Heat-inducible cell therapy

Abstract

Provided herein are methods of activating cells (e.g., CAR-T cells) by heat shock, e.g., by contacting the cells with pre-heated media. Also provided herein are methods of preserving the expression level of a protein of interest (e.g., a CAR) by freezing cells after activation. The frozen cells can be further thawed and recovered for optimal expression of the protein of interest (e.g., a CAR). The activated cells described herein can be administered to subjects in need thereof to treat diseases or disorders (e.g., cancer).

Description

[0001] HEAT-INDUCIBLE CELL THERAPY

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U. S. Patent Application Serial No. 63 / 714,942, filed on November 1, 2024. The disclosure of the prior application is considered part of, and is incorporated by reference in, the disclosure of this application.

[0004] SEQUENCE LISTING

[0005] This application contains a Sequence Listing that has been submitted electronically as an XML file named 58805-0002W01 SL_ST26.xml. The XML file, created on October 29, 2025, is 44,946 bytes in size. The material in the XML file is hereby incorporated by reference in its entirety.

[0006] TECHNICAL FIELD

[0007] This disclosure relates to methods of activating cells (e.g., CAR-T cells) by heat shock and methods of preserving the expression level of a protein of interest (e.g., CAR) in heat shock-activated cells. The methods can be used for large-scale production and storage of cells (e.g., CAR-T cells) as cell therapies for cancer treatment.

[0008] BACKGROUND

[0009] Advances in cellular immunotherapy have provided a promising approach for the treatment of various tumors. One such treatment involves genetic engineering of immune cells, particularly T cells, to express chimeric antigen receptors (CARs) on the cell surface. Chimeric antigen receptors are proteins which, in their usual format, graft the specificity of a monoclonal antibody (mAb) to the effector function of a T cell. Once the CARs are expressed in a T cell, the CAR modified T cell (CAR-T or CAR-T cell) acquires some properties, such as antigen specific recognition, antitumor reactivity and proliferation, and thus can act as “living drugs” to eradicate targeted tumor cells. In principle, any antigens (e.g., cell surface molecules) can be targeted by these CAR-T cells. CAR-T cell therapy can override tolerance to self-antigens and provide a treatment which is not reliant on the MHC status of a patient.

[0010] However, there is a pressing need for scalable production methods that can consistently produce CAR-T cells in large quantities without compromising their therapeutic effectiveness. Moreover, ensuring the long-term stability and viability of these cells during storage remains a critical issue, impacting the practicality of widespread clinical use. These challenges underscore the need for a more simplified, scalable, and versatile approach to CAR-T cell therapy, one that can be more easily adopted and applied across different CAR constructs to address a broader range of cancers.

[0011] SUMMARY

[0012] Heat-inducible CAR-T cells are a type of CAR-T cell that has been engineered to be responsive to heat. The present disclosure describes the development and application of modular, heat-inducible CAR-T cells, offering a versatile and safer approach to CAR-T cell therapy. The CAR design allows for precise control of CAR expression through heat activation, reducing off-target toxicity and enhancing the therapeutic potential against various tumor types. The present disclosure demonstrated that the CAR-T cells, including those targeting PSMA, MSLN, GD2, and PD-L1, exhibit significantly stronger cytotoxicity against corresponding tumor cells compared to wild-type T cells. The modular nature of this system enables easy adaptation to different tumor antigens, broadening its applicability across multiple cancer types. Additionally, The present disclosure optimized the storage conditions and heat-shock protocols to ensure the viability and effectiveness of these CAR-T cells, making them suitable for large-scale production and clinical use. In vivo studies further confirmed the safety and efficacy of the heat-inducible CAR-T cells, showing significant tumor inhibition with minimal toxicity to normal tissues. This technology represents a significant advancement in CAR-T cell therapy, providing a more controlled, scalable, and versatile platform for cancer treatment.

[0013] In one aspect, the disclosure is related to methods of using heat shock to activate cells (e.g., CAR-T cells). The methods can be used to activate heat-inducible CAR-T cells using heat shock alone to enable effective tumor cell destruction. In one aspect, the disclosure is related to optimized heat shock conditions for large-scale production of CAR-T cells. The methods define specific heat shock conditions, including temperature and duration, that are suitable for the large-scale production of heat shock-activated CAR-T cells, ensuring consistency and effectiveness.

[0014] In one aspect, the disclosure is related to optimized storage conditions. A technique for storing heat shock-activated CAR-T cells was developed that can preserve their viability and therapeutic potency over time, making them more practical for clinical use.

[0015] In one aspect, the disclosure is related to broad applicability across CAR types, e.g., the application of the heat shock activation methods to various CAR constructs (e.g., MSLN, GD2, PSMA, EGFR, and high-affinity PD1 CARs) targeting different type of solid tumors, demonstrating the versatility and wide-ranging utility of the invention.

[0016] In one aspect, the disclosure is related to off-the-shelf and ready-to-use cell therapy products. By combining the knockout (KO) of endogenous TCR with heat shock activation, the heat-inducible CAR-T cells can serve as off-the-shelf, ready-to-use cell therapy products, offering an allogeneic solution for a broad range of patients and reducing the time and cost associated with individualized CAR-T cell therapies.

[0017] In one aspect, the disclosure is related to a method for activating a population of cells that express a protein of interest, comprising a) providing a population of cells comprising a nucleic acid comprising a heat-responsive promoter, and a sequence encoding the protein of interest; and b) introducing a heat shock to the population of cells, thereby activating the population of cells.

[0018] In one aspect, the disclosure is related to a method of preserving the expression level of a protein of interest in a population of cells, comprising: a) providing a population of cells comprising a nucleic acid comprising a heat-responsive promoter, and a sequence encoding the protein of interest; b) introducing a heat shock to the population of cells, thereby activating the population of cells; and c) freezing the population of activated cells, e.g., in liquid nitrogen.

[0019] In some embodiments, the population of cells comprise an immune cell (e.g., a T cell, a natural killer (NK) cell, a B cell, a monocyte, a macrophage, or a combination thereof). In some embodiments, the heat shock is introduced by contacting the population of cells with a preheated medium, optionally the pre-heated medium comprises a cytokine (e.g., IL-2). In some embodiments, the temperature of the pre-heated medium is maintained at about 41-46°C (e.g., about 43°C) during the heat shock. In some embodiments, the pre-heated medium is maintained at the temperature consistently during the heat shock, e.g., using a water bath and / or by agitation. In some embodiments, the population of cells are contacted with the pre-heated medium for about 5 minutes to about 24 hours (e.g., 20 minutes). In some embodiments, the population of cells are suspended in the pre-heated medium that has a volume of about 1 ml to about 30,000 liter (e.g., 50 ml). In some embodiments, the population of cells are suspended in the pre-heated medium, and the population of cells have a concentration of about 1 × 105to about 1 × 1010cells / ml (e.g., about 2 × 107to about 4 × 107cells / ml). In some embodiments, the heat shock is not introduced by ultrasound.

[0020] In some embodiments, the population of cells are recovered at about 37°C after the heat shock. In some embodiments, the population of cells are recovered for about 1-24 hours (e.g., about 2 hours).

[0021] In some embodiments, the heat-responsive promoter comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of heat shock elements, in some embodiments, each heat shock element comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 8. In some embodiments, the heat-responsive promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 2.

[0022] In some embodiments, the heat-responsive promoter further comprises one or more feedback loop elements that are designed to sustain expression of the protein of interest. In some embodiments, the one or more feedback loop elements comprise a CRE (cAMP Response Element), a SRE (Serum Response Element), a NFAT-RE (Nuclear factor of activated T cell Response Element), a NFKB-RE (nuclear factor kappa B Response Element), and / or a YBTATA-mini-promoter. In some embodiments, the one or more feedback loop elements comprise, optionally from 5’ end to 3’ end: (1) a CRE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 3; (2) a SRE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 4; (3) a NFAT-RE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 5; (4) a NFKB-RE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 6; and / or (5) a YBTATA-mini-promoter comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 7. In some embodiments, the heat-responsive promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 1.

[0023] In some embodiments, the protein of interest is an engineered receptor, e.g., a chimeric antigen receptor (CAR), an engineered T cell receptor (TCR), a T cell antigen coupler (TAC) or a portion thereof. In some embodiments, the engineered receptor specifically targets a tumor antigen. In some embodiments, the tumor antigen is selected from the group consisting of BCMA, CLL1, CD4, GPC3, GPRC5D, GU2CYC, 0)19, MUC16, MUC1, CALX, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, ERBB2, ERBB3, ERBB4, EBP, fetal acetylcholine receptor, folate receptor-a, GD2, GD3, HER-2, hTERT, IL-13R-a2, K-light chain, KDR, LeY, LI cell adhesion molecule, MAGE-A1, mesothelin, MAGEA3, p53, MARTI, GP100, proteinase-3 (PR3), tyrosinase, survivin, hTERT, EphA2, NY-ESO-1, h5T4, PSCA, PSMA, R0R1, TAG-72, VEGF-R2, WT-1, CD 123, CD44V6, NKCS1, IGF1R, EGFR, EGFR- VIII, Claudin 18.2, Claudin 6, NKG2D, Delta-like 3 (DLL3), CD70, CS-1, c-Met, Glycolipid F77, MSLN, PD-L1, and PD-L2. In some embodiments, the engineered receptor is a CAR that specifically targets a tumor antigen (e.g., PSMA, GD2, EGFR, MSLN, or PD-L1) In some embodiments, the CAR comprises, optionally from N-terminus to C-terminus: (1) an optional CD8 signal peptide; (2) an optional c-Myc tag; (3) an antigen-binding region that specifically binds to the tumor antigen; (4) a CD28 extracellular domain; (5) a CD28 transmembrane domain; (6) a CD28 co-stimulatory domain; and (7) a CD3z intracellular signaling domain. In some embodiments, the optional CD8 signal peptide comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 10; the optional c-Myc tag comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 11; the CD28 extracellular domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 13; the CD28 transmembrane domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 14; the CD28 co-stimulatory domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 15; and / or the CD3z intracellular signaling domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 16. In some embodiments, (1) the engineered receptor is a CAR comprising an antigen-binding region that specifically binds to PSMA, in some embodiments, the CAR comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 18; (2) the engineered receptor is a CAR comprising an antigen- binding region that specifically binds to GD2, in some embodiments, the CAR comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 9; (3) the engineered receptor is a CAR comprising an antigen-binding region that specifically binds to MSLN, in some embodiments, the antigen-binding region comprises or consists of an ammo acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 19; or (4) the engineered receptor is a CAR comprising an antigenbinding region that specifically binds to PD-L1, in some embodiments, the antigen-binding region comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 24.

[0024] In some embodiments, the rate of cells expressing the protein of interest and / or the expression level of the protein of interest (e.g., a CAR) are increased by at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold as compared to those when step (c) occurs prior to step (b). In some embodiments, the protein of interest is a CAR, and the population of cells are T cells. In some embodiments, the method further comprises thawing and / or recovering the population of activated cells after step (c). In some embodiments, the population of activated cells are recovered at about 37°C after being thawed for about 1-24 hours (e.g., about 2 hours).

[0025] In one aspect, the disclosure is related to a population of activated cells prepared using the method described herein.

[0026] In one aspect, the disclosure is related to an engineered cell comprising a nucleic acid comprising a heat-responsive promoter and a sequence encoding the protein of interest, in some embodiments, the sequence encoding the protein of interest is operably linked to the heat- responsive promoter, optionally the heat-responsive promoter further comprises one or more feedback loop elements. In some embodiments, the heat-responsive promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 1 or 2. In some embodiments, the engineered cell lacks a functional endogenous T cell receptor (TCR)

[0027] In one aspect, the disclosure is related to a chimeric antigen receptor (CAR) comprising a PSMA (prostate- specific membrane antigen)-binding domain, in some embodiments, the PSMA-binding domain comprises a single chain variable fragment (scFv), comprising a heavy chain variable region (VH) and a light chain variable region (VL), in some embodiments, the VH of the scFv comprises a CDR1 set forth in SEQ ID NO: 34 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 35 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 36 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3, and the VL of the scFv comprises a CDR1 set forth in SEQ ID NO: 37 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 38 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 39 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3. In some embodiments, the VH of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 40, and the VL of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 41, In some embodiments, the scFv comprises from N-terminus to C-terminus: the VH, a linker peptide, and the VL; or the scFv comprises from N-terminus to C-terminus: the VL, a linker peptide, and the VH; optionally, in some embodiments, the linker peptide is a flexible linker that comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of SEQ ID NO: 26. In some embodiments, the PSMA-binding domain comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17. In some embodiments, the CAR comprises, from N-terminus to C-terminus: an optional signal peptide, the PSMA-binding domain, an optional hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the CAR comprises, from N-terminus to C-terminus: an optional CD8 signal peptide, an optional c-Myc tag, the MSLN-binding domain, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3z intracellular signaling domain. In some embodiments, the CAR comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18.

[0028] In one aspect, the disclosure is related to a chimeric antigen receptor (CAR) comprising a MSLN (mesothelin)-binding domain, in some embodiments, the MSLN-binding domain comprises a single chain variable fragment (scFv), comprising a heavy chain variable region ( VH) and a light chain variable region (VL), in some embodiments, the VH of the scFv comprises a CDR1 set forth in SEQ ID NO: 27 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 28 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 29 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3, and the VL of the scFv comprises a CDR1 set forth in SEQ ID NO: 30 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 31 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 32 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3, In some embodiments, the VH of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 21, and the VL of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 22. In some embodiments, the scFv comprises from N-terminus to C-terminus: the VH, a linker peptide, and the VL; or the scFv comprises from N-terminus to C-terminus: the VL, a linker peptide, and the VH; optionally, in some embodiments, the linker peptide is a flexible linker that comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of SEQ ID NO: 26. In some embodiments, the MSLN-binding domain comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 20. In some embodiments, the CAR comprises, from N-terminus to C-terminus: an optional signal peptide, the MSLN-binding domain, an optional hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the CAR comprises, from N-terminus to C -terminus: an optional CD8 signal peptide, an optional c-Myc tag, the MSLN-binding domain, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3z intracellular signaling domain. In some embodiments, the CAR comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19.

[0029] In one aspect, the disclosure is related to a chimeric antigen receptor (CAR) comprising a PD-L1 (programmed death-ligand l)-binding domain, in some embodiments, the PD-Ll-binding domain comprises or is derived from all or part of the extracellular region of PD-1 (programmed cell death protein 1), e.g., human PD-1. In some embodiments, the PD-Ll-binding domain comprises a sequence that corresponds to positions 21-147 of a wild-type human PD-1 protein (SEQ ID NO: 33). In some embodiments, the PD-Ll-binding domain comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity' to the amino acid sequence set forth in SEQ ID NO: 25. In some embodiments, the CAR comprises, from N-terminus to C-terminus: an optional signal peptide, the MSLN-binding domain, an optional hinge domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the CAR comprises, from N-terminus to C-terminus: an optional CD8 signal peptide, an optional c-Myc tag, the PD-Ll-binding domain, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3z intracellular signaling domain. In some embodiments, the CAR comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity' to the amino acid sequence set forth in SEQ ID NO: 24.

[0030] In one aspect, the disclosure is related to an engineered cell expressing the CAR described herein.

[0031] In one aspect, the disclosure is related to a method of treating a disease or disorder in a subject, the method comprising administering to the subject, an effective amount of the population of activated cells described herein, and / or the engineered cell described herein. In some embodiments, the disease or disorder is cancer, autoimmune disease, or infection. In some embodiments, the cancer is a solid tumor, e.g., prostate cancer, cervical cancer, ovarian cancer, or glioblastoma. In some embodiments, the cells are CAR-T cells and the subject is a human subject.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0033] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

[0034] DESCRIPTION OF DRAWINGS FIG. 1 A is a plasmid schematic that illustrates key components of a heat-inducible CAR construct, in which a constitutively expressed tCD19 is used as a marker to track the expression and biodistribution of CAR-T cells.

[0035] FIG. 1B shows a schematic representation of the heat-inducible CAR-T cell activation mechanism. At 37°C, the CAR gene remains inactive, with minimal expression due to the inactivity of the heat-responsive promoter. Upon heat shock at 42-43 °C, the 7HH promoter is activated (step 1), leading to the transcription and expression of the CAR protein (step 2). The feedback mechanism (FB) sustains the CAR expression, enhancing the overall signaling pathway (step 3). The expressed CAR on the T cell surface enables the recognition and binding of tumor cells, resulting in targeted tumor cell destruction. “HSF” stands for heat shock factor. PSMA-CAR (SEQ ID NO: 18) is used as an example of CAR.

[0036] FIG. 2A shows flow cytometry analysis results of T cell viability subjected to HS treatment at 43°C for varying durations. T cells treated using the conventional small-scale HS method m PCR tubes with 50 uL of media were used as a control.

[0037] FIG. 2B shows quantification of cell viability after different HS stimulations (n=3). FIG. 2C shows CAR expression under the large-scale FIS method with varying durations, indicating a time- dependent increase in CAR expression, exceeding 50% after 30 minutes of FIS treatment.

[0038] FIG. 2D shows quantification of the CAR-positive rate under the large-scale FIS method with varying durations (n=3, One-way ANOVA).

[0039] FIG. 3A shows two storage strategies: T cells were either subjected to FIS before freezing or after thawing.

[0040] FIG. 3B shows the PSMA-CAR expression rate under different storage conditions. The data demonstrate that cells subjected to HS before freezing show significantly higher PSMA-CAR expression rates compared to those in which HS was performed after thawing.

[0041] FIG. 3C shows the CAR expression level, represented by mean fluorescence intensity (MFI) of CAR. The data demonstrate that cells subjected to HS before freezing show significantly higher PSMA-CAR expression levels compared to those in which HS was performed after thawing.

[0042] FIG. 3D shows the CAR expression rate measured at various time points after HS induction. The results show a significant increase in CAR expression within 1-hour post-HS, with expression reaching a plateau at approximately 2 hours. (n=3 in each test; One-way ANOVA was used for statistical analysis).

[0043] FIGS. 4A-4B show cytotoxicity of heat-inducible PSMA-CAR T cells, T cell killing efficiency was assessed by measuring the Flue signal of the tumor cells after co-culture with PSMA-CAR-transduced T cells (circles) and WTT cells (triangles) at varying effector-to-target (E: T) ratios, with T cells derived from two different donors (FIG. 4Aand FIG. 4B, respectively). Data are presented as mean ± SD, and two-way ANOVA was used for statistical analysis, FIGS 5A-5F show cytotoxic efficacy of heat- inducible CAR-T cells targeting various tumor types. The figures display the cytotoxic activity of different CAR-T cells, including MSLNC / XR, GD2CAR, and high-affimty PDI CAR, against corresponding target tumor cells (MSL -positive HeLa, GD2-positive U87-MG, and PDL1 -positive tumor cells) compared to non-engineered wild-type (WT) T cells. Tumor cells were engineered to express a Flue signal, allowing for the quantification of T cell-mediated killing efficiency at varying effector-to-target (E: T) ratios. FIG. 5Aand FIG. 5B show the killing efficiency of MSLNCAR-T cells and GD2C / XR-T cells against HeLa and U87-MG cells, respectively. FIGS. 5C-5F represent the cytotoxicity of high-affinity PD1 CAR-T cells against multiple tumor cell lines including PC3 (prostate cancer), HeLa (cervical cancer), SK-OV-3 (ovarian cancer), and U87-MG (glioblastoma).

[0044] FIG. 6A is an overview of the experimental design.

[0045] FIG. 6B shows a schematic representation of the mechanism. Heat-activated PSMACAR-T cells (left) specifically target PSMA-expressing PC3 prostate cancer cells (right).

[0046] FIG. 6C shows tumor growth curves. The x-axis represents time (Days), and the y-axis represents fluorescence intensity as a proxy for tumor volume. Solid circles represent the average tumor volume in the treatment group, while hollow circles represent the average tumor volume in the untreated control group. Asterisks denote statistically significant differences between the treatment and control groups.

[0047] FIG. 7 A is an overview of the experimental design for the bilateral tumor model. PSMA-expressing PC3 cells were injected subcutaneously into the lateral thighs of immunodeficient NSGmice to establish bilateral prostate tumors. After 13 days, heat-activated PSMACAR-T cells were administered subcutaneously near the proximal (right) tumor in the treatment group.

[0048] FIG. 7B shows tumor growth curves. The x-axis represents time (Days), and the y-axis represents fluorescence intensity indicating tumor volume.

[0049] FIG. 8 shows H& E-stained tissue sections of major organs from control, treatment, and bilateral tumor group mice. No significant tissue abnormalities were observed in any group, indicating that PSMACAR-T cells do not cause significant toxicity to normal tissues.

[0050] FIG. 9A is an overview' of the experimental design for the bilateral tumor model, simulating normal prostate tissue with low PSMA expression.

[0051] FIG. 9B shows tumor growth curves following two injections of 0.5 M PSMACAR-T cells. The x-axis represents time (Days), and the y-axis represents fluorescence intensity, indicating tumor volume.

[0052] FIG. 10A lists VII and VL CDR sequences of anti-MSLN scFv according to Kabat definition.

[0053] FIG. 10B lists VII and VL CDR sequences of anti-PSMA scFv according to Kabat definition. FIG. 11 lists sequences discussed in the disclosure.

[0054] DETAILED DESCRIPTION

[0055] The disclosure introduces a novel method for activating heat-inducible cells (e.g., CAR-T cells) using heat shock alone and simplifying the therapeutic process. This method also includes optimized conditions for large-scale production and storage of these heat shock-activated cells (e.g., CAR-T cells), ensuring their stability and effectiveness. The safety and effectiveness have been tested in vitro and m mouse model. Specifically, prostate-specific membrane antigen (PSMA)-expressing PC3 prostate cancer cell lines were injected into NSG mice to form xenografts, followed by the injection of heat-activated PSM AC / XR-T cells. Results showed significant tumor growth inhibition in the treatment group compared to the control group, whether in unilateral or bilateral prostate xenograft models, demonstrating its efficacy in treating solid prostate tumors. Moreover, dose studies revealed that even at lower doses, the PSMACAR-T cells effectively inhibited tumor growth, indicating strong inhibitory efficiency. In safety studies, the PSMACAR-T cells did not show significant toxicity to normal tissues and organs. In a bilateral tumor model simulating normal prostate tissue, the PSMACAR-T cells also showed specific inhibition of high PSMA-expressing tumor tissues, demonstrating potential safety and efficacy in prostate cancer therapy. Furthermore, the invention demonstrates that this approach is applicable across various CAR constructs targeting different tumors, including Mesothelin (MSLN), Epidermal Growth Factor Receptor (EGFR), and high-affinity Programmed Death- 1 (PD1) CARs, thereby broadening its potential use in cancer immunotherapy.

[0056] Heat-inducible Cell Therapy

[0057] Heat-inducible cell therapies (e.g., CAR-T cells) are a type of cell therapies including cells that have been engineered to be responsive to heat. Unlike traditional cells used as cell therapies with continuous expression and causing toxicity, these cells can be heat-activated, and the cell therapy molecules (e.g., CAR molecules) gradually degrade after tumor cell killing, providing enhanced safety. These cells can also be designed with a feedback system that sustains the expression of the cell therapy molecules (e.g,, CAR molecules) on their surface after activation, addressing the common issue of on target / off tumor toxicity, exhaustion, and lack of persistence in traditional cell therapies.

[0058] Details of heat-inducible cell therapies can be found, e.g., in Wu, Y., et al. "Control of the activity of CAR-T cells within tumours via focused ultrasound." Nature Biomedical Engineering 5.11 (2021): 1336-1347; and Tang, M, etal. "Heat-inducible CAR-T overcomes adverse mechanical tumor microenvironment in a 3D bioprinted glioblastoma model." Materials Today Bio 26 (2024): 101077; each of which is incorporated herein by reference m its entirety.

[0059] As shown in FIG. 1, provided herein is a nucleic acid comprising a heat-responsive promoter (“7HH”), one or more feedback loop elements (“FB”), and a sequence encoding a CAR. The nucleic acid may further include a reporter gene promoter (e.g., a PGK promoter, or “PGK”) and a reporter gene (e.g., truncated CD 19, or “tCD19”), to track CAR expression and / or biodistribution of CAR-T cells. In some embodiments, nucleic acid is a vector. In some embodiments, the nucleic acid in integrated to the genome of the CAR-T cells.

[0060] FIG. 1B shows a schematic representation of heat-inducible CAR-T cell activation mechanism. At 37°C, the CAR gene remains inactive, with minimal expression due to the inactivity of the heat-responsive promoter. The heat shock factor (HSF) is located within the cytoplasm. Upon heat shock at 41-46°C using any of the methods described herein, the HSF migrates from the cytoplasm to the nucleus, e.g., due to heat-induced conformational change and forms a trimer. The HSF can bind to the 7HH promoter as a transcription factor, thereby activating the 7HH promoter (step 1). Activation of the 7HH promoter then leads to the transcription and expression of the CAR protein (step 2). The CAR expression will mediate the activation of T cells and the targeted destruction of antigen-positive tumor cells. This process is further potentiated by a feedback loop (FB) designed to sustain CAR expression, which can sense T cell and tumor cell engagement, thereby prolonging the antitumor response (Step 3) In some embodiments, the heat-responsive promoter described herein includes one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of heat shock elements. In some embodiments, the heat shock element comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 8. In some embodiments, the heat-responsive promoter includes 7 repeats of the heat shock elements. In some embodiments, the one or more repeats of the heat shock elements in the heat- responsive promoter are identical. In some embodiments, the one or more repeats of the heat shock elements are linked via linkers. In some embodiments, the heat-responsive promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 2.

[0061] In some embodiments, the heat-responsive promoter further includes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) feedback loop elements. In some embodiments, the feedback loop elements can enhance the overall signaling pathways (e.g., calcium signaling, ZAP70 kinase pathway, mitogen-activated protein kinases (MAPKs) and extracellular signal-regulated kinases (ERKs) pathway, nuclear factor of activated T-cells signaling (NEAT), nuclear factor kappa B signaling, and / or cyclic AMI’ (cAMP) pathway), thereby sustaining expression of the CAR protein. In some embodiments, the one or more feedback loop elements include a CRE, a SRE, a NFAT-RE, a NFKB-RE, and / or a YBTATA-mmi-promoter. In some embodiments, the one or more feedback loop elements are linked via a linker. In some embodiments, the one or more feedback loop elements are directly linked. In some embodiments, the one or more feedback loop elements includes, optionally from 5’ end to 3’ end: a CRE, a SRE, a NFAT-RE, a NFKB-RE, and / or a YBTATA-mini-promoter. In some embodiments, the CRE comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 3. In some embodiments, the SRE comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 4, In some embodiments, the NFAT-RE comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 5, In some embodiments, the FKB-RE comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 6. In some embodiments, the YBTATA-mini-promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 7.

[0062] In some embodiments, the one or more feedback loop elements can be linked in tandem. For example, the FB elements may have the following orders: a CRE, a SRE, a NFAT-RE, a NFKB-RE, and / or a YBTATA-mini-promoter. Without wishing to be bound by theory, it is contemplated that any order of the one or more (e.g., 2, 3, 4, or 5) feedback loop elements described herein can be used to achieve a similar result. In some embodiments, the heat-responsive promoter described herein includes one or more repeats of heat shock elements (e.g., any of the heat shock elements described herein) and one or more feedback loop elements (e.g.., any of the feedback loop elements described herein). In some embodiments, the heat-responsive promoter described herein comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 1.

[0063] In some embodiments, the sequence encoding the protein of interest (e.g., any of the proteins of interest described herein) is operably linked to the heat-responsive promoter (e.g., any of the heat-responsive promoters described herein).

[0064] In some embodiments, the sequence encoding the protein of interest (e.g., any of the proteins of interest described herein) is not expressed in the absence of inducement (e.g., heat).

[0065] In various embodiments, an immune cell is provided which expresses chimeric antigen receptor (CAR) or includes a vector comprising an expression cassette encoding the CAR driven by a multi-responsive or highly heat-sensitive promoter. For example, the CAR contains an antigen-specific targeting region that targets GD2, PSMA, MSLN, EGFR, PD-L1, or another antigen associated with a disease, a cancer, or an immune cell malignancy.

[0066] In some embodiments, a multi-responsive promoter is a thermo-sensitive promoter, which includes a heat shock element (HSE, for binding by a heat-shock protein), thereby also called a heat-sensitive promoter or a heat shock protein promoter. In various aspects, a heatsensitive promoter is a mammalian or human promoter activated by increased temperature, e.g., temperature increased to between about 40°C and 48 °C, or to between about 42°C and 45°C, or to about 43°C. HSEs comprise multiple inverted repeats of the consensus sequence 5’-nGAAn-3’ and are arrayed upstream of the transcription start site of heat-shock proteins (HSPs) to allow their upregulation following thermal stress. Heat shock factors (HSF) are transcriptional activators of heat shock genes. HSF are also referred to as transcription factors, which bind specifically to Heat Shock sequence Elements (HSE). Without wishing to be bound by a particular theory, the heat shock response is mediated at the transcriptional level by cis-acting sequences called heat shock elements (HSE) that are present in multiple copies upstream of the heat shock protein (HSP) genes, wherein the heat shock factor (HSF) can bind to the HSE and induce HSP gene expression. Preferably the heat shock element has a nucleotide sequence being a variant to naturally occurring, human heat shock protein 70B (Hsp) promoter, and with increased heat inducibility and reduced ‘leakage’ (e.g., reduced expression of linked gene in a non-heated condition). In various embodiments, the heat shock element has a nucleotide sequence having 1-20 repeats of AGAATGTTCTGGACT (SEQ ID NO: 8). In some embodiments, the heat shock element has a nucleotide sequence having 5-10 repeats of AGAATGTTCTGGACT (SEQ ID NO: 8). In some embodiments, the heat shock element has a nucleotide sequence having 7 repeats of AGAATGTTCTGGACT (SEQ ID NO: 8). In a preferred embodiment, the heat shock element has a nucleotide sequence comprising, or consisting of, SEQ ID NO: 2. In some embodiments, the heat shock element comprises a nucleotide sequence having at least 80% sequence identity to SEQ ID NO: 2. In some embodiments, the heat shock element comprises a nucleotide sequence having at least 85% sequence identity to SEQ ID NO: 2. In some embodiments, the heat shock element comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2. In some embodiments, the heat shock element comprises a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 2. In various embodiments, promoters comprising a heat shock element comprising one or more repeats of AGAATGTTCTGGACT (SEQ ID NO: 8) is more heat inducible than otherwise identical promoters except for having a same number of repeats of a parent heat shock element of HSP 70.1. In various embodiments, promoters comprising a heat shock element comprising one or more repeats of AGAATGTTCTGGACT (SEQ ID NO: 8) is more heat inducible than otherwise identical promoters except for having a same number of repeats of a rationally designed (RD) heat shock element.

[0067] In some embodiments, a multi-responsive promoter further comprises one or more of: a cyclic adenosine monophosphate (cAMP) response element (CRE), a serum response element (SRE), a nuclear factor of activated T-cells signaling (NEAT) response element (NEAT-RE), and a nuclear factor-KB (NF-KB) responsive element (or a NF-KB response element). In various embodiments, response elements are upstream of a gene of interest to be expressed, or m an expression cassette, the response elements are within a promoter or linked to a minimal promoter sequence, and upstream of a heterologous polynucleotide.

[0068] In some embodiments, a) a heat shock element, b) a CRE, c) a SRE, d) a NF / XT- RE, and e) a NF-KB responsive element are each independently optionally absent or present and are in any order of choice. In some embodiments, a promoter contains all five of a)-e), wherein b)-e) are in a user-selected orientation. In some embodiments, a promoter contains a) and b), c), and d), but not e). In some embodiments, a promoter contains a) and b), c), and e), but not d). In some embodiments, a promoter contains a) and b), d), and e), but not c). In some embodiments, a promoter contains a) and c), d), and e), but not b). In some embodiments, a promoter contains a) and b) and c), but not d) or e). In some embodiments, a promoter contains a) and b) and d), but not c) or e). In some embodiments, a promoter contains a) and c) and d), but not b) or e). In some embodiments, a promoter contains a) and b) and e), but not c) or d). In some embodiments, a promoter contains a) and c) and e), but not b) or d). In some embodiments, a promoter contains a) and d) and e), but not b) or c). In some embodiments, a promoter contains a) and b), but not c), d), or e). In some embodiments, a promoter contains a) and c), but not b), d), or e). In some embodiments, a promoter contains a) and d), but not b), c), or e). In some embodiments, a promoter contains a) and e), but not b), c), or d).

[0069] In some embodiments, a promoter comprises elements selected from a)-e) as described above linked by a spacer sequence between any two elements, wherein the spacer sequence is between 1-200 nucleotides long. In some embodiments, elements selected from a)-e) as described above are independently duplicated, triplicated, or in multiple repeats in a promoter.

[0070] In some embodiments, a promoter has a)-e) in a configuration from 5’ to 3’: a)- b)-c)-d)-e). In some embodiments, a promoter has any one or more of b)-e) in any order. In some embodiments, a promoter has a) being upstream relative to one or more of b)-e). In some embodiments, a promoter has any one or more of a)-e) being upstream relative to a minimal promoter sequence. In various embodiments, the activation of CRE / SRE / TRFAT-RE / NFKB-RE is controlled by CAR T cell engagement with tumor cells, and HSE serves as an “on” switch; that is, in a promoter linked to a CAR coding nucleotide, only after HSE is activated can CAR expression be induced.

[0071] Without wishing to be bound by a particular theory, cAMP response element (CRE) mayfunction by a mechanism wherein a rise in intracellular cAMP level activates protein kinase A (PKA), phosphorylating a CRE-binding protein (CREB), which then binds to a CRE in the promoter of a target gene, so as to increase transcription of the target gene. Hence, CRE is a DNA-bmding sequence for CREB, and CRE typically contains a highly conserved nucleotide sequence, 5’-TGACGTCA-3’. An exemplary CRE has a nucleotide sequence as shown in SEQ ID NO: 3. In other embodiments, a CRE comprises a nucleotide sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 3. Further exemplary CRE sequences contain one or two or three or more repeats of 5’-TGACGTCA-3’. In some embodiments, a CRE contains 2 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1- 20 nucleotide long. In some embodiments, a CRE contains 3 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a CRE contains 4 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1 -20 nucleotide long. In some embodiments, a CRE contains 4 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a CRE contains 5 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a CRE contains 6 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1 -20 nucleotide long. In some embodiments, a CRE contains 7 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a CRE contains 8 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a CRE contains 9 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a CRE contains 10 or more repeats of TGACGTCA, optionally linked by a spacer sequence between any two adjacent repeats of TGACGTCA, wherein a spacer sequence is 1-20 nucleotide long.

[0072] Without wishing to be bound by a particular theory, a mechanism by which serum response element (SRE) may function is via protein kinase C (PKC)-dependent MAP kinase activation, and another mechanism is via Ras-dependent MAP kinase activation. In various implementations, SRE is a DNA-binding sequence for serum response factor. SRE was originally discovered as a short sequence of dyad symmetry located 300 bp to the 5' of the site of transcription initiation of some genes (such as FOS); and SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGFIACATCTGC (SEQ ID NO: 42), of which CCATATTAGG (SEQ ID NO: 43) is the CArG box, TTAGGACAT is the C / EBP box, and CATCTG is the E box. An exemplary SRE has a nucleotide sequence as shown in SEQ ID NO: 4. In other embodiments, an SRE comprises a nucleotide sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 4. Further exemplary SRE sequences contain one or two or three or more repeats of CCATATTAGG (SEQ ID NO: 43). In some embodiments, a SRE contains 2 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 3 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 4 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 5 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 6 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 7 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 8 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 9 or more repeats of SEQ ID NO: 43, optionally linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. In some embodiments, a SRE contains 10 or more repeats of SEQ ID NO: 43, optionally-linked by a spacer sequence between any two adjacent repeats, wherein a spacer sequence is 1-20 nucleotide long. Without wishing to be bound by a particular theory, nuclear factor of activated T-cells signaling (NF AT) response element (NFAT-RE) may function by a mechanism wherein intracellular calcium influx / increase dephosphorylates cytoplasmic NFAT, leading to the activation of NF / XT-RE, thereby stimulating gene expression. In various implementations, NFAT-RE is a DN / X-binding sequence for the NFAT family of transcription factors. An exemplary NFAT-RE has a nucleotide sequence as shown in SEQ ID NO: 5. In other embodiments, an NFAT-RE comprises a nucleotide sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 5. Further examples of NFAT-RE sequences are described in U. S. Patent No. 11,692,194, which is incorporated by reference in its entirety.

[0073] In some embodiment, a polynucleotide disclosed herein includes an inducible promoter comprising a nuclear factor- K B (NF-kB) response element. NF- K B exerts its role as transcription factor by binding to variations of the consensus DNA sequence of 5’-GGGRNYYYCC-3’ (SEQ ID NO: 44; in which R is a purine, Y is a pyrimidine, and N is any nucleotide) known as K B sites. In some embodiments wherein NF-kB response element is included, the promoter includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 copies of the consensus DNA sequence of SEQ ID NO: 44. An exemplary NFKB responsive element (NFKB-RE) has a nucleotide sequence as shown in SEQ ID NO: 6. In other embodiments, NFKB-RE has a nucleotide sequence having at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 6. Additional NFkB responsive promoters are described in Badr et al., Mol Imaging. 2009 Sep-Oct; 8(5): 278-290, which is incorporated by reference.

[0074] Exemplary minimal promoters, suitable for operably linking with HSE and other response elements disclosed herein, include HSPB1 core promoter, HSPA1 A core promoter, HSPH1 core promoter, HSPA6 core promoter, and synthetic core promoter (e.g., YB TATA, mini CMV. mini TK), and human IL-2 minimal promoter. In some embodiments, a heat sensitive promoter comprises 7H-YB. 7H-YB promoter comprises 7 repeats of a heat-shock element (HSE) operably linked to and upstream of YB-TATA promoter.

[0075] In some embodiments, a YB-TATA promoter has a sequence of:

[0076] GCGATTAATCCATATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACC AGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 45) In some embodiments, a YB-TATA promoter is used in its shorter version TCTAGAGG ITATATAATGGGGGCCA (SEQ ID NO: 46). Accordingly, wherever YB-TATA is referred to as a component of an inducible promoter herein, an equivalent sequence with s YB-TATA substituted in place of YB-TATA is also considered to be an alternative embodiment of the invention. Further description of YB-TAIA promoter or similar mini promoters are provided in US Patent Application Publication No. US20230167458, which is hereby incorporated by reference in its entirety.

[0077] Further embodiments provides that an expression cassette comprises a multi-responsive promoter operably linked to a heterologous polynucleotide, wherein the heterologous polynucleotide encodes a CAR comprising an antigen-specific targeting region (e.g., an scFv or VHH), a transmembrane domain, and a CD3zeta signaling domain. In some embodiments, the CAR comprises the antigen-specific targeting region, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 costimulatory domain, and the CD3zeta signaling domain. In some aspects, the CARs comprise linker residues between the various domains. In some aspects, the linker is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more amino acids long. In some embodiments, the expression cassette comprises a multi-responsive promoter disclosed herein operably linked to a polynucleotide encoding a CAR that does not contain a 4-1BB costimulatory domain. In various aspects, the extracellular binding domain comprises an antibody or antigen binding fragment thereof. In one preferred embodiment, the extracellular binding domain is an scFv. In another preferred embodiment, the extracellular binding domain is a camel id antibody. In some embodiments, the CAR comprises an extracellular domain that binds a tumor antigen.

[0078] Methods of Activating Cells by Heat Shock

[0079] In one aspect, the disclosure is related to methods of activating a population of cells that express a protein of interest (e.g., CAR), comprising: a) providing a population of cells comprising a nucleic acid comprising a heat-responsive promoter, and a sequence encoding the protein of interest; and b) introducing a heat shock to the population of cells, thereby activating the population of cells. The methods can be easily adopted for large-scale production of cells (e.g., C / XR-T cells) without compromising their therapeutic effectiveness. In some embodiments, the heat shock is introduced by contacting the population of cells with a pre-heated medium. For instance, a medium suitable for proliferation of the cells can be pre-heated in a water bath that has been set to a pre-determined temperature. Time for preheating the medium can be determined by the volume of the medium and the stability of supplements in the medium at the pre-determined temperature. In some embodiments, the preheated medium is supplemented with a cytokine, e.g., IL-2. In some embodiments, the concentration of the cytokine is about 10-1000 lU / ml, e.g., 100 lU / ml. In some embodiments, the temperature of the pre-heated medium before the heat shock is about 41-46°C (e.g., about 43°C). Upon harvesting, the cells can be resuspended in the pre-heated medium in a container (e.g., a centrifuge tube), thereby introducing the heat shock.

[0080] As described herein, the temperature of the pre-heated medium is maintained at about 41-46°C (e.g., 43°C) during the heat shock. To maintain the temperature of the pre-heated medium during the heat shock, the container can be placed in a water bath that has been set to the temperature. In some embodiments, the actual temperature of the pre-heated medium may fluctuate during the heat shock. For instance, the fluctuation is within ± 1°C, 0.9°C, 0.8°C, 0.7°C, 0.6°C, 0.5°C, 0.4°C, 0.3cC, 0.2°C, or 0.1°C of the pre- determined temperature. In some embodiments, the temperature of the pre-heated medium during the heat shock may be consistently maintained. The container may be agitated to allow for adequate heat exchange with the water bath. In some embodiments, the temperature of the pre-heated medium is at least about 41°C, about 41.5°C, about 42°C, about 42, 5°C, about 43°C, about 43.5°C, about 44°C, about 44,5°C, about 45°C, about 45.5°C, or about 46°C. In some embodiments, the temperature of the pre-heated medium is about 41-46°C, about 41 -45.5°C, about 41-45°C, about 41 -44.5°C, about 41-44°C, about 41-43.5°C, about 41-43°C, about 41-42.5°C, about 41-42°C, about 41-41.5°C, about 41,5-46°C, about 41.5-45.5°C, about 41.5-45°C, about 41.5-44.5°C, about 41.5-44°C, about 41,5-43.5°C, about 41.5-43°C, about 41.5-42.5°C, about 41.5-42°C, about 42-46°C, about 42-45.5°C, about 42-45°C, about 42-44.5°C, about 42-44°C, about 42-43.5°C, about 42-43°C, about 42-42.5°C, about 42.5-46°C, about 42.5-45.5°C, about 42.5-45°C, about 42.5-44.5°C, about 42.5-44°C, about 42.5-43.5°C, about 42.5-43°C, about 43-46°C, about 43-45.5°C, about 43-45°C, about 43-44.5°C, about 43-44°C, about 43-43.5°C, about 43.5-46°C, about 43.5-45.5°C, about 43.5-45°C, about 43.5-44.5°C, about 43.5-44°C, about 44-46°C, about 44-45.5°C, about 44-45°C, about 44-44.5°C, about 44.5-46°C, about 44.5-45.5°C, about 44.5-45°C, about 45-46°C, about 45-45.5°C, or about 45.5-46°C.

[0081] In some embodiments, the population of cells are contacted with the pre-heated medium for about 5 minutes to bout 2 hours. As can be determined by a skilled person in the art, time for heat shock can be determined by many factors, e.g., the volume of the pre-heated medium, the stability of supplements in the medium, the sensitivity of cells to heat shock, and the concentration of the population of cells. As shown in Example 2, when the volume of the preheated volume was 50 ml and the concentration of the cells is about 2-4 million / niL, it takes about 20-40 minutes at about 43°C to reach the maximum CAR expression level without compromising the cell viability.

[0082] In some embodiments, the population of cells are contacted with the pre-heated medium for at least about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, about 60 minutes, about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 18 hours, or about 24 hours. In some embodiments, the foregoing heat shock time is about 5 minutes to about 10 minutes, about 10 minutes to about 15 minutes, about 15 minutes to about 20 minutes, about 20 minutes to about 25 minutes, about 25 minutes to about 30 minutes, about 30 minutes to about 35 minutes, about 35 minutes to about 40 minutes, about 40 minutes to about 45 minutes, about 45 minutes to about 50 minutes, about 50 minutes to about 55 minutes, about 55 minutes to about 1 hour, about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 5 hours, about 5 hours to about 6 hours, about 6 hours to about 7 hours, about 7 hours to about 8 hours, about 8 hours to about 9 hours, about 9 hours to about 10 hours, about 10 hours to about 11 hours, about 11 hours to about 12 hours, about 12 hours to about 18 hours, or about 18 hours to about 24 hours.

[0083] In some embodiments, the population of cells are suspended in the pre-heated medium that has a volume of at least about 1 ml, about 2 ml, about 5 ml, about 10 ml, about 20 ml, about 50 ml, about 100 ml, about 200 ml, about 500 ml, about 1 liter (L), about 2 L, about 5 L, about 10 L, about 20 L, about 50 L, about 100 L, about 200 L, about 500 L, about 1000 L, about 2000 L, about 5000 L, about 10000 L, about 20000 L, or about 50000 L. In some embodiments, the volume is about 1 ml to about 2 ml, about 2 ml to about 5 ml, about 5 ml to about 10 ml, about 10 ml to about 20 ml, about 20 ml to about 50 ml, about 50 ml to about 100 ml, about 100 ml to about 200 ml, about 200 ml to about 500 ml, about 500 ml to about 1 L, about 1 L to about 2 L, about 2 L to about 5 L, about 5 L to about 10 L, about 10 L to about 20 L, about 20 L to about 50 L, about 50 L to about 100 L, about 100 L to about 200 L, about 200 L to about 500 L, about 500 L to about 1000 L, about 1000 L to about 2000 L, about 2000 L to about 5000 L, about 5000 L to about 10000 L, about 10000 L to about 20000 L, or about 20000 L to about 50000 L. In some embodiments, the volume of the pre-heated medium is equivalent to or slightly less than the size of industrial fermenters, e.g., about 300 L to about 30000 L.

[0084] In some embodiments, the population of cells are suspended in the pre-heated medium, and the population of cells have a concentration of at least about 1 x 103cells / ml, about l x 106cells / ml, about l x 107cells / ml, about l x 108cells / ml, about 1 x 109cells / ml, or about 1x1010cells / ml. In some embodiments, the concentration is about 1 x 103cells / ml to about 1 x io10cells / ml, about 1 103cells / ml to about 1 x io9cells / ml, about 1 x IO5cells / ml to about 1 * 108cells / ml, about 1 105cells / ml to about 1 x 1 o7cells / ml, about 1 x 1 O' cells / ml to about 1 106cells / ml, about 1 106cells / ml to about 1 x 1O'° cells / ml, about 1 x 106cells / ml to about 1 x io9cells / ml, about 1 106cells / ml to about 1 x 1 o8cells / ml, about 1 x 10° cells / ml to about 1 x 1 o7cells / ml, about 1 107cells / ml to about 1 x 1O10cells / ml, about 1 x io7cells / ml to about 1 x io9cells / ml, about 1 107cells / ml to about i IO8cells / ml, about 1 x 108cells / ml to about 1 x 1O10cells / ml, about 1 IO8cells / ml to about 1 x io9cells / ml, or about 1 x io9cells / ml to about 1 x 10i0cells / ml. In some embodiments, the concentration is about 1 x io7to about 1 x 108cells / ml, about 1 x 107to about 9 x 10' cells / ml, about 1 x 107to about 8 x J O7cells / ml, about 1 x 107to about 7 x 10' cells / ml, about 1 x io7to about 6 x J O7cells / ml, about 1 x 107to about 5 x 107cells / ml, about 1 x J O7to about 4 x 107cells / ml, about 1 x 107to about 3 x 107cells / ml, about 1 x 107to about 2 x io7cells / ml, about 2 x 10' to about 1 x io8cells / ml, about 2 x io7to about 9 x 107cells / ml, about 2 x IO7to about 8 < 107cells / ml, about 2 x 107to about 7 x ] o7cells / ml, about 2 x io7to about 6 x JO7cells / ml, about 2 x io7to about 5 x io7cells / ml, about 2 x 107to about 4 x 107cells / ml, about 2 x io7to about 3 x io7cells / ml, about 3 < 107to about 1 x 108cells / ml, about 3 x 10zto about 9 < io7cells / ml, about 3 x io7to about 8 x ]07cells / ml, about 3 x IO7to about 7 x io7cells / ml, about 3 x io7to about 6 < 107cells / ml, about 3 x io7to about 5 x 107cells / ml, about 3 x io7to about 4 < 107cells / ml, about 4 x 107to about 1 x ] o8cells / ml, about 4 x 107to about 9 x io7cells / ml, about 4 x 107to about 8 x io7cells / ml, about 4 x 107to about 7 x io7cells / ml, about 4 x 107to about 6 x io7cells / ml, about 4 < 107to about 5 x io7cells / ml, about 5 x 10zto about 1x108cells / ml, about 5 x io7to about 9 x io7cells / ml, about 5 x 107to about 8 x io7cells / ml, about 5 < io7to about 7 x io7cells / ml, about 5 x 107to about 6 x 107cells / ml, about 6 x io7to about 1 x 108cells / ml, about 6 x 107to about 9 x io7cells / ml, about 6 x io7to about 8 x io7cells / ml, about 6 x 10' to about 7 < 107cells / ml, about 7 x io7to about 1 x 108cells / ml, about 7 x 107to about 9 x io7cells / ml, about 7 x io7to about 8 x io7cells / ml, about 8 x io7to about 1 x io8cells / ml, about 8 x 107to about 9 x 107cells / ml, or about 9 x io7to about 1 x io8cells / ml.

[0085] In some embodiments, the population of cells are recovered at about 37°C for about 1-24 hours (e.g., 2 hours). For example, the cells can be transferred to an incubator or a water bath that has been set at a pre-determined temperature, e.g., about 37°C. In some embodiments, the temperature of the medium gradually decreases during the recovery (e.g., from about 43°C to about 37CC), e.g., at about 1°C per hour, about 1.5°C per hour, about 2CC per hour, about 2.5CC per hour, about 3CC per hour, about 3.5CC per hour, about 4°C per hour, about 4.5°C per hour, about 5CC per hour, about 5.5°C per hour, about 6°C per hour, about 6.5°C per hour, about 7°C per hour, about 7.5°C per hour, about 8°C per hour, about 8.5°C per hour, about 9°C per hour, about 9.5°C per hour, or about 10°C per hour. As can be determined by a skilled person in the art, time for recovery can be determined by many factors, e.g., the volume of the pre-heated medium, the sensitivity of cells to temperature drop, and the concentration of the population of cells. As shown in Example 2, when the volume of the pre-heated volume 'as 50 ml and the concentration of the cells is about 20-40 million, it takes about 2 hours at about 37°C for the cells to recover from the heat shock.

[0086] In some embodiments, the recovery time is at least about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 18 hours, or about 24 hours. In some embodiments, the recovery time is about I hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 5 hours, about 5 hours to about 6 hours, about 6 hours to about 7 hours, about 7 hours to about 8 hours, about 8 hours to about 9 hours, about 9 hours to about 10 hours, about 10 hours to about 11 hours, about 11 hours to about 12 hours, about 12 hours to about 18 hours, or about 18 hours to about 24 hours.

[0087] In some embodiments, the recovery can take place for one or more stages. For example, the population of cells can be transferred to one or more (e.g., 1, 2, 3, 4, or 5) incubators, each having a pre-set temperature between 37°C and the heat shock temperature (e.g., 43°C). For example, the cells in a container (e.g., a centrifuge tube) can be transferred to a first incubator at 41°C, then a second incubator at 39°C, and then a third incubator at 37°C. Without wishing to be bound by theory, it is contemplated that using one or more stages for recovery can help preserving cell viability of enhancing expression of the protein of interest (e.g., CAR).

[0088] In some embodiments, the activated cells prepared using the methods described herein (e.g., any of the methods for introducing heat shock and / or subsequent recovery), can have a viability of at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% after the heat shock or subsequent recovery'.

[0089] In some embodiments, the percentage of cells expressing the protein of interest in the activated cells prepared using the methods described herein (e.g., any of the methods for introducing heat shock and / or subsequent recovery) is at least 10%, at least 20%, at least 30%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% after about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes or about 1 hour of heat shock (e.g,, using any of the methods for introducing heat shock described herein).

[0090] Methods of Preserving the Expression Level of a Protein of Interest

[0091] In one aspect, the disclosure is related to methods of preserving the expression level of a protein of interest (e.g., CAR) in a population of cells, comprising: a) providing a population of cells comprising a nucleic acid comprising a heat-responsive promoter, and a sequence encoding the protein of interest; b) introducing a heat shock to the population of cells, thereby activating the population of cells; and c) freezing the population of activated cells, e.g., in liquid nitrogen. The methods described herein ensure the viability and efficacy of cells (e.g., CAR-T cells) when delivered to subjects in need thereof (e.g., patients having cancer).

[0092] In some embodiments, the population of cells can be activated using any of the methods described herein to introduce the heat shock. In some embodiments, the population of cells can be subsequently recovered using any of the recovery methods described herein.

[0093] In some embodiments, the activated cells can be frozen using any methods known in the art, e.g., in liquid nitrogen. Methods of cryopreservation can be found, e.g., in Meneghel, J., et al. "Cryopreservation as a key element in the successful delivery of cell-based therapies — a review." Frontiers in Medicine 7 (2020): 592242; and Jaiswal, A. N. etal. "Cry opreservation: A review article." Ciireus 14.11 (2022); each of which is incorporated herein by reference in its entirety.

[0094] In some embodiments, the activated cells can be stored at a temperature of less than -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In some embodiments, the activated cells can be stored for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 5 years, or 10 years without comprising the viability and efficacy of cells (e.g., CAR-T cells).

[0095] As shown in FIGS. 3 A, the present disclosure compared two storage strategies: the first involved inducing CAR expression by heat shock (e.g., using any methods described herein to introduce heat shock) after thawing the cells, and the second involved inducing CAR expression by heat shock (e.g., using any methods described herein to introduce heat shock) before freezing the cells. It was discovered that the second strategy exhibited a significantly higher CAR expression rate and expression level compared to the first strategy.

[0096] Thus, in some embodiments, the methods described herein, i.e,, activating cells by heat shock before freezing the cells, can increase the rate of cells expressing a protein of interest (e.g., C AR) by at least I -fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold as compared to that when cells are activated by heat shock after thawing the cells. In some embodiments, the foregoing rate of cells expressing the protein of interest (e.g., CAR) increases by about 1-2 folds, about 2-3 folds, about 3-4 folds, about 4-5 folds, about 5-6 folds, about 6-7 folds, about 7-8 folds, about 8-9 folds, or about 9-10 folds. In some embodiments, the rate of cells expressing the protein of interest (e.g., CAR) is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%, In some embodiments, the cells are recovered at about 37°C after the heat shock for about 1 hour, 2 hours, or 4 hours.

[0097] In some embodiments, the methods described herein, i.e., activating cells by heat shock before freezing the cells, can increase the expression level of a protein of interest (e.g,, C AR) by at least 1 -fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold as compared to that when cells are activated by heat shock after thawing the cells. In some embodiments, the foregoing expression level of the protein of interest (e.g., CAR) increases by about 1-2 folds, about 2-3 folds, about 3-4 folds, about 4-5 folds, about 5-6 folds, about 6-7 folds, about 7-8 folds, about 8-9 folds, or about 9-10 folds. In some embodiments, the cells are recovered at about 37°C after the heat shock for about 1 hour, 2 hours, or 4 hours.

[0098] In some embodiments, the methods described herein further comprises thawing and / or recovering the population of activated cells after freezing the cells. In some embodiments, the population of activated cells are recovered at about 37°C after being thawed for 1-24 hours (e.g., 2 hours). For example, the cells can be transferred to an incubator or a water bath that has been set at a pre-determined temperature, e.g., about 37°C. In some embodiments, the temperature of the medium increases during the recovery (e.g., from about -80°C to about 37°C) at a rate, e.g., of about 1 °C per minute, about 2°C per minute, about 5°C per minute, about 10°C per minute, about 20°C per minute, about 30°C per minute, about 40°C per minute, about 50°C per minute, about 60°C per minute, about 70°C per minute, about 80°C per minute, about 90°C per minute, or about 100°C per minute. As can be determined by a skilled person in the art, time for recovery can be determined by many factors, e.g., the volume of the pre-heated medium, the sensitivity of cells to thawing, and the concentration of the population of cells. As shown in Example 3, when the volume of the pre-heated volume was 50 ml and the concentration of the cells is about 20-40 million, it takes about 2 hours at about 37°C for the cells to recover from freeze / thaw.

[0099] In some embodiments, the recovery time is at least about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 18 hours, or about 24 hours. In some embodiments, the recovery time is about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 5 hours, about 5 hours to about 6 hours, about 6 hours to about 7 hours, about 7 hours to about 8 hours, about 8 hours to about 9 hours, about 9 hours to about 10 hours, about 10 hours to about 11 hours, about 11 hours to about 12 hours, about 12 hours to about 18 hours, or about 18 hours to about 24 hours.

[0100] Protein of Interest

[0101] One aspect of the present disclosure provides methods of activating and preserving cells that express one or more proteins of interest. In some embodiments, the cells are modified by introducing a vector (e.g., a viral vector) comprising a heat-responsive promoter, and a sequence encoding one or more proteins of interest (e.g., any of the proteins of interest described herein). In some embodiments, the sequence encoding the one or more proteins of interest are connected via one or more linker peptides. In some embodiment, the linker peptide is a self-cleavable linker, such as P2A, T2A, E2A, or F2A peptide.

[0102] The one or more proteins of interest may include an engineered receptor, a fusion protein, an enzyme, a soluble protein, a structural protein, a transcriptional regulatory protein, a receptor, a translational regulatory protein, a chromatin protein, a hormone, a cell cycle regulatory protein, a G protein, a neuroactive peptide, an immunomodulatory protein or agent, a blood component protein, a heat shock protein, dihydrofolate reductase, an antibiotic resistance protein, a functional fragment of any one of the proteins, an epitope fragment of any one of the proteins, and any combinations thereof. In some embodiments, the one or more proteins of interest include a soluble polypeptide, a single chain antigen-binding polypeptide, a scFv, a single-domain antibody, a soluble portion of a transmembrane protein, a secretory protein, a ligand, a VHH, or a cytokine. In some embodiments, the one or more proteins of interest include any of the engineered receptors described herein.

[0103] The one or more proteins of interest may include an antibody or antigen binding fragment thereof (e.g., scFv). In some embodiments, the antigen-binding fragment is a single-chain variable fragment (scFv). The scFv usually has one heavy chain variable domain, and one light chain variable domain. In some embodiments, the scFv has two heavy chain variable domains, and two light chain variable domains. The one or more proteins of interest may include a single domain antibody. A singledomain antibody (sdAb), also known as a nanobody, is an antibody fragment consisting of a single monomeric variable antibody domain. Like a whole antibody, it can bind selectively to a specific antigen. In some embodiments, the single-domain antibodies are engineered from heavychain antibodies found in camelids and are called VHH fragments. As used herein, the “VHH” refers to the antigen-binding fragment of heavy chain only antibodies.

[0104] The one or more proteins of interest may include a cytokine. As used herein, the term "cytokine" refers to any protein or peptide, analog or functional fragment thereof, which is capable of stimulating or inducing a cytocidal immune response against a preselected cell-type, for example, a cancer cell or a virally-infected cell, in a mammal. Accordingly, it is contemplated that a variety of cytokines can be fused to the Fc at the sites described herein.

[0105] a. Engineered Receptor

[0106] One aspect of the present disclosure provides cells (e.g., immune cells) that express an engineered receptor. The engineered receptor can comprise an extracellular ligand binding domain or an extracellular antigen binding domain, and optionally an intracellular signaling domain. Exemplary engineered receptors include, but are not limited to, chimeric antigen receptor (CAR), engineered T-cell receptor (TCR), and T-cell antigen coupler (TAC) receptor. The engineered receptor can comprise an extracellular antigen binding domain that specifically binds to an antigen (e.g., a tumor antigen), a transmembrane domain, and an intracellular signaling domain. The intracellular signaling domain can comprise a primary intracellular signaling domain and / or a co-stimulatory signaling domain. The intracellular signaling domain can comprise an intracellular signaling domain of a TCR co-receptor. The engineered receptor can be encoded by a heterologous polynucleotide operably linked to a promoter (such as a constitutive promoter or an inducible promoter). In some embodiments, the engineered receptor can be encoded by a heterologous polynucleotide operably linked to a heat-responsive promoter (e.g., any of the heat-responsive promoters described herein).

[0107] The engineered receptor can comprise one or more specific binding domains that target at least one tumor antigen, and one or more intracellular effector domains, such as one or more primary intracellular signaling domains and / or co-stimulatory signaling domains. The engineered receptor can be a chimeric antigen receptor (CAR) Many chimeric antigen receptors are known in the art and can be suitable for the engineered cells described herein. CARs can also be constructed with a specificity for any cell surface marker by utilizing antigen binding fragments or antibody variable domains of, for example, antibody molecules.

[0108] CARs of the present disclosure may comprise an extracellular domain comprising at least one antigen binding domain that specifically binds at least one tumor antigen, a transmembrane domain, and an intracellular signaling domain.

[0109] The intracellular signaling domain may generate a signal that promotes an immune effector function of the CAR- containing cell, e.g., a CAR-T cell. Immune effector function or immune effector response refers to function or response, e.g., of an immune effector cell, that enhances or promotes an immune attack of a target cell. For example, an immune effector function or response can refer to a property of a T or NK cell that promotes killing or the inhibition of growth or proliferation, of a target cell. Examples of immune effector function, e.g., in a CAR-T ceil, include cytolytic activity (such as antibody-dependent cellular toxicity, or ADCC) and helper activity (such as the secretion of cytokines). The intracellular signaling domain may generate a signal that promotes proliferation and / or survival of the CAR containing cell. The CAR may comprise one or more intracellular signaling domains selected from the signaling domains of CD28, CD137, CD3, CD27, CD40, ICOS, GITR, and 0X40. The signaling domain of a naturally occurring molecule can comprise the entire intracellular or cytoplasmic portion, or the entire native intracellular signaling domain, of the molecule, or a fragment or derivative thereof.

[0110] The intracellular signaling domain of a CAR can comprise a primary intracellular signaling domain, “Primary intracellular signaling domain” refers to cytoplasmic signaling sequence that acts in a stimulatory manner to induce immune effector functions. The primary intracellular signaling domain may contain a signaling motif known as Immunoreceptor Tyrosme-based Activation Motif, or ITAM. The primary intracellular signaling domain may comprise a functional signaling domain of a protein selected from the group consisting of CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, common FcR gamma (FCER1G), FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fcgamma R Ila, DAP10, and DAP 12. The primary intracellular signaling domain may comprise a nonfunctional or attenuated signaling domain of a protein selected from the group consisting of CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, common FcR gamma (FCERIG), FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fcgamma R Ila, DAPIO, and DAP 12. The nonfunctional or attenuated signaling domain can be a mutant signaling domain having a point mutation, insertion or deletion that attenuates or abolishes one or more immune effector functions, such as cytolytic activity or helper activity, including antibodydependent cellular toxicity (ADCC). The CAR may comprise a nonfunctional or attenuated CD3 zeta (i.e. CD3C, or CD3z) signaling domain. The intracellular signaling domain may not comprise a primary intracellular signaling domain. An attenuated primary intracellular signaling domain may induce no more than about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less of an immune effector function (such as cytolytic function against target cells) compared to CARs having the same construct, but with the wild-type primary intracellular signaling domain.

[0111] The intracellular signaling domain of a CAR can comprise one or more (such as any of 1, 2, 3, or more) co-stimulatory signaling domains. “Co- stimulatory signaling domain” can be the intracellular portion of a co-stimulatory molecule. The term “co-stimulatory molecule” refers to a cognate binding partner on an immune cell (such as T cell) that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the immune cell, such as, but not limited to, proliferation and survival. Co-stimulatory molecules are cell surface molecules other than antigen receptors or their ligands that contribute to an efficient immune response. A co-stimulatory molecule can be represented in the following protein families: TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SIAM proteins), and activating NK cell receptors. Co-stimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll ligand receptor, as well as 0X40, CD27, CD28, CDS, ICAM-1, LFA-1 (CD1 la / CD18), ICOS (CD278), and 4-1BB (CD137). Further examples of such co-stimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, GDI 9, CD4, CD8alpha, CD8beta, IL-2Rbeta, IL-2R gamma, IL-7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, GDI Id, ITGAE, CD103, ITGAL, GDI la, LFA-1, ITGAM, GDI lb, ITGAX, CDllc, ITGB1, CD29, ITGB2, GDI 8, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAMI (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CDIOO (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM: (SLAMF1, GDI 50, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, CD 19a, and a ligand that specifically binds with CD83.

[0112] The CAR can comprise a single co-stimulatory signaling domain. The CAR can comprise two or more co-stimulatory signaling domains. The intracellular signaling domain can comprise a functional primary intracellular signaling domain and one or more co-stimulatory signaling domains. The CAR may not comprise a functional primary intracellular signaling domain (such as CD3ζ. The CAR can comprise an intracellular signaling domain consisting of or consisting essentially of one or more co-stimulatory signaling domains. The CAR can comprise an intracellular signaling domain consisting of or consisting essentially of a nonfunctional or attenuated primary intracellular signaling domain (such as a mutant CD3ζ and one or more co-stimulatory signaling domains. Upon binding of the antigen binding domain to tumor antigen, the co-stimulatory signaling domains of the CAR can transduce signals for enhanced proliferation, survival and differentiation of the modified immune cells having the CAR (such as T cells), and inhibit activation induced cell death. The one or more co-stimulatory signaling domains can be derived from one or more molecules selected from the group consisting of CD27, CD28, 4-1BB (i.e., CD137), 0X40, CD30, CD40, CD3, lymphocyte function-associated antigen- 1(LF A- 1), CD2, CD7, LIGHT, NKG2C, B7-H3 and ligands that specially bind to CD83.

[0113] The intracellular signaling domain of a CAR can comprise a co-stimulatory signaling domain derived from CD28, The intracellular signaling domain can comprise a primary intracellular signaling domain of CD3ζ, and a co-stimulatory signaling domain of CD28. The intracellular signaling domain in the chimeric receptor of the present application can comprise a co-stimulatory signaling domain derived from 4-1BB (i.e., CD137). The intracellular signaling domain can comprise a primary intracellular signaling domain of CD3ζ, and a co-stimulatory signaling domain of 4- IBB. The intracellular signaling domain can comprise a polypeptide comprising from the N-terminus to the C-tenninus: a co-stimulatory signaling domain of 4-1BB and a primary intracellular signaling domain of CD3ζ.

[0114] The intracellular signaling domain of the CAR can comprise a co-stimulatory signaling domain of CD28 and a co-stimulatory signaling domain of 4-1BB. The intracellular signaling domain can comprise a primary intracellular signaling domain of CD3ζ, a co-stimulatory signaling domain of CD28, and a co-stimulatory signaling domain of 4-1BB. The intracellular signaling domain can comprise a polypeptide comprising from the N-terminus to the C -terminus: a co-stimulatory signaling domain of CD28, a co-stimulatory signaling domain of 4-1BB, and a primary intracellular signaling domain of CD3ζ,.

[0115] The antigen binding domain of a CAR may comprise one or more (such as any one of 1, 2, 3, 4, 5, 6 or more) antibodies or antibody fragments, which can be selected from an scFv, a Fv, a Fab, a (Fab')?., a minibody, a diabody, a single domain antibody (sdAb), or a VHH domain. The antigen binding domain of a CAR can comprise a ligand or an extracellular portion of a receptor that specifically binds to a tumor antigen. The CAR can be a monospecific, bispecific or multispecific CAR. The antigen binding domain of a CAR can specifically bind to a single tumor antigen. The antigen binding domain of a CAR can bind to two or more tumor antigens. The engineered receptor (e.g., CAR) may redirect the specificity of the engineered cells through the expression of a chimeric antigen receptor (CAR) or TCR on these cells.

[0116] The antigen may be a tumor antigen selected from the group consisting of BCMA, CLL1, CD4, GPC3, GPRC5D, GU2CYC, CD 19, MUC16, MUC1, CAIX, CEA, CDS, CD7, CD 10, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, ERBB2, ERBB3, ERBB4, FBP, fetal acetylcholine receptor, folate receptor-a, GD2, GD3, hTERT, IL-13Ra2, K-light chain, KDR, LeY, LI ceil adhesion molecule, MAGE-A1, mesothelin, MAGEA3, p53, MARTI, GP100, proteinase-3 (PR3), tyrosinase, survivm, hTERT, EphA2, NY-ESO-1, h5T4, PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, CD123, CD44V6, NKCS1, IGF1R, EGFR, EGFR-VIII, Claudin 18.2, Claudin 6, NKG2D, Delta-like 3 (DLL3), CD70, CS-1, c-Met, Glycolipid F77, MSLN, PD-L1, PD-L2, and other tumor antigens with clinical significance, and combinations thereof.

[0117] The tumor antigen can be derived from an intracellular protein of tumor cells. The tumor antigen can be expressed on the surface of tumor cells. Many TCRs specifi c for tumor antigens (including tumor-associated antigens) have been described, including, for example, NY-ESO-1 cancer-testis antigen, the p53 tumor suppressor antigens, TCRs for tumor antigens in melanoma (e.g., MARTI, gp 100), leukemia (e.g., WT1, minor histocompatibility antigens), and breast cancer (e.g., HER2, NY-BR1). In some embodiments, the tumor antigen can be derived from an intracellular protein of solid tumors. The transmembrane domain of a CAR can be selected from the transmembrane domain of an alpha, beta or zeta chain of a T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, GDI 6, CD22, CD33, CD37, CD64, CD80, CD86, GDI 34, CD137, GDI 54, K1RDS2, 0X40, CD2, CD27, LFA-1 (GDI la, CD18), IGOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, FIVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD160, CD19, IL-2Rbeta, IL-2R gamma, IL-7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, II GAD, CD lid, ITGAE, CD 103, 1TGAL, CD 11 a, LFA-1, II GAM, CD 11b, ITGAX, CD 11c, ITGB1, CD29, ITGB2, CD 18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CDIOO (SEMA4D), SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, PAGCbp, NKp44, NKp30, NKp46, NKG2D, and / or NKG2C. The transmembrane domain of the CAR can be a CD4, CD3, CD8a, or CD28 transmembrane domain. The transmembrane domain of the CAR can comprise a CD8a transmembrane domain. The transmembrane domain can be derived from a molecule selected from the group consisting of CD8a, CD4, CD28, CD 137, CD80, CD86, CD 152 and PD1.

[0118] The extracellular domain can be connected to the transmembrane domain by a hinge domain. The hinge domain can be a hinge domain of CD8a.

[0119] The CAR can also comprise a signal peptide (SP), such as a CD8a signal peptide. The signal peptide can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 10.

[0120] The CAR can also comprise a tag, such as a c-Myc tag. The c-Myc tag can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 11.

[0121] The CAR may be a CAR that specifically targets a tumor antigen (e.g., PSMA, GD2, EGFR, MSLN, or PD-L1 ). The CAR may be monospecific. The CAR may be bispecific or bivalent. The extracellular antigen binding domain of CAR may be or include one or more antigen-binding regions or moieties. The antigen-binding region may bind to one or more epitopes on a tumor antigen (e.g., any of the tumor antigens described herein). The CAR may be bivalent CARs comprising one or more antigen-scFvs targeting same or different epitopes of a tumor antigen (e.g., any of the tumor antigens described herein).

[0122] The CAR described herein can comprise from the N-terminus to the C-terminus: an optional CD8 signal peptide, an optional c-Myc tag, an antigen-binding region that specifically binds to a tumor antigen, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain; and a CD3z intracellular signaling domain.

[0123] The optional CD8 signal peptide can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 10.

[0124] The optional c-Myc tag can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 11.

[0125] The CD28 extracellular domain can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 13.

[0126] The CD28 transmembrane domain can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 14.

[0127] The CD28 co-stimulatory domain can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 15.

[0128] The CD3ζ intracellular signaling domain can comprise a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 16.

[0129] In some embodiments, the CAR comprises an antigen-binding region can specifically bind to PSMA (e.g., human PSMA). In some embodiments, the anti-PSMA antigen-binding region can comprise a scFv having a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments, the CAR comprises a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 18.

[0130] In some embodiments, the CAR comprises an antigen-binding region can specifically bind to GD2 (CAS No. 65988-71-8). In some embodiments, the anti-GD2 antigen-binding region can comprise a scFv having a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 12. In some embodiments, the CAR comprises a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 9.

[0131] In some embodiments, the CAR comprises an antigen-binding region can specifically bind to MSLN (e.g., human MSLN). In some embodiments, the anti-MSLN antigen-binding region can comprise a scFv having a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 20. In some embodiments, the CAR comprises a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 19.

[0132] In some embodiments, the CAR comprises an antigen-binding region can specifically bind to PD-L1 (e g., human PD-L1). In some embodiments, the antigen-binding region targeting PD-L1 can comprise all or part of the extracellular region of PD-1 (e.g., human PD-1) that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 25. In some embodiments, the CAR comprises a sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 24.

[0133] In some embodiments, the CARs described herein may specifically bind to tumor cells expressing MSLN (e.g., HeLa cells), tumor cells expressing GD2 (e.g., U87-MG cells), or tumor cells expressing PD-L1 (e.g., PC3, HeLa, SK-OV-3, or U87-MG cells). In some embodiments, the CARs described herein may specifically bind to a solid tumor, e.g., prostate cancer, cervical cancer, ovarian cancer, or glioblastoma.

[0134] The engineered receptor can be a modified T-cell receptor or engineered T-cell receptor. The engineered TCR can be specific for a tumor antigen. The tumor antigen can be selected from the group consisting of BCMA, CLL1, CD4, GPC3, GPRC5D, GU2CYC, CD19, MUC16, MUC1, CAIX, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, ERBB2, ERBB3, ERBB4, EBP, fetal acetyl choline receptor, folate receptor-a, GD2, GD3, HER-2, hTERT, IL-13R-O.2, K-light chain, KDR, LeY, LI cell adhesion molecule, MAGE-A1, mesothelin, MAGEA3, p53, MARTI, GP100, proteinase-3 (PR3), tyrosinase, survivin, hTERT, EphA2, NY-ESO-1, h5T4, PSCA, PSMA, R0R1, TAG-72, VEGF-R2, WT-1, CD123, CD44V6, NKCS1, IGFTR, EGER, EGFR-VIII, Claudin 18.2, Claudin 6, NKG2D, Delta-like 3 (DLL3), CD70, CS-1, c-Met, Glycolipid F77, PD-L1, PD-L2, and other tumor antigens with clinical significance, and combinations thereof. The tumor antigen can be derived from an intracellular protein of tumor cells. The tumor antigen can be expressed on the surface of tumor cells. Many TCRs specific for tumor antigens (including tumor-associated antigens) have been described, including, for example, NY-ESO-1 cancer-testis antigen, the p53 tumor suppressor antigens, TCRs for tumor antigens in melanoma (e.g., MARTI, gp 100), leukemia (e.g., WT1, minor histocompatibility antigens), and breast cancer (e.g,, HER2, NY-BR1 ), Any of the TCRs known in the art can be used. The TCR can have an enhanced affinity' to the tumor antigen. Exemplary TCRs and methods for introducing the TCRs to immune cells have been described, for example, in U. S, Pat, No. 5,830,755, and Kessels et al. Immunotherapy through TCR gene transfer, Nat, Immunol. 2, 957-961 (2001), which are incorporated herein by reference in the entirety.

[0135] The TCR receptor complex is an octomeric complex formed by variable TCR receptor a and p chains (or y and 8 chains on case of y§ T cells) with three dimeric signaling modules CD33 / 8, CD3y / s and CD247 (T-cell surface glycoprotein CD3 zeta chain) J' or c / r|- Ionizable residues in the transmembrane domain of each subunit form a polar network of interactions that hold the complex together. TCR complex has the function of activating signaling cascades in T cells. The engineered receptor can be an engineered TCR comprising one or more T-cell receptor (TCR) fusion proteins (TFPs). Exemplary TFPs have been described, for example, in US20170166622A1, which is incorporated herein by reference in its entirety. The TFP can comprise an extracellular domain of a TCR subunit that comprises an extracellular domain or portion thereof of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications. The TFP can comprise a transmembrane domain that comprises a transmembrane domain of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications. The TFP can comprise a transmembrane domain that comprises a transmembrane domain of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a TCR zeta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, CD154, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.

[0136] The TFP can comprise a TCR subunit comprising at least a portion of a TCR extracellular domain, and a TCR intracellular domain comprising a stimulatory domain from an intracellular signaling domain of CD3 epsilon; and an antigen binding domain, wherein the TCR subunit and the antigen binding domain are operatively linked, and wherein the TFP incorporates into a TCR when expressed in a T cell.

[0137] The engineered receptor can be a T-cell antigen coupler (TAC) receptor. Exemplary TAC receptors have been described, for example, in US20160368964A1, which is incorporated herein by reference. The TAC can comprise an antigen binding domain, a TCR-binding domain that specifically binds a protein associated with the TCR complex, and a T-cell receptor signaling domain. The antigen binding domain can be an antibody fragment, such as scFv or VHH, which specifically binds to a tumor antigen. The antigen binding domain can be a designed Ankyrin repeat (DARPin) polypeptide. The tumor antigen can be selected from the group consisting of BCMA, CLL1, CD4, GPC3, GPRC5D, GU2CYC, GDI 9, MUC16, MUC1, CAIX, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, ERBB2, ERBB3, ERBB4, FBP, fetal acetylcholine receptor, folate receptor-a, GD2, GD3, FIER-2, hTERT, IL-13R-a2, K-light chain, KDR, LeY, LI cell adhesion molecule, MAGE-A1, mesothelin, MAGEA3, p53, MARTI, GP100, proteinase-3 (PR3), tyrosinase, survivin, hTERT, EphA2, NY-ESO-1, h5T4, PSCA, PSMA, R0R1, TAG-72, VEGF-R2, WT-1, CD 123, CD44V6, NKCS1, IGF1R, EGFR, EGFR- VI II, Claudin 18.2, Claudin 6, NKG2D, Delta-like 3 (DLL3), CD70, CS-1, c-Met, Glycolipid F77, PD-L1, PD-L2, and other tumor antigens with clinical significance, and combinations thereof. The tumor antigen can be derived from an intracellular protein of tumor cells. The tumor antigen can be expressed on the surface of tumor cells. The protein associated with the TCR complex can be CD3, such as CD3E. The TCR-binding domain can be a single chain antibody, such as scFv, or a VHH. The TCR-binding domain can be derived from UCHT1. The I' AC receptor can comprise a cytosolic domain and a transmembrane domain. The T-cell receptor signaling domain can comprise a cytosolic domain derived from a TCR co-receptor. Exemplary TCR co-receptors include, but are not limited to, CD4, CD8, CD28, CD45, CD4, CD5, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 and CD 154. The TAC receptor can comprise a transmembrane domain and a cytosolic domain derived from CD4. The TAC receptor can comprise a transmembrane domain and a cytosolic domain derived from CD8 (such as CD8a).

[0138] T cell co-receptors are expressed as membrane proteins on T cells. They can provide stabilization of the TCR: peptide: MEC complex and facilitate signal transduction. The two subtypes of T cell co-receptor, CD4 and CD8, display strong specificity for particular MEC classes. The CD4 co-receptor can only stabilize TCR: MEC II complexes while the CD8 co-receptor can only stabilize the TCR: MEC I complex. The differential expression of CD4 and CD8 on different T cell types results in distinct T cell functional subpopulations, CD8+ T cells are cytotoxic T cells.

[0139] The engineered receptor (such as CAR, TCR, or TAC) can target one or more tumor antigens. Tumor antigens are proteins that are produced by tumor cells that can elicit an immune response, particularly T-cell mediated immune responses. The selection of the targeted antigen will depend on the particular type of cancer to be treated. Exemplary tumor antigens include, for example, a glioma-associated antigen, carcinoembryonic antigen (CEA), -human chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CAIX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxyl esterase, mut hsp70-2, M-CSF, prostase, prostate-specific antigen (PSA), PAP, NY-ESO-1, LAGE-la, p53, prostein, PSMA, HER2 / neu, survivin and telomerase, prostate-carcinoma tumor antigen- 1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrinB2, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor and mesothelin.

[0140] The tumor antigen can comprise one or more antigenic cancer epitopes associated with a malignant tumor. Malignant tumors express a number of proteins that can serve as target antigens for an immune attack. These molecules include but are not limited to tissue-specific antigens such as MART-1, tyrosinase and gplOO in melanoma and prostatic acid phosphatase (PAP) and prostate-specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules such as the oncogene HER2 / Neu / ErbB-2. Yet another group of target antigens are onco-fetal antigens such as carcinoembryonic antigen (CEA). In B-cell lymphoma the tumor-specific idiotype immunoglobulin constitutes a truly tumor-specific immunoglobulin antigen that is unique to the individual tumor. B cell differentiation antigens such as CD 19, CD20 and CD57 are other candidates for target antigens in B-cell lymphoma.

[0141] The tumor antigen can be a tumor-specific antigen (TSA) or a tumor-associated antigen (TA A). A TSA is unique to tumor cells and does not occur on other cells in the body. A TA A associated antigen is not unique to a tumor cell, and instead is also expressed on a normal cell under conditions that fail to induce a state of immunologic tolerance to the antigen. The expression of the antigen on the tumor can occur under conditions that enable the immune system to respond to the antigen. TAAs can be antigens that are expressed on normal cells during fetal development, when the immune system is immature, and unable to respond or they can be antigens that are normally present at extremely low levels on normal cells, but which are expressed at much higher levels on tumor cells.

[0142] Non-limiting examples of TSA or TAA antigens include the following: Differentiation antigens such as MART-l / MelanA (MART-I), gp 100 (Pmel 17), tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pl 5; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor-suppressor genes such as p53, Ras, HER2 / neu; unique tumor antigens resulting from chromosomal translocations; such as BCR-ABL, E2A-PRL, FI4-RET, IGH-IGK, MYL-RAR; and viral antigens, such as the Epstein Barr virus antigens EBVA and the human papillomavirus (HPV) antigens E6 and E7. Other large, protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, pl85erbB2, pI80erbB-3, c-met, nm-23HI, PSA, TAG-72, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-Catemn, CDK4, Mum-1, p 15, p 16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3\CA 27.29XBCAA, CA 195, CA 242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344, MA-50, MG7-Ag, M0V18, NB / 70K, NY-CO-1, RCAS 1, SDCCAG16, TA-90\Mac-2 binding protein\cyclophilin C-associated protein, TAAL6, TAG72, TLP, and TPS.

[0143] b. MSLN CAR

[0144] Mesothelin (MSLN) is a cell surface-bound, glycosylphosphatidylinositol (GPI) anchored protein, whose normal expression is restricted to the mesothelial cells of the pleura, pericardium, peritoneum, and tunica vaginalis in men, whereas very low MSLN expression (trace amounts) has also been observed in the epithelial lining of the ovaries, fallopian tubes, and rete testis.

[0145] In contrast to its limited expression on mesothelial cells under normal physiological conditions, MSLN has been found to be overexpressed in a plethora of cancers, including malignant mesothelioma, ovarian cancer, breast cancer (and more specifically triple-negative breast cancer (TNBC)), pancreatic cancer, lung cancer, gastric cancer, endometrial cancer, cervical cancer, biliary cancer, uterine serous carcinoma, cholangiocarcinoma and pediatric acute myeloid leukemia. Increased MSLN expression has been associated with a poorer prognosis for patients with TNBC, ovarian cancer, lung adenocarcinoma, cholangiocarcinoma, and pancreatic adenocarcinoma.

[0146] MSLN and its identity as a tumor-associated antigen (TAA) were discovered over 20 years ago and was initially isolated (via mice immunization) and characterized a monoclonal antibody named KI, reactive with human ovarian carcinoma cells as well as with the normal mesothelium. A few years later, the same researchers used molecular cloning to identify and isolate the cDNA and protein recognized by the KI antibody. They named the protein ‘mesothelin’ as it is normally produced by mesothelial cells and provided early evidence that this protein could be involved in cellular adhesion. The human MS LN gene is located at chromosome 16 and contains a 1884-base pair open reading frame and a total of 15 exons. The human MSLN gene was shown to encode a ~71-kDa precursor protein consisting of ~628 amino acids. The precursor is cleaved (via furin cleavage) at Arginine 295 (Arg295) into two products; a ~ 31-kDa N-terminal soluble protein known as mature megakaryocyte potentiating factor (MPF) and a ~ 40-kDa GPI-anchored mesothelin protein, bound on the cell surface. In mesothelioma and ovarian cancer, the levels of membrane-bound MSLN that is released in the serum have been found to be elevated and serum MSLN is considered to be a tumor marker for mesothelioma and ovarian cancer patients

[0147] A detailed description of MSLN, and the use of anti-MSLN antibodies to treat cancers are described, e.g., in Faust, J. R., et al. Mesothelin: an immunotherapeutic target beyond solid tumors. Cancers (Basel). 2022; 14 (6); and Klampatsa, A., et al. "Mesothelin-targeted CAR-T cell therapy for solid tumors." Expert Opinion on Biological Therapy 21.4 (2021): 473-486; each of which is incorporated by reference in its entirety.

[0148] In one aspect, the disclosure is related to a CAR comprising a MSLN-binding domain, wherein the MSLN-binding domain comprises or is derived from a single chain variable fragment (scFv), comprising a heavy chain variable region (VH) and a light chain variable region (VL). As shown in FIG. 10A, the VH of the scFv comprises a CDR1 set forth in SEQ ID NO: 27, a CDR2 set forth in SEQ ID NO: 28 and a CDR3 set forth in SEQ ID NO: 29, and the VL of the scFv comprises a CDR1 set forth in SEQ ID NO: 30, a CDR2 set forth in SEQ ID NO: 31, and a CDR3 set forth in SEQ ID NO: 32. In some embodiments, the CDRs are defined under Kabat definition.

[0149] The amino acid sequence for heavy chain variable region (VH) and light chain variable region (VL) of the scFv are also provided. The amino acid sequence for the VH is set forth in SEQ ID NO: 21. The amino acid sequences for the VL is set forth in SEQ ID NO: 22,

[0150] In some embodiments, the scFv can have a heavy chain variable region (VH) comprising complementarity determining regions (CDRs) 1, 2, 3, wherein the CDR1 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 27, the CDR2 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 28, and the CDR3 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 29, and a light chain variable region (VL) comprising CDRs 1, 2, 3, wherein the CDR1 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 30, the CDR2 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 31, and the CDR3 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 32.

[0151] In some embodiments, the scFv described herein can contain a heavy chain variable domain containing one, two, or three of the CDRs of SEQ ID NO: 27 with zero, one or two amino acid insertions, deletions, or substitutions; SEQ ID NO: 28 with zero, one or two amino acid insertions, deletions, or substitutions; SEQ ID NO: 29 with zero, one or two amino acid insertions, deletions, or substitutions. In some embodiments, the antibody or an antigen-binding fragment described herein can contain a light chain variable domain containing one, two, or three of the CDRs of SEQ ID NO: 30 with zero, one or two amino acid insertions, deletions, or substitutions; SEQ ID NO: 31 with zero, one or two amino acid insertions, deletions, or substitutions; SEQ ID NO: 32 with zero, one or two ammo acid insertions, deletions, or substitutions. The insertions, deletions, and substitutions can be within the CDR sequence, or at one or both terminal ends of the CDR sequence.

[0152] The disclosure also provides scFv that binds to MSLN. The scFv contain a heavy chain variable region (VH) comprising or consisting of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 21, and a light chain variable region (VL) comprising or consisting of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 22.

[0153] The disclosure also provides nucleic acid comprising a polynucleotide encoding the scFv, the MSLN-binding domain, and the CAR targeting MSLN.

[0154] In some embodiments, the scFv described herein comprises from N-terminus to C-terminus: the VH, a linker peptide, and the VL. In some embodiments, the scFv described herein comprises from N-terminus to C-terminus: the VL, a linker peptide, and the VH. In some embodiments, the linker peptide is a flexible linker. In some embodiments, the flexible linker is a GS linker. Details of flexible linkers can be found, e.g., in Chen, X., et al. "Fusion protein linkers: property, design and functionality." Advanced Drug Delivery Reviews 65.10 (2013): 1357-1369, which is incorporated herein by reference in its entirety. In some embodiments, the linker peptide comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of SEQ ID NO: 26. In some embodiments, the linker peptide comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 23.

[0155] In some embodiments, the MSLN-binding domain comprises an amino acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 20.

[0156] In some embodiments, the CAR described herein comprises, optionally from N-terminus to C-terminus, an optional CD8 signal peptide (e.g., any of the CD8 signal peptides described herein), an optional c-Myc tag (e.g., any of the c-Myc tags described herein), the MSLN-binding domain (e.g., any of the MSLN-binding domains described herein), a CD28 extracellular domain (e.g., any of the CD28 extracellular domains described herein), a CD28 transmembrane domain (e.g., any of the CD28 transmembrane domains described herein), a CD28 co- stimulatory domain (e.g., any of the CD28 co-stimulatory domains described herein), and a CD3z intracellular signaling domain (e.g., any of the CD3z intracellular signaling domains described herein). In some embodiments, the CAR described herein comprises an amino acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19.

[0157] c. PD-L1 CAR

[0158] PD-1 (programmed death- 1) is an immune checkpoint and guards against autoimmunity through a dual mechanism of promoting apoptosis (programmed cell death) in antigen-specific T-cells in lymph nodes while simultaneously reducing apoptosis in regulatory T cells (antiinflammatory, suppressive T cells).

[0159] PD-1 is mainly expressed on the surfaces of T cells and primary B cells; two ligands of PD-1 (PD-LI and PD-L2) are widely expressed in antigen-presenting cells (APCs). The interaction of PD-1 with its ligands plays an important role in the negative regulation of the immune response. Inhibition the binding between PD-1 and its ligand can make the tumor cells exposed to the killing effect of the immune system, and thus can reach the effect of killing tumor tissues and treating cancers.

[0160] PD-Ll is expressed on the neoplastic cells of many different cancers. By binding to PD-1 on T-cells leading to its inhibition, PD-Ll expression is a major mechanism by which tumor cells can evade immune attack. PD-Ll over-expression may conceptually be due to 2 mechanisms, intrinsic and adaptive. Intrinsic expression of PD-Ll on cancer cells is related to cellular / genetic aberrations in these neoplastic cells. Activation of cellular signaling including the AKT and STAT pathways results in increased PD-Ll expression. In primary mediastinal B-cell lymphomas, gene fusion of the MHC class II transactivator (CIITA) with PD-L1 or PD-L2 occurs, resulting m over expression of these proteins. Amplification of chromosome 9p23-24, where PD-Ll and PD-L2 are located, leads to increased expression of both proteins in classical Hodgkin lymphoma. Adaptive mechanisms are related to induction of PD-Ll expression in the tumor microenvironment. PD-Ll can be induced on neoplastic cells in response to interferon y. In microsatellite instability colon cancer, PD-Ll is mainly expressed on myeloid cells in the tumors, which then suppress cytotoxic T-cell function.

[0161] The use of PD-1 blockade to enhance anti-tumor immunity originated from observations in chronic infection models, where preventing PD-1 interactions reversed T-cell exhaustion. Similarly, blockade of PD-1 prevents T-cell PD-1 / tumor cell PD-L1 or T-cell PD-1 / tumor cell PD-L2 interaction, leading to restoration of T-cell mediated anti-tumor immunity.

[0162] A detailed description of PD-1, and the use of anti-PD-1 antibodies to treat cancers are described, e.g., in Topalian, Suzanne L., et al. "Safety, activity, and immune correlates of anti-PD-1 antibody in cancer," New England Journal of Medicine 366.26 (2012): 2443-2454; Hirano, Fumiya, et al. "Blockade ofB7-Hl and PD-1 by monoclonal antibodies potentiates cancer therapeutic immunity." Cancer research 65.3 (2005): 1089-1096; Raedler, Lisa A. "Keytruda (pembrolizumab): first PD-1 inhibitor approved for previously treated unresectable or metastatic melanoma." American health & drug benefits 8. Spec Feature (2015): 96; Kwok, Gerry, et al. "Pembrolizumab (Keytruda)." (2016): 2777-2789; US 20170247454; US 9,834,606 B; and US 8,728,474; each of which is incorporated by reference in its entirety. In one aspect, the disclosure is related to a CAR comprising a PD-Ll-binding domain, wherein the PD-L1 -binding domain comprises or is derived from all or part of the extracellular region of PD-1 (e.g., human PD-1; SEQ ID NO: 33).

[0163] As used herein, the term “PD-Ll-binding domain” refers to a protein domain that can bind to PD-L1. In some embodiments, the PD-Ll-binding domain can be an anti-PD-Ll antibody, an antigen-binding fragment thereof (e.g., a scFv or a VHH), or a PD-Ll-binding protein or a portion thereof. In some embodiments, the PD-L1 -binding domain comprises or consists of a PD-1 extracellular domain. The PD-1 can be a wild type PD-1, a human PD-1, a polypeptide derived from a wildtype PD-1 (e.g., with mutations), or a portion thereof (e.g., the extracellular region of PD-1). In some embodiments, the polypeptide derived from a wildtype PD-1 can have one or more mutations. In some embodiments, the PD-1 extracellular domain comprises or consists of substantially the entire extracellular region of PD-1 or the variant thereof. In some embodiments, the PD-1 extracellular domain comprises or consists of a portion of the extracellular region of PD-1 or the variant thereof. In some embodiments, the PD-1 extracellular domain has one or more mutations.

[0164] According to UniProt identifier Q 15116, the extracellular region of human PD-1 corresponds to amino acids 24-170 of SEQ ID NO: 33, the transmembrane region of human PD-1 corresponds to amino acids 171-191 of SEQ ID NO: 33, and the cytoplasmic region of human PD-1 corresponds to amino acids 192-288 of SEQ ID NO: 33. The PD-1 extracellular region also has an IgV domain, which corresponds to amino acids 35-145 of the human PD-1 protein (SEQ ID NO: 33; NP_005009.2), The signal peptide corresponds to amino acids 1-23 of SEQ ID NO: 33. The cytoplasmic region of human SIRPa also has an immunoreceptor tyrosine-based inhibition motif (ITIM; corresponding to amino acids 221-226 of SEQ ID NO: 33) and a Immunoreceptor tyrosine-based switch motif (ITSM; corresponding to amino acids 241-251 of SEQ ID NO: 33).

[0165] In some embodiments, the PD-Ll-binding domain comprises a sequence that corresponds to positions 21-147 of a wild-type human PD-1 protein (SEQ ID NO: 33). In some embodiments, the PD-L1 -binding domain comprises an ammo acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 25.

[0166] In some embodiments, the polypeptide derived from a wildtype PD-1 can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) mutations. Details of possible mutations that can be introduced to the wild-type PD-1 can be found, e.g., in Maute, R. L., et al. "Engineering high-affinity PD-1 variants for optimized immunotherapy and immuno-PET imaging." Proceedings of the National Academy of Sciences 112.47 (2015): E6506-E6514, which is incorporated herein by reference in its entirety.

[0167] The disclosure also provides nucleic acid comprising a polynucleotide encoding the PD-L1 -binding domain and the CAR targeting PD-L1.

[0168] In some embodiments, the PD-L1 -binding domain comprises an ammo acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 25.

[0169] In some embodiments, the CAR described herein comprises, optionally from N-terminus to C-terminus, an optional CD8 signal peptide (e.g., any of the CD8 signal peptides described herein), an optional c-Myc tag (e.g., any of the c-Myc tags described herein), the PD-L1 -binding domain (e.g., any of the PD-L1 -binding domains described herein), a CD28 extracellular domain (e.g., any of the CD28 extracellular domains described herein), a CD28 transmembrane domain (e.g., any of the CD28 transmembrane domains described herein), a CD28 co-stimulatory domain (e.g., any of the CD28 co-stimulatory domains described herein), and a CD3z intracellular signaling domain (e.g., any of the CD3z intracellular signaling domains described herein). In some embodiments, the CAR described herein comprises an amino acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 24.

[0170] d. PSMA CAR

[0171] Prostate-specific membrane antigen (PSMA), also known as glutamate carboxy peptidase II, N-acetyl-a-linked acidic dipeptidase I, or folate hydrolase, is a type II transmembrane glycoprotein belonging to the M28 peptidase family. The protein acts as a glutamate carboxypeptidase on various substrates, including the nutrient folate and the neuropeptide N-acetyl-l-aspartyl-l-glutamate. The PSMA protein has a unique 3-part structure: a 19-amino-acid internal portion, a 24-amino-acid transmembrane portion, and a 707-amino-acid external portion. Prostate- specific membrane antigen is considered to be the best-established target antigen in prostate cancer because it is highly and specifically expressed on the surface of prostate tumor cells at all tumor stages.

[0172] PSMA is located in the cytosol in normal prostate cells and switches to a membranebound protein in prostatic carcinoma. Despite its name, PSMA is not specific for prostate cancer. Most PSMA expression appears to be restricted to the prostate, but lower-level expression is seen in the brain, kidneys, salivary glands, and small intestine. The level of PSMA expression rises with increasing tumor dedifferentiation and in metastatic and hormone-refractory cancers.

[0173] The PSMA receptor has an oncogenic signaling role in prostate cancer cells, acting on glutamate receptors and activating the PI3K and Akt growth pathways. It is overexpressed in 90% of metastatic prostate cancer while having a low level of physiological expression m normal tissues (prostate, small intestine, salivary and lachrymal glands, and kidney). Cellular studies have demonstrated that once a PSMA-ligand binds to the PSMA receptor, there is internalization that leads to intracellular trapping with prolonged retention of the ligand. This appears to happen predominantly within tumor cells, while in normal tissues, where there may be non-specific uptake, there is relatively rapid washout. This phenomenon is demonstrable by repeated scintigraphic imaging using PSMA ligands radiolabeled with gamma-emitter isotopes with differential clearance kinetics from tumor sites compared to normal tissues. These features make PSMA an ideal target for novel prostate cancer therapies, either by radiolabeling PSMA ligands in the case of radionuclide therapy or by targeting PSMA using immunotherapeutic approaches, A detailed review of PSMA and its functions can be found in Chang, S. S. "Overview of prostate-specific membrane antigen." Reviews in Urology 6. Suppl 10 (2004): S13; Giraudet, A. L., et al. "PSMA targeting in metastatic castration-resistant prostate cancer: Where are we and where are we going? Ther. Adv." Med. Oncol 13.17588359211053898 (2021); and Afshar-Oromieh, A., et al. "The rise of PSMA ligands for diagnosis and therapy of prostate cancer." Journal of Nuclear Medicine 57. Supplement 3 (2016): 79S-89S; each of which is incorporated by reference in its entirety.

[0174] In one aspect, the disclosure is related to a CAR comprising a PSMA-binding domain, wherein the PSMA-binding domain comprises or is derived from a single chain variable fragment (scFv), comprising a heavy chain variable region (VI I) and a light chain variable region (VL). As shown in FIG. 10B, the VH of the scFv comprises a CDR1 set forth in SEQ ID NO: 34, a CDR2 set forth in SEQ ID NO: 35 and a CDR3 set forth in SEQ ID NO: 36, and the VL of the scFv comprises a CDR1 set forth in SEQ ID NO: 37, a CDR2 set forth in SEQ ID NO: 38, and a CDR3 set forth m SEQ ID NO: 39. In some embodiments, the CDRs are defined under Kabat definition.

[0175] The amino acid sequence for heavy chain variable region (VH) and light chain variable region ( VL) of the scFv are also provided. The amino acid sequence for the VH is set forth in SEQ ID NO: 40. The amino acid sequences for the VL is set forth in SEQ ID NO: 41.

[0176] In some embodiments, the scFv can have a heavy chain variable region (VH) comprising complementarity determining regions (CDRs) 1, 2, 3, wherein the CDR1 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 34, the CDR2 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 35, and the CDR3 region comprises or consists of an ammo acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 36, and a light chain variable region VL) comprising CDRs 1, 2, 3, wherein the CDR1 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 37, the CDR2 region comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 38, and the CDR3 region comprises or consists of an ammo acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 39.

[0177] In some embodiments, the scFv described herein can contain a heavy chain variable domain containing one, two, or three of the CD Rs of SEQ ID NO: 34 with zero, one or two amino acid insertions, deletions, or substitutions; SEQ ID NO: 35 with zero, one or two amino acid insertions, deletions, or substitutions; SEQ ID NO: 36 with zero, one or two amino acid insertions, deletions, or substitutions. In some embodiments, the antibody or an antigen-binding fragment described herein can contain a light chain variable domain containing one, two, or three of the CDRs of SEQ ID NO: 37 with zero, one or two ammo acid insertions, deletions, or substitutions; SEQ ID NO: 38 with zero, one or two ammo acid insertions, deletions, or substitutions; SEQ ID NO: 39 with zero, one or two amino acid insertions, deletions, or substitutions. The insertions, deletions, and substitutions can be within the CDR sequence, or at one or both terminal ends of the CDR sequence.

[0178] The disclosure also provides scFv that binds to PSMA. The scFv contain a heavy chain variable region (VH) comprising or consisting of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 40, and a light chain variable region (VL) comprising or consisting of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 41.

[0179] The disclosure also provides nucleic acid comprising a polynucleotide encoding the scFv, the PSMA-binding domain, and the CAR targeting PSMA.

[0180] In some embodiments, the scFv described herein comprises from N-terminus to C-terminus: the VH, a linker peptide, and the VL. In some embodiments, the scFv described herein comprises from N-terminus to C-terminus: the VL, a linker peptide, and the VH In some embodiments, the linker peptide is a flexible linker. In some embodiments, the flexible linker is a GS linker. Details of flexible linkers can be found, e.g., in Chen, X., et al. "Fusion protein linkers: property, design and functionality." Advanced Drug Delivery Reviews 65.10 (2013): 1357-1369, which is incorporated herein by reference in its entirety. In some embodiments, the linker peptide comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of SEQ ID NO: 26. In some embodiments, the linker peptide comprises or consists of an amino acid sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO: 23,

[0181] In some embodiments, the PSMA-binding domain comprises an ammo acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17.

[0182] In some embodiments, the C / XR described herein comprises, optionally from N-terminus to C-terminus, an optional CD8 signal peptide (e.g., any of the CD8 signal peptides described herein), an optional c-Myc tag (e.g., any of the c-Myc tags described herein), the PSMA-bmding domain (e.g., any of the PSMA-binding domains described herein), a CD28 extracellular domain (e.g., any of the CD28 extracellular domains described herein), a CD28 transmembrane domain (e.g., any of the CD28 transmembrane domains described herein), a CD28 co- stimulatory domain (e.g., any of the CD28 co-stimulatory domains described herein), and a CD3z intracellular signaling domain (e.g., any of the CD3z intracellular signaling domains described herein). In some embodiments, the CAR described herein comprises an amino acid sequence having at least about 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18.

[0183] Engineered Celis

[0184] One aspect of the present disclosure provides engineered cells comprising a nucleic acid comprising a heat-responsive promoter (e.g., any of the heat-responsive promoters described herein), and a sequence encoding the protein of interest (e.g., any of the proteins of interest described herein).

[0185] The engineered cells described herein may comprise an engineered receptor (e.g., any of the CAR molecules described herein). The engineered receptor (e.g., CAR) may redirect the specificity of the engineered cells through the expression of a chimeric antigen receptor (CAR) or TCR on these cells. CAR expression may be induced through electroporation of engineered cells for the insertion of genetic material, or by infecting these cells with viral vectors, such as lentiviruses or retroviruses containing the desired genetic material. Such genetic editing may improve the potency of the engineered cells by improving homing, cytokine production, recycle killing, and / or improved engraftment.

[0186] The engineered cells described herein may express more than one polypeptide chains. The engineered cells described herein may express more than one engineered receptors, such as any combination of CAR, TCR, or TAC receptors. The engineered cell expressing the engineered receptors described herein may be used to treat cancer.

[0187] Comparing to a cell not engineered to express the protein of interest described herein (e.g., a wild-type T cell), the engineered cell described herein may have a higher cytotoxicity against tumor cells. Comparing to a cell not engineered to express the protein of interest described herein (e.g., a wild-type T cell), the engineered cell described herein may have a higher persistence and / or proliferation in the tumor microenvironment.

[0188] In some embodiments, the engineered cell can be an immune cell (e.g., a T cell, a natural killer (NK) cell, a B cell, a monocyte, a macrophage, or a combination thereof). Accordingly, such engineered cells may possess the specificity directed by the engineered receptor (e.g., CAR) that is expressed therein. For example, an engineered cell of the present disclosure comprising a CAR(s) may possess specificity for one or more antigen(s) on a target cell (e.g., one or more tumor antigen(s) on a cancer cell).

[0189] The engineered cells may be modified immune cells. The engineered cells may be selected from a group consisting of T cells, aPT cells, y5T cells, NK cells, peripheral blood mononuclear cells (PBMC), hematopoietic stem cells, pluripotent stem cells, embryonic stem cells, and a combination thereof. The engineered cells may be T cells. The engineered cells may be NK cells. The engineered cells may be aP T cells. The engineered cells may be y8 I' cells. The engineered cells may be V61 T cells.

[0190] The engineered cells may be an autologous cells, syngeneic cells, allogeneic cells, or xenogeneic cells with respect to the individual receiving them. The engineered cells may be modified by changing the major histocompatibility complex (MHC) profile, by inactivating P2-microglobulin to prevent the formation of functional Class I MHC molecules, or by inactivating Class II MHC molecules. The engineered cells may be autologous cells obtained from the human subject receiving them. The engineered cells may be autologous T cells obtained from the human subject receiving them.

[0191] The engineered cells described herein may include eukaryotic cells, e.g,, mammalian cells. The engineered cells may be human cells. The engineered cells may be equine, bovine, murine, ovine, canine, or feline cells..

[0192] To evaluate the CAR positive rate, amplification and viability of the engineered cells in vitro, the engineered cells are repeatedly stimulated by tumor cells for several rounds in a rechallenge assay. The engineered cells may be amplified by more than I fold, more than 2 fold, more than 3 fold, more than 4 fold, more than 5 fold, more than 6 fold, more than 7 fold, more than 8 fold, more than 9 fold, more than 10 fold, more than 15 fold, more than 20 fold, more than 25 fold, more than 30 fold, more than 35 fold, more than 40 fold, more than 45 fold, more than 50 fold, more than 60 fold, more than 70 fold, more than 80 fold, more than 90 fold, more than 100 fold, more than 110 fold, more than 120 fold, more than 150 fold, more than 200 fold, more than 300 fold, or more than 400 fold, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay. Each round of stimulation lasts for 1 day, 2 days, 3 days, 4 days or 5 days. Comparing to the cells not engineered to express the protein of interest described herein (e.g., a wild-type T cell), the amount of amplification of the engineered cells described herein may increase by more than 5%, more than 10%, more than 15%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 150%, more than 200%, more than 250%, more than 300%, more than 400%, more than 500%, more than 600%, more than 700%, more than 800%, more than 900%, or more than 1000%.

[0193] The engineered cells may have a CAR positive rate of more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, or more than 90%, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay. The engineered ceils may have a CAR positive rate of less than 5%, less than 10%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less than 50%, less than 55%, less than 60%, less than 65%, less than 70%, less than 75%, less than 80%, or less than 90%, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay.

[0194] Comparing to the cells not engineered to express the protein of interest described herein (e g., a wild-type T cell), the engineered cells described herein may have a similar CAR positive rate, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay.

[0195] The engineered cells may have a viability of more than 5%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, more than 55%, more than 60%, more than 65%, more than 70%, more than 75%, more than 80%, or more than 90%, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay. The engineered cells may have a viability of less than 5%, less than 10%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less than 50%, less than 55%, less than 60%, less than 65%, less than 70%, less than 75%, less than 80%, or less than 90%, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay. Comparing to the cells not engineered to express the protein of interest described herein (e.g., a wild-type T cell), the engineered cells described herein may have a similar viability, after 1 round, 2 rounds, 3 rounds, 4 rounds, or 5 rounds of stimulation in a re-challenge assay.

[0196] The cytotoxicity of the engineered cells against tumor cells may be evaluated in a cytotoxicity assay, where the engineered cells are co-cultured with tumor cells (e.g., any of the tumor cells described herein). The effector cell: target cell (E: T) ratio may be 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4.5, 1:4, 1:3.5, 1:3, 1:2.5, 1:2, 1:1.5, 1:1, 1.5:1, 2:1, 2.5:1, 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1. the engineered cells described herein may have a cytotoxicity that is at least 1-fold, at least 2-fold, at least 3 -fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, or at least 100-fold as compared to that of the cells not engineered to express the protein of interest described herein (e.g., a wild-type T cell). In some embodiments, the E: T ratio is about 500:1, 400:1, 300:1, 200:1, 100:1, 90:1, 80:1, 70:1, 60:1, 50:1, 40:1, 30:1, 20:1, or 10:1. In some embodiments, the E: T ratio is about 1:500, 1:400, 1:300, 1:200, 1:100, 1:90, 1:80, 1:70, 1:60, 1: 50, 1:40, 1:30, 1:20, or 1:10. In some embodiments, the engineered cells and target cells are co-cultured for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days. In some embodiments, the cytotoxicity is determined by quantifying the killing efficiency of the engineered cells, e.g., by measuring the fluorescent signal emitted by target cells.

[0197] In some embodiments, the engineered cells and target cells are co-cultured in the presence of one or more cytokines (e.g., IL-2). In some embodiments, the engineered cells and target cells are co-cultured in the absence of any cytokines (e.g,, IL-2). In some embodiments, the concentration of the one or more cytokines is about 10U, about 20U, about 50U, about 100U, about 200U, about 300U, about 400U, about 500U, about 600U, about 700U, about 800U, about 900U, about 1000U, about 2000U, about 3000U, about 4000U, about 5000U, or about 10000U.

[0198] Nucleic Acids

[0199] The present disclosure provides a nucleic acid comprising a heat-responsive promoter (e.g., any of the heat-responsive promoters described herein), and a sequence encoding the protein of interest (e.g., any of the proteins of interest described herein). The nucleic acids of the present disclosure can also comprise a nucleic acid sequence encoding any one of the proteins of interest, e.g., any of the engineered receptors described herein (CARs and / or TCRs disclosed herein). The expression of the proteins of interest may be regulated by a heat-responsible promoter (e.g., any of the heat-responsive promoters described herein).

[0200] A nucleic acid of the present disclosure may comprise a first nucleic acid sequence and a second nucleic acid sequence. The first nucleic acid may be upstream of the second nucleic acid or the first nucleic acid may be downstream of the second nucleic acid. The first and second nucleic acid sequence can be separated by a linker. A linker for use in the present disclosure allows for multiple proteins to be encoded by the same nucleic acid sequence (e.g., a multicistronic or bicistronic sequence), which are translated as a polyprotein that is dissociated into separate protein components. The nucleic acid may comprise from 5' end to 3' end of the first nucleic acid sequence, the linker, and the second nucleic acid sequence. The nucleic acid may comprise from 5' end to 3' end the second nucleic acid sequence, the linker, and the first nucleic acid sequence. In some embodiments, the first nucleic acid sequence may include a heat-responsive promoter described herein and the second nucleic acid sequence may encode a protein of interest (e.g., CAR) described herein. In some embodiments, the first nucleic acid sequence may encode a first protein of interest (e.g., a first CAR) described herein and the second nucleic acid sequence may encode a protein of interest (e.g,, a second CAR) described herein. In some embodiments, the first and second CARs are the same. In some embodiments, the first and second CARs are different.

[0201] The linker described herein may comprise a nucleic acid sequence that encodes for a self-cleaving peptide. As used herein, a “self-cleaving peptide” or “2A linker” refers to an oligopeptide that allow multiple proteins to be encoded as polyproteins, which dissociate into component proteins upon translation. Use of the term “self-cleaving” is not intended to imply a proteolytic cleavage reaction. Various self-cleaving or 2A linkers are known to those of skill in the art, including, without limitation, those found in members of the Picornaviridae virus family, e.g., foot-and-mouth disease virus (FMDV), equine rhinitis A virus (ERAVO), Thosea asigna virus (TaV), and porcine tescho virus-1 (PTV-1); and carloviruses such as Theilovirus and encephalomyocarditis viruses. 2A linkers derived from FMDV, ERAV, PTV-1, and TaV are referred to herein as “F2A,” “E2A,” “P2A,” and “T2A,” respectively.

[0202] A nucleic acid of the present disclosure may comprise a restriction enzyme site sequence. A nucleic acid of the present disclosure can be operably linked to a transcriptional control element, e.g., a promoter, and enhancer, etc.

[0203] The promoter may be a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or an NK-specific promoter. For example, a CD4 gene promoter can be used; see, e.g., Salmon et al. Proc. Natl. Acad. Sci. USA (1993) 90:7739; and Marodon et al. (2003) Blood 101:3416. As another example, a CD8 gene promoter can be used. NK cellspecific expression can be achieved by use of an Neri (p46) promoter; see, e.g., Eckelhart et al. Blood (2011) 117:1565.

[0204] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any nucleic acid sequence operatively linked thereto. Other constitutive promoter sequences can also be used, including, but not limited to a simian virus 40 (SV40) early promoter, a mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, a MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, an actin promoter, a myosin promoter, a hemoglobin promoter, and a creatine kinase promoter. Further, the disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the nucleic acid sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.

[0205] The nucleic acid of the present disclosure may be provided for the production of a protein of interest (e.g., any of the engineered receptors described herein), e.g., in a mammalian cell. The nucleic acid of the present disclosure may provide for amplification of the nucleic acid. A vector, for example an expression vector (e.g., a lenti viral vector or a retroviral vector) can be used to introduce the nucleic acid described herein into an immune cell (e.g., a T cell) or precursor thereof. The vector may comprise a heat-responsive promoter (e.g., any of the heat-responsive promoters described herein) and a sequence encoding a protein of interest (e.g., any of the proteins of interest described herein). In some embodiments, the heat-responsive promoter may include one or more feedback loop elements (e.g., any one or a combination of the feedback loop elements described herein).

[0206] The vector may comprise additional elements that will aid in the functional expression of the protein of interest (e.g., any of the engineered receptors described herein). The expression vector may comprise a mammalian promoter.

[0207] The vector may comprise additional elements that will aid in tracking expression of the protein of interest (e.g., any of the engineered receptors described herein) and / or biodistribution of cells expressing the protein of interest (e.g., any of the engineered cells described herein). For example, the vector may include a reporter gene promoter (e.g., a PGK promoter) and a reporter gene (e.g., truncated CD 19).

[0208] Other physiological promoters suitable for use in a vector can be incorporated into a vector of the present disclosure. The vector may comprise a non-requisite cis acting sequence that can improve titers and gene expression.

[0209] The nucleic acid can encode a naked CAR. The nucleic acid can comprise from the 5' end to the 3' end, an optional CD8 signal peptide, an optional c-Myc- tag, an antigen-binding region that specifically binds to the tumor antigen, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain; and a CD3z intracellular signaling domain. The nucleic acid may encode an amino acid sequence that is at least 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the ammo acid sequence set forth in SEQ ID NO: 9, 18, 19, or 24.

[0210] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The amino acid residues or nucleotides at corresponding ammo acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same ammo acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

[0211] Introduction of Polynucleotides into Host Ceils

[0212] The polynucleotides (e.g., vectors) described herein can be introduced as one or more polynucleotides or constructs, optionally comprising a marker that will allow for selection of host cells that contain the construct(s). The genes and regulatory regions can be isolated, as appropriate, ligated, cloned in an appropriate cloning host, analyzed by restriction or sequencing. Particularly, using PCR, individual fragments including all or portions of a functional unit can be isolated, where one or more mutations can be introduced using "primer repair", ligation, in vitro mutagenesis, etc. as appropriate. The polynucleotides obtained and demonstrated to have the appropriate sequences can then be introduced into the host cell by any convenient means. The polynucleotides can be integrated and packaged into non-replicating, defective viral genomes like lentivirus, Adenovirus, Adeno-associated virus (AAV), or Herpes simplex virus (HSV) or others, including retroviral vectors, for infection or transduction into cells. The polynucleotides can include viral sequences for transfection, if desired. Alternatively, the polynucleotides can be introduced by fusion, electroporation, biolistics, transfection, lipofection, or the like. The host cells can be grown and expanded in culture before introduction of the construct(s), followed by the appropriate treatment for introduction of the construct(s) and integration of the construct(s). The cells are then expanded and screened by virtue of a marker present in the construct. Various markers that can be used successfully include hprt, neomycin resistance, thymidine kinase, hygromycm resistance, etc. The protein of interest (e.g., any of the engineered receptors described herein) can be introduced into the engineered cells as an RNA for transient expression. RNA can be delivered to the engineered cells (e.g., any of the immune cells described herein) of the disclosure by various means including microinjection, electroporation, and lipid- mediated transfection, for example. Introduction of constructs into the cell's genome can occur via transposons. An example of a synthetic transposon for use is the Sleeping Beauty transposon that comprises an expression cassette including the appropriate gene of active fragment thereof. The construct can be integrated at a particular locus in the genome of the host cell. An endogenous gene can be replaced with the gene encoded for by the construct using homologous recombination.

[0213] A construct encoding a protein of interest (e.g., any of the engineered receptors described herein) can be introduced into the host cell using a lentiviral delivery system or a retroviral delivery system.

[0214] The host cells described herein can be human cells. The host cells can be human T cells. The human T cells can be purified from commercialized PBMCs. The host cells can be aPT cells. The host cells can be y8T cells. The host cells can be V51 y5T cells. The host cells can be V82 yST cells. The host cells can be V83 yST cells. The host cells can be tumor-infiltrating lymphocytes (TIL). The host cells can be NK cells (e.g., primary NK cells). The human NK cells can be purified from commercialized PBMCs. The host cells can be PBNK cells. The host cells can be expanded and / or activated before use. The host cells can be PBMCs isolated from healthy donors.

[0215] Allogeneic Cell or Allogeneic Cells

[0216] In one aspect, the present disclosure provides allogeneic cells (or allogenic cells), the terms “allogeneic cells”, “allogeneic immune cells” or “allogeneic engineered immune cells” are used interchangeably herein to refer to the cells are obtained from allogeneic donor. The allogeneic cells may be T cells or NK cells. The T cell may a y8 T cell or an a.p T cell.

[0217] In some aspects, the allogeneic cell can be an allogeneic T cell, e.g., an allogeneic T cell lacking expression of endogenous T cell receptor (TCR) and / or human leukocyte antigen (IILA), e.g., I ILA Class I and / or IILA Class II. In some embodiments, the allogeneic T cell has a normal expression level (e.g., at least 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140% or 150% as compared to that of a wildtype T cell) of endogenous HLA Class I and / or HLA Class II molecules.

[0218] In some aspects, the allogeneic cell can be a T cell lacking a functional endogenous TCR. A T cell lacking a functional endogenous TCR can be, e.g., engineered such that it does not express any functional TCR on its surface, engineered such that it does not express one or more subunits that comprise a functional TCR (e.g., engineered such that it does not express (or exhibits reduced expression of) TCRa, TCRP, TCRy, TCR5, CD3y, CD35, CD3s and / or ζ-chain, or engineered such that it produces very little functional TCR on its surface. Alternatively, the T cell can express a substantially impaired TCR, e.g., by expression of mutated or truncated forms of one or more of the subunits of the TCR. The term "substantially impaired TCR" means that this TCR will not elicit an adverse immune reaction in a host.

[0219] In some aspects, the T cell or NK cell described herein can be, e.g., engineered such that it does not express a functional HLA on its surface. For example, a cell described herein can be engineered such that cell surface HLA, e.g., HLA Class I and / or HLA Class II, is downregulated. In some aspects, downregulation of HLA may be accomplished by reducing or eliminating expression of beta-2 microglobulin (B2M). In some aspects, the T cell or NK cell described herein can express a functional HLA on its surface. For example, the expression of cell surface HLA, e.g., HLA Class I and / or HLA Class II, are not eliminated or reduced in the engineered cells. In some embodiments, the beta-2-microglobulin (B2M) gene of the engineered cell is not genetically modified.

[0220] In some aspects, the cell can lack a functional TCR and a functional HLA, e.g., HLA Class I and / or HLA Class II. Engineered cells that lack expression of a functional TCR and / or HLA can be obtained by any suitable means, including a knockout or knock down of one or more subunit of TCR or HLA. For example, the T cell or NK cell can include a knock down of TCR and / or HLA using siRNA, shRNA, clustered regularly interspaced short palindromic repeats (CRISPR), transcription-activator like effector nuclease (TALEN), or zinc finger endonuclease (ZFN). Methods of Treatment

[0221] The polypeptides described herein, the polynucleotides described herein and the engineered cells described herein can be used in a variety of experimental, therapeutic and commercial applications.

[0222] In one aspect, the disclosure provides a method of modulating an immune response comprising administering an effective amount of engineered cells described herein to a subject in need thereof.

[0223] In one aspect, the disclosure provides a method of treating a disease or disorder in a subject, the method comprising administering to the subject, an effective amount of the engineered cell (e.g., engineered cells expressing any one of the proteins of interest described herein and / or cells activated using any of the methods described herein). In one aspect, the present disclosure provides a method for treating cancer comprising administering an effective amount of engineered cells (e.g., engineered cells expressing any one of the proteins of interest described herein and / or cells activated using any of the methods described herein) to the subject. Examples of cancer that can be treated include, but are not limited to, solid tumors. In some embodiments, the tumors can be original tumors or metastatic tumors.

[0224] The term “effective amount” as used herein means an amount effective, at dosages and for periods of time necessary to achieve the desired results.

[0225] In one embodiment, an effective amount of the engineered cells provided to a subject is at least 2×106cells / kg, at least 3×106cells / kg, at least 4×106cells / kg, at least 5×106cells / kg, at least 6×106cells / kg, at least 7×106cells / kg, at least 8×106cells / kg, at least 9×106cells / kg, or at least 10×106cells / kg, or more cells / kg, including all intervening doses of cells. One of ordinary skill in the art would recognize that multiple administrations of the compositions contemplated in particular embodiments may be required to effect the desired therapy. For example, a composition may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more times over a span of 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 1 year, 2 years, 5, years, 10 years, or more.

[0226] The disclosure further includes the use of the engineered cells described herein in the manufacture of a medicament or pharmaceutical composition to modulate an immune response. to treat an infection or to treat cancer as described hereinabove. The engineered cells can also be used in experimental models, for example, to further study and elucidate the function of the cells.

[0227] One or more of the engineered cells described herein can be administered to a subject in a single, unified form, such as an intravenous injection, or in multiple forms, for example, as multiple intravenous infusions or injections, or subcutaneous injections. In some cases, the engineered cells can expand within a subject's body, in vivo, after administration to a subject. The engineered cells can be frozen to provide cells for multiple treatments with the same cell preparation. The engineered cells of the disclosure, and pharmaceutical compositions comprising the same, can be packaged as a kit. A kit can include instructions (e.g., written instructions) on the use of the engineered cells and compositions comprising the same. In some embodiments, one or more of the engineered cells described herein can be administered to a subject via intratumoral injections.

[0228] The cells can be administered at a desired dosage, which in some aspects includes a desired dose or number of cells or cell type(s) and / or a desired ratio of cell types. Thus, the dosage of cells may be based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types. The dosage of cells may be based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types. The dosage may be based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations. The engineered cells described herein can be administered before, during, or after the occurrence of a disease or condition, and the timing of administering the engineered cells can vary. For example, the engineered cells can be used as a prophylactic and can be administered continuously to subjects with a propensity to conditions or diseases in order to lessen a likelihood of the occurrence of the disease or condition. The engineered cells can be administered to a subject during or as soon as possible after the onset of the symptoms. The administration of the engineered cells can be initiated immediately within the onset of symptoms, within the first 3 hours of the onset of the symptoms, within the first 6 hours of the onset of the symptoms, within the first 24 hours of the onset of the symptoms, within 48 hours of the onset of the symptoms, or within any period of time from the onset of symptoms. The initial administration can be via any route practical (e.g., intravenous infusions or injections), such as by any route described herein using any formulation described herein. The administration of the engineered cells of the disclosure can be an intravenous administration. One or multiple dosages of the engineered cells can be administered as soon as is practicable after the onset of a cancer or an infectious disease, and for a length of time necessary for the treatment of the disease, such as, for example, from about 24 hours to about 48 hours, from about 48 hours to about 1 week, from about 1 week to about 2 weeks, from about 2 weeks to about 1 month, from about 1 month to about 3 months. For the treatment of cancer, one or multiple dosages of the engineered cells can be administered years after onset of the cancer and before or after other treatments. The engineered cells can be administered for at least about 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months, at least 1 year, at least 2 years at least 3 years, at least 4 years, or at least 5 years. The length of treatment can vary for each subject.

[0229] Methods for administration of engineered cells for adoptive cell therapy are known and can be used in connection with the provided methods and compositions. For example, adoptive T cell therapy methods are described, e.g., in US Patent Application Publication No.2003 / 0170238 to Gruenberg et al; US Patent No.4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10): 577-85). See, e.g., Themeli etal. (2013) Nat Biotechnol.31(10): 928-933;

[0230] Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338, The cell therapy, e.g., adoptive T cell therapy may be carried out by autologous transfer, in which the cells are isolated and / or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.

[0231] The cell therapy (e.g., adoptive T cell therapy) may be carried out by allogeneic transfer, in which the cells are isolated and / or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject. The cells may then be administered to a different subject, e.g., a second subject, of the same species. The first and second subjects may be genetically identical. The first and second subjects may be genetically similar. The second subject may express the same HLA class or supertype as the first subject.

[0232] The subject may have been treated with a therapeutic agent targeting the disease or condition, e.g. the tumor, prior to administration of the cells or composition containing the cells. In some aspects, the subject is refractory or non-responsive to the other therapeutic agent. The subject may have persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. The administration may effectively treat the subject despite the subject having become resistant to another therapy.

[0233] The subject may be responsive to the other therapeutic agent, and treatment with the therapeutic agent reduces disease burden. In some aspects, the subject is initially responsive to the therapeutic agent, but exhibits a relapse of the disease or condition over time. The subject may not have relapsed. The subject may be determined to be at risk for relapse, such as at a high risk of relapse, and thus the cells are administered prophylactically, e.g., to reduce the likelihood of or prevent relapse. In some aspects, the subject has not received prior treatment with another therapeutic agent.

[0234] The subject may have persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. The administration may effectively treat the subject despite the subject having become resistant to another therapy.

[0235] The engineered cells described herein can be administered to an animal, preferably a mammal, even more preferably a human, to treat cancer. In addition, engineered cells can be used for the treatment of any condition related to a cancer, especially a cell-mediated immune response against a tumor cell(s), where it is desirable to treat or alleviate the disease. The types of cancers to be treated with the engineered cells or pharmaceutical compositions include, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas. Other exemplary cancers include but are not limited breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, thyroid cancer, and the like. The cancers can be non- solid tumors (such as hematological tumors) or solid tumors. Adult tumors / cancers and pediatric tumors / cancers are also included. The cancer can be a solid tumor or a hematological tumor. The cancer can be a carcinoma. The cancer can be a sarcoma. The cancer can be a leukemia. The cancer can be a solid tumor.

[0236] Solid tumors are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, melanoma, and CNS tumors (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases). In some embodiments, the engineered cells are used in the treatment of solid tumors or cancers. Solid tumors or cancers include, but are not limited to, adrenal cancer, adrenocortical carcinoma, anal cancer, appendix cancer, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain / CNS cancer, breast cancer, bronchial tumors, cardiac tumors, cervical cancer, cholangiocarcinoma, chondrosarcoma, chordoma, colon cancer, colorectal cancer, craniopharyngioma, ductal carcinoma in situ (DCIS) endometrial cancer, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, eye cancer, fallopian tube cancer, fibrous histiocytoma, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor (GIST), germ cell tumors, glioma, glioblastoma, head and neck cancer, hemangioblastoma, hepatocellular cancer, hypopharyngeal cancer, intraocular melanoma, kaposi sarcoma, kidney cancer, laryngeal cancer, leiomyosarcoma, lip cancer, liposarcoma, liver cancer, lung cancer, non-small cell lung cancer, lung carcinoid tumor, malignant mesothelioma, medullary carcinoma, medulloblastoma, menangioma, melanoma, Merkel cell carcinoma, midline tract carcinoma, mouth cancer, myxosarcoma, myelodysplastic syndrome, myeloproliferative neoplasms, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, oligodendroglioma, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic islet cell tumors, papillary carcinoma, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pinealoma, pituitary tumor, pleuropulmonary blastoma, primary peritoneal cancer, prostate cancer, rectal cancer, retinoblastoma, renal cell carcinoma, renal pelvis and ureter cancer, rhabdomyosarcoma, salivary gland cancer, sebaceous gland carcinoma, skin cancer, soft tissue sarcoma, squamous cell carcinoma, small cell lung cancer, small intestine cancer, stomach cancer, sweat gland carcinoma, synovioma, testicular cancer, throat cancer, thymus cancer, thyroid cancer, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vascular cancer, vulvar cancer, and Wilms Tumor. In some embodiments, the engineered cells are used in the treatment of solid tumors or cancers including, without limitation, liver cancer, pancreatic cancer, lung cancer, breast cancer, bladder cancer, brain cancer, bone cancer, thyroid cancer, kidney cancer, or skin cancer.

[0237] Carcinomas that can be amenable to therapy by a method disclosed herein include, but are not limited to, esophageal carcinoma, hepatocellular carcinoma, basal cell carcinoma (a form of skin cancer), squamous cell carcinoma (various tissues), bladder carcinoma, including transitional cell carcinoma (a malignant neoplasm of the bladder), bronchogenic carcinoma, colon carcinoma, colorectal carcinoma, gastric carcinoma, lung carcinoma, including small cell carcinoma and non-small cell carcinoma of the lung, adrenocortical carcinoma, thyroid carcinoma, pancreatic carcinoma, breast carcinoma, ovarian carcinoma, prostate carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, renal cell carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical carcinoma, uterine carcinoma, testicular carcinoma, osteogenic carcinoma, epithelial carcinoma, and nasopharyngeal carcinoma.

[0238] Sarcomas that can be amenable to therapy by a method disclosed herein include, but are not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteogenic sarcoma, osteosarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, and other soft tissue sarcomas.

[0239] In some embodiments, the engineered cells are used in the treatment of liquid cancers or hematological cancers. In some embodiments, the engineered cells are used in the treatment of B-cell malignancies, including but not limited to, leukemias, lymphomas, and multiple myeloma.

[0240] The engineered cells (e.g., immune cells, T cells, or NK cells) described herein can be included in a composition for immunotherapy. The composition can include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition comprising the engineered cells can be administered.

[0241] The engineered cells can be immediately used in the above therapeutic, experimental or commercial applications or the cells can be cryopreserved for use at a later date. The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0242] The engineered cells disclosed herein can be formulated in unit dosage forms suitable for single administration of precise dosages. In some cases, the unit dosage forms comprise additional lymphocytes. In unit dosage form, the formulation is divided into unit doses containing appropriate quantities of one or more compounds. The unit dosage can be in the form of a package containing discrete quantities of the formulation. Non-limiting examples are packaged tablets or capsules, and powders in vials or ampoules. Aqueous suspension compositions can be packaged in single-dose non-reclosable containers. Multiple-dose reclosable containers can be used, for example, in combination with a preservative or without a preservative. In some examples, the pharmaceutical composition does not comprise a preservative. Formulations for parenteral injection can be presented in unit dosage form, for example, in ampoules, or in multi-dose containers with a preservative. In further embodiments, heat shock is re-applied to the subject / patient for one, two, three, four, five, six, seven, eight, nine, ten or more times periodically, or as needed, to mitigate the severity or appearance of the tumor.

[0243] EXAMPLES

[0244] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0245] Example 1. Controlled tumor elimination by heat-shock inducible CAR-T cells

[0246] In a heat-inducible CAR-T cell design, the CAR molecule can only be expressed after heat shock (FIG. 1A). As shown in FIG. 1B, at a basal temperature of 37°C, the engineered CAR- 1' cells maintain a quiescent state with minimal CAR expression due to the inactivity of the heat-responsive promoter (7HH; SEQ ID NO: 2). Upon exposure to an elevated temperature of about 41-46°C (e.g., 42-43°C), the 7HH promoter is activated, initiating the transcriptional upregulation and surface expression of the CAR molecules (FIG. 1B, steps 1-2). The CAR expression can mediate the activation of T cells and the targeted destruction of antigen-positive tumor cells. This process is further potentiated by a feedback loop (FB) designed to sustain CAR expression, which can sense T cell and tumor cell engagement, thereby prolonging the antitumor response (FIG. 1B, step 3). The thermally induced CAR-T cells are then capable of recognizing and binding to specific antigens on tumor cells, leading to their targeted destruction. This approach leverages the controlled application of heat to modulate CAR-T cell activity, providing a refined method for enhancing the precision and efficacy of CAR-T cell-mediated immunotherapy. This design is modular, and the CAR molecule can be adapted to target multiple solid tumor types.

[0247] Example 2. Enhancing CAR expression and viability through preheated media for large-scale cell production

[0248] The optimization of heat shock conditions is crucial when scaling up heat-inducible PSMACAR-T cell production, as it ensures consistent and effective CAR expression across larger cell batches while maintaining cell viability. This is particularly relevant for clinical applications, where large quantities of functional CAR.-T cells are required. To address this, we tested large-scale cell heat shock conditions, using the conventional small-scale heat shock method in PCR tubes as a control. During this phase of development, we used PSMA CAR (CAR promoter: SEQ ID NO: 1; PSMA CAR: SEQ ID NO: 18) as test bed.

[0249] During large-scale heat shock treatment (up to 20 mL of cell suspension), the gradual increase in temperature is impractical due to the difficulty in controlling temperature in a larger volume of medium, as is commonly done in a PCR tube with only 50 pL of medium.

[0250] To conduct the large-scale heat shock experiment on T cells, we began by preparing the culture medium. The medium was supplemented with 100 lU / mL of IL-2 and then preheated in a water bath set to 43 °C, ensuring the temperature was stable before use. Meanwhile, T cells were harvested and resuspended in the preheated medium at the desired concentration (20 nnllion-40 nnllion / ml). The resuspended T cells were then transferred into 50 mL centrifuge tubes. The tubes were subsequently placed in a water bath maintained at 43°C, where the I' cells were subjected to heat shock for varying durations according to the experimental design. Care was taken to maintain a consistent temperature throughout the heat shock process. Following the heat shock treatment, the tubes were transferred to an incubator set at 37°C to allow the T cells to recover for 2 hours. Throughout the procedure, attention was given to ensuring accurate temperature control and gentle handling of the T cells to minimize unintended stress.

[0251] FIGS. 2A-2D compared the cell viability and CAR expression between small-scale and large-scale heat shock (HS) conditions. As shown in FIGS. 2A-2B, the data revealed that under these large-scale heat shock conditions, cell viability was even improved compared to the small-scale PCR tube stimulation approach. Correspondingly, as shown in FIG. 2C-2D, a timedependent increase in the percentage of CAR-expressing cells was observed, with CAR expression exceeding 50% after 30 minutes of HS treatment. Thus, preheating the culture medium prior to HS not only preserved cell viability7but also facilitated the use of extended HS durations, thereby enhancing CAR expression. These findings suggest that optimizing thermal conditions during HS can significantly improve the efficiency of CAR-T cell generation, providing a robust protocol for achieving high levels of CAR expression. Example 3. Optimized storage condition for HS-induced CAR-T cells

[0252] Optimizing storage conditions is critical for the heat-inducible PSMACAR-T product, as it ensures the viability and efficacy of the CAR-T cells when delivered to patients. We tested two storage strategies: the first involved inducing CAR expression after thawing the cells (FIG. 3A, left panel), and the second involved inducing CAR expression before freezing the cells (FIG. 3A, right panel). Our results indicated that T cells in the group subjected to I IS before freezing exhibited a significantly higher PSMA-CAR expression rate and expression level compared to the group where HS was performed after thawing (FIGS. 3B-3C). After HS, the CAR molecule takes some time to be expressed, which is crucial for determining the optimal freezing time. To identify the best time for freezing, we tested the kinetics of CAR expression and found that CAR expression becomes significantly high after 1 hour of induction and reaches a plateau after 2 hours (FIG. 3D). Based on these findings, freezing the cells after HS induction (with additional 2 hours recovery) would be the optimal time point, which can ensure maximum CAR expression and preserving the cells’ viability and therapeutic potency over time, making them more practical for clinical use.

[0253] Example 4. High cell toxicity of heat-inducible CAR-T cells to tumor cells

[0254] We further evaluated the cytotoxic efficacy of heat-inducible PSMACAR-T cells against Fluc+PSMA+ PC3 tumor cells, using non-engineered wild-type (WT) T cells as a control. To quantify the killing efficiency of the T cells, we measured the Flue signal of the tumor cells after co-culture with the T cells at varying effector-to-target (E: T) ratios. As shown m FIGS. 4A-4B, the results demonstrated that the heat-inducible PSMACAR-T cells exhibited significantly stronger killing ability compared to WT T cells across all tested E: T ratios. This enhanced cytotoxicity was consistent across T cells from two different donors, highlighting the robust and reproducible nature of the PSMA-C AR T cells in mediating targeted tumor cell lysis. These findings underscore the potential of PSMA-CAR T cells as an effective therapeutic strategy for targeting PSMA-expressing tumors. Example 5. Versatility and efficacy of modular CAR-T cells across multiple tumor targets This approach is applicable to other CAR-T designs, as the CAR system is modular. We further evaluated the cytotoxic efficacy of heat-inducible CAR-T cells against various tumor cells, using non-engmeered wild-type (WT) T cells as a control. To quantify the killing efficiency of the T cells, all target tumor cells were engineered to express a Flue signal, allowing us to measure tumor cell viability after co-culture with T cells at varying effector-to-target (E: T) ratios. Specifically, we engineered heat-activated MSLNCAR (SEQ ID NO: 19) targeting MSLN-positive HeLa cells and GD2CAR (SEQ ID NO: 9) targeting GD2-positive U87-MG cells. As shown in FIGS.5A-5B, the results demonstrated that the heat-mducible CAR-T cells exhibited significantly stronger killing ability compared to WT I' cells across all tested E: T ratios and all CAR candidates.

[0255] Additionally, we engineered a high-affinity PD1 CAR (SEQ ID NO: 24) that can bind to PDL1, which is commonly expressed on multiple tumor cells. As shown in FIGS.5C-5F, among the tumor cells we tested, including PC3 (prostate cancer), HeLa (cervical cancer), SK-OV-3 (ovarian cancer), and U87-MG (glioblastoma), the highaffmityPDl -CAR-T cells consistently showed enhanced cytotoxicity compared to WT T cells.

[0256] Example 6. In vivo inhibition of unilateral prostate tumors by heat-activated PSMACAR-T cells

[0257] To study the cytotoxicity of heat-inducible PSMACAR-T cells against prostate cancer in vivo, a prostate cancer xenograft mouse model was employed. The widely used PC3 prostate cancer cell line, which expresses PSMA and a luciferase reporter gene, was utilized. The luciferase reporter gene allows for quantitative monitoring of tumor growth via IVIS (In Vivo Imaging System) imaging. As shown in FIGS.6A-6B, PSMA-expressing PC3 cells were injected subcutaneously into the lateral thigh of immunodeficient NSG mice to establish a prostate xenograft model. Thirteen days after tumor formation, PSMACAR-T cells were heat-activated in vitro and injected subcutaneously near the tumors in the treatment group. The mice received six injections (2 million cells per injection) of the heat-activated FB-PSMACAR-T cells every two days, while the control group did not receive any T cell injections. As shown in FIG.

[0258] 6C, IVIS monitoring revealed rapid tumor growth m the control group after Day 13, whereas tumor growth was significantly inhibited in the treatment group. The results demonstrated that heat-activated PSMACAR-T cells effectively inhibit prostate tumors in vivo.

[0259] Example 7. In vivo inhibition of bilateral prostate tumors by heat-activated PSMACAR-T cells

[0260] To further investigate the cytotoxicity of PSMACAR-T cells against prostate cancer in vivo, PSMA-expressing PC3 cells were injected subcutaneously into both left and right lateral thighs of immunodeficient NSG mice to establish a bilateral prostate xenograft model (FIG. 7A). Thirteen days later, gene-edited PSMACAR-T cells were heat-activated in vitro and injected subcutaneously near the right tumor in the treatment group. Mice received six injections (2 million cells per injection) of heat-activated PSMACAR-T cells every two days near the right tumor; no injections were given near the left tumor, which served as the distal control group. As shown in FIG. 7B, I VIS monitoring revealed rapid growth of the left tumor after Day 13, whereas the right tumor was significantly inhibited. Inhibition of the left distal tumor was also observed to some extent after 20 days. The results indicated that heat-activated PSMACAR-T cells significantly inhibited prostate tumor growth in vivo and also exhibited potential inhibitory effects on metastatic tumors.

[0261] To evaluate the potential toxicity of PSMACAR-T cells to normal tissues and organs, major organs of control, treatment, and bilateral tumor group mice were sectioned and subjected to H& E staining on Day 27 to examine tissue damage. As shown in FIG. 8, H& E staining showed no significant tissue damage in the hearts, livers, spleens, lungs, or kidneys of the unilateral treatment group and the bilateral tumor group compared to the control group, indicating that PSMACAR-T cells do not exhibit significant toxicity to normal tissues and organs.

[0262] Example 8. In vivo safety study of FB-PSMACAR-T cells

[0263] Compared to continuously expressing PSMACAR-T cells, heat-activated PSMACAR-T cells theoretically have lower off-target toxicity. To verify this, a bilateral prostate xenograft mouse model was used. Since PSMA expression is low in normal tissues, PC3 cells with low PSMA expression were injected subcutaneously into the lateral thigh of NSG mice to simulate normal tissue antigen expression, with no treatment administered (left tumor in FIG.9A).

[0264] Simultaneously, PC3 cells with high PSMA expression were injected subcutaneously into the opposite thigh to establish a prostate xenograft (right tumor in FIG.9A). After 11 days, gene-edited PSMACAR-T cells were heat-activated in vitro and injected subcutaneously near the right tumor in the treatment group. Mice received injections of heat-activated T cells every four days, with no injections given near the left tumor, which served as the distal control group. As shown in FIG. 9B, IVIS monitoring revealed significant inhibition of the right tumor after Day 11, with no observable inhibition of the left tumor. These results indicate that PSMACAR-T cells exhibit low off-target toxicity and demonstrate therapeutic safety.

[0265] OTHER EMBODIMENTS

[0266] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. WHAT IS CLAIMED IS:

1. A method for activating a population of cells that express a protein of interest, comprising a) providing a population of cells comprising a nucleic acid comprising3.a heat-responsive promoter, and4.a sequence encoding the protein of interest; and5.b) introducing a heat shock to the population of cells, thereby activating the population of cells.

2. A method of preserving the expression level of a protein of interest in a population of cells, comprising:7.a) providing a population of cells comprising a nucleic acid comprising8.a heat-responsive promoter, and9.a sequence encoding the protein of interest;10.b) introducing a heat shock to the population of cells, thereby activating the population of cells; and11.c) freezing the population of activated ceils, e.g., in liquid nitrogen.

3. The method of claim 1 or 2, wherein the population of cells comprise an immune cell (e.g,, a T cell, a natural killer (NK) cell, a B cell, a monocyte, a macrophage, or a combination thereof).

4. The method of any one of claims 1 -3, wherein the heat shock is introduced by contacting the population of cells with a pre-heated medium, optionally the pre-heated medium comprises a cytokine (e.g., IL-2).

5. The method of claim 4, wherein the temperature of the pre-heated medium is maintained at about 41-46°C (e.g., about 43°C) during the heat shock.

6. The method of claim 5, wherein the pre-heated medium is maintained at the temperature consistently during the heat shock, e.g., using a water bath and / or by agitation.

7. The method of any one of claims 4-6, wherein the population of cells are contacted with the pre-heated medium for about 5 minutes to about 24 hours (e.g., 20 minutes).

8. The method of any one of claims 4-7, wherein the population of cells are suspended in the pre-heated medium that has a volume of about 1 ml to about 30,000 liter (e.g., 50 ml).

9. The method of any one of claims 4-8, wherein the population of cells are suspended in the pre-heated medium, and the population of cells have a concentration of about 1 * 105to about 1 x 1010cells / ml (e.g., about 2 x 106to about 4 x 107cells / ml).

10. The method of any one of claims 1-9, wherein the heat shock is not introduced by ultrasound.

11. The method of any one of claims 1-10, wherein the population of cells are recovered at about 37°C after the heat shock.

12. The method of claim 11, wherein the population of cells are recovered for about 1-24 hours (e.g., about 2 hours).

13. The method of any one of claims 1-12, wherein the heat-responsive promotor comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of heat shock elements, wherein each heat shock element comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 8.

14. The method of any one of claims 1-13, wherein the heat- responsive promotor comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 2.

15. The method of any one of claim 1-14, wherein the heat- responsive promoter further comprises one or more feedback loop elements that are designed to sustain expression of the protein of interest.

16. The method of claim 15, wherein the one or more feedback loop elements comprise a CRE (cAMP Response Element), a SRE (Serum Response Element), a NEXT-RE (Nuclear factor of activated I' cell Response Element), a NFKB-RE (nuclear factor kappa B Response Element), and / or a YBTATA-mini-promoter.

17. The method of claim 15 or 16, wherein the one or more feedback loop elements comprise, optionally from 5’ end to 3’ end:25.(1) a CRE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 3;26.(2) a SRE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 4;27.(3) a NEAT-RE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 5;28.(4) a NFKB-RE comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 6; and / or29.(5) a YBTATA-mini-promoter comprising or consisting of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 7.

18. The method of any one of claims 15-17, wherein the heat-responsive promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 1.

19. The method of any one of claims 1-18, wherein the protein of interest is an engineered receptor, e.g., a chimeric antigen receptor (CAR), an engineered T cell receptor (TCR), a T cell antigen coupler (TAC) or a portion thereof.

20. The method of claim 19, wherein the engineered receptor specifically targets a tumor antigen.

21. The method of claim 20, wherein the tumor antigen is selected from the group consisting of BCMA, CLL1, CD4, GPC3, GPRC5D, GU2CYC, CD19, MUC16, MUC1, CAIX, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD 133, CD 138, EGP-2, EGP-40, EpCAM, ERBB2, ERBB3, ERBB4, FBP, fetal acetylcholine receptor, folate receptor-a, GD2, GD3, HER-2, hTERT,! L-13R-a2, K-light chain, KDR, LeY, LI cell adhesion molecule, MAGE-A1, mesothelin, MAGEA3, p53, MARTI, GP100, proteinase-3 (PR3), tyrosinase, survivin, hTERT, EphA2, NY-ESO-1, h5T4, PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, CD 123, CD44V6, NKCS1, IGF1R, EGFR, EGFR- VIII, Claudm 18.2, Claudin 6, NKG2D, Delta-like 3 (DLL3), CD70, CS-1, c- Met, Glycolipid F77, MSLN, PD-L1, and PD-L2.

22. The method of any one of claims 19-21, wherein the engineered receptor is a CAR that specifically targets a tumor antigen (e.g., PSMA, GD2, EGFR, MSLN, or PD-L1).

23. The method of claim 22, wherein the CAR comprises, optionally from N-terminus to C- terminus:35.(1) an optional CD8 signal peptide;36.(2) an optional c-Myc tag;37.(3) an antigen-binding region that specifically binds to the tumor antigen;38.(4) a CD28 extracellular domain;39.(5) a CD28 transmembrane domain;40.(6) a CD28 co-stimulatory domain; and41.(7) a CD3z intracellular signaling domain,24. The method of claim 23, wherein:43.the optional CD8 signal peptide comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 10; the optional c-Myc tag comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 11;44.the CD28 extracellular domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 13;45.the CD28 transmembrane domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 14;46.the CD28 co-stimulatory domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 15; and / or47.the CD3z intracellular signaling domain comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 16.

25. The method of any one of claims 19-24, wherein:49.(1) the engineered receptor is a CAR comprising an antigen-binding region that specifically binds to PSMA, wherein the CAR comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 18;50.(2) the engineered receptor is a CAR comprising an antigen-binding region that specifically binds to GD2, wherein the CAR comprises or consists of an ammo acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 9;51.(3) the engineered receptor is a CAR comprising an antigen-binding region that specifically binds to MS LN, wherein the antigen-binding region comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 19; or52.(4) the engineered receptor is a CAR comprising an antigen-bmding region that specifically binds to PD-L1, wherein the antigen-binding region comprises or consists of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:

24.

26. The method of any one of claims 2-25, wherein the rate of cells expressing the protein of interest and / or the expression level of the protein of interest (e.g., a CAR) are increased by at least 1-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold as compared to those when step (c) occurs prior to step (b).

27. The method of claim 26, wherein the protein of interest is a CAR, and the population of cells are T cells.

28. The method of any one of claims 2-27, wherein the method further comprises thawing and / or recovering the population of activated cells after step (c).

29. The method of claim 28, wherein the population of activated cells are recovered at about 37°C after being thawed for about 1-24 hours (e.g., about 2 hours).

30. A population of activated cells prepared using the method of any one of claims 1-29.

31. An engineered cell comprising a nucleic acid comprising a heat-responsive promoter and a sequence encoding the protein of interest, wherein the sequence encoding the protein of interest is operably linked to the heat-responsive promoter, optionally the heat-responsive promoter further comprises one or more feedback loop elements.

32. The engineered cell of claim 31, wherein the heat-responsive promoter comprises or consists of a nucleic acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 1 or 2,33. The engineered cell of claim 31 or 32, wherein the engineered cell lacks a functional endogenous T cell receptor (TCR).

34. A chimeric antigen receptor (CAR) comprising a PSMA (prostate-specific membrane antigen)-binding domain, wherein the PSMA-binding domain comprises a single chain variable fragment (scFv), comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH of the scFv comprises a CDR1 set forth in SEQ ID NO: 34 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 35 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 36 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3, and the VL of the scFv comprises a CDR1 set forth in SEQ ID NO: 37 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 38 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 39 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3.

35. The CAR of claim 34, wherein the VH of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 40, and the VL of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 41.

36. The CAR of claim 34 or 35, wherein the scFv comprises from N-terminus to C-terminus: the VH, a linker peptide, and the VL; or the scFv comprises from N-terminus to C-terminus: the VL, a linker peptide, and the VH; optionally, wherein the linker peptide is a flexible linker that comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of SEQ ID NO: 26.

37. The CAR of any one of claims 34-36, wherein the PSMA-binding domain comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 17.

38. The CAR of any one of claims 34-37, wherein the CAR comprises, from N-terminus to C- terminus: an optional signal peptide, the PSMA-binding domain, an optional hinge domain, a transmembrane domain, and an intracellular signaling domain.

39. The CAR of any one of claims 34-37, wherein the CAR comprises, from N-terminus to C- terminus: an optional CD8 signal peptide, an optional c-Myc tag, the MSLN-binding domain, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3z intracellular signaling domain.

40. The CAR of any one of claims 34-39, wherein the CAR comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 18.

41. A chimeric antigen receptor (CAR) comprising a MSLN (mesothelin)-binding domain, wherein the MSLN-binding domain comprises a single chain variable fragment (scFv), comprising a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH of the scFv comprises a CDR1 set forth in SEQ ID NO: 27 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 28 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 29 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3, and the VL of the scFv comprises a CDR1 set forth in SEQ ID NO: 30 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR1, a CDR2 set forth in SEQ ID NO: 31 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR2, and a CDR3 set forth in SEQ ID NO: 32 or a variant thereof comprising up to about 3 amino acid substitutions in the CDR3.

42. The CAR of claim 41, wherein the VH of the scFv comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 21, and the VL of the scFv comprises an amino acid sequence having at leastabout 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 22.

43. The CAR of claim 41 or 42, wherein the scFv comprises from N-terminus to C-terminus: the VH, a linker peptide, and the VL; or the scFv comprises from N-terminus to C-terminus: the VL, a linker peptide, and the VH; optionally, wherein the linker peptide is a flexible linker that comprises one or more repeats (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats) of SEQ ID NO: 26.

44. The CAR of any one of claims 41-43, wherein the MSLN-binding domain comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 20.

45. The CAR of any one of claims 41-44, wherein the CAR comprises, from N-terminus to C- terminus: an optional signal peptide, the MSLN-binding domain, an optional hinge domain, a transmembrane domain, and an intracellular signaling domain.

46. The CAR of any one of claims 41-44, wherein the CAR comprises, from N-terminus to C- terminus: an optional CD8 signal peptide, an optional c-Myc tag, the MSLN-binding domain, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3z intracellular signaling domain.

47. The CAR of any one of claims 41-46, wherein the CAR comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 19,48. A chimeric antigen receptor (CAR) comprising a PD-L1 (programmed death-ligand 1 )- binding domain, wherein the PD-L1 -binding domain comprises or is derived from all or part of the extracellular region of PD-1 (programmed cell death protein 1), e.g., human PD-1.

49. The CAR of claim 48, wherein the PD-L1 -binding domain comprises a sequence that corresponds to positions 21-147 of a wild-type human PD-1 protein (SEQ ID NO: 33).

50. The CAR of claim 48 or 49, wherein the PD-L1 -binding domain comprises an amino acid sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 25.

51. The CAR of any one of claims 48-50, wherein the CAR comprises, from N-terminus to C- terminus: an optional signal peptide, the MSLN-binding domain, an optional hinge domain, a transmembrane domain, and an intracellular signaling domain.

52. The CAR of any one of claims 48-50, wherein the CAR comprises, from N-terminus to C- terminus: an optional CD8 signal peptide, an optional c-Myc tag, the PD-Ll-binding domain, a CD28 extracellular domain, a CD28 transmembrane domain, a CD28 co-stimulatory domain, and a CD3z intracellular signaling domain.

53. The CAR of any one of claims 48-52, wherein the CAR comprises an amino acid sequence having at least about 80%, 85%, 90%, or 95% sequence identity to the amino acid sequence set forth in SEQ ID NO: 24.

54. An engineered cell expressing the CAR of any one of claims 34-53.

55. A method of treating a disease or disorder in a subject, the method comprising administering to the subject, an effective amount of the population of activated cells of claim 30, and / or the engineered cell of any one of claims 31-33, and 54.

56. The method of claim 55, wherein the disease or disorder is cancer, autoimmune disease, or infection.

57. The method of claim 56, wherein the cancer is a solid tumor, e.g., prostate cancer, cervical cancer, ovarian cancer, or glioblastoma.

58. The method of any one of claims 55-57, wherein the cells are CAR-T cells and the subject is a human subject.

Images