may target and phosphorylate the gene MECP2, which has been characterized as important in the function of neurons and other brain cells, and in the maintenance of neuronal synapses, and isAttorney Docket No. 14640.0303-00304 thought to be the causative agent for Rett syndrome. CDKL5 may also target and phosphorylate CEP131, which is thought to play a role in cell proliferation. CDKL5 may also target and phosphorylate MAP IS, DLG5, EB2, and / or ARHGEF, which are microtubule associated proteins, thought to play roles in neuronal division, differentiation, migration, and neurite growth. CDKL5 may also target and phosphorylate AKT and mTOR, which are thought to play roles in cell proliferation, migration and development.
[0007] Without being bound by theory, CDKL5 may be involved in the formation, growth, and migration of neurons. It may also play a role in cell division and / or transmission of chemical signals at neuronal synapses.
[0008] Mutations in CDKL5 are known to cause disease in subjects, e.g., human subjects. CDKL5 mutations lead to CDKL5 deficiency disorder (CDD). CDD is a neurodevelopmental disorder. It is characterized by nervous system symptoms including epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties and / or visual impairment. It is also characterized by low muscle tone and gastrointestinal reflux.
[0009] CDD can manifest with a broad array of clinical manifestations. Clinical manifestations of CDD comprise behavioral symptoms such as episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep. Clinical manifestations also comprise facial appearance changes including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than normal space between the nose and upper lip; an upturned nose; fuller lips; and / or widely-spaced teeth. Further clinical manifestations include difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, and cortical visual impairment or cortical blindness. Other manifestations include bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux and constipation.
[0010] CDD has an incidence of 1 in 42000 births in the USA, and 85% of cases occur in females. Typically, CDD patients are fully reliant on caregivers for the duration of their lives.
[0011] CDD is typically caused by de novo mutations in CDKL5. CDKL5 mutations in CDD patients result in a reduced amount of functional CDKL5 protein.
[0012] Existing treatments for patients with CDD focus on alleviating symptoms such as seizures. To date, there are limited treatments available for patients with CDD, and delivery of treatments to the central nervous system (CNS) remains a significant challenge in the development of new and effective therapies.Attorney Docket No. 14640.0303-00304
[0013] The current standard of care for CDD is first line treatment with an anti-epileptic drug. Anti-epileptic drugs are known in the art and include valproate and levetiracetam. Second line treatment for refractory patients comprises first line treatment plus additional anti-epileptic drugs such as clobazam and / or lamotrigine in combination with ganaxolone. However, ganaxolone has been reported to have short durability in treating subjects with CDD. Third line treatment introduces additional anti-epileptic drugs, such as topiramate, and / or alternative interventions, such as ketogenic diet and / or vagal nerve stimulation. However, seizures in CDD are commonly refractory to known treatments.
[0014] Therefore, a need remains for improved therapies and treatments that target the cause of CDD. In particular, there remains a need for pharmaceutical compositions and methods to deliver CDKL5 to a target cell or tissue (e.g., a target cell or tissue of the CNS) and there remains a need for pharmaceutical compositions and methods to treat CDD and other CDKL5-related disorders or symptoms thereof.Summary
[0015] In some embodiments, the present disclosure provides an isolated nucleic acid comprising a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence, wherein the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 82% (e.g., at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0016] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 13, or SEQ ID NO: 5, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0017] In some embodiments, the CDKL5 -encoding sequence encodes a CDKL5 protein comprising the amino acid sequence of SEQ ID NO: 3.
[0018] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4.
[0019] In some embodiments, the isolated nucleic acid comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or any one of SEQ ID NOs: 38-42, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at leastAttorney Docket No. 14640.0303-0030498%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8.
[0020] In some embodiments, the isolated nucleic acid comprises a promoter operably linked to the CDKL5 -encoding sequence. In some embodiments, the promoter is a human synapsin 1 (hSYNl) promoter or a chicken P-actin hybrid (CBh) promoter. In some embodiments, the promoter is a hSYNl promoter. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7.
[0021] In some embodiments, the isolated nucleic acid comprises a polyadenylation (poly A) sequence. In some embodiments, the polyA sequence is a bovine growth hormone (bGH) polyA sequence. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9.
[0022] In some embodiments, the isolated nucleic acid comprises at least one inverted terminal repeat (ITR). In some embodiments, the at least one ITR comprises a 5’ ITR and a 3’ ITR. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%). In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10.
[0023] In some embodiments, the isolated nucleic acid further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduces or prevents expression of CDKL5 in dorsal root ganglia. In some embodiments, the one or more miR binding sites comprises one, two, three, or four miR183 binding sites.
[0024] In some embodiments, the isolated nucleic acid comprises a nucleotide sequencing encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical. In some embodiments, each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In someAttorney Docket No. 14640.0303-00304 embodiments, each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.
[0025] In some embodiments, the isolated nucleic acid further comprises a nucleotide sequence encoding a microRNA183 (miR183) binding site series, wherein the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2.
[0026] In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 15.
[0027] In some embodiments, the present disclosure provides a recombinant viral genome comprising the isolated nucleic acid described herein. In some embodiments, the present disclosure provides a recombinant viral genome comprising the nucleotide sequence of SEQ ID NO: 1111 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the present disclosure provides a recombinant viral genome comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0028] In some embodiments, the present disclosure provides a recombinant viral genome comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the recombinant viral genome comprises, in 5’ to 3’ order: (a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (c) a cyclin-dependent kinase- like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 orAttorney Docket No. 14640.0303-00304 a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (d) a woodchuck hepatitis virus post- transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (e) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) a 3’ ITR comprising the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0029] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0030] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequenceAttorney Docket No. 14640.0303-00304 of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0031] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
[0032] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0033] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
[0034] In some embodiments, the recombinant viral genome comprises, in 5’ to 3’ order: (a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; (b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; (c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5; (d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; (e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and (f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.Attorney Docket No. 14640.0303-00304
[0035] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12.
[0036] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduce or prevent expression of CDKL5 in dorsal root ganglia. In some embodiments, each of the one or more miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the recombinant viral genome encodes four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
[0037] In some embodiments, the recombinant viral genome further comprises a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 2.
[0038] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 15.
[0039] In some embodiments, the present disclosure provides an AAV particle comprising an adeno-associated virus (AAV) particle comprising: (i) an AAV capsid; and (ii) a recombinant viral genome as described herein or a recombinant viral genome comprising an isolated nucleic acid as described herein.
[0040] In some embodiments, the AAV capsid comprises an AAV1 capsid or a variant thereof, an AAV2 capsid or a variant thereof, an AAV3 capsid or a variant thereof, an AAV3b capsid or a variant thereof, an AAV4 capsid or a variant thereof, an AAV5 capsid or a variant thereof, an AAV6 capsid or a variant thereof, an AAV7 capsid or a variant thereof, an AAV8 capsid or a variant thereof, an AAVrh8 capsid or a variant thereof, an AAV9 capsid or a variant thereof, an AAVPHP.B capsid or a variant thereof, an AAVPHP.N capsid or a variant thereof, a VOY101 capsid or a variant thereof, an AAVrhlO capsid or a variant thereof, an AAVrh32.33 capsid or a variant thereof, or an AAVrh74 capsid or a variant thereof. In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0041] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.Attorney Docket No. 14640.0303-00304
[0042] In some embodiments, the recombinant viral genome comprises: (a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; (c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; (e) optionally a nucleotide sequence encoding a microRNA binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; (f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.
[0043] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 15.
[0044] In some embodiments, the present disclosure provides a cell comprising an isolated nucleic acid described herein, a recombinant viral genome described herein, or an AAV particle described herein. In some embodiments, the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
[0045] In some embodiments, the present disclosure provides a method of making an AAV particle described herein, the method comprising: (i) providing a cell comprising a recombinant viral genome of as described herein or a recombinant viral genome comprising an isolated nucleic acid as described herein, and a nucleic acid encoding an AAV capsid; and (ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV capsid; thereby making the AAV particle.
[0046] In some embodiments, the recombinant viral genome comprises: (a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; (b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; (c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; (d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; (e) optionally a nucleotide sequence encoding a microRNA binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; (f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and (g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.Attorney Docket No. 14640.0303-00304
[0047] In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 15.
[0048] In some embodiments, the method of making comprises, prior to step (i), introducing into the cell a nucleic acid comprising the recombinant viral genome. In some embodiments, the method of making further comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid. In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
[0049] In some embodiments, the present disclosure provides a pharmaceutical composition comprising the isolated nucleic acid described herein, the recombinant viral genome described herein, or the AAV particle described herein, and further comprising a pharmaceutically acceptable excipient.
[0050] In some embodiments, the present disclosure provides a method of delivering cyclin-dependent kinase-like 5 (CDKL5) to a cell, comprising administering an effective amount of the isolated nucleic acid described herein, the recombinant viral genome described herein, the AAV particle described herein, or the pharmaceutical composition described herein. In some embodiments, the cell is in a subject. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder.
[0051] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having a CDKL5-related disorder, or at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid described herein, the recombinant viral genome described herein, the AAV particle described herein, or the pharmaceutical composition described herein. In some embodiments, the CDKL5-related disorder is a CDKL5-related neurodegenerative or neuromuscular disorder. In some embodiments, the CDKL5-related neurodegenerative or neuromuscular disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0052] In some embodiments, the present disclosure provides a method of treating a subject having or diagnosed with having a CDKL5-related disorder, or at least one symptom thereof, wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), comprising administering to the subject an effective amount of the isolated nucleic acid described herein, the recombinant viral genome described herein, the AAV particle described herein, or the pharmaceutical composition described herein. In some embodiments, the subject has one orAttorney Docket No. 14640.0303-00304 more mutations in the CDKL5 gene. In some embodiments, the subject has a reduced level of CDKL5 activity as compared to a reference level in an individual who does not have a CDKL5-related disorder.
[0053] In some embodiments, the treating results in prevention of progression of the disorder or at least one symptom thereof in the subject. In some embodiments, the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers. In some embodiments, the one or more biomarkers comprises neurofilament light chain or a marker of CDKL5 activity, e.g., as measured by phosphorylation levels of substrate proteins, e.g., MECP2, or as measured by mass spectrometry. In some embodiments, the at least one symptom comprises epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than-normal space between the nose and upper lip; an upturned nose; full lips and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof.
[0054] In some embodiments, the subject is a human.
[0055] In some embodiments, the isolated nucleic acid, the recombinant viral genome, the AAV particle, or the pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject. In some embodiments, the cell, tissue, or region of the CNS comprises a cell, tissue, or region of the cortex, hippocampus, striatum, thalamus, or cerebellum. In some embodiments, the cell of the CNS comprises a neuron (e.g., a glutamatergic neuron and / or a GABAergic neuron). In some embodiments, the isolated nucleic acid, the recombinant viral genome, the AAV particle, or the pharmaceutical composition is delivered to the subject via intravenous administration.
[0056] In some embodiments, the method of delivering or treating further comprises evaluating, e.g., measuring, the level of CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject. In some embodiments, the level of CDKL5 protein expression is measured by an enzyme- linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay.Attorney Docket No. 14640.0303-00304
[0057] In some embodiments, evaluating the level of CDKL5 gene, mRNA, and / or protein expression is performed before and after administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, optionally wherein the subject’s level of CDKL5 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of CDKL5 gene, mRNA, and / or protein expression after administration.
[0058] In some embodiments, the level of CDKL5 gene, mRNA, and / or protein expression is evaluated in a cell or tissue of the CNS in the subject. In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the cortex, hippocampus, striatum, thalamus, or cerebellum. In some embodiments, the cell of the CNS comprises a neuron (e.g., a glutamatergic neuron and / or a GABAergic neuron).
[0059] In some embodiments, wherein the subject’s level of CDKL5 protein expression after administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is increased relative to the subject’s level of CDKL5 protein expression before administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0060] In some embodiments, the method of treating or delivering further comprises evaluating, e.g., measuring, the level of CDKL5 protein activity in the subject, e.g., in a cell or tissue of the subject.
[0061] In some embodiments, the administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition to the subject results in an increase in: (i) the level of CDKL5 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, GABAergic neurons, glutamatergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of CDKL5 activity in a cell, tissue, or fluid of an individual with a CDKL5-related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition; (ii) the number and / or level of viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, GABAergic neurons, glutamatergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or (iii) the level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, GABAergic neurons, glutamatergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue of an individualAttorney Docket No. 14640.0303-00304 with a CDKL5-related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle or pharmaceutical composition.
[0062] In some embodiments, the method of treating or delivering further comprises administering to the subject at least one additional agent and / or therapy suitable for treating the CDKL5-related disorder or at least one symptom thereof. In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0063] In some embodiments, the method of treating or delivering further comprises administering an immunosuppressant to the subject. In some embodiments, the immunosuppressant comprises an adrenocorticotropic hormone, corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
[0064] In some embodiments, the present disclosure provides the isolated nucleic acid described herein, the recombinant viral genome described herein, the AAV particle described herein, or the pharmaceutical composition described herein, for use in the treatment of a CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0065] In some embodiments, the subject has been diagnosed with having, or is at risk of having, the CDKL5-related disorder; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
[0066] In some embodiments, the present disclosure provides the use of the isolated nucleic acid described herein, the recombinant viral genome described herein, the AAV particle described herein, the cell described herein, or the pharmaceutical composition described herein in the manufacture of a medicament for the treatment of a CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having the CDKL5-related disorder; optionally wherein the CDKL5- related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.Attorney Docket No. 14640.0303-00304
[0067] In some embodiments, the present disclosure provides the isolated nucleic acid described herein, the recombinant viral genome described herein, the AAV particle described herein, or the pharmaceutical composition described herein for use in a method of treating a disorder described herein.Brief Description of the Drawings
[0068] FIGs. 1A-1E depict vector genome (VG) quantification (VG / diploid genome (DNA)) for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 23), Construct 1 (SEQ ID NO: 11), Construct 4 (SEQ ID NO: 24), Construct 7 (SEQ ID NO: 14), or Construct 6 (SEQ ID NO: 26). FIG. 1A depicts expression levels of human CDKL5 (hCDKL5) DNA relative to P-actin. FIG. IB depicts expression levels of WPRE DNA relative to P-actin. FIG. 1C depicts expression levels of hCDKL5 DNA relative to mouse Cdkl5 (mCdkl5). FIG. ID depicts expression levels of WPRE DNA relative to mCdkl5. FIG. IE depicts expression levels of mCdkl5 DNA relative to P-actin.
[0069] FIGs. 2A-2E depict transgene expression levels measured by RT-qPCR analysis of bulk RNA for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 23), Construct 1 (SEQ ID NO: 11), Construct 4 (SEQ ID NO: 24), Construct 7 (SEQ ID NO: 14), or Construct 6 (SEQ ID NO: 26). FIG. 2A depicts the mRNA levels of hCDKL5 relative to P-actin. FIG. 2B depicts the mRNA levels of WPRE relative to P-actin. FIG. 2C depicts the mRNA levels of hCDKL5 relative to mCdkl5. FIG. 2D depicts the mRNA levels of WPRE relative to mCdkl5. FIG. 2E depicts the mRNA levels of mCdkl5 relative to P-actin.
[0070] FIGs. 3A-3D depict the percentage of neurons that were hCDKL5-positive for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 5 (SEQ ID NO: 27), or Construct 8 (SEQ ID NO: 23), where a cell was considered hCDKL5-positive if the hCDKL5 fluorescent area was greater than 0 pm2. FIG. 3A depicts the percentage of hCDKL5-positive neurons in the cortex. FIG. 3B depicts the percentage of hCDKL5-positive neurons in the CAI hippocampal region. FIG. 3C depicts the percentage of hCDKL5-positive neurons in the CA2 hippocampal region. FIG. 3D depicts the percentage of hCDKL5-positive neurons in the CA3 hippocampal region.
[0071] FIGs. 4A-4D depict the percentage of neurons that were hCDKL5-positive for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 5 (SEQ ID NO: 27), or Construct 8 (SEQ ID NO: 23), where a cell was considered hCDKL5-positive if the cell’s hCDKL5 fluorescent area was greater than the 25thAttorney Docket No. 14640.0303-00304 percentile of mCdkl5 fluorescent area. FIG. 4A depicts the percentage of hCDKL5-positive neurons in the cortex. FIG. 4B depicts the percentage of hCDKL5 -positive neurons in the CAI hippocampal region. FIG. 4C depicts the percentage of hCDKL5 -positive neurons in the CA2 hippocampal region. FIG. 4D depicts the percentage of hCDKL5-positive neurons in the CA3 hippocampal region.
[0072] FIGs. 5A-5D show the percentage of neurons that were mCdkl 5 -positive for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 5 (SEQ ID NO: 27), or Construct 8 (SEQ ID NO: 23), where a cell was considered mCdkl5-positive if the cell’s mCdkl5 fluorescent area was greater than 0 pm2. FIG. 5A depicts the percentage of mCdkl5-positive neurons in the cortex. FIG. 5B depicts the percentage of mCdkl5-positive neurons in the CAI hippocampal region. FIG. 5C depicts the percentage of mCdkl5-positive neurons in the CA2 hippocampal region. FIG. 5D depicts the percentage of mCdkl5-positive neurons in the CA3 hippocampal region.
[0073] FIGs. 6A-6D depict the percentage of mCdkl5-positive neurons that were hCDKL5- positive (i.e., the percentage of mCdkl5 / NeuN double-stained neurons that were hCDKL5 / mCdkl5 / NeuN triple stained) for mice at 4-weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 5 (SEQ ID NO: 27), or Construct 8 (SEQ ID NO: 23). FIG. 6A depicts the percentage of mCdkl5-positive neurons that were hCDKL5-positive in the cortex. FIG. 6B depicts the percentage of mCdkl 5 -positive neurons that were hCDKL5 -positive in the CAI hippocampal region. FIG. 6C depicts the percentage of mCdkl 5 -positive neurons that were hCDKL5 -positive in the CA2 hippocampal region. FIG. 6D depicts the percentage of mCdkl5-positive neurons that were hCDKL5 -positive in the CA3 hippocampal region.
[0074] FIGs. 7A-7D depict the percentage of neurons expressing WPRE for mice at 4- weeks post-IV injection of PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) or Construct 7 (SEQ ID NO: 14). FIG. 7A depicts the percentage of neurons with WPRE mRNA in the cortex. FIG. 7B depicts the percentage of neurons with WPRE mRNA in the CAI hippocampal region. FIG. 7C depicts the percentage of neurons with WPRE mRNA in the CA2 hippocampal region. FIG. 7D depicts the percentage of neurons with WPRE mRNA in the CA3 hippocampal region.
[0075] FIGs. 8A-8E depict CDKL5 transgene expression in the hippocampus (HPC), cortex (CTX), striatum (STR), and thalamus (Thai) 4 weeks after dosing mice via IV injection with PBS (Veh) or PHP.eB viral particles (denoted as AAV) carrying Construct 1 (SEQ ID NO: 11). FIG. 8A depicts mCdkl5 expression in a wildtype (WT) mouse. FIG. 8B depictsAttorney Docket No. 14640.0303-00304 hCDKL5 expression in a mouse administered PHP.eB-Construct 1. FIG. 8C depicts a lack of hCDKL5 expression in a PBS-treated mouse. The percentage of neurons positive for mCDKL5 or hCDKL5 for mice treated with PBS or PHP.eB-Construct 1 are reported in FIG. 8D (mCDKL5) and FIG. 8E (hCDKL5). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0076] FIGs. 9A-9B depict transgene expression driven by the human synapsin (hSynl) promoter in Construct 1 (SEQ ID NO: 11). FIG. 9A shows the injection site in the thalamus and FIG. 9B depicts hCDKL5 expression at the injection compared to a contralateral site 19 days post-injection.
[0077] FIGs. 10A-10C depict neuronal expression of hCDKL5 following injection with PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 10A depicts hCDKL5 staining. FIG. 10B depicts NeuN staining. FIG. 10C depicts colocalization of hCDKL5 and NeuN staining.
[0078] FIG. HA depicts DAPI staining of neurons at an injection site following administration of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 11B depicts hCDKL5 -positive cells in the injection site. FIG. 11C depicts DAPI staining of a contralateral site. FIG. 11D depicts a lack of hCDKL5-positive cells in the contralateral site.
[0079] FIGs. 12A-12E depict expression results in the cerebellum 4 weeks following IV injection of wildtype or CDKL5-KO mice with PBS or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 12A depicts vector genome copy. FIG. 12B depicts hCDKL5 mRNA. FIG. 12C depicts the percentage of hCDKL5-positive neurons in the cortex and hippocampus, as measured by in situ hybridization. FIG. 12D depicts CDKL5 protein concentration. FIG. 12E depicts kinase activity of the CDKL5 protein. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0080] FIGs. 13A and 13B depict the effects of administration of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 4 (SEQ ID NO: 24), or Construct 8 (SEQ ID NO: 23) in wildtype and CDKL5-KO mice. FIG. 13A depicts the occurrence of sudden unexpected death in epilepsy (SUDEP). FIG. 13B depicts the severity of seizures as measured using the Racine scale. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0081] FIGs. 14A-14F depict effects on motor function in CDKL5-KO mice when a WPRE or Myc tag is included in payloads. FIG. 14A depicts aggregate scores of hindlimb clasping behavior. FIG. 14B depicts individual scores for wildtype (WT) mice administered PBS (Veh). FIG. 14C depicts individual scores for CDKL5-KO mice administered PBS (Veh). FIG. 14D depicts individual scores for CDKL5-KO mice administered PHP.eB viral particles carrying Construct 4 (SEQ ID NO: 24). FIG. 14E depicts individual scores for CDKL5-KOAttorney Docket No. 14640.0303-00304 mice administered PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 14F depicts individual scores for CDKL-KO mice administered PHP.eB viral particles carrying Construct 8 (SEQ ID NO: 23). Wk = week. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0082] FIGs. 15A-15B depict results from recordings of ex vivo neural hyperactivity in mice administered PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 15A depicts a whole cell patch clamp in the CA2 region of the hippocampus from a mouse. FIG. 15B depicts a comparison of the decay time of NMDA current in CDKL5-KO mice as compared to wildtype (WT) mice following administration of PBS (Veh) or PHP.eB viral particles carrying Construct 1 (AAV). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0083] FIGs. 16A-16B depict a reduction in seizure susceptibility and mortality in CDKL5 KO mice following administration of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 4 (SEQ ID NO: 24), or Construct 8 (SEQ ID NO: 23). FIG. 16A depicts percent mortality. FIG. 16B depicts maximum seizure scores. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0084] FIGs. 17A-17B depict expression of CDKL5 in CDKL5-KO mice dosed with vehicle or PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11), Construct 4 (SEQ ID NO: 24), or Construct 8 (SEQ ID NO: 23). FIG. 17A depicts the hCDKL5 in total protein (pg / g). FIG. 17B depicts hCDKL5 in total protein, measured as a percentage of hCDKL5 protein in the wildtype (WT) mice dosed with vehicle. *P<0.05, **P<0.01, ***P<0.001, ****p<0.0001.
[0085] FIGs. 18A-18E depict effects of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11) on CDKL5 KO mice. FIG. 18A depicts mortality during seizures. FIG. 18B depicts the latency to death. FIG. 18C depicts the hindlimb clasping behavior score before dosing. FIG. 18D depicts the hindlimb clasping behavior score after dosing. FIG. 18E depicts a summary of hindlimb clasping behavior scores. Veh = Vehicle; WT = wildtype. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0086] FIG. 19A depicts vector genome copies per diploid genome in CDKL5-KO mouse cerebrum following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 19B depicts normalized CDKL5 protein expression in CDKL5-KO mouse cerebrum following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 19C depicts the percentage of neurons in CDKL5-KO mouse cortex that are hCDKL5 -positive following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). FIG. 19D depicts the percentage of neurons in CDKL5-KO mouse hippocampus that are hCDKL5-positiveAttorney Docket No. 14640.0303-00304 following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11). Veh = Vehicle; WT = wildtype.Detailed DescriptionI. CompositionsA. Nucleic Acids and Viral Genomes1. CDKL5-Encoding Sequence
[0087] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a polynucleotide encoding CDKL5, also referred to as a CDKL5 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5 -encoding sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0088] In some embodiments, the CDKL5 -encoding sequence encodes human CDKL5. In some embodiments, the CDKL5 -encoding sequence encodes wildtype CDKL5. In some embodiments, the CDKL5 -encoding sequence encodes a CDKL5 isoform.
[0089] In some embodiments, the CDKL5 -encoding sequence encodes CDKL5 isoform 1 (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 19), CDKL5 isoform 2 (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 20), CDKL5 isoform CRA A (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 21), or CDKL5 isoform CRA b (e.g., the CDKL5 amino acid sequence of SEQ ID NO: 22). In some embodiments, the CDKL5 comprises the amino acid sequence of any one of SEQ ID NOs: 19-22 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5 comprises the amino acid sequence of any one of SEQ ID NOs: 19-22.
[0090] In some embodiments, the CDKL5 -encoding sequence encodes a CDKL5 protein comprising the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 96% identical to the amino acidAttorney Docket No. 14640.0303-00304 sequence of SEQ ID NO: 3. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 97% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 98% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the CDKL5 protein comprises an amino acid sequence that is at least 99% identical to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the CDKL5 protein comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, the CDKL5 protein consists of the amino acid sequence of SEQ ID NO: 3.
[0091] Non-limiting examples of CDKL5 amino acid sequences are provided in Table 1.Table 1. Exemplary CDKL5 Amino Acid SequencesAttorney Docket No. 14640.0303-00304
[0092] In some embodiments, the CDKL5 -encoding sequence comprises a human CDKL5 nucleotide sequence. In some embodiments, the CDKL5 -encoding sequence comprises a wildtype CDKL5 nucleotide sequence. In some embodiments, the CDKL5-encoding sequence comprises a codon-optimized CDKL5 nucleotide sequence. In some embodiments, the CDKL5-encoding sequence comprises one or more CpG motifs. In some embodiments, the CDKL5-encoding sequence is CpG-depleted. In some embodiments, the CDKL5- encoding sequence comprises no CpG motifs (i.e., is CpG-free).
[0093] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotideAttorney Docket No. 14640.0303-00304 sequence of SEQ ID NO: 4. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:4. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the CDKL5 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 4.
[0094] In some embodiments, the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the CDKL5-encoding sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO:5. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the CDKL5 -encoding sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the CDKL5 -encoding sequence consists of the nucleotide sequence of SEQ ID NO: 5.
[0095] Non-limiting examples of CDKL5-encoding sequences are provided in Table 2A.
[0096] The present disclosure provides nucleic acids (e.g., an isolated nucleic acids) or viral genomes (e.g., recombinant viral genomes) encoding a Myc-tagged CDKL5 protein. In some embodiments, the tag is a Myc tag. In some embodiments, the Myc tag is linked to the CDKL5 protein by a GGGS (SEQ ID NO: 29) spacer sequence. In some embodiments, the Myc tag and spacer (e.g., of amino acid sequence EQKLISEEDLGGGGS (SEQ ID NO: 16))Attorney Docket No. 14640.0303-00304 is located immediately after the N-terminal methionine of the encoded CDKL5. Table 2B provides exemplary nucleotide sequences that encode Myc-tagged CDKL5.Table 2A. Exemplary CDKL5-Encoding SequencesAttorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Table 2B. Exemplary Sequences Encoding Tagged CDKL5 ProteinAttorney Docket No. 14640.0303-003042. Promoter
[0097] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a promoter operably linked to a CDKL5-encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a promoter operably linked to a CDKL5-encoding sequence and, in some embodiments, the presentAttorney Docket No. 14640.0303-00304 disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0098] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence and (ii) the CDKL5 -encoding sequence.
[0099] In some embodiments, the promoter is or comprises a synapsin 1 promoter. In some embodiments, the promoter is or comprises a human synapsin 1 (“human SYN1,” “hSYNl,” “hSYN,” “hSyn,” or “hSynl”) promoter.
[0100] In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 7. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 7.
[0101] In some embodiments, the promoter is or comprises a chicken P-actin hybrid promoter (“CBh promoter”). In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the promoter comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises a nucleotide sequence that is at least 99% identical toAttorney Docket No. 14640.0303-00304 the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter comprises the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the promoter consists of the nucleotide sequence of SEQ ID NO: 18.
[0102] Non-limiting examples of promoter sequences are provided in Table 3.Table 3. Exemplary Promoter Sequences3. WPRE
[0103] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a CDKL5-encoding sequence and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5 -encoding sequence and a WPRE and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0104] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a WPRE and a CDKL5 -encoding sequence. In some embodiments, the nucleic acid (e.g., isolated nucleicAttorney Docket No. 14640.0303-00304 acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a CDKL5 -encoding sequence and a WPRE. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5- encoding sequence, and (iii) a WPRE.
[0105] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:38 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 38. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 38.
[0106] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:39 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 39. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 39.
[0107] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:40 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 40. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 40.
[0108] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:41 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 41. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 41.
[0109] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO:42 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises the nucleotide sequenceAttorney Docket No. 14640.0303-00304 of SEQ ID NO: 42. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 42.
[0110] In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE comprises the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the WPRE consists of the nucleotide sequence of SEQ ID NO: 8.
[0111] A non-limiting example of a WPRE sequence is provided in Table 4.Table 4. Exemplary WPRE SequenceAttorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-003044. MicroRNA Binding Site
[0112] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a CDKL5-encoding sequence and a nucleotide sequence encoding at least one microRNA (miR) binding site. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5-encoding sequence and a nucleotide sequence encoding at least one miR binding site and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0113] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a CDKL5-encoding sequence and a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5 -encoding sequence, and (iii) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site). In some embodiments, the nucleic acid (e.g., isolated nucleic acid)Attorney Docket No. 14640.0303-00304 and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5-encoding sequence, (iii) a WPRE, and (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site).
[0114] In some embodiments, the miR binding site prevents, suppresses, or otherwise inhibits expression of CDKL5 in dorsal root ganglia. In some embodiments, the miR binding site is or comprises a microRNA 183 (miR183) binding site. In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) encodes a miR binding site series comprising at least 2 miR binding sites. In some embodiments, the miR binding site series comprises at least 2, at least 3, at least 4, or at least 5 miR binding sites. In some embodiments, the miR binding site series comprises 1, 2, 3, 4, or 5 miR binding sites. In some embodiments, the miR binding sites of the miR binding site series are continuous. In some embodiments, the miR binding sites of the miR binding site series are separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site. In some embodiments, each miR binding site of the miR binding site series is a miR183 binding site, wherein each miR183 binding site has the same nucleotide sequence.
[0115] In some embodiments, the nucleic acid (e.g., an isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence encoding at least one miR183 binding site, wherein the at least one miR183 binding site is encoded by the nucleotide sequence of AGTGAATTCTACCAGTGCCATA (SEQ ID NO: 1) or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1 and comprises the nucleotide sequence of GTGCCAT. In some embodiments, the at least one miR183 binding site is encoded by a nucleotide sequence that has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, but no more than 10, modifications relative to the nucleotide sequence of SEQ ID NO: 1, wherein the ncucleotide sequence encoding the at least one miR183 binding site comprisesAttorney Docket No. 14640.0303-00304 the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has no more than 5 modifications relative to the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 2 modifications relative to the nucleotide sequence of SEQ ID NO: 1, wherein nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site has 1 modification relative to the nucleotide sequence of SEQ ID NO: 1, wherein the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of GTGCCAT.
[0116] In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site comprises the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the nucleotide sequence encoding the at least one miR183 binding site consists of the nucleotide sequence of SEQ ID NO: 1.
[0117] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) of the present disclosure comprises a nucleotide sequence encoding multiple miR183 binding sites, which may be referred to as a nucleotide sequence encoding a miR183 binding site series.
[0118] In some embodiments, the at least one miR183 binding site comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR183 binding sites), wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the miR183 binding site series comprises at least two miR183 binding sites (e.g., 2, 3, 4, or 5 miR183 binding sites), wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 1.
[0119] In some embodiments, the miR183 binding site series comprises 4 miR binding sites. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the miR183 binding site series comprises 4 miR binding sites, wherein each miR183 binding site is encoded by the nucleotide sequence of SEQ ID NO: 1.
[0120] In some embodiments, each of the miR183 binding sites in the miR183 binding site series is separated by a spacer. In some embodiments, the spacer is 1 to 10 nucleotides in length, e.g., 1-6 nucleotides or 5-10 nucleotides in length. In some embodiments, the spacer isAttorney Docket No. 14640.0303-00304 encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA, or a nucleotide sequence having at least one, two, three, or four modifications, but no more than four modifications relative to the nucleotide sequence of GATAGGTA. In some embodiments, each spacer is encoded by a nucleotide sequence comprising the nucleotide sequence of GATAGTTA. In some embodiments, each spacer is encoded by the nucleotide sequence of GATAGTTA.
[0121] In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 50% (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%) identical thereto, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 2, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 2, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 2, wherein at least one miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the miR183 binding site series is encoded by a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO: 2, wherein each miR183 binding site of the series is encoded by a nucleotide sequence that comprises the nucleotide sequence of GTGCCAT. In some embodiments, the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the miR183 binding site series consists of the nucleotide sequence of SEQ ID NO: 2.Attorney Docket No. 14640.0303-00304
[0122] A non-limiting example of a nucleotide sequence encoding a miR183 binding site series is provided in Table 5.Table 5. Exemplary miR183 Binding Site-Encoding Sequence5. Polyadenylation Sequence
[0123] In some embodiments, the present disclosure provides a nucleic acid (e.g., an isolated nucleic acid) comprising a CDKL5-encoding sequence and a polyadenylation (poly A) sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) is or is comprised within a viral genome (e.g., recombinant viral genome). Accordingly, in some embodiments, the present disclosure provides an isolated nucleic acid comprising a CDKL5- encoding sequence and a polyA sequence and, in some embodiments, the present disclosure provides a viral genome (e.g., recombinant viral genome) comprising said isolated nucleic acid.
[0124] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, a CDKL5-encoding sequence and a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5-encoding sequence, and (iii) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5 -encoding sequence, (ii) the CDKL5- encoding sequence, (iii) a WPRE, and (iv) a polyA sequence. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises, in 5’ to 3’ order, (i) a promoter operably linked to a CDKL5-encoding sequence, (ii) the CDKL5-encoding sequence, (iii) a WPRE, (iv) a nucleotide sequence encoding at least one miR binding site (e.g., at least one miR183 binding site), and (v) a polyA sequence.
[0125] In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of SEQ ID NO:Attorney Docket No. 14640.0303-003049. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9. In some embodiments, the polyA sequence consists of the nucleotide sequence of SEQ ID NO: 9.
[0126] A non-limiting example of a polyA sequence is provided in Table 6.Table 6. Exemplary PolyA Sequence6. Inverted Terminal Repeats (ITRs)
[0127] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) disclosed herein further comprises an ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises two ITRs.
[0128] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 3’ ITR. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a 5’ ITR and a 3’ ITR.
[0129] In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%)Attorney Docket No. 14640.0303-00304 identical thereto. In some embodiments, the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6. In some embodiments, the 5’ ITR consists of the nucleotide sequence of SEQ ID NO: 6.
[0130] In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical thereto. In some embodiments, the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the 3’ ITR consists of the nucleotide sequence of SEQ ID NO: 10.
[0131] Non-limiting examples of ITR sequences are provided in Table 7.Table 7. Exemplary ITR Sequences7. Exemplary ITR-to-ITR Sequences
[0132] In some embodiments, the present disclosure provides a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprising a nucleotide sequence that is at least 80% (e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27.
[0133] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 85% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27.Attorney Docket No. 14640.0303-00304
[0134] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27.
[0135] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 95% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23- 27. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 96% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 97% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 98% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises a nucleotide sequence that is at least 99% identical to the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27.
[0136] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) consists of the nucleotide sequence of any one of SEQ ID NOs: 11, 12, 14, 15, and 23-27.
[0137] In some embodiments, a nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) disclosed herein comprises a 5’ ITR comprising the nucleotide sequence of SEQ ID NO: 6; a promoter comprising the nucleotide sequence of SEQ ID NO: 7; a CDKL5-encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or 5; a WPRE comprising the nucleotide sequence of SEQ ID NO: 8; a polyA sequence comprising the nucleotide sequence of SEQ ID NO: 9; and a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) furtherAttorney Docket No. 14640.0303-00304 comprises a nucleotide sequence encoding a miR183 binding site series, comprising the nucleotide sequence of SEQ ID NO: 2.
[0138] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 11.
[0139] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 12.
[0140] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the nucleotide sequence of SEQ ID NO: 15.
[0141] In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 1. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 2. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) comprises the ITR-to-ITR sequence (the viral genome) of Construct 3.
[0142] Without being bound by theory, in some embodiments, the nucleic acid (e.g., isolated nucleic acid) comprising the ITR-to-ITR components limits overexpression of CDKL5 in the presence of endogenous expression of functional CDKL5. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) comprising the ITR-to-ITR components results in a post- translational mechanism that limits overexpression of CDKL5 in the presence of endogenous expression of functional CDKL5.
[0143] Exemplary ITR-to-ITR sequences (viral genomes) are summarized in Tables 8-10 and Table 11. In some embodiments, the nucleic acid (e.g., isolated nucleic acid) and / or viral genome (e.g., recombinant viral genome) may comprise any nucleotide sequence or combination thereof, from the nucleotide sequences in Tables 8-10 or Table 11.Table 8. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and ComponentsAttorney Docket No. 14640.0303-00304Table 9. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and Components (Continued)Table 10. SEQ ID NOs of Exemplary ITR-to-ITR Sequences and Components (Continued)Table 11. Exemplary Viral GenomesAttorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304Attorney Docket No. 14640.0303-00304B. Associated Virus (AAV) Capsids and Particles
[0144] AAVs typically have a genome of about 5,000 nucleotides in length and contain one open reading frame encoding the (non-structural) proteins responsible for replication (Rep78, Rep68, Rep52, Rep40, encoded by Rep genes) and another open reading frame encoding the structural proteins of the capsid (VP1, VP2, VP3, encoded by capsid genes or Cap genes). The open reading frames are flanked by two inverted terminal repeat (ITR) sequences, which serve as the origin of replication of the viral genome. The Rep proteins are important for replication and packaging, while the capsid proteins are assembled to create the protein shell of the AAV, or AAV capsid. Alternative splicing and alternate initiation codons and promoters result in the generation of four different Rep proteins from a single open reading frame and the generation of three capsid proteins from a single open reading frame. VP1 is the full- length capsid protein sequence and contains the VP2 and VP3 sequences and VP2 and VP3 are shorter components of the whole, with the VP2 sequence containing the VP3 sequence. Though it varies by AAV serotype, as a non-limiting example, for AAV9 / hu.14 (SEQ ID NO: 123 of US 7,906,111, the relevant contents of which are herein incorporated by reference in their entirety) VP1 refers to amino acids 1-736, VP2 refers to amino acids 138-736, and VP3 refers to amino acids 203-736.
[0145] Changes in the sequence in the VP3 region of a single capsid open reading frame are also changes to VP1 and VP2; however, the percent difference as compared to the parent sequence will be greatest for VP3 since it is the shortest sequence of the three. Though described here in relation to the amino acid sequence, the nucleic acid sequence encodingAttorney Docket No. 14640.0303-00304 these proteins can be similarly described. Together, the three capsid proteins assemble to create the AAV capsid. Without being bound by theory, the AAV capsid typically comprises a molar ratio of 1 : 1 : 10 of VP1 :VP2:VP3.
[0146] The AAV particle typically requires a co-helper (e.g., adenovirus) to undergo productive infection in cells. In the absence of such helper functions, the AAV virions essentially enter host cells but do not integrate into the cells’ genome.
[0147] AAV particles may be used as a biological tool, including in gene therapy, due to their relatively simple structure, their ability to infect a wide range of cells (including quiescent and dividing cells) without integration into the host genome and without replicating, and their relatively benign immunogenic profile. Moreover, infection with AAV particles has minimal influence on changing the pattern of cellular gene expression (Stilwell and Samulski et al., Biotechniques, 2003, 34, 148, the relevant contents of which are herein incorporated by reference in their entirety). The genome of the virus may be manipulated to contain a minimum of components for the assembly of a functional recombinant virus, or viral particle, which is loaded with or engineered to target a particular tissue and express or deliver a desired payload.
[0148] Typically, AAV particles for CDKL5 delivery may be recombinant viral particles that are replication defective as they lack sequences encoding functional Rep and Cap proteins within the viral genome. In some cases, the replication-defective AAV particles may lack most or all coding sequences and essentially only contain one or two AAV ITR sequences and a nucleic acid sequence encoding CDKL5. In some cases, the nucleic acid sequence encoding CDKL5 further comprises one or more regulatory elements to modulate transcription.
[0149] In some embodiments, the AAV particles of the present disclosure may be introduced into mammalian cells.
[0150] AAV particles of the present disclosure may be produced recombinantly and may be based on AAV reference sequences. In addition to single-stranded AAV viral genomes (e.g., ssAAVs), the present disclosure also provides for self-complementary AAV (scAAV) viral genomes. scAAV viral genomes contain DNA strands that anneal together to form doublestranded DNA. By skipping second strand synthesis, scAAVs allow for rapid expression in the transduced cell. In some embodiments, the AAV particle of the present disclosure is an scAAV. In some embodiments, the AAV particle of the present disclosure is an ssAAV.
[0151] Methods for producing and / or modifying AAV particles are disclosed in the art such as pseudotyped AAV particles (International Patent Publication Nos. W0200028004;Attorney Docket No. 14640.0303-00304W0200123001; WO2004112727; W02005005610; and W02005072364, the relevant contents of each of which are incorporated herein by reference in their entirety).
[0152] In some embodiments, an AAV particle of the present disclosure comprises a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV capsid. In some embodiments, the AAV capsid is an AAV capsid variant, wherein the variant comprises a capsid protein that differs from a wildtype AAV capsid protein by one or more insertions, deletions, and / or substitutions. In some embodiments, the AAV capsid or AAV capsid variant comprises a capsid protein selected from the group consisting of: AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV9 K449R, VOY101, VOY201, AAVPHP.A, AAVPHP.B, AAVPHP.B2, AAVPHP.B3, AAVPHP.eB, AAVPHP.N, AAVPHP.S, G2B4, G2B5, CAP-BIO, AAVrhlO, AAVrh32.33, AAVrh74, a capsid protein of an AAV serotype as provided in Table 6 of International Patent Publication No.WO2021230987 (the relevant contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023081648 (the contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023154693 (the contents of which are incorporated by reference in their entirety), a capsid protein disclosed in International Patent Publication No. WO2023235791 (the contents of which are incorporated by reference in their entirety), and a capsid protein disclosed in International Patent Publication No.W02024006741 (the contents of which are incorporated by reference in their entirety), or a variant of any of the foregoing.
[0153] In some embodiments, the AAV capsid variant preferentially targets the brain over the liver. In some embodiments, the AAV capsid variant is AAVPHP.eB or CAP -B 10. See, e.g., Goertsen et al. AAV capsid variants with brain-wide transgene expression and decreased liver targeting after intravenous delivery in mouse and marmoset. Nat Neurosci 25, 106-115 (2022); Seo et al. Multimodal imaging of capsid and cargo reveals differential brain targeting and liver detargeting of systemically-administered AAVs, Biomaterials 288 (2022). In some embodiments, the AAV capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023081648 or WO2023235791. In some embodiments, the AAV5 capsid variant is an AAV9 capsid variant disclosed in International Patent Publication No. WO2023154693.In some embodiments, the present disclosure provides an AAV particle comprising a viral genome (e.g., recombinant viral genome) disclosed herein and an AAV9 capsid variant.Attorney Docket No. 14640.0303-00304C. Tropism and Biodistribution Properties
[0154] AAV particles and payloads of the disclosure may be delivered to one or more target cells, tissues, organs, or organisms. In some embodiments, the AAV particles demonstrate enhanced tropism for a target cell type, tissue or organ. As a non-limiting example, the AAV particle may have enhanced tropism for cells and tissues of the central or peripheral nervous systems (CNS and PNS, respectively). In some embodiments, an AAV particle may, in addition, or alternatively, have decreased tropism for a cell-type, tissue or organ.
[0155] AAV particles may be modified to enhance the efficiency of delivery. Such modified AAV particles of the present disclosure can be packaged efficiently and can be used to successfully infect the target cells at high frequency and with minimal toxicity.
[0156] In some embodiments, AAV particles may be used to deliver a CDKL5 -encoding sequence to the central nervous system (see, e.g., U.S. Patent No. 6,180,613; the relevant contents of which are herein incorporated by reference in their entirety) or to specific tissues of the central nervous system.
[0157] In some embodiments, the AAV capsid allows for blood brain barrier penetration of the AAV particle following intravenous administration, focused ultrasound (FUS), e.g., coupled with the intravenous administration of microbubbles (FUS-MB), or MRI-guided FUS coupled with intravenous administration. In some embodiments, the AAV capsid allows for blood brain barrier penetration of the AAV particle following intravenous administration.II. AAV Particle Production
[0158] The present disclosure further provides processes and methods for producing an AAV particle comprising an AAV capsid that may be used to contact a target cell to deliver CDKL5.
[0159] In some embodiments, the present disclosure provides a method of making an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) disclosed herein, wherein the method comprises: (i) providing a cell comprising a nucleic acid comprising a viral genome (e.g., recombinant viral genome) comprising a CDKL5- encoding sequence and a nucleic acid encoding the AAV capsid; and (ii) incubating the cell under conditions suitable to encapsulate the viral genome (e.g., recombinant viral genome) in the AAV capsid; thereby making the AAV particle.
[0160] In some embodiments, the method of making an AAV particle comprises, prior to step (i), introducing into the cell the nucleic acid comprising the viral genome (e.g., recombinant viral genome). In some embodiments, the method comprises, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid.Attorney Docket No. 14640.0303-00304
[0161] In some embodiments, the AAV capsid is an AAV capsid variant. In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0162] In some embodiments, the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell. In some embodiments, AAV particles are produced in mammalian cells (e.g., HEK293 cells). In some embodiments, AAV particles are produced in insect cells (e.g., Sf9 cells). In some embodiments, the A AV particle is an isolated AAV particle. In some embodiments, the AAV particle is a recombinant AAV particle.
[0163] Any method known in the art may be used for the preparation of AAV particles. For example, methods of making AAV particles are described in U.S. Patent Nos. 6204059, 5756283, 6258595, 6261551, 6270996, 6281010, 6365394, 6475769, 6482634, 6485966, 6943019, 6953690, 7022519, 7238526, 7291498, 7491508, 5064764, 6194191, 6566118, and 8137948 and International Patent Publication Nos. WO1996039530, W01998010088, WO1999014354, WO1999015685, WO1999047691, W02000055342, W02000075353, and WO200 1023597, as well as in Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir.63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir., 219:37-44 (1996); and Zhao et al., Vir.272:382-93 (2000); the relevant contents of each of which are herein incorporated by reference in their entirety. In some embodiments, the AAV particles are made using the methods described in International Patent Publication No. W02015191508, the relevant contents of which are herein incorporated by reference in their entirety.III. Pharmaceutical Compositions
[0164] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a nucleic acid, viral genome, or AAV particle disclosed herein and a pharmaceutically acceptable excipient. Suitable excipients are known in the art, e.g., as described in Remington: The Science and Practice of Pharmacy (Adeboye Adejare ed., 23rd ed. 2020), the relevant contents of which are incorporated by reference herein in their entirety. In some embodiments, a pharmaceutical composition described herein comprises at least one buffering agent, at least one stabilizing agent, at least one osmotic pressure regulator, at least one protective agent, at least one coating agent, at least one binding agent, and least one disintegrant, at least one preservative, at least one solvent, at least oneAttorney Docket No. 14640.0303-00304 surfactant, at least one cryoprotectant, at least one lubricant, at least one glidant, and / or at least one filler.
[0165] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 4 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8). In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 5 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8).
[0166] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 11.
[0167] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 12.
[0168] In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the pharmaceutical composition comprises an isolated nucleic acid comprising the nucleotide sequence of SEQ ID NO: 15.
[0169] In some embodiments, the pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 4 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8). In some embodiments, the pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 5 and a WPRE (e.g., comprising the nucleotide sequence of SEQ ID NO: 8).
[0170] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprisingAttorney Docket No. 14640.0303-00304 the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11.
[0171] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 12 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 12.
[0172] In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, the AAV particle of the pharmaceutical composition comprises an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 15.
[0173] In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0174] Although pharmaceutical compositions provided herein are principally directed to those that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions may be suitable for administration to any other animal, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various non-human animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.
[0175] In some embodiments, pharmaceutical compositions are administered to humans, e.g., human patients or human subjects.Attorney Docket No. 14640.0303-00304
[0176] A pharmaceutical composition in accordance with the present disclosure may be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as a plurality of single unit doses. As used herein, a “unit dose” refers to a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and / or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.IV. Formulations
[0177] Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping, and / or packaging the product into a desired single- or multi-dose unit.
[0178] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient(s), and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. For example, the composition may comprise about 0.1% (w / w) to about 100% (w / w) of the active ingredient, e.g., about 0.1% (w / w) to about 99% (w / w), about 0.5% (w / w) to about 50% (w / w), about 1% (w / w) to about 30% (w / w), about 5% (w / w) to about 80% (w / w), or at least 80% (w / w) active ingredient.
[0179] Isolated nucleic acids, recombinant viral genomes, or AAV particles of the disclosure may be formulated using one or more excipients to: (1) increase stability; (2) increase cell transfection or transduction; (3) permit sustained or delayed release; (4) alter biodistribution (e.g., target the active ingredient to one or more specific tissues or cell types); (5) increase the translation of encoded protein in vivo, (6) alter the release profile of encoded protein in vivo and / or (7) allow for regulatable expression of CDKL5.
[0180] Formulations of the present disclosure may include, without limitation, saline, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with viral vectors (e.g., for transplantation into a subject), nanoparticle mimics, and combinations thereof. In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated using self-assembled nucleic acid nanoparticles.Attorney Docket No. 14640.0303-00304
[0181] In some embodiments, an isolated nucleic acid, recombinant viral genome, or AAV particle of the present disclosure may be formulated to optimize baricity and / or osmolality. In some embodiments, the baricity and / or osmolality of the formulation may be optimized to ensure optimal drug distribution in the central nervous system or a region or component of the central nervous system.
[0182] In some embodiments, a pharmaceutically acceptable excipient of a formulation disclosed herein may be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the pharmaceutically acceptable excipient is approved for use for humans and for veterinary use. In some embodiments, the pharmaceutically acceptable excipient is approved by the United States Food and Drug Administration (FDA). In some embodiments, the pharmaceutically acceptable excipient is of pharmaceutical grade. In some embodiments, the pharmaceutically acceptable excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.
[0183] Pharmaceutically acceptable excipients, which, as used herein, include, but are not limited to, any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, and the like, may be suited to the particular dosage form desired. Various excipients for formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (including but not limited to those provided in Remington: The Science and Practice of Pharmacy, 23rd Edition, A. Adejare, Elsevier Science, 2020; the relevant contents of which are herein incorporated by reference in their entirety). The use of a conventional excipient medium may be contemplated within the scope of the present disclosure, except insofar as any conventional excipient medium may be incompatible with a substance or its derivatives, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutical composition.
[0184] In some embodiments, a formulation of the present disclosure may comprise at least one excipient which is an inactive ingredient. As used herein, the term “inactive ingredient” refers to one or more agents that do not contribute to the activity of the pharmaceutical composition included in formulations. In some embodiments, all, none, or some of the inactive ingredients which may be used in the formulations of the present disclosure may be approved by the United States FDA.Attorney Docket No. 14640.0303-00304
[0185] In some embodiments, a formulation of the present disclosure comprises cations or anions. In some embodiments, the formulation includes metal cations such as, but not limited to, Zn2+, Ca2+, Cu2+, Mg+, or a combination thereof. In some embodiments, the formulation may comprise polymers or polynucleotides complexed with a metal cation (see, e.g., U.S. Patent Nos. 6,265,389 and 6,555,525, the relevant contents of each of which are herein incorporated by reference in their entirety).
[0186] In some embodiments, the disclosure provides a formulation of a pharmaceutical composition comprising an adeno-associated virus (AAV) particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising a CDKL5 -encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 8. In some embodiments, the AAV capsid is an AAV9 capsid variant.
[0187] In some embodiments, a formulation of a pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 15, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto. In some embodiments, a formulation of a pharmaceutical composition comprises an AAV particle comprising an AAV capsid and a viral genome (e.g., recombinant viral genome) comprising the nucleotide sequence of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 15. In some embodiments, the AAV capsid is an AAV9 capsid variant.V. Uses and Applications
[0188] The compositions of the disclosure (e.g., AAV particles or pharmaceutical compositions) may be administered to a subject or used in the manufacture of a medicament for administration to a subject having a CDKL5-related disorder. The CDKL5-related disorder may be a disorder of the central nervous system, and / or a neurological and / or neuromuscular disorder. Also contemplated herein is a CDKL5-related neurodegenerative or neuromuscular disorder. In some embodiments, the CDKL5-related disorder is CDKL5 deficiency disorder (CDD). Other CDKL5-related disorders include but are not limited to developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0189] The present disclosure addresses the need for new technologies by providing CDKL5-related treatment deliverable by AAV-based compositions and complexes for the treatment of CDKL5-related disorders. The compositions of the disclosure may be administered to a subject, e.g., to deliver CDKL5, e.g., to a subject who has, has beenAttorney Docket No. 14640.0303-00304 diagnosed with having, or is at risk of having CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome).
[0190] The compositions may similarly be used in the manufacture of a medicament for administration to a subject having a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome). In some embodiments, the CDKL5- related disorder is CDKL5 deficiency disorder (CDD). In some embodiments, the CDKL5- related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0191] In some embodiments, the disclosure provides a method of delivering a CDKL5 protein to a cell, comprising administering an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein, thereby delivering the CDKL5 protein. In some embodiments, the cell is in a subject.
[0192] In some embodiments, the disclosure provides a method of delivering a CDKL5 protein to a subject, comprising administering to the subject an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein.
[0193] In some embodiments, delivery is to a cell or tissue of the central nervous system (CNS). In some embodiments, the cell or tissue of the CNS comprises a cell or tissue of the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof) and / or the cell of the CNS is a neuron (e.g. GABAergic neuron, glutamatergic neuron, or a combination thereof). In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder, or a symptom thereof. In some embodiments, the CDKL5-related disorder is a CDKL5-related neurodegenerative or neuromuscular disorder. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2. In some embodiments, the CDKL5-related disorder is atypical Rett syndrome.
[0194] In some embodiments, the disclosure provides a method for treating a CDKL5- related disorder such as a CDKL5-related neurodegenerative or neuromuscular disorder, or for treating at least one symptom of a CDKL5-related disorder such as a CDKL5-related neurodegenerative or neuromuscular disorder, in a subject, comprising administering to the subject an effective amount of an isolated nucleic acid, recombinant viral genome, an AAV particle, or pharmaceutical composition disclosed herein. In some embodiments, the CDKL5- related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.Attorney Docket No. 14640.0303-00304
[0195] In some embodiments, the present disclosure provides an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein for use in a method of treating a disorder or symptom as disclosed herein. In some embodiments, the disclosure provides an AAV particle or pharmaceutical composition disclosed herein for treating a CDKL5-related disorder or for treating at least one symptom of a CDKL5-related disorder. The compositions may similarly be used in the manufacture of a medicament for treating a CDKL5-related disorder (e.g., a CDKL5-related neurodegenerative or neuromuscular disorder) or for treating at least one symptom of a CDKL5-related disorder. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0196] In some embodiments, the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome). In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0197] In some embodiments, the disclosure provides a method of treating CDD, or at least one symptom of CDD, in a subject, comprising administering to the subject an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having CDD.
[0198] In some embodiments, the disclosure provides a method of treating developmental and epileptic encephalopathy 2, or at least one symptom of developmental and epileptic encephalopathy 2, in a subject, comprising administering to the subject an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having developmental and epileptic encephalopathy 2.
[0199] In some embodiments, the disclosure provides a method of treating atypical Rett syndrome, or at least one symptom of atypical Rett syndrome, in a subject, comprising administering to the subject an effective amount of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein. In some embodiments, the subject has, has been diagnosed with having, or is at risk of having atypical Rett syndrome.Attorney Docket No. 14640.0303-00304
[0200] In some embodiments, the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein is administered to a subject who has one or more mutations in the CDKL5 gene. In some embodiments, the subject has a reduced level of CDKL5 activity as compared to a reference level in an individual who does not have a CDKL5-related disorder.
[0201] In some embodiments, the treatment results in an increase in the subject’s CDKL5 protein level as compared to baseline. In some embodiments, the treatment results in an increase in the subject’s CDKL5 protein level as compared to an individual with the CDKL5- related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome) who has been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein.
[0202] Delivery of a payload construct comprising a CDKL 5 -encoding sequence may alleviate or reduce symptoms that result from abnormal level and / or function of a gene product (e.g., an absence or defect in a protein) in a subject in need thereof or that otherwise confers a benefit to a CNS disorder in a subject in need thereof.
[0203] In some embodiments, the treatment may result in prevention of progression of a CDKL5-related disorder. In some embodiments, treatment may result in prevention of progression of at least one symptom of a CDKL5-related disorder. As a non-limiting example, progression of the disorder or symptom may be assessed by tests or diagnostic tools known to those skilled in the art or by a change in the pathological features of the brain, CSF, muscle, or other tissues of the subject. In some embodiments, the treatment may result in stabilizing the condition of a subject who has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder. In some embodiments, the treatment may result in stabilizing the condition of at least one symptom of a CDKL5-related disorder. In some embodiments, the treatment may result in amelioration (e.g., reducing the severity of) at least one symptom of a CDKL5-related disorder. In some embodiments, the treatment reverses or partially reverses at least one symptom of a CDKL5-related disorder. In some embodiments, the treatment may prevent or delay the onset of one or more symptoms of a CDKL5-related disorder. In some embodiments, the treatment improves at least one symptom of a CDKL5- related disorder. In some embodiments, the CDKL5-related disorder is CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome. In some embodiments, the CDKL 5 -related disorder is CDD.
[0204] In some embodiments, at least one symptom comprises epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visualAttorney Docket No. 14640.0303-00304 impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than-normal space between the nose and upper lip; an upturned nose; full lips; and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof. In some embodiments, amelioration of at least one symptom and / or prevention of progression of the disorder is assessed by one or more biomarkers in the subject. In some embodiments, the one or more biomarkers comprises neurofilament light chain or a marker of CDKL5 activity, e.g., as measured by phosphorylation levels of substrate proteins, e.g., MECP2, or as measured by mass spectrometry.
[0205] In some embodiments, the methods disclosed herein further comprise evaluating, e.g., measuring, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject. In some embodiments, the level of CDKL5 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay. In some embodiments, evaluating the level of CDKL5 gene, mRNA, and / or protein expression is performed before and after administering the AAV particle or pharmaceutical composition, optionally wherein the subject’s level of CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression before administration is compared to the subject’s level of CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression after administration.
[0206] In some embodiments, the level of CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) may be evaluated in a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof) and / or in a neuron (e.g. GABAergic neuron, glutamatergic neuron, or a combination thereof). In some embodiments, the level of CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) is evaluated in a cell or tissue of the central nervous system. In some embodiments, subject’s level of CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) after administration is increased relative to the subject’sAttorney Docket No. 14640.0303-00304 level of CDKL5 expression CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) before administration.
[0207] In some embodiments, the level of CDKL5 activity in the subject (e.g., in a cell or tissue of the subject) is evaluated, e.g., measured.
[0208] In some embodiments, administering to a subject an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein results in an increase in CDKL5 activity in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof) and / or in a neuron (e.g. GABAergic neuron, glutamatergic neuron, or a combination thereof) of the subject, relative to baseline and / or relative to the level of CDKL5 activity in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0209] In some embodiments, administering to a subject administering to a subject an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein results in an increase in the number and / or level of recombinant viral genomes (VG) per cell level in a tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof) and / or in a neuron (e.g. GABAergic neuron, glutamatergic neuron, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral tissue of the subject.
[0210] In some embodiments, administering to a subject an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition disclosed herein results in an increase in CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) in a cell or tissue (e.g., a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof) and / or to neurons (e.g. GABAergic neurons, glutamatergic neurons, or a combination thereof)) of the subject relative to baseline and / or relative to the level of CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0211] In some embodiments, a method of delivery or treating provided herein further comprises administering to the subject at least one additional agent and / or therapy suitable for treatment of a CDKL5-related disorder or at least one symptom thereof. In someAttorney Docket No. 14640.0303-00304 embodiments, the at least one additional agent and / or therapy comprises one or more antiepileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0212] In some embodiments, a method of delivery or treating provided herein further comprises administering to the subject an immunosuppressant. In some embodiments, the immunosuppressant comprises adrenocorticotropic hormone, a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
[0213] In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human subject.
[0214] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions comprising isolated nucleic acids, recombinant viral genomes, or AAV particles disclosed herein, in combination with agents that may improve their bioavailability, reduce and / or modify their metabolism, and / or modify their distribution within the body.
[0215] In some embodiments, an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein is used as a research tool. In some embodiments, the research tool is used in in vitro investigations using human cell lines such as HEK293T and in vivo testing in nonhuman primates that occur prior to human clinical trials.
[0216] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome), or at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5 and a WPRE comprising the nucleotide sequence of SEQ ID NO: 8.
[0217] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome), or at least one symptom thereof, comprising administering to the subject anAttorney Docket No. 14640.0303-00304 effective amount of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition comprises the nucleotide sequence of SEQ ID NO: 11, 12, or 15, or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) thereto.
[0218] In some embodiments, the disclosure provides a method of delivering (e.g., by intravenous injection) an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein to a subject for treating a CDKL5-related disorder (e.g., CDD, developmental and epileptic encephalopathy 2, or atypical Rett syndrome), or at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, wherein the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition comprises the nucleotide sequence of SEQ ID NO: 11, 12, or 15.VI. DeliveryA. Delivery to Cells
[0219] In some aspects, the present disclosure provides a method of delivering to a cell or tissue any of the above-described isolated nucleic acids, recombinant viral genomes, or AAV particles, comprising contacting the cell or tissue with said isolated nucleic acids, recombinant viral genomes, or AAV particles, or contacting the cell or tissue with a formulation comprising said isolated nucleic acids, recombinant viral genomes, or AAV particles, or contacting the cell or tissue with any of the described compositions, including pharmaceutical compositions. In some embodiments, the method of delivering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is an in vitro method of delivering to a cell or tissue. In some embodiments, the method is an in vivo method of delivering to a cell or tissue. In some embodiments, the method is an ex vivo method of delivering to a cell or tissue. In some embodiments, the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions are delivered to a cell, tissue, or region of the CNS. In some embodiments, delivery of the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions is to a cell, tissue, or region of the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, delivery is to a cell, tissue, or region of theAttorney Docket No. 14640.0303-00304 cortex, hippocampus, striatum, thalamus, or cerebellum, and / or wherein the cell of the CNS is a glutamatergic neuron and / or GABAergic neuron.
[0220] In some embodiments, delivery is to a cell, tissue, or region of the PNS.B. Delivery to Subjects
[0221] In some aspects, the present disclosure additionally provides a method of delivering to a subject, including a mammalian subject, any of the above-described isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions, comprising administering to the subject said isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.
[0222] In some embodiments, delivery bypasses anatomical blockages (e.g., the blood brain barrier).
[0223] In some embodiments, the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions may be formulated and delivered to a subject by a route which increases the speed of drug effect as compared to oral delivery.
[0224] In some embodiments, delivery uses intrathecal infusion.
[0225] In some embodiments, delivery uses a bolus infusion.
[0226] In some embodiments, the delivery uses a continuous and / or bolus infusion. Each site of delivery may use a different dosing regimen, or the same dosing regimen may be used for each site of delivery. As a non-limiting example, the sites of delivery may be in the cervical and the lumbar region. As another non-limiting example, the sites of delivery may be in the cervical region. As another non-limiting example, the sites of delivery may be in the lumbar region.
[0227] In some embodiments, the delivery uses a single route of administration.
[0228] In some embodiments, delivery uses a multi-site route of administration. In some embodiments, delivery may be via administration at 2, 3, 4, 5, or more than 5 sites.
[0229] In some embodiments, delivery comprises sustained delivery over a period of minutes, hours, or days. The infusion rate may be changed depending on the subject, distribution, formulation, or another delivery parameter known to those in the art.
[0230] In some embodiments, if continuous delivery (continuous infusion) is used, the continuous infusion may be for 1 hour, 2, hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, or more than 24 hours.Attorney Docket No. 14640.0303-00304
[0231] In some embodiments, the subject’s intracranial pressure may be evaluated prior to administration. The route, volume, concentration of the isolated nucleic acid, recombinant viral genome, or AAV particle, infusion duration and / or vector titer may be optimized based on the intracranial pressure of a subject.
[0232] In some embodiments, delivery uses systemic delivery. In some embodiments, the systemic delivery may be by intravascular administration.
[0233] In some embodiments, delivery uses injection into the CSF pathway. Non-limiting examples of delivery to the CSF pathway include intrathecal and intracerebroventricular administration.
[0234] In some embodiments, delivery uses direct (intraparenchymal) injection into the substance of an organ, e.g., one or more regions of the brain.
[0235] In some embodiments, delivery uses subpial injection into the spinal cord. For example, subjects may be placed into a spinal immobilization apparatus. A dorsal laminectomy may be performed to expose the spinal cord. Guiding tubes and XYZ manipulators may be used to assist catheter placement. Subpial catheters may be placed into the subpial space by advancing the catheter from the guiding tube and AAV particles may be injected through the catheter (Miyanohara et al., Mol Ther Methods Clin Dev. 2016; 3: 16046). In some embodiments, delivery uses injection into the cervical subpial space. In some embodiments, delivery uses injection into the thoracic subpial space.
[0236] In some embodiments, delivery uses direct injection to the CNS of a subject. In some embodiments, direct injection is intracerebral injection, intraparenchymal injection, intrathecal injection, intra-ci sterna magna injection, or any combination thereof. In some embodiments, direct injection to the CNS of a subject comprises convection enhanced delivery (CED). In some embodiments, administration comprises peripheral injection. In some embodiments, peripheral injection is intravenous injection.
[0237] In some embodiments, the delivery results in an increase in a CDKL5 protein level in the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, the delivery results in an increase in a CDKL5 protein level in the cortex (e.g., motor cortex), hippocampus, striatum, thalamus, or cerebellum.
[0238] In some embodiments, the delivery results in increased CDKL5 expression (e.g., CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression) or activity in the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, or aAttorney Docket No. 14640.0303-00304 combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof) as compared to a baseline level in the subject.
[0239] In some embodiments, the delivery results in increased CDKL5 gene, mRNA, and / or protein expression in the cortex, hippocampus, striatum, thalamus, or cerebellum. In some embodiments, delivery comprises transducing cells in these CNS regions. Transduction may also be referred to as the number of cells that are positive for CDKL5.
[0240] In some embodiments, delivery to neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof) in the cortex, hippocampus, striatum, thalamus, or cerebellum may lead to an increased CDKL5 gene, mRNA, and / or protein expression in one or more of those neurons. In some embodiments, the increased CDKL5 gene, mRNA, and / or protein may lead to improved survival and / or function of various cell types in these CNS regions and / or improvement of at least one symptom of a CDKL5-related disorder in a subject. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0241] In some embodiments, delivery may be used to achieve widespread distribution of CDKL5 throughout the CNS, e.g., by administering the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions to the thalamus of the subject. In some embodiments, the increased expression of CDKL5 may lead to a stabilization or reduction in at least one symptom of a CDKL5-related disorder in a subject (e.g., CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome). In some embodiments, the at least one symptom comprises epilepsy (e.g., early- onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than normal space between the nose and upper lip; an upturned nose; fuller lips; and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof.Attorney Docket No. 14640.0303-00304C. Administration
[0242] In some embodiments, the present disclosure provides methods comprising administering isolated nucleic acids, viral genomes, AAV particles, or pharmaceutical compositions disclosed herein to a subject in need thereof. In some embodiments, the isolated nucleic acids, viral genomes, AAV particles, or pharmaceutical compositions disclosed herein are administered in an amount and a route of administration effective for treating a disease, disorder, and / or condition associated with decreased CDKL5 expression or CDKL5 deficiency, or for treating at least one symptom thereof. In some embodiments, the disease or disorder is a CDKL5-related disorder. In some embodiments, the CDKL5-related disorder is CDD. In some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0243] Compositions in accordance with the disclosure may be formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present disclosure may be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective, prophylactically effective, or appropriate imaging dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex, and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific agent employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts.
[0244] In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. As used herein, a “split dose” is the division of single unit dose or total daily dose into two or more doses, e.g., two or more administrations of the single unit dose. As used herein, a “single unit dose” is a dose of any therapeutic composition administered in one dose / at one time / single route / single point of contact, e.g, single administration event. In some embodiments, a single unit dose is provided as a discrete dosage form (e.g., a tablet, capsule, patch, loaded syringe, vial, efc.). As used herein, a “total daily dose” is an amount given or prescribed in 24-hour period. In some embodiments, the total daily dose may be administered as a single unit dose. In someAttorney Docket No. 14640.0303-00304 embodiments, an active agent or pharmaceutical composition described herein may be formulated in buffer only or in a formulation described herein.
[0245] In some embodiments, a pharmaceutical composition described herein can be formulated into a topical, intranasal, pulmonary, intratracheal, or injectable dosage form. In some embodiments, an active agent or pharmaceutical composition described herein can be formulated in a dosage form suitable for intravenous, intraocular, intravitreal, intramuscular, intracardiac, intraperitoneal, and / or subcutaneous administration.
[0246] In some embodiments, delivery of the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions described herein results in minimal serious adverse events (SAEs) as a result of the delivery the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions.VII. Combinations
[0247] In some embodiments, the present disclosure encompasses the delivery of pharmaceutical, prophylactic, diagnostic, or imaging compositions, comprising an active agent (e.g., an isolated nucleic acid, recombinant viral genome, or AAV particle) described herein in combination with one or more agents that may improve the composition or active agent’s bioavailability, reduce and / or modify their metabolism, modify their distribution within the body, and / or elicit or enhance a therapeutic effect. The combination agent may be, without limitation, a therapeutic, prophylactic, diagnostic, or imaging agent.
[0248] The phrase “in combination with,” is not intended to require that the agents must be administered at the same time and / or formulated for delivery together, although these methods of delivery are within the scope of the present disclosure. Compositions can be administered concurrently with, before, or after one or more other desired therapeutics or medical procedures. In general, each agent will be administered at a dose and / or on a time schedule determined for that agent.
[0249] The therapeutic agents may be approved by the US Food and Drug Administration or may be in clinical trial or at the preclinical research stage. The therapeutic agents may utilize any therapeutic modality known in the art, with non-limiting examples including gene silencing or interference (z.e., miRNA, siRNA, RNAi, shRNA), gene editing (z.e., TALEN, CRISPR / Cas9 systems, zinc finger nucleases), and gene, protein, or enzyme replacement.
[0250] In some embodiments, the combination agent comprises at least one additional therapeutic agent and / or therapy, e.g., suitable for treating a CDKL5-related disorder or at least one symptom thereof. In some embodiments, the CDKL5-related disorder is CDD. InAttorney Docket No. 14640.0303-00304 some embodiments, the CDKL5-related disorder is developmental and epileptic encephalopathy 2 or atypical Rett syndrome.
[0251] In some embodiments, the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).
[0252] In some embodiments, the combination agent comprises one or more of: growth and trophic factors, cytokines, hormones, neurotransmitters, enzymes, anti-apoptotic factors, angiogenic factors, modulatory polynucleotides, and any protein known to be mutated in pathological disorders such as CDKL5-related disorders.
[0253] In some embodiments, the combination agent comprises an immunosuppressant. In some embodiments, the immunosuppressant may be administered to the subject before administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject simultaneously with administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, the immunosuppressant may be administered to the subject after administration of an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein.
[0254] In some embodiments, the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is administered to a subject who is receiving or has received an immunosuppressant.
[0255] In some embodiments, the immunosuppressant comprises a corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), rapamycin, mycophenolate mofetil, tacrolimus, rituximab, and / or eculizumab hydroxychloroquine.VIII. Measurement of Expression
[0256] In some embodiments, expression of the CDKL5 gene, CDKL5 mRNA, and / or CDKL5 protein may be determined using various methods known in the art such as, but not limited to immunochemistry (e.g., IHC), enzyme-linked immunosorbent assay (ELISA), affinity ELISA, ELISPOT, flow cytometry, immunocytology, surface plasmon resonance analysis, kinetic exclusion assay, liquid chromatography-mass spectrometry (LCMS), high- performance liquid chromatography (HPLC), BCA assay, immunoelectrophoresis, Western blot, SDS-PAGE, protein immunoprecipitation, PCR, and / or in situ hybridization (ISH).Attorney Docket No. 14640.0303-00304
[0257] In some embodiments, CDKL5 protein is detectable by an ELISA. In some embodiments, CDKL5 protein is detectable by an immunohistochemistry assay. In some embodiments, CDKL5 protein is detectable by Western blot.
[0258] In some embodiments, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression is measured in a cell or tissue of a subject who is receiving or has received an isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition described herein. In some embodiments, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression is measured in a cell or tissue of the CNS, such as the cortex, hippocampus, striatum, thalamus, cerebellum, or a combination thereof and / or neurons (e.g. glutamatergic neurons, GABAergic neurons, or a combination thereof). In some embodiments, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression is measured in a cell or tissue of the cortex, hippocampus, striatum, thalamus, or cerebellum.
[0259] In some embodiments, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression is measured in the brainstem. In some embodiments, CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression is measured in the cerebellum. In some embodiments, expression is measured in a peripheral cell or tissue, such as the liver, heart, kidney, pancreas, and / or muscle.IX. Kits and DevicesA. Kits
[0260] In some aspects, the present disclosure provides a variety of kits for conveniently and / or effectively carrying out methods of the present disclosure. Typically, kits will comprise sufficient amounts and / or numbers of components to allow a user to perform multiple treatments of a subject(s) and / or to perform multiple experiments.
[0261] Any of the active agents or compositions comprising active agents (e.g., isolated nucleic acids, recombinant viral genomes, or AAV particles) of the present disclosure may be comprised in a kit. In some embodiments, kits may further include reagents and / or instructions for creating and / or synthesizing compounds and / or compositions of the present disclosure. In some embodiments, kits may also include one or more buffers. In some embodiments, kits of the disclosure may include components for making protein or nucleic acid arrays or libraries and thus, may include, for example, solid supports.
[0262] In some embodiments, kit components may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may beAttorney Docket No. 14640.0303-00304 placed, and suitably aliquoted. Where there is more than one kit component, (labeling reagent and label may be packaged together), kits may also generally contain second, third or other additional containers into which additional components may be separately placed. In some embodiments, kits may also comprise second container means for containing sterile, pharmaceutically acceptable buffers and / or other diluents. In some embodiments, various combinations of components may be comprised in one or more vial. Kits of the present disclosure may also typically include means for containing active agents and / or compositions of the present disclosure and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which desired vials are retained.
[0263] In some embodiments, kit components are provided in one and / or more liquid solutions. In some embodiments, liquid solutions are aqueous solutions, with sterile aqueous solutions being particularly used. In some embodiments, kit components may be provided as dried powder(s). When reagents and / or components are provided as dry powders, such powders may be reconstituted by the addition of suitable volumes of solvent. In some embodiments, it is envisioned that solvents may also be provided in another container means. In some embodiments, labeling dyes are provided as dried powders. In some embodiments, it is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 micrograms or at least or at most those amounts of dried dye are provided in kits of the disclosure. In such embodiments, dye may then be resuspended in any suitable solvent, such as DMSO.
[0264] In some embodiments, kits may include instructions for employing kit components as well the use of any other reagent not included in the kit. Instructions may include variations that may be implemented.B. Devices
[0265] In some embodiments, active agents and / or compositions of the present disclosure may be combined with, coated onto or embedded in a device. Devices may include, but are not limited to, dental implants, stents, bone replacements, artificial joints, valves, pacemakers and / or other implantable therapeutic device.
[0266] The present disclosure provides for devices which may incorporate isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions disclosed herein. These devices contain the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions in a stable formulation, which may be immediately delivered to a subject in need thereof, such as a human patient.Attorney Docket No. 14640.0303-00304
[0267] Devices for administration may be employed to deliver the isolated nucleic acids, recombinant viral genomes, AAV particles, or pharmaceutical compositions according to single, multi- or split-dosing regimens taught herein.
[0268] Methods and devices known in the art for multi-administration to cells, organs and tissues are contemplated for use in conjunction with the methods and compositions disclosed herein as embodiments of the present disclosure.X. Definitions
[0269] At various places in the present specification, substituents of compounds of the present disclosure are disclosed in groups or in ranges. It is specifically intended that the present disclosure include each and every individual sub-combination of the members of such groups and ranges. The following is a non-limiting list of term definitions.
[0270] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0271] The articles “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The disclosure includes embodiments in which more than one, or the entire group members are present in, employed in, or otherwise relevant to a given product or process.
[0272] The term “comprising” is intended to be open and permits but does not require the inclusion of additional elements or steps.
[0273] Where ranges are given, endpoints are included. Furthermore, it is to be understood that, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
[0274] Active Agent: As used herein, the term “active agent” refers to an agent (e.g., a nucleic acid and / or viral genome) that encodes a CDKL5 protein or comprises or encapsulates said agent (e.g., an AAV particle).Attorney Docket No. 14640.0303-00304
[0275] Adeno-Associated Virus: As used herein, the term “adeno-associated virus” or “AAV” refers to a member of the dependovirus genus or a functional variant thereof. Unless stated otherwise, “AAV” may refer to wildtype (i.e., naturally occurring) AAV or recombinant AAV (e.g., an AAV comprising a variant AAV capsid).
[0276] Adeno-Associated Virus (AAV) Particle'. As used herein, an “AAV particle” refers to a particle (also a “virion”) comprising an AAV capsid, e.g., an AAV capsid variant (such as a parent capsid sequence with at least one peptide insertion and / or with at least one substitution), and a polynucleotide, e.g., a viral genome, e.g., a recombinant viral genome. The AAV particle may be capable of delivering a CDKL5 -encoding sequence to cells. The cells may be mammalian cells, e.g., human cells. In some embodiments, an AAV particle of the present disclosure may be produced recombinantly. An AAV particle may be derived from any serotype, described herein or known in the art, including combinations of serotypes (e.g., “pseudotyped” AAV) or from various genomes (e.g., single stranded or self-complementary). In some embodiments, the AAV particle may be replication defective and / or targeted. In some embodiments, the AAV particle may comprise a peptide present in, e.g., inserted into and / or replacing a wildtype amino acid of, a capsid to enhance tropism for a desired target tissue.
[0277] Administering'. As used herein, the term “administering” refers to providing an agent (e.g., an active agent or pharmaceutical composition) to a subject.
[0278] Amelioration'. As used herein, the term “amelioration” or “ameliorating” refers to a lessening of severity of at least one indicator of a disease, disorder, or condition. For example, in the context of a neurodegenerative disorder, amelioration includes the reduction or stabilization of neuron loss.
[0279] Approximately: As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is within 10% of a stated reference value.
[0280] Baseline: The term “baseline,” when used to describe a measurement in a subject receiving or about to receive a treatment, refers to a measurement made before starting the treatment.
[0281] Capsid: As used herein, the term “capsid” refers to the exterior, e.g., a protein shell, of a virus particle, e.g., an AAV particle, that is substantially (e.g., >50%, >60%, >70%, >80%, >90%, >95%, >99%, or 100%) protein. In some embodiments, the capsid is an AAV capsid comprising an AAV capsid protein described herein, e.g., a VP1, VP2, and / or VP3 polypeptide. The AAV capsid protein can be a wild-type AAV capsid protein or a variant, e.g., a structural and / or functional variant from a wild-type or a reference capsid protein, referred to herein as an “AAV capsid variant.” For example, and without limitation, an AAV capsidAttorney Docket No. 14640.0303-00304 variant may refer to at least a VP1 protein, a VP2 protein, or a VP3 protein (e.g., all of the VP1, VP2, and VP3 proteins forming the AAV capsid). In some embodiments, the AAV capsid variant described herein has the ability to encapsulate (i.e., encapsidate) a viral genome (e.g., a recombinant viral genome) and / or is capable of entry into a cell, e.g., a mammalian cell.
[0282] CDKL5-related disorder: As used herein, a “CDKL5-related disorder” refers to a disease, disorder, or condition in which one or more symptoms is caused by or associated with a deficiency of cyclin-dependent kinase-like 5 (CDKL5) in a subject.
[0283] Central Nervous System (CNS): As used herein, “central nervous system” or “CNS” refers to the brain and spinal cord, and sub-structures of the brain and spinal cord. Cells found in the CNS include but are not limited to neurons and sub-types thereof, glial cells (microglia, oligodendrocytes, ependymal cells, and astrocytes), choroid plexus cells, and cells related to blood vessels and coverings. Non-limiting examples of neurons include sensory neurons, motor neurons, interneurons, unipolar cells, bipolar cells, multipolar cells, pseudounipolar cells, pyramidal cells, basket cells, stellate cells, Purkinje cells, Betz cells, amacrine cells, granule cell, ovoid cell, medium aspiny neurons and large aspiny neurons, GABAergic neurons and / or glutamatergic neurons.
[0284] Corresponding to As used herein, the phrase “corresponding to,” in the context of an amino acid sequence, refers to the location of an amino acid in a reference sequence or the equivalent position in a modified sequence when aligned.
[0285] Effective amount. As used herein, the term “effective amount” or “therapeutically effective amount” of an agent is an amount sufficient to effect beneficial or desired results, e.g., sufficient to effect desired expression, delivery, amelioration of an indicator or symptom, or treatment of a disease, disorder, or condition.
[0286] Excipient. As used herein, the term “excipient” refers to an inactive substance that serves as the vehicle or medium for an active pharmaceutical agent or other active substance.
[0287] Fragment: A “fragment,” as used herein, refers to a contiguous portion of a nucleic acid sequence or an amino acid sequence. A fragment may comprise a functional fragment that retains at least one activity of the reference sequence. For example, fragments of proteins may comprise polypeptides obtained by digesting full-length protein isolated from cultured cells. A fragment may also refer to a truncation (e.g., an N-terminal and / or C-terminal truncation) of a protein or a truncation (e.g., at the 5’ and / or 3’ end) of a nucleic acid. A protein fragment may be obtained by expression of a truncated nucleic acid, such that the nucleic acid encodes a portion of the full-length protein.Attorney Docket No. 14640.0303-00304
[0288] Healthy individual: As used herein, the term “healthy individual” refers to an individual who does not have a CDKL5-related disorder or an individual who does not harbor a CDKL5 gene mutation.
[0289] Identity. As used herein, the term “identity” (or “identical to”) refers to the overall relatedness between polymeric molecules, e.g., between oligonucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide (e.g., protein) molecules. Calculation of the percent identity of two polynucleotide sequences, for example, may be performed by aligning the two sequences for optimal comparison purposes (e.g, gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993;Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; the relevant contents of each of which is incorporated herein by reference in its entirety. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Myers and Miller (CAB IOS, 1989, 4:11- 17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix. Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988); the relevant contents of which are incorporated herein by reference in its entirety. Techniques forAttorney Docket No. 14640.0303-00304 determining identity are codified in publicly available computer programs. Computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), the Basic Local Alignment Search Tool (BLAST, which includes, e.g., BLASTP for protein sequences and BLASTN for nucleic acid sequences), and FASTA Altschul, S. F. et al., J. Molecular Biol., 215, 403 (1990)), EMBOSS Needle, Clustal Omega, Benchling, and Geneious. In preferred embodiments, sequence identity may be determined using BLAST, Clustal Omega, or EMBOSS Needle. In some embodiments, sequence identity is determined by local alignment. In some embodiments, sequence identity is determined by global alignment.
[0290] Inverted terminal repeat. As used herein, the term “inverted terminal repeat” or “ITR” refers to a cis-regulatory element for the packaging of polynucleotide sequences into viral capsids.
[0291] Isolated. As used herein, the term “isolated” refers to a substance or entity that is altered or removed from the natural state, e.g., altered or removed from at least some of component with which it is associated in the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell. For example, isolated polynucleotides could be part of an AAV particle and / or be part of a composition, and still be isolated in that such AAV particle or composition is not part of the environment in which it is found in nature.
[0292] miRNA binding site: As used herein, a “miRNA binding site” or “miR binding site” refers to an RNA sequence that is bound by a microRNA. The miR binding site is capable of binding, or binds, in whole or in part to a microRNA (miRNA, miR) through complete or partial hybridization. A miR binding site may be encoded or transcribed in series, also referred to as a “miR binding site series,” which includes two or more miR binding sites having the same or a different nucleotide sequence.
[0293] Modification'. As used herein, the term “modification” or “modified,” refers to any substance, compound, or molecule that has been changed in any way. For example, a modification in an amino acid sequence may comprise a substitution (e.g., a conservative substitution), an insertion, and / or a deletion of one or more amino acids in the sequence.Attorney Docket No. 14640.0303-00304
[0294] Neurological disease: As used herein, a “neurological disease” is any disease associated with the central or peripheral nervous system and components thereof (e.g., neurons).
[0295] Operably linked: As used herein, the phrase “operably linked” refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.
[0296] Peripheral Nervous System (PNS): As used herein, the term “peripheral nervous system” or “PNS” refers to parts of the nervous system (e.g., nerves and ganglia) outside the brain and spinal cord in a body. Without limitation, the PNS includes cranial nerves, spinal nerves, roots and / or branches of spinal nerves, peripheral nerves, and neuromuscular junctions.
[0297] Position'. The term “position,” as used herein in the context of an amino acid sequence, refers to the location of a particular amino acid or set of amino acids relative to a larger sequence. A position or positions of amino acids may interchangeably be referred to by an amino acid number or numbers of a reference sequence. Within a sequence, an amino acid position is counted from the A-terminus.
[0298] Preventing'. As used herein, the term “preventing” refers to partially or completely delaying onset of an infection, disease, disorder and / or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular infection, disease, disorder, and / or condition; partially or completely delaying progression from an infection, a particular disease, disorder and / or condition; and / or decreasing the risk of developing pathology associated with the infection, the disease, disorder, and / or condition. The term “prevention” or “preventing” of an infection, disease, disorder and / or condition may be considered a subset within the meaning with the term “treatment” or “treating” of the infection, disease, disorder and / or condition.
[0299] Recombinant: As used herein, the term “recombinant” refers to a biomolecule (e.g., nucleic acid or protein), cell, or organism - including but not limited to a nucleic acid, viral genome, and / or AAV particle disclosed herein - that is engineered from and / or contains genetic material from different sources (e.g., from at least two different sources).“Recombinant” may also be used in reference to technologies or laboratory techniques that combine different sources of genetic material.Attorney Docket No. 14640.0303-00304
[0300] Region: As used herein, the term “region” refers to a sequence portion, domain, zone, or general area. Regions may comprise terminal regions. When referring to a protein or protein module, a region may comprise a linear sequence of amino acids within the protein or protein module or may comprise a three-dimensional area. When referring to a polynucleotide, a region may comprise a linear sequence of nucleic acids along the polynucleotide or may comprise a three-dimensional area, secondary structure, or tertiary structure. In some embodiments, regions comprise terminal regions. As used herein, a “terminal region” refers to regions located at the ends or termini of a given agent. In proteins, terminal regions may comprise N- and / or C-termini. N-termini refer to the end of a protein comprising an amino acid with a free amino group (i.e., the start of a protein). C-termini refer to the end of a protein comprising an amino acid with a free carboxyl group. N- and / or C- terminal regions may comprise the N- and / or C-termini as well as neighboring amino acids. When referring to polynucleotides, terminal regions may comprise 5’ and / or 3’ termini. 5’ and / or 3 ’-terminal regions may comprise the 5’ and / or 3 / termini as well as neighboring nucleotides.
[0301] Sample: As used herein, the term “sample” or “biological sample” refers to a subset of tissues, cells, nucleic acids, or a component or part of the body (e.g., a body fluid, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, amniotic fluid, amniotic cord blood, urine, vaginal fluid, and semen).
[0302] Serotype: As used herein, the term “serotype” refers to distinct variations in a capsid of an AAV based on surface antigens which allow epidemiologic classifications of the AAVs at the sub-species level.
[0303] Similarity: As used herein, the term “similarity” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.
[0304] Spacer: As used herein, a “spacer” is generally any selected nucleic acid sequence of, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length, which is located between two or more consecutive miR binding site sequences. As used herein, spacers may also be more than 10 nucleotides in length, e.g., 20, 30, 40, or 50 or more than 50 nucleotides.
[0305] Subject: As used herein, the term “subject” (or “patient”) refers to any organism to which a composition in accordance with the disclosure may be administered, e.g, forAttorney Docket No. 14640.0303-00304 experimental, diagnostic, prophylactic, and / or therapeutic purposes. Similarly, “subject” or “patient” refers to an organism who may seek, who may require, who is receiving, or who will receive treatment or who is under care by a trained professional for a particular disease, disorder, or condition. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). As used herein, a subject or patient may be susceptible to, suspected of having, or have a CDKL5-related disorder.
[0306] Substantially. As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0307] Suffering from'. An individual who is “suffering from” a disease, disorder, and / or condition has been diagnosed with or displays one or more symptoms of a disease, disorder, and / or condition.
[0308] Susceptible to: An individual who is “susceptible to” a disease, disorder, and / or condition has not been diagnosed with and / or may not exhibit symptoms of the disease, disorder, and / or condition but harbors a propensity to develop a disease or its symptoms. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may be characterized by one or more of the following: (1) a genetic mutation associated with development of the disease, disorder, and / or condition; (2) a genetic polymorphism associated with development of the disease, disorder, and / or condition; (3) increased and / or decreased expression and / or activity of a protein and / or nucleic acid associated with the disease, disorder, and / or condition; (4) habits and / or lifestyles associated with development of the disease, disorder, and / or condition; (5) a family history of the disease, disorder, and / or condition; and (6) exposure to and / or infection with a microbe associated with development of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.
[0309] Target Cell: As used herein, a “target cell” refers to one or more cells of interest. The target cell may be found in vitro, in vivo, in situ, or in the tissue or organ of an organism. The organism may be an animal, preferably a mammal, more preferably a human and mostAttorney Docket No. 14640.0303-00304 preferably a human subject. In the context of delivery of an AAV particle, a target cell may refer to one or more cells to which the AAV particle is delivered (e.g., preferentially delivered) and / or one or more cells that the AAV particle transduces. In the context of expression of a CDKL5 -encoding sequence or the effects of a CDKL5 -encoding sequence, a target cell may refer to one or more cells in which expression of CDKL5 is desired or achieved and / or one or more cells in which an increase in CDKL5 (e.g., a gene, mRNA, or protein expression and / or level) is desired or achieved. A target cell may be comprised in a “target tissue.”
[0310] Therapeutic Agent: The term “therapeutic agent” refers to any agent that, when administered to a subject, elicits a desired biological and / or pharmacological effect.
[0311] Therapeutically Effective Outcome'. As used herein, the term “therapeutically effective outcome” means an outcome that is sufficient in a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, improve symptoms of, delay progression of symptoms, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition.
[0312] Treating'. As used herein, the term “treating” refers to partially or completely alleviating, ameliorating, improving, relieving, delaying onset of, inhibiting progression of, reducing severity of, reducing incidence of, and / or preventing one or more symptoms or features of a particular infection, disease, disorder, and / or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition and / or to a subject who exhibits only early signs of a disease, disorder, and / or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.
[0313] Unmodified. As used herein, “unmodified” refers to any substance, compound or molecule prior to being changed in any way. Unmodified may, but does not always, refer to the wild-type or native form of a biomolecule or entity. Molecules or entities may undergo a series of modifications whereby each modified product may serve as the “unmodified” starting molecule or entity for a subsequent modification.
[0314] Variant: The term “variant” refers to a polypeptide or polynucleotide that has an amino acid or a nucleotide sequence that has at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) sequence identity to a reference sequence. The variant may be a functional variant. As used herein, the term “functional variant” refers to a polypeptide variant or aAttorney Docket No. 14640.0303-00304 polynucleotide variant that differs in sequence from a reference sequence but has at least one activity in common with the reference sequence.
[0315] Viral genome'. As used herein, a “viral genome,” “vector genome,” or “VG” is a polynucleotide comprising at least one nucleotide sequence encoding CDKL5. A viral genome comprises at least one copy of a CDKL5-encoding sequence. A viral genome may be a recombinant viral genome.Attorney Docket No. 14640.0303-00304EXAMPLESExample 1: Comparison of payload constructs
[0316] Viral genomes were encapsulated in a PHP.eB capsid, which is an AAV9 capsid variant (see, e.g., US20170166926A1, hereby incorporated by reference in its entirety).
[0317] Wildtype C57BL6 / J mice (n=3 per group) were intravenously injected with 1E14 VG / kg of PHP.eB comprising one of the constructs provided in Table 12 (AAV-dosed mice), or with vehicle (phosphate-buffered saline (PBS)). As shown in Table 12, constructs comprised a wildtype (WT) CDKL5 -encoding sequence, a CpG-depleted CDKL5 -encoding sequence, codon-optimized CDKL5 -encoding sequences, and sequences encoding Myc- tagged CDKL5 protein. Further, constructs either did or did not include WPRE downstream of the CDKL5 -encoding sequence.
[0318] Left and right brain hemisphere tissues were collected from mice 4 weeks postinjection. Left and right brain hemisphere tissues have no expected difference in transgene expression or function. The left half was flash frozen in liquid nitrogen immediately after tissue collection for DNA, RNA, and protein extraction, whereas the right half was fixed for histological analysis. The right-brain hemispheres were fixed in 10% neutral buffered formalin (NBF), then dehydrated in 70% ethanol, followed by further dehydration and formalin-fixed paraffin embedding (FFPE).Table 12. Description of Payload Constructs
[0319] DNA and RNA were extracted from the cerebellum region of the frozen left brain hemisphere tissues. The vector genome (used interchangeably with the term “viral genome”) was detected by quantitative polymerase chain reaction (qPCR) primers recognizing the transgene sequence, WPRE, and beta-actin (control), and hCDKL5 transgene expression inAttorney Docket No. 14640.0303-00304 the cerebellum was analyzed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) using the following probes: Human CDKL5 primers: forward GGGTTGTAGGTGAAGGAGCC (SEQ ID NO: 30), reverse CAACTTTCCCCTCCGACGAA (SEQ ID NO: 31) (5’ - 3’, 206 bp) ; Mouse CDKL5 primers: forward GCAACGGCGAGAATCCAAG (SEQ ID NO: 32), reverse GGAGTGACTACAGGCAGCTTT (SEQ ID NO: 33) (5’ - 3’, 106 bp); WPRE primers: forward CTTTCCCCCTCCCTATTGCC (SEQ ID NO: 34), reverse CGGAATTGTCAGTGCCCAAC (SEQ ID NO: 35) (5’ - 3’, 93 bp); Actin primers: forward CGTCGACAACGGCTCCGGCATG (SEQ ID NO: 36), reverse GGGCCTCGTCACCCACATAGGAG (SEQ ID NO: 37) (5’ - 3’).
[0320] Quality control (QC) parameters are as shown in Table 13.Table 13. Quality Control for Specificity
[0321] FIGs. 1A-1E show expression levels of hCDKL5 DNA relative to P-actin (FIG. 1A), WPRE DNA relative to P-actin (FIG. IB), hCDKL5 DNA relative to mouse Cdkl5 (mCdkl5) (FIG. 1C), WPRE DNA relative to mCdkl5 (FIG. ID), and mCdkl5 DNA relative to P-actin (FIG. IE). As expected, expression from codon-optimized Constructs 6 and 7 were not detected, as the codon-optimized sequence is not recognized by the probes recognizing the wildtype hCDKL5 sequence. Together, these expression analyses show that all vector genomes tested entered the brain.
[0322] FIGs. 2A-2E show transgene expression levels measured by RT-qPCR analysis of bulk RNA using the same probes described above. The mRNA levels of hCDKL5 relative to P-actin (FIG. 2A), WPRE relative to P-actin (FIG. 2B), hCDKL5 relative to mCdkl5 (FIG. 2C), WPRE relative to mCdkl5 (FIG. 2D), and mCdkl5 relative to P-actin (FIG. 2E) were measured. Together, these expression analyses show that transgene expression in the brain from all vector genomes tested. Surprisingly, the WPRE, which is known to improve protein expression by modification of RNA polyadenylation, RNA export, and / or RNA translation, increased transgene expression at the RNA level and not only at the post-transcriptional level.Attorney Docket No. 14640.0303-00304
[0323] The Myc tag of Construct 8 did not significantly change the expression at the RNA level, while the codon-optimized hCDKL5 of Constructs 6 and 7 were expressed at a lower level compared to constructs encoding the wildtype hCDKL5 sequence, as shown in the mRNA levels of hCDKL5 relative to P-actin (FIG. 2A), WPRE relative to P-actin (FIG. 2B), hCDKL5 relative to mCdkl5 (FIG. 2C), WPRE relative to mCdkl5 (FIG. 2D), and mCdkl5 relative to P-actin (FIG. 2E).
[0324] Neuronal expression of the transgene was analyzed in brain tissues stained by in-situ hybridization (ISH) and immunofluorescence (IF) using the reagents shown in Table 14.Table 14. ISH and IF Reagents
[0325] FIGs. 3A-3D show the percentage of neurons expressing hCDKL5 in the cortex (FIG. 3A), CAI (FIG. 3B), CA2 (FIG. 3C), and CA3 (FIG. 3D) hippocampal regions for payload Constructs 1, 5, and 8. For this analysis, a cell was considered hCDKL5 -positive if the hCDKL5 fluorescent area was greater than 0 pm2. In addition, FIG. 4A-4D show the percentage of neurons expressing hCDKL5 mRNA in the cortex (FIG. 4A), CAI (FIG. 4B), CA2 (FIG. 4C), and CA3 (FIG. 4D). For this assessment, a cell was considered hCDKL5- positive if the cell’s hCDKL5 fluorescent area was greater than the 25thpercentile of mCdkl5 fluorescent area. Together, these expression analyses show that hCDKL5 was expressed in about 70% of neurons by payloads with the WPRE element, and by about 30% of neurons by payloads without the WPRE element, thus indicating that the WPRE element increased the expression levels of hCDKL5 RNA (FIGs. 3A-4D) by about 2-fold, and protein by about 200-fold in terms of total protein (FIG. 17A) and total protein as % of WT (FIG. 17B). FIGs. 5A-5D show the percentage of neurons expressing mCdkl5 in the cortex (FIG. 5A) and CAI (FIG. 5B), CA2 (FIG. 5C), and CA3 (FIG. 5D) hippocampal regions for Constructs 1, 5, and 8. For this analysis, a cell was considered mCdkl5-positive if the cell’s mCdkl5 fluorescent area was greater than 0 pm2.Attorney Docket No. 14640.0303-00304
[0326] FIGs. 6A-6D show the percentage of neurons expressing hCDKL5 mRNA in mCdkl5-positive neurons (i.e., the percentage of mCdkl5 / NeuN double-stained neurons also expressing hCDKL5 (that were hCDKL5 / mCdkl5 / NeuN triple stained)) in the cortex (FIG. 6A), CAI (FIG. 6B), CA2 (FIG. 6C), and CA3 (FIG. 6D). Together, these expression analyses show that transgene hCDKL5 was expressed from the vector genomes in neurons that endogenously express mCdkl5.
[0327] FIGs. 7A-7D show the percentage of neurons with WPRE mRNA in the cortex (FIG. 7A), CAI (FIG. 7B), CA2 (FIG. 7C), and CA3 (FIG. 7D) hippocampal regions for Constructs 1 and 7. WPRE was expressed in > 20% neurons in the cortex and hippocampus of mice administered PHP.eB viral particles carrying Construct 1. Together, these expression analyses show that the codon-optimized sequence produced a lower transcription level compared to the wildtype hCDKL5 sequence.
[0328] The transgene expression was further examined in the FFPE tissues from the right brain hemisphere. The FFPE brain tissues were sectioned into 5 micrometer-thick brain sections and stained by ISH for hCDKL5 and mCdkl5, and IF for NeuN (a neuronal marker) as described above. As shown in FIGs. 8A-8E, mCdkl5 expression was found in both vehicle (FIG. 8C) and AAV-dosed (FIG. 8B) mice in glutamatergic neurons in the cortex and hippocampus, and in GABAergic neurons in the thalamus and striatum. Percent neurons positive for mCDKL5 or hCDKL5 for both AAV-dosed and vehicle mice are quantified in FIG. 8D (mCDKL5) and FIG. 8E (hCDKL5).
[0329] FIGs. 8A-8E also show that hCDKL5 expression was found only in AAV-dosed mice in the hippocampus (HPC), cortex (CTX), striatum (STR), and thalamus (Thai). Expression of hCDKL5 was not found in the vehicle group (FIG. 8C) in the hippocampus, cortex, striatum, and thalamus. FIG. 8A shows mCdkl5 expression in a WT mouse. FIG. 8B shows hCDKL5 expression in an AAV-dosed mouse. Transgene expression was quantified as percent of neurons positive for mCdkl5 (FIG. 8D) or hCDKL5 (FIG. 8E). These graphs further show that hCDKL5-positive cells were found in all four of the cortex, hippocampus, thalamus, and striatum in the AAV-dosed mice (FIG. 8B).
[0330] FIGs. 9A-11D show that the human synapsin (hSynl) promoter is highly efficient at driving transgene expression in neurons. The human synapsin (hSynl) promoter is located in the proximal region of the endogenous human SYN1 gene. The small size of the promoter is suitable for use in an AAV vector. The promoter drives selective expression in neurons in the CNS and sustained long term transgene expression. As shown in Table 12, hSynl and hybrid chicken beta-actin (CBh) promoter were included in the tested payloads. Construct 1 withAttorney Docket No. 14640.0303-00304 hSynl was tested by intraparenchymal injection of mouse thalamus, at a dose of 8E10 VG. Injected mice were perfused with PBS then 4% paraformaldehyde (PF A). Brains were dissected out and post-fixed in PFA and then dehydrated in 30% sucrose. Brain tissues were then sectioned into brain sections with 30-micron thickness, and immunostained for NeuN (neuronal marker, EMD Millipore, Catalog No. ABN90) and hCDKL5 (Proteintech, Catalog No. 12973-1-AP). hCDKL5-positive cells were observed in the injection site but not in the contralateral site (FIGs. 9A and 9B). FIGs. 9B and 11A-11B show that Construct 1 resulted in expression of hCDKL5 in the tissues transduced by the encapsidating AAV at the injection site, while hCDKL5 was not expressed at the contralateral site (FIGs. 9B and 11C-11D). FIGs. 10A-10C show that hCDKL5 was specifically expressed in neurons as shown by hCDKL5 staining (FIG. 10A), NeuN staining (FIG. 10B), and colocalization of hCDKL5 and NeuN staining (FIG. 10C). AAV transduction was at about 67% efficiency, and that 94% of hCDKL5 -positive cells were NeuN positive, out of a total of 1838 cells analyzed from two mice. Together, these results demonstrate high cell specificity of the hSynl promoter for driving hCDKL5 transgene expression.
[0331] A further study is conducted in which PHP.eB-encapsidated Construct 9 is administered to wildtype C57BL6 / J mice (n=3) at a dose of 1E14 VG / kg and PBS is used as negative control (n=3). Brain tissues are collected, fixed, and embedded in paraffin as described above. Brain sections are stained for hCDKL5 mRNA by BaseScope and NeuN by immunohi stochemi stry.Example 2: Target engagement and efficacy of Construct 1 delivered by PHP.eB
[0332] CDKL5-KO mice (Jackson Laboratories JAX#021967; B6.129(FVB)- Cdkl5tml.lJoez / J) and age- and gender-matched wildtype controls were intravenously injected with a single 1E14 VG / kg dose of payload Constructs 1, 4, or 8 encapsidated in PHP.eB (AAV-dosed mice) or vehicle (PBS) (n=30 for WT / Veh, n=28 for KO / Veh, n=20 for KO / Construct 1, n=9 for KO / Construct 8, and n=10 for KO / Construct 4 groups). Four weeks later, mice were tested for behavioral phenotypes as described below, followed by brain tissue collection for biodistribution analysis. After collection, the left-brain hemispheres from each mouse were transferred to liquid nitrogen. The right-brain hemispheres were fixed in 10% NBF, then dehydrated in 70% ethanol, followed by further dehydration and then formalin- fixed paraffin embedding (FFPE).
[0333] The fresh frozen brain tissues were homogenized in lysis buffer after which protein was extracted from cerebrum, and DNA and RNA were extracted from cerebellum. TheAttorney Docket No. 14640.0303-00304 vector genome and expression of the hCDKL5 transgene were analyzed by droplet digital polymerase chain reaction (ddPCR) using primers recognizing hCDKL5 using the following primers / probes: WPRE probe: Qiagen CGT Assay, WPRE (Cy5), 20x; Human CDKL5 Taqman probe: Thermo Fisher, Assay ID Hs01043909_ml, FAM; Mouse CDKL5 Taqman probe: Thermo Fisher, Assay ID Mm01156815_ml, FAM; Beta actin Taqman probe: Thermo Fisher, Assay ID Hs01060665_gl, FAM. The protein level of hCDKL5 was measured with ELISA, with antibody pairs (Novus NBP2-32157H and EMB Millipore MABS1132 8F3.1). As shown in FIGs. 12A, 12B, and 12D, AAV-dosed mice showed significantly higher (p<0.001) copies of DNA (FIG. 12A) and RNA (FIG. 12B) and higher protein (FIG. 12D) levels compared to vehicle treated groups. Consistently, the phosphorylation level of hCDKL5 substrate EB2 was also found to be higher in AAV dosed mice (FIG. 12E), measured by MSD (Meso Scale Discovery) ELISA assay (using the following antibodies: Anti-EB2 antibody [KT52], Abeam, Cat# ab45767; Anti-EB2 antibody, Abeam, Cat# ab234843; EB2 PS222 Antibody, Covalab, Cat# 00117741), demonstrating restored CDKL5 function as a kinase.
[0334] The transgene expression was further examined in the FFPE tissues using BaseScope ISH and IHC, as described in Example 1. Neuronal expression of hCDKL5 was found only in AAV-dosed mice. These data demonstrate that PHP. eB-encap si dated Construct 1 was able to drive mCDKL5 expression in neurons of affected brain regions in CDKL5-KO mice (FIG. 12C)
[0335] To evaluate the effect of including WPRE and / or Myc tag in payloads on the susceptibility of treated mice to NMDA-induced seizure, four weeks after AAV dosing, mice were dosed i.p. with 80 mg / kg NMD A, a potent agonist that causes excitation of the neuronal circuit. CDKL5-KO mice have increased seizure susceptibility to NMDA as compared to wild type, evidenced by higher modality (death) during seizure caused by NMDA treatment. FIGs. 13A and 13B show the effects of administration of various constructs in mice, specifically, the occurrence of sudden unexpected death in epilepsy (SUDEP) (FIG. 13A), and the severity of seizures in mice as measured using the Racine scale (FIGS. 13B). Administration of PHP. eB-encap si dated Construct 1 (with WPRE) suppressed seizure susceptibility, as seen in the % occurrence of SUDEP (FIG. 13A) and in the Racine scores (FIG. 13B). Administration of Construct 4, which does not comprise WPRE, showed no effect on NMDA-induced seizure susceptibility, as seen in the % occurrence of SUDEP (FIG. 13A) and in the Racine scores (FIG. 13B). In contrast, administration of Construct 8, which comprises WPRE and a Myc tag, had a stronger effect than Construct 1 on suppressingAttorney Docket No. 14640.0303-00304 seizure susceptibility, as seen in the % occurrence of SUDEP (FIG. 13A) and in the Racine scores (FIG. 13B)
[0336] The effect of including WPRE or a Myc tag in payload constructs on motor function of treated mice was also evaluated as follows. Four weeks after AAV dosing, mice were hanged by their tails for 30 seconds and video recorded. Videos were then used to score hindlimb clasping behavior on a four-grade scale as described in Table 15 (FIGs. 14A-14F). The videos were scored double-blind, and the videos were played at x0.5 speed when scoring to improve accuracy.Table 15. Scoring Criteria for Hindlimb Clasping Behavior.
[0337] The videos were scored for hindlimb clasping, and the aggregate scores for all groups were compiled (FIG. 14A). Hindlimb clasping scores were also compiled individually for the following groups: WT + vehicle (FIG. 14B), KO + vehicle (FIG. 14C), KO + CDKL5 (FIG. 14D), KO+CDKL5 with WPRE (FIG. 14E), and KO + CDKL5 with WPRE and Myc tag (FIG. 14F). As shown in FIGs. 14A-14F, CDKL5-KO mice exhibited higher hindlimb clasping scores than wildtype mice; and hCDKL5 expression after administration of PHP.eB-encapsi dated Construct 1 suppressed hindlimb clasping (FIG. 14E). Administration of PHP.eB-encapsidated Construct 4, which does not comprise WPRE, showed no effect on hindlimb clasping score (FIG. 14D). Administration of PHP.eB-encapsidated Construct 8, comprising both WPRE and a Myc tag, also decreased hindlimb clasping score (FIG. 14F).
[0338] Brains of mice after administration of PHP.eB-encapsidated Construct 1 were evaluated for ex vivo neural hyperactivity as follows. CDKL5-KO mice or age- and gender- matched wildtype controls were intravenously injected with 1E14 VG / kg of PHP.eB- encapsidated Construct 1 or vehicle (n=20 for WT / Veh, 19 for KO / Veh, 10 for KO / Construct 1, 10 for KO / Construct 4, and 9 for KO / Construct 8 groups). Mice were sacrificed and fresh brain tissues were harvested and sectioned into brain slices. The CA2 region of the hippocampus was recorded with whole cell patch clamp (FIG. 15A). To do this, NMDA was puffed to neurons at a concentration of ImM in a puff pipette. Neurons were held at +40mV and currents were recorded using recording pipettes. The results (FIG. 15B) demonstrate thatAttorney Docket No. 14640.0303-00304 in the CDKL5-K0 mice neurons showed longer decay time of NMDA current than those in wildtype mice and administration of PHP. eB-encap si dated Construct 1 was able to rescue this deficit, where NMDA current decay deficits are associated with higher risk of seizures.
[0339] Seizure susceptibility and mortality in CDKL5 KO mice were reduced by a restoration of CDKL5 expression via AAV (PHP.eB) delivery. As shown in FIGs. 16A and 16B, mice dosed in the Construct 1 and Construct 8 groups had reduced percent mortality (FIG. 16A) and maximum seizure scores (FIG. 16B) as compared to mice in the Construct 4 group. These reductions in seizure susceptibility and mortality were correlated with the level of expressed CDKL5 protein (FIG. 17A and FIG. 17B). Mice dosed with Construct 8, which comprises WPRE and a Myc tag, had enhanced expression of CDKL5 and more pronounced effects in reducing seizure and mortality as compared to Construct 1 and Construct 4.Example 3. Dose-Dependent Transgene Expression and Efficacy after Administration of PHP.eB-Encapsidated Construct 1
[0340] After administration of varying doses of PHP.eB-encapsidated Construct 1, mice were evaluated for neuron transduction and hCDKL5 transgene expression as follows. CDKL5-KO mice (Jackson Laboratories JAX#021967; B6.129(FVB)-Cdkl5tml. lJoez / J) were intravenously injected with 5E12 VG / kg, IE 13 VG / kg, 2E13 VG / kg, or 5E13 VG / kg of PHP.eB-encapsidated Construct 1 (AAV-dosed mice). As controls, CDKL5-KO or age- and gender-matched wildtype mice were dosed with vehicle (PBS) (n=20 for WT / Veh, 22 for KO / Veh, 15 for KO / 5E12 VG / kg, 15 for KO / 1E13 VG / kg, 20 for KO / 2E13 VG / kg, and 20 for KO / 5E13 VG / kg groups). Four weeks later, dosed mice were tested for behavioral phenotypes as described below. Behavioral phenotyping was followed by euthanization and tissue collection for biodistribution analysis. As described in Example 1, the left-brain hemispheres from each mouse were immediately transferred to liquid nitrogen. The right- brain hemispheres were fixed in 10% NBF, then dehydrated in 70% ethanol, followed by further dehydration and then formalin-fixed paraffin embedding.
[0341] As described in Example 1, the fresh frozen brain tissues were processed, and DNA / protein were extracted from cerebrum. The vector genome was analyzed by ddPCR and the protein level of hCDKL5 was measured with ELISA (FIGs. 19A-19B), as described in Example 2. AAV-dosed mice showed dose-dependent changes in vector genome and protein levels. FIG. 19A shows the level of vector genome copies in the cerebrum at different doses; FIG. 19B shows the level of protein expression level in the cerebrum at different doses.
[0342] The transgene expression was further examined in the FFPE-embedded tissues using BaseScope in situ hybridization and immunostaining as described in Example 1. As shown inAttorney Docket No. 14640.0303-00304FIGs. 19C-19D, the percent of neurons expressing hCDKL5 showed dose dependency in AAV-dosed mice. FIG. 19C shows percent of neurons expressing hCDKL5 mRNA at different doses in the cortex; FIG. 19D shows percent of neurons expressing hCDKL5 mRNA at different doses in the hippocampus. Table 16 shows the percentage of neurons in CDKL5-K0 mouse cortex, hippocampus, thalamus, and striatum that were hCDKL5-positive following administration of various doses of PHP.eB viral particles carrying Construct 1 (SEQ ID NO: 11).Table 16. Percent Neurons Transduced in In Vivo Dose Dependency Study (CDKL5 KO Mice).
[0343] Treated mice were evaluated for susceptibility to NMDA-induced seizure as follows. Four weeks after AAV dosing, mice were dosed intraperitoneally (i.p.) with 80mg / kg NMD A, as described in Example 2. As shown in FIG. 18A, all four tested doses reduced seizure susceptibility (* signifies p<0.05; absolute p values are shown when p is close to 0.05 but not lower than 0.05). 2E13 VG / kg and 5E13 VG / kg doses significantly suppressed seizure susceptibility. FIG. 18B shows latency to death after all four tested doses.
[0344] Motor function (hindlimb clasping) of treated mice was evaluated as follows. Four weeks after AAV dosing, mice were tested for hindlimb clasping, as described in Example 2. Data are shown in FIG. 18C (hindlimb clasping score, before dosing), FIG. 18D (hindlimb clasping score, after dosing), and FIG. 18E (summary of hindlimb clasping scores), which demonstrate that the 2E13 and 5E13 VG / kg doses were able to significantly decrease hindlimb clasping score.
Claims
Attorney Docket No. 14640.0303-00304ClaimsWe claim:
1. An isolated nucleic acid comprising a cyclin-dependent kinase-like 5 (CDKL5)- encoding sequence, wherein the isolated nucleic acid comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 82% (e.g., at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
2. The isolated nucleic acid of claim 1, wherein the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4, SEQ ID NO: 13, or SEQ ID NO: 5, or a nucleotide sequence that is at least 90% (at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
3. The isolated nucleic acid of claim 1 or claim 2, wherein the CDKL5 -encoding sequence encodes a CDKL5 protein comprising the amino acid sequence of SEQ ID NO: 3.
4. The isolated nucleic acid of any one of claims 1-3, wherein the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4.
5. The isolated nucleic acid of any one of claims 1-4, comprising a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
6. The isolated nucleic acid of claim 5, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or any one of SEQ ID NOs: 38-42, or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
7. The isolated nucleic acid of claim 6, wherein the WPRE comprises the nucleotide sequence of SEQ ID NO: 8.Attorney Docket No. 14640.0303-003048. The isolated nucleic acid of any one of claims 1-7, comprising a promoter operably linked to the CDKL5-encoding sequence.
9. The isolated nucleic acid of claim 8, wherein the promoter is a human synapsin 1 (hSYNl) promoter or a chicken P-actin hybrid (CBh) promoter.
10. The isolated nucleic acid of claim 8 or claim 9, wherein the promoter is a hSYNl promoter.
11. The isolated nucleic acid of any one of claims 8-10, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
12. The isolated nucleic acid of claim 11, wherein the promoter comprises the nucleotide sequence of SEQ ID NO: 7.
13. The isolated nucleic acid of any one of claims 1-12, comprising a polyadenylation (poly A) sequence.
14. The isolated nucleic acid of claim 13, wherein the polyA sequence is a bovine growth hormone (bGH) polyA sequence.
15. The isolated nucleic acid of claim 14, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
16. The isolated nucleic acid of claim 15, wherein the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9.
17. The isolated nucleic acid of any one of claims 1-16, comprising at least one inverted terminal repeat (ITR).
18. The isolated nucleic acid of claim 17, wherein the at least one ITR comprises a 5’ ITR and a 3 ’ ITR.Attorney Docket No. 14640.0303-0030419. The isolated nucleic acid of claim 18, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
20. The isolated nucleic acid of claim 18 or claim 19, wherein the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6.
21. The isolated nucleic acid of any one of claims 18-20, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%).
22. The isolated nucleic acid of any one of claims 18-21, wherein the 3’ ITR comprises the nucleotide sequence of SEQ ID NO: 10.
23. The isolated nucleic acid of any one of claims 1-22, further comprising a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduces or prevents expression of CDKL5 in dorsal root ganglia.
24. The isolated nucleic acid of claim 23, wherein the one or more miR binding sites comprises one, two, three, or four miR183 binding sites.
25. The isolated nucleic acid of claim 23 or claim 24, comprising a nucleotide sequencing encoding four miR183 binding sites, optionally wherein the four miR183 binding sites are identical.
26. The isolated nucleic acid of claim 25, wherein each of the four miR183 binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
27. The isolated nucleic acid of claim 26, wherein each of the four miR183 binding sites is encoded by the nucleotide sequence of SEQ ID NO: 1.Attorney Docket No. 14640.0303-0030428. The isolated nucleic acid of any one of claims 24-27, wherein the miR183 binding sites are separated by a spacer, optionally wherein the spacer is encoded by the nucleotide sequence GATAGTTA.
29. The isolated nucleic acid of any one of claims 1-28, further comprising a nucleotide sequence encoding a microRNA183 (miR183) binding site series, wherein the nucleotide sequence encoding the miR183 binding site series comprises the nucleotide sequence of SEQ ID NO: 2 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
30. The isolated nucleic acid of claim 29, wherein the miR183 binding site series is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 2.
31. The isolated nucleic acid of claim 30, wherein the miR183 binding site series is encoded by the nucleotide sequence of SEQ ID NO: 2.
32. The isolated nucleic acid of any one of claims 1-22, comprising the nucleotide sequence of SEQ ID NO: 11.
33. The isolated nucleic acid of any one of claims 1-3 and 5-22, comprising the nucleotide sequence of SEQ ID NO: 12.
34. The isolated nucleic acid of any one of claims 1-31, comprising the nucleotide sequence of SEQ ID NO: 15.
35. A recombinant viral genome comprising the isolated nucleic acid of any one of claims 1-34.
36. A recombinant viral genome comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g., at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.Attorney Docket No. 14640.0303-0030437. The recombinant viral genome of claim 35 or claim 36, comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
38. A recombinant viral genome comprising the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto, wherein the recombinant viral genome comprises, in 5’ to 3’ order: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) a 3’ ITR comprising the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
39. The recombinant viral genome of claim 38, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto;Attorney Docket No. 14640.0303-00304 b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
40. The recombinant viral genome of claim 38 or claim 39, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
41. The recombinant viral genome of any one of claims 38-40, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7;Attorney Docket No. 14640.0303-00304 c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO:4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
42. The recombinant viral genome of any one of claims 38-41, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9 or a nucleotide sequence that is at least 95% (e.g., at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
43. The recombinant viral genome of any one of claims 38-42, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7; c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 4; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
44. The recombinant viral genome of any one of claims 38-42, wherein: a) the 5’ ITR comprises the nucleotide sequence of SEQ ID NO: 6; b) the promoter comprises the nucleotide sequence of SEQ ID NO: 7;Attorney Docket No. 14640.0303-00304 c) the CDKL5 -encoding sequence comprises the nucleotide sequence of SEQ ID NO: 5; d) the WPRE comprises the nucleotide sequence of SEQ ID NO: 8; e) the polyA sequence comprises the nucleotide sequence of SEQ ID NO: 9; and f) the 3’ ITR sequence comprises the nucleotide sequence of SEQ ID NO: 10.
45. The recombinant viral genome of any one of claims 36-43, comprising the nucleotide sequence of SEQ ID NO: 11.
46. The recombinant viral genome of any one of claims 36-42 or claim 44, comprising the nucleotide sequence of SEQ ID NO: 12.
47. The recombinant viral genome of any one of claims 36-44, further comprising a nucleotide sequence encoding one or more microRNA (miR) binding sites, wherein the one or more miR binding sites reduce or prevent expression of CDKL5 in dorsal root ganglia.
48. The recombinant viral genome of claim 47, wherein each of the one or more miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
49. The recombinant viral genome of claim 47 or claim 48, encoding four miR binding sites, wherein each of the four miR binding sites is encoded by a nucleotide sequence comprising the nucleotide sequence of SEQ ID NO: 1.
50. The recombinant viral genome of any one of claims 36-44, further comprising a nucleotide sequence encoding a microRNA (miR) binding site series, wherein the nucleotide sequence encoding the miR binding site series comprises the nucleotide sequence of SEQ ID NO: 2.
51. The recombinant viral genome of any one of claims 36-43 and 47-50, comprising the nucleotide sequence of SEQ ID NO: 15.
52. An adeno-associated virus (AAV) particle comprising:(i) an AAV capsid; andAttorney Docket No. 14640.0303-00304(ii) the recombinant viral genome of any one of claims 35-51 or a recombinant viral genome comprising the isolated nucleic acid of any one of claims 1-34.
53. The AAV particle of claim 52, wherein the AAV capsid comprises an AAV1 capsid or a variant thereof, an AAV2 capsid or a variant thereof, an AAV3 capsid or a variant thereof, an AAV3b capsid or a variant thereof, an AAV4 capsid or a variant thereof, an AAV5 capsid or a variant thereof, an AAV6 capsid or a variant thereof, an AAV7 capsid or a variant thereof, an AAV8 capsid or a variant thereof, an AAVrh8 capsid or a variant thereof, an AAV9 capsid or a variant thereof, an AAVPHP.B capsid or a variant thereof, an AAVPHP.N capsid or a variant thereof, a VOY101 capsid or a variant thereof, an AAVrhlO capsid or a variant thereof, an AAVrh32.33 capsid or a variant thereof, or an AAVrh74 capsid or a variant thereof.
54. The AAV particle of claim 53, wherein the AAV capsid is an AAV9 capsid variant.
55. The AAV particle of any one of claims 52-54, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11 or a nucleotide sequence that is at least 90% (e.g. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.
56. The AAV particle of claim 55, wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8; e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.Attorney Docket No. 14640.0303-0030457. The AAV particle of any one of claims 52-56, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11.
58. The AAV particle of any one of claims 52-56, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12.
59. The AAV particle of any one of claims 52-56, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 15.
60. A cell comprising the isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, or the AAV particle of any one of claims 52-59.
61. The cell of claim 60, wherein the cell is a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
62. A method of making an AAV particle, the method comprising:(i) providing a cell comprising the recombinant viral genome of any one of claims 35-51 or a recombinant viral genome comprising the isolated nucleic acid of any one of claims 1-34, and a nucleic acid encoding an AAV capsid; and(ii) incubating the cell under conditions suitable to encapsulate the recombinant viral genome in the AAV capsid; thereby making the AAV particle.
63. The method of claim 62, wherein the recombinant viral genome comprises: a) a 5’ inverted terminal repeat (ITR) comprising the nucleotide sequence of SEQ ID NO: 6; b) a promoter comprising the nucleotide sequence of SEQ ID NO: 7; c) a cyclin-dependent kinase-like 5 (CDKL5)-encoding sequence comprising the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5; d) a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) comprising the nucleotide sequence of SEQ ID NO: 8;Attorney Docket No. 14640.0303-00304 e) optionally a nucleotide sequence encoding a microRNA (miR) binding site, wherein the nucleotide sequence encoding the miR binding site comprises the nucleotide sequence of SEQ ID NO: 1; f) a polyadenylation (poly A) sequence comprising the nucleotide sequence of SEQ ID NO: 9; and g) a 3’ ITR sequence comprising the nucleotide sequence of SEQ ID NO: 10.
64. The method of claim 63, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 11.
65. The method of claim 63, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 12.
66. The method of claim 63, wherein the recombinant viral genome comprises the nucleotide sequence of SEQ ID NO: 15.
67. The method of any one of claims 62-66, further comprising, prior to step (i), introducing into the cell a nucleic acid comprising the recombinant viral genome.
68. The method of any one of claims 62-67, further comprising, prior to step (i), introducing into the cell the nucleic acid encoding the AAV capsid.
69. The method of any one of claims 62-68, wherein the cell comprises a mammalian cell (e.g., an HEK293 cell), an insect cell (e.g., an Sf9 cell), or a bacterial cell.
70. A pharmaceutical composition comprising the isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, or the AAV particle of any one of claims 52-59, and further comprising a pharmaceutically acceptable excipient.
71. A method of delivering cyclin-dependent kinase-like 5 (CDKL5) to a cell, comprising administering an effective amount of the isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, the AAV particle of any one of claims 52-59, or the pharmaceutical composition of claim 70.Attorney Docket No. 14640.0303-0030472. The method of claim 71, wherein the cell is in a subject.
73. The method of claim 72, wherein the subject has, has been diagnosed with having, or is at risk of having a CDKL5-related disorder.
74. A method of treating a subject having or diagnosed with having a CDKL5-related disorder, or at least one symptom thereof, comprising administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, the AAV particle of any one of claims 52-59, or the pharmaceutical composition of claim 70.
75. The method of claim 73 or claim 74, wherein the CDKL5-related disorder is a CDKL5-related neurodegenerative or neuromuscular disorder.
76. The method of claim 75, wherein the CDKL5-related neurodegenerative or neuromuscular disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
77. A method of treating a subject having or diagnosed with having a CDKL5-related disorder, or at least one symptom thereof, wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), comprising administering to the subject an effective amount of the isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, the AAV particle of any one of claims 52-59, or the pharmaceutical composition of claim 70.
78. The method of any one of claims 72-77, wherein the subject has one or more mutations in the CDKL5 gene.
79. The method of any one of claims 72-78, wherein the subject has a reduced level of CDKL5 activity as compared to a reference level in an individual who does not have a CDKL5-related disorder.
80. The method of any one of claims 74-79, wherein the treating results in prevention of progression of the disorder or at least one symptom thereof in the subject.Attorney Docket No. 14640.0303-0030481. The method of any one of claims 74-80, wherein the treating results in amelioration of at least one symptom of the disorder in the subject, e.g., as indicated by one or more biomarkers.
82. The method of claim 81, wherein the one or more biomarkers comprises neurofilament light chain or a marker of CDKL5 activity, e.g., as measured by phosphorylation levels of substrate proteins, e.g., MECP2, or as measured by mass spectrometry.
83. The method of any one of claims 77-82, wherein the at least one symptom comprises epilepsy (e.g., early-onset epilepsy), autism, deficits in cognition, limited motor skills, sleep difficulties, visual impairment, low muscle tone, gastrointestinal reflux, behavioral symptoms (including episodes of laughing or crying that occur for what appears to be no reason, hypersensitivity to touch, and disrupted sleep), facial appearance changes (including microcephaly; a high, broad forehead; large, deep-set eyes; smaller-than-normal space between the nose and upper lip; an upturned nose; full lips and / or widely-spaced teeth), difficulties standing and walking, small, cold feet, lack of or poor eye contact, frequent sideways glances, cortical visual impairment or cortical blindness, bruxism, limited or absent speech, difficulties eating, stereotypies, limited ability to make small and / or focused hand movements, gastroesophageal reflux, constipation, or a combination thereof.
84. The method of any one of claims 72-83, wherein the subject is a human.
85. The method of any one of claims 72-84, wherein the isolated nucleic acid, the recombinant viral genome, the AAV particle, or the pharmaceutical composition is delivered to a cell, tissue, or region of the central nervous system (CNS) of the subject.
86. The method of claim 85, wherein the cell, tissue, or region of the CNS comprises a cell, tissue, or region of the cortex, hippocampus, striatum, thalamus, or cerebellum.
87. The method of claim 85 or claim 86, wherein the cell of the CNS comprises a neuron (e.g., a glutamatergic neuron and / or a GABAergic neuron).Attorney Docket No. 14640.0303-0030488. The method of any one of claims 72-87, wherein the isolated nucleic acid, the recombinant viral genome, the AAV particle, or the pharmaceutical composition is delivered to the subject via intravenous administration.
89. The method of any one of claims 72-88, further comprising evaluating, e.g., measuring, the level of CDKL5 gene expression, CDKL5 mRNA expression, and / or CDKL5 protein expression in the subject, e.g., in a cell, tissue, or fluid of the subject.
90. The method of claim 89, wherein the level of CDKL5 protein expression is measured by an enzyme-linked immunosorbent assay (ELISA), a Western blot, or an immunohistochemistry assay.
91. The method of claim 89 or claim 90, wherein the evaluating the level of CDKL5 gene, mRNA, and / or protein expression is performed before and after administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition, optionally wherein the subject’s level of CDKL5 gene, mRNA, and / or protein expression before administration is compared to the subject’s level of CDKL5 gene, mRNA, and / or protein expression after administration.
92. The method of any one of claims 72-91, comprising evaluating the level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue of the CNS in the subject.
93. The method of claim 92, wherein the cell or tissue of the CNS comprises a cell or tissue of the cortex, hippocampus, striatum, thalamus, or cerebellum.
94. The method of claim 92 or claim 93, wherein the cell of the CNS comprises a neuron (e.g., a glutamatergic neuron and / or a GABAergic neuron).
95. The method of any one of claims 72-94, wherein the subject’s level of CDKL5 protein expression after administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition is increased relative to the subject’s level of CDKL5 protein expression before administration of the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition.Attorney Docket No. 14640.0303-0030496. The method of any one of claims 72-95, further comprising evaluating, e.g., measuring, the level of CDKL5 protein activity in the subject, e.g., in a cell or tissue of the subject.
97. The method of any one of claims 72-96, wherein administering the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition to the subject results in an increase in:(i) the level of CDKL5 activity in a cell, tissue, or fluid (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, GABAergic neurons, glutamatergic neurons, or a combination thereof) of the subject, relative to baseline and / or relative to the level of CDKL5 activity in a cell, tissue, or fluid of an individual with a CDKL5-related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition;(ii) the number and / or level of viral genomes (VG) per cell level in a cell or tissue of the CNS (e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, GABAergic neurons, glutamatergic neurons, or a combination thereof) of the subject, relative to the number and / or level of VG per cell in a peripheral cell or tissue of the subject; and / or(iii) the level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue (e.g., a cell or tissue of the CNS, e.g., the cortex, hippocampus, striatum, thalamus, cerebellum, GABAergic neurons, glutamatergic neurons, or a combination thereof) of the subject relative to baseline and / or relative to the level of CDKL5 gene, mRNA, and / or protein expression in a cell or tissue of an individual with a CDKL5-related disorder who has not been administered the isolated nucleic acid, recombinant viral genome, AAV particle or pharmaceutical composition.
98. The method of any one of claims 73-97, further comprising administering to the subject at least one additional agent and / or therapy suitable for treating the CDKL5-related disorder or at least one symptom thereof.
99. The method of claim 98, wherein the at least one additional agent and / or therapy comprises one or more anti-epileptic drugs (e.g., bromide, clobazam, felbamate, ganaxolone, lamotrigine, levetiracetam, phenobarbital, topiramate, valproate, or a combination thereof).Attorney Docket No. 14640.0303-00304100. The method of any one of claims 72-99, further comprising administering an immunosuppressant to the subject.
101. The method of claim 100, wherein the immunosuppressant comprises an adrenocorticotropic hormone, corticosteroid (e.g., prednisone, prednisolone, methylprednisolone, and / or dexamethasone), eculizumab hydroxychloroquine, mycophenolate mofetil, rapamycin, rituximab, and / or tacrolimus.
102. The isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, the AAV particle of any one of claims 52-59, or the pharmaceutical composition of claim 70, for use in the treatment of a CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
103. The isolated nucleic acid, recombinant viral genome, AAV particle, or pharmaceutical composition of claim 102, wherein the subject has been diagnosed with having, or is at risk of having, the CDKL5-related disorder; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
104. Use of the isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, the AAV particle of any one of claims 52-59, the cell of claim 60 or claim 61, or the pharmaceutical composition of claim 70 in the manufacture of a medicament for the treatment of a CDKL5-related disorder or at least one symptom thereof in a subject; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.
105. The use of claim 104, wherein the subject has, has been diagnosed with having, or is at risk of having the CDKL5-related disorder; optionally wherein the CDKL5-related disorder is CDKL5 deficiency disorder (CDD), developmental and epileptic encephalopathy 2, or atypical Rett syndrome.Attorney Docket No. 14640.0303-00304106. The isolated nucleic acid of any one of claims 1-34, the recombinant viral genome of any one of claims 35-51, the AAV particle of any one of claims 52-59, or the pharmaceutical composition of claim 70 for use in a method of treating a disorder according to any one of claims 74-101.
Citation Information
Patent Citations
TARGETING PEPTIDES FOR DIRECTING ADENO-ASSOCIATED VIRUSES (AAVs)
US20170166926A1
Mineral hollow fiber bioreactor for the cultivation of animal cells
US5064764A
Method for improved transduction by recombinant adeno-associated viruses
US5756283A
AAV-mediated delivery of DNA to cells of the nervous system
US6180613B1
An improved method for the production and purification of adenoviral vectors
US6194191B1