A synthetic gene regulator t autoimmune regulator
Sequence-selective DNA binding compounds with a polyamide moiety and BET binding ligand target the TTATTA sequence to restore AIRE gene expression, addressing the limitations of current APS1 treatments and enhancing therapeutic outcomes for autoimmune diseases.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ST JUDE CHILDRENS RES HOSPITAL INC
- Filing Date
- 2025-11-03
- Publication Date
- 2026-05-07
AI Technical Summary
Current treatments for autoimmune polyendocrine syndrome 1 (APS1) caused by autoimmune regulator (AIRE) dysfunction are limited, and existing chemical interventions for gene expression control have broad, undesired transcriptome-wide consequences.
Development of sequence-selective DNA binding compounds comprising a polyamide moiety tethered to a bromodomain extraterminal domain (BET) binding ligand, designed to target the TTATTA sequence and restore AIRE gene expression.
The compounds specifically enhance AIRE gene expression, offering a targeted therapeutic intervention for APS1 and related autoimmune diseases, with potential benefits including improved treatment efficacy and reduced side effects.
Smart Images

Figure IMGF000025_0001 
Figure IMGF000028_0001 
Figure IMGF000029_0001
Abstract
Description
A SYNTHETIC GENE REGULATOR T AUTOIMMUNE REGULATORCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This Application claims the benefit of U. S. Application No. 63 / 716,179, filed on November 04, 2024, the contents of which are incorporated herein by reference in its entirety.REFERENCE TO SEQUENCE LISTING
[0002] This Application includes a Sequence Listing filed electronically as an XML file named “19116_0060Pl_SL / ’ created on November 01, 2025. with a size of 12,088 bytes. The Sequence Listing is incorporated herein by reference in its entirety.BACKGROUND
[0003] The heterogenous disease termed autoimmune poly endocrine syndrome 1 (APS1) is an autoimmune disorder resulting directly from mutations in autoimmune regulator (AIRE / T-AIRE)(Bjorklund, G. et al., (2022) Autoimmunity Reviews 21, 103135). Considered a monogenic disease, mutations in AIRE disrupt normal regulation of antigen expression leading to loss of normal antigen regulation and abnormal clonal cell populations. AIRE mutation and deletion then leads to a broad range of symptoms, up to and including mortality due to limited immune defense. Disease presentation is highly variable across patients, and was predominantly mapped to the AIRE gene locus, a surprising feature for the expected multi-loci heterogenous nature of autoimmune disorders (Mathis, D. and Benoist, C., (2007) Nature Reviews Immunology 7, 645-650). APS1 is an orphan disease, with limited treatment measures. Its diagnosis is often delayed to later in life due to multiplicity7of symptoms (candidiasis, hypoparathyroidism, Addison's disease) and relies on genetic counseling and lifelong patient care as treatment measures (Bjorklund, G. et al., (2022) Autoimmunity Reviews 21, 103135)
[0001] . As such, promising treatment measures that stimulate AIRE target gene expression are required.
[0004] One method to stimulate AIRE target gene expression is to take advantage of targeted control of gene expression with rationally designed small molecules. Chemical control of gene expression is typically achieved by inhibiting enzymes that act on the transcriptional machinery / chromatin or by perturbing protein-protein interactions that drive gene expression(Dervan, P. B. (2019) Isr J. Chem. 59 (1-2) 71-83; Ptashne, M.; Gann, A. (2002) Genes & Signals; Cold Spring Harbor Laboratory Press: Cold Spring Harbor: NY,; Vol. 402; Henley, M. J.; Koehler, A. N. (2021) Nat. Rev. Drug Discovery 20 (9), 669-688). Such chemical interventions have broad, often undesired, transcriptome-wide consequences, which constrain therapeutic applications. The promise of targeting specific genomic loci by design has fueled the exploration and development of different classes of sequence-selective DNA-binding molecules. Among these, pyrrole-imidazole polyamides have emerged as a versatile class of molecules that can be rationally designed to target nearly every permutation of the DNA sequence observed in the human genome (White, S., et al., (1998) Nature 391 (6666) 468-471. Not only does this class of synthetic DNA-binding molecules display sequence selectivity and affinity properties that are comparable to mammalian DNA-binding transcription factors (TFs), but they can also access binding sites in nucleosomes and heterochromatin (Dervan, P. B. (2019) Isr J. Chem. 59 (1-2) 71-83; Carlson, C. D.; et al., (2010) Proc. Natl. Acad. Sci. U. S. A. 107 (10), 4544-4549; Erwin, G. S.; et al, (2016) Proc. Natl. Acad. Sci. U. S. A. 113 (47), E7418-E7427; Edayathumangalam, R. S.; et al., (2004) Proc. Natl. Acad. Sci. U. S. A. 101 (18), 6864-6869; Gottesfeld, J. M.; et al., (2002) J. Mol. Biol. 321 (2), 249-263; Suto, R. K.; et al., (2003) J. Mol. Biol. 326 (2), 371-380; Puckett, J.W.; et al., (2007) J. Am. Chem. Soc. 129 (40), 12310-12319). Moreover, polyamides retain their sequence specificity when further conjugated to other small molecules or peptides. These heterobifunctional molecules, much like their natural counterparts, leverage the principle of induced proximity (Stanton, B. Z.; et al, (2018) Science 359 (6380) No. eaao5902; Gerry, C. J.; Schreiber, S. L. (2020) Nat. Chem. Biol. 16 (4) 369-378) to ‘‘recruit'’ specific cellular machinery to targeted genomic loci. This form of chemically induced proximity enables the recruited proteins to perform targeted genomic transactions.
[0005] Currently, there is no therapeutic modality that addresses APS1 (or APECED) that is caused by AIRE dysfunction. Thus, there remains a need for compounds intended to promote AIRE target expression that offer a novel, targeted, mechanism-guided rational therapeutic intervention.SUMMARY
[0006] In accordance with the purpose(s) of the invention, as embodied and broadly described herein, the invention, in one aspect, relates to sequence selective deoxyribonucleic acid (DNA) binding compound comprising a polyamide moiety configured to bind a DNAsequence. The invention also relates to to pharmaceutical compositions comprising the compounds, and methods of using the compounds for restoring expression of autoimmune regulator (AIRE) gene. The invention further relates to pharmaceutical compositions comprising the compounds, and methods of using the compounds for treating an autoimmune disease (e.g., Addison disease. Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes).
[0007] Thus, in one aspect, disclosed are sequence selective deoxyribonucleic acid (DNA) binding compounds comprising a polyamide moiety configured to bind a DNA sequence, or a pharmaceutically acceptable salt thereof, wherein the polyamide moiety is tethered via a first chemical linker to a bromodomain extraterminal domain (BET) binding ligand, and wherein the polyamide moiety is configured to bind a sequence5TTATTA3.
[0008] Also disclosed are pharmaceutical compositions comprising a disclosed compound, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0009] Also disclosed are methods for restoring expression of autoimmune regulator (AIRE) gene in a cell, the method comprising contacting the cell with an effective amount of a disclosed compound or a pharmaceutically acceptable salt thereof.
[0010] Also disclosed are methods for restoring expression of autoimmune regulator (AIRE) gene in a subject in need thereof, the method comprising administering to the subject an effective amount of the a disclosed compound or a pharmaceutically acceptable salt thereof.
[0011] Also disclosed are methods treating an autoimmune disease in a subject in need thereof, the method comprising administering to the subject an effective amount of the a disclosed compound or a pharmaceutically acceptable salt thereof.
[0012] While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory7class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps oroperational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects and together with the description serve to explain the principles of the invention.
[0014] FIG. 1A and FIG. IB shows representative data illustrating relative expression of S100A8 mRNA, a known target of T-AIRE in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of either hairpin or linear polyamide.
[0015] FIG. 2 shows representative data illustrating relative expression of HCP5 mRNA, a know n target of T-AIRE in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of either hairpin or linear polyamide.
[0016] FIG. 3 shows representative data illustrating relative expression of Insulin mRNA, a known target of T-AIRE in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of either hairpin or linear polyamide.
[0017] FIG. 4 shows representative data illustrating relative expression of S100A8 and Insulin mRNA in Jurkat cells after 24 hours of treatment with different concentrations (0.5 pM, 1 pM, or 10 pM) of SYNGR with linear polyamide.
[0018] FIG. 5 shows representative data of a quantitative real time polymerase chain reaction (qRT-PCR) data relevant to a candidate small molecule (termed AIRE4) designed to target the TTATTA moiety relevant to AIRE. In these data, AIRE target genes (S100A8, Insulin. HCP5, AIRE) were consistently elevated upon micromolar-level treatment of Jurkat T lymphocytes.
[0019] FIG. 6A and FIG.6B shows representative data illustrating relative expression of insulin mRNA and S100A8 in Jurkat cells after 24 hr of treatment with lOpM of SYNGR with linear polyamide.
[0020] FIG. 7A-C shows representative data illustrating relative expression of HCP5, SI 00 and AIRE mRNA in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of linear polyamide.
[0021] FIG. 8 shows representative data illustrating relative expression of S100A8, a known targets of T-AIRE in HEK293T cells following treatment for 24 hr with varying (IpM or lOpM) of SYNGR comprising of hairpin polyamide.
[0022] While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.DETAILED DESCRIPTION
[0023] The present invention can be understood more readily by reference to the following detailed description of the invention and the Examples included therein.
[0024] Before the present compounds, compositions, articles, systems, devices, and / or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.
[0025] While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is no wayintended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.
[0026] Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein may be different from the actual publication dates, which can require independent confirmation.A. DEFINITIONS
[0027] As used in the specification and the appended claims, the singular forms “a,” "an" and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a functional group,” “an alkyl,” or “a residue” includes mixtures of two or more such functional groups, alkyls, or residues, and the like.
[0028] As used in the specification and in the claims, the term “comprising” can include the aspects “consisting of’ and “consisting essentially of.”
[0029] Ranges can be expressed herein as from “about” one particular value, and / or to “about” another particular value. When such a range is expressed, another aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0030] As used herein, the terms "about” and “at or about” mean that the amount or value in question can be the value designated some other value approximately or about the same. It isgenerally understood, as used herein, that it is the nominal value indicated ±10% variation unless otherwise indicated or inferred. The term is intended to convey that similar values promote equivalent results or effects recited in the claims. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but can be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors know n to those of skill in the art. In general, an amount, size, formulation, parameter or other quantity7or characteristic is “about” or “approximate” whether or not expressly stated to be such. It is understood that where “about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0031] References in the specification and concluding claims to parts by weight of a particular element or component in a composition denotes the weight relationship between the element or component and any other elements or components in the composition or article for which a part by weight is expressed. Thus, in a compound containing 2 parts by weight of component X and 5 parts by w eight component Y, X and Y are present at a weight ratio of 2:5, and are present in such ratio regardless of whether additional components are contained in the compound.
[0032] A weight percent (wt. %) of a component, unless specifically stated to the contrary, is based on the total weight of the formulation or composition in which the component is included.
[0033] As used herein, the terms “optional” or “optionally” means that the subsequently described event or circumstance can or cannot occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
[0034] As used herein, the term “subject” can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In one aspect, the subject is a mammal. A patient refers to a subject afflicted with a disease or disorder. The term “patient” includes human and veterinary7subjects.
[0035] As used herein, the term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically towardthe improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. In various aspects, the term covers any treatment of a subject, including a mammal (e.g, a human), and includes: (i) preventing the disease from occurring in a subject that can be predisposed to the disease but has not yet been diagnosed as having it; (ii) inhibiting the disease, / .<?., arresting its development; or (iii) relieving the disease, i.e., causing regression of the disease. In one aspect, the subject is a mammal such as a primate, and, in a further aspect, the subject is a human. The term “subject” also includes domesticated animals (e.g, cats, dogs, etc.), livestock (e.g, cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e g, mouse, rabbit, rat, guinea pig, fruit fly, etc.).
[0036] As used herein, the term “prevent" or “preventing” refers to precluding, averting, obviating, forestalling, stopping, or hindering something from happening, especially by advance action. It is understood that where reduce, inhibit or prevent are used herein, unless specifically indicated otherwise, the use of the other two words is also expressly disclosed.
[0037] As used herein, the term “diagnosed” means having been subjected to a physical examination by a person of skill, for example, a physician, and found to have a condition that can be diagnosed or treated by the compounds, compositions, or methods disclosed herein.
[0038] As used herein, the terms “administering” and “administration” refer to any method of providing a pharmaceutical preparation to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, apreparation can be administered therapeutically: that is. administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition.
[0039] As used herein, the terms “effective amount'’ and “amount effective” refer to an amount that is sufficient to achieve the desired result or to have an effect on an undesired condition. For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a disease or condition.
[0040] As used herein, “dosage form” means a pharmacologically active material in a medium, carrier, vehicle, or device suitable for administration to a subject. A dosage form can comprise a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, in combination with a pharmaceutically acceptable excipient, such as a preservative, buffer, saline, or phosphate buffered saline. Dosage forms can be made using conventional pharmaceutical manufacturing and compounding techniques. Dosage forms can comprise inorganic or organic buffers (e.g., sodium or potassium salts of phosphate, carbonate, acetate, or citrate) and pH adjustment agents (e.g., hydrochloric acid.sodium or potassium hydroxide, salts of citrate or acetate, amino acids and their salts) antioxidants (e.g., ascorbic acid, alpha-tocopherol), surfactants (e.g., polysorbate 20, polysorbate 80, polyoxyethylene9-10 nonyl phenol, sodium desoxycholate), solution and / or cryo / lyo stabilizers (e.g., sucrose, lactose, mannitol, trehalose), osmotic adjustment agents (e.g., salts or sugars), antibacterial agents (e.g., benzoic acid, phenol, gentamicin), antifoaming agents (e.g., polydimethylsilozone), preservatives (e.g., thimerosal, 2-phenoxyethanol, EDTA), polymeric stabilizers and viscosity-adjustment agents (e.g., polyvinylpyrrolidone, poloxamer 488, carboxymethylcellulose) and co-solvents (e.g., glycerol, polyethylene glycol, ethanol). A dosage form formulated for injectable use can have a disclosed compound, a product of a disclosed method of making, or a salt, solvate, or polymorph thereof, suspended in sterile saline solution for injection together with a preservative.
[0041] As used herein, “kit’' means a collection of at least two components constituting the kit. Together, the components constitute a functional unit for a given purpose. Individual member components may be physically packaged together or separately. For example, a kit comprising an instruction for using the kit may or may not physically include the instruction with other individual member components. Instead, the instruction can be supplied as a separate member component, either in a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation.
[0042] As used herein, “instruction(s)” means documents describing relevant materials or methodologies pertaining to a kit. These materials may include any combination of the following: background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the kit, trouble-shooting, references, technical support, and any other related documents. Instructions can be supplied with the kit or as a separate member component, either as a paper form or an electronic form which may be supplied on computer readable memory’ device or downloaded from an internet website, or as recorded presentation. Instructions can comprise one or multiple documents, and are meant to include future updates.
[0043] As used herein, the terms “therapeutic agent” include any synthetic or naturally occurring biologically active compound or composition of matter which, when administered to an organism (human or nonhuman animal), induces a desired pharmacologic, immunogenic, and / or physiologic effect by local and / or systemic action. The term thereforeencompasses those compounds or chemicals traditionally regarded as drugs, vaccines, and biopharmaceuticals including molecules such as proteins, peptides, hormones, nucleic acids, gene constructs and the like. Examples of therapeutic agents are described in well-known literature references such as the Merck Index (14thedition), the Physicians' Desk Reference (64thedition), and The Pharmacological Basis of Therapeutics (12thedition). and they include, without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of a disease or illness; substances that affect the structure or function of the body, or pro-drugs, which become biologically active or more active after they have been placed in a physiological environment. For example, the term “therapeutic agent” includes compounds or compositions for use in all of the major therapeutic areas including, but not limited to, adjuvants; anti-infectives such as antibiotics and antiviral agents; analgesics and analgesic combinations, anorexics, anti-inflammatory agents, anti-epileptics, local and general anesthetics, hypnotics, sedatives, antipsychotic agents, neuroleptic agents, antidepressants, anxiolytics, antagonists, neuron blocking agents, anticholinergic and cholinomimetic agents, antimuscarinic and muscarinic agents, antiadrenergics, antiarrhythmics, antihypertensive agents, hormones, and nutrients, antiarthritics, antiasthmatic agents, anticonvulsants, antihistamines, antinauseants, antineoplastics, antipruritics, antipyretics; antispasmodics, cardiovascular preparations (including calcium channel blockers, beta-blockers, beta-agonists and antiarrythmics), antihypertensives, diuretics, vasodilators; central nervous system stimulants; cough and cold preparations; decongestants; diagnostics; hormones; bone growth stimulants and bone resorption inhibitors; immunosuppressives; muscle relaxants; psychostimulants; sedatives; tranquilizers; proteins, peptides, and fragments thereof (whether naturally occurring, chemically synthesized or recombinantly produced); and nucleic acid molecules (polymeric forms of two or more nucleotides, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) including both double- and single-stranded molecules, gene constructs, expression vectors, antisense molecules and the like), small molecules (e g., doxorubicin) and other biologically active macromolecules such as, for example, proteins and enzymes. The agent may be a biologically active agent used in medical, including veterinary, applications and in agriculture, such as with plants, as well as other areas. The term "therapeutic agent" also includes without limitation, medicaments; vitamins; mineral supplements; substances used for the treatment, prevention, diagnosis, cure or mitigation of disease or illness; or substances which affect the structure or function of the body; or pro- drugs, which become biologicallyactive or more active after they have been placed in a predetermined physiological environment.
[0044] The term “pharmaceutically acceptable” describes a material that is not biologically or otherwise undesirable, i.e., without causing an unacceptable level of undesirable biological effects or interacting in a deleterious manner.
[0045] As used herein, the term “derivative” refers to a compound having a structure derived from the structure of a parent compound (e.g., a compound disclosed herein) and whose structure is sufficiently similar to those disclosed herein and based upon that similarity7, would be expected by one skilled in the art to exhibit the same or similar activities and utilities as the claimed compounds, or to induce, as a precursor, the same or similar activities and utilities as the claimed compounds. Exemplary derivatives include salts, esters, amides, salts of esters or amides, and N-oxides of a parent compound.
[0046] As used herein, the term “pharmaceutically acceptable carrier” refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preser atives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption. Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-poly glycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues. The injectable formulations can be sterilized, for example.by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, at least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
[0047] A residue of a chemical species, as used in the specification and concluding claims, refers to the moiety that is the resulting product of the chemical species in a particular reaction scheme or subsequent formulation or chemical product, regardless of whether the moiety is actually obtained from the chemical species. Thus, an ethylene glycol residue in a polyester refers to one or more -OCH2CH2O- units in the polyester, regardless of whether ethylene glycol was used to prepare the polyester. Similarly, a sebacic acid residue in a polyester refers to one or more -CO(CH2)sCO- moieties in the polyester, regardless of whether the residue is obtained by reacting sebacic acid or an ester thereof to obtain the polyester.
[0048] As used herein, the term '‘substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acy clic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms “substitution” or “substituted with” include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g, a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. It is also contemplated that, in certain aspects, unless expressly indicated to the contrary, individual substituents can be further optionally substituted (i.e., further substituted or unsubstituted).
[0049] In defining various terms, “A1,” “A2,” “A3,” and “A4” are used herein as generic symbols to represent various specific substituents. These symbols can be any substituent, not limited to those disclosed herein, and when they are defined to be certain substituents in oneinstance, they can, in another instance, be defined as some other substituents.
[0050] The term '‘aliphatic” or “aliphatic group,” as used herein, denotes a hydrocarbon moiety that may be straight-chain (z.e., unbranched), branched, or cyclic (including fused, bridging, and spirofused polycyclic) and may be completely saturated or may contain one or more units of unsaturation, but which is not aromatic. Unless otherwise specified, aliphatic groups contain 1-20 carbon atoms. Aliphatic groups include, but are not limited to, linear or branched, alkyl, alkenyl, and alkynyl groups, and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
[0051] The term “alkyl” as used herein is a branched or unbranched saturated hydrocarbon group of 1 to 24 carbon atoms, such as methyl, ethyl, zr-propyl, isopropyl, n-butyl, isobutyl, s-butyl, / -butyl. n-pentyl, isopentyl,. -pentyl, neopentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, tetradecyl, hexadecyl, eicosyl, tetracosyl, and the like. The alkyl group can be cyclic or acyclic. The alkyl group can be branched or unbranched. The alkyl group can also be substituted or unsubstituted. For example, the alkyl group can be substituted with one or more groups including, but not limited to, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol, as described herein. A “lower alkyl” group is an alkyl group containing from one to six (e.g., from one to four) carbon atoms. The term alky l group can also be a Cl alkyl, C1-C2 alkyl, C1-C3 alkyl, C1-C4 alkyl, C1-C5 alkyl, C1-C6 alkyl, C1-C7 alkyl, C1-C8 alkyl. C1-C9 alkyl. Cl -CIO alkyl, and the like up to and including a C1-C24 alkyl.
[0052] Throughout the specification “alkyl” is generally used to refer to both unsubstituted alkyl groups and substituted alky l groups; however, substituted alky l groups are also specifically referred to herein by identifying the specific substituent(s) on the alkyl group. For example, the term '‘halogenated alkyl” or “haloalkyl” specifically refers to an alkyl group that is substituted with one or more halide, e.g., fluorine, chlorine, bromine, or iodine.Alternatively, the term “monohaloalky 1” specifically refers to an alkyl group that is substituted with a single halide, e.g. fluorine, chlorine, bromine, or iodine. The term “polyhaloalkyl” specifically refers to an alkyl group that is independently substituted with two or more halides, i.e. each halide substituent need not be the same halide as another halide substituent, nor do the multiple instances of a halide substituent need to be on the same carbon. The term '‘alkoxy alkyl” specifically refers to an alkyl group that is substituted with one or more alkoxy groups, as described below. The term “aminoalkyl” specifically refers to an alkyl group that is substituted with one or more amino groups. The term “hydroxyalkyl”specifically refers to an alkyl group that is substituted with one or more hydroxy groups. When “alkyl” is used in one instance and a specific term such as “hydroxyalkyl” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “hydroxyalkyl” and the like.
[0053] This practice is also used for other groups described herein. That is, while a term such as “cycloalkyl” refers to both unsubstituted and substituted cycloalkyl moieties, the substituted moieties can, in addition, be specifically identified herein; for example, a particular substituted cycloalkyd can be referred to as, e.g., an “alkylcycloalkyl.” Similarly, a substituted alkoxy can be specifically referred to as, e.g., a “halogenated alkoxy,” a particular substituted alkenyl can be. e.g., an “alkenylalcohol,” and the like. Again, the practice of using a general term, such as “cycloalkyl,” and a specific term, such as “alkylcycloalkyl,” is not meant to imply that the general term does not also include the specific term.
[0054] The term “cycloalkyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalky l groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, norbomyl, and the like. The term “heterocycloalkyl” is a type of cycloalkyl group as defined above, and is included within the meaning of the term “cycloalkyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. For example, the cycloalkyl group and heterocycloalkyl group can be substituted with 0, 1, 2, 3, or 4 groups independently selected from C1-C4 alkyl, C3-C7 cycloalkyl, C1-C4 alkoxy, -NH2, (C1-C4) alkylamino, (C1-C4)(C1-C4) dialkylamino, ether, halogen, -OH. C1-C4 hydroxyalkyl, -NO2, silyl, sulfo-oxo, -SH, and C1-C4 thioalkyl, as described herein.
[0055] The term “polyalkylene group” as used herein is a group having two or more CH2 groups linked to one another. The polyalkylene group can be represented by the formula — (CH2)a —, where “a” is an integer of from 2 to 500.
[0056] The terms “alkoxy” and “alkoxyl” as used herein to refer to an alkyl or cycloalkyl group bonded through an ether linkage; that is, an “alkoxy” group can be defined as — OA1where A1is alkyl or cycloalkyl as defined above. “Alkoxy” also includes polymers of alkoxy groups as just described; that is, an alkoxy can be a poly ether such as — OA1— OA2or — OA1— (OA2)a— OA3, where “a” is an integer of from 1 to 200 and A1, A2, and A3are alkyl and / or cycloalkyl groups.
[0057] The term “alkenyl” as used herein is a hydrocarbon group of from 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon double bond.Asymmetric structures such as (A1A2)C=C(A3A4) are intended to include both the E and Z isomers. This can be presumed in structural formulae herein wherein an asymmetric alkene is present, or it can be explicitly indicated by the bond symbol C=C. The alkenyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol, as described herein.
[0058] The term “cycloalkenyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms and containing at least one carbon-carbon double bound, i.e., C=C. Examples of cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, norbomenyl. and the like. The term “heterocycloalkenyl” is a type of cycloalkenyl group as defined above, and is included within the meaning of the term “cycloalkenyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkenyl group and heterocycloalkenyl group can be substituted or unsubstituted. For example, the cycloalkenyl group and heterocycloalkenyl group can be substituted with 0, 1, 2, 3, or 4 groups independently selected from C1-C4 alkyl, C3-C7 cycloalkyl, C1-C4 alkoxy, C2-C4 alkenyl, C3-C6 cycloalkenyl, C2-C4 alkynyl, and, heteroaryl, aldeyhyde, -NFb, (Cl-C4) alkylamino, (C1-C4)(C1-C4) dialkylamino, carboxylic acid, ester, ether, halogen, -OH, C1-C4 hydroxyalkyl, ketone, azide, -NO2, silyl, sulfo-oxo, -SH, and C1-C4 thioalkyl, as described herein.
[0059] The term “alkynyl” as used herein is a hydrocarbon group of 2 to 24 carbon atoms with a structural formula containing at least one carbon-carbon triple bond. The alkynyl group can be unsubstituted or substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol, as described herein.
[0060] The term “cycloalkynyl” as used herein is a non-aromatic carbon-based ring composed of at least seven carbon atoms and containing at least one carbon-carbon triple bound. Examples of cycloalkynyl groups include, but are not limited to, cycloheptynyl,cyclooctynyl, cyclononynyl. and the like. The term “heterocycloalkynyl” is a type of cycloalkenyl group as defined above, and is included within the meaning of the term “cycloalkynyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkynyl group and heterocycloalkynyl group can be substituted or unsubstituted. The cycloalkynyl group and heterocycloalkynyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalky nyl, ary l. heteroaryl. aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol as described herein.
[0061] The term “aromatic group’7as used herein refers to a ring structure having cyclic clouds of delocalized n electrons above and below the plane of the molecule, where the T clouds contain (4n+2) 71 electrons. A further discussion of aromaticity' is found in Morrison and Boyd, Organic Chemistry, (5th Ed., 1987), Chapter 13, entitled “Aromaticity,” pages 477-497, incorporated herein by reference. The term “aromatic group” is inclusive of both aryl and heteroaryl groups.
[0062] The term “aryl” as used herein is a group that contains any carbon-based aromatic group including, but not limited to, benzene, naphthalene, phenyl, biphenyl, anthracene, and the like. The aryl group can be substituted or unsubstituted. The aryl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cy cloalkynyl, aryl, heteroaryl, aldehyde, — NH2. carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol as described herein. The term “biaryl” is a specific type of ary l group and is included in the definition of “aryl.” In addition, the aryl group can be a single ring structure or comprise multiple ring structures that are either fused ring structures or attached via one or more bridging groups such as a carboncarbon bond. For example, biaryl can be two aryl groups that are bound together via a fused ring structure, as in naphthalene, or are attached via one or more carbon-carbon bonds, as in biphenyl.
[0063] The term “aldehyde” as used herein is represented by the formula — C(O)H.Throughout this specification “C(O)” or “CO” is a short hand notation for a carbonyl group, z.e., C=O.
[0064] The terms “amine” or “amino” as used herein are represented by the formula — NAXA2, where A1and A2can be, independently, hydrogen or alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cy cloalkynyl, aryl, or heteroaryl group as described herein. A specificexample of amino is — NH2.
[0065] The term '‘alkylamino” as used herein is represented by the formula — NH(-alkyl) where alkyd is a described herein. Representative examples include, but are not limited to, methylamino group, ethylamino group, propylamino group, isopropylamino group, butylamino group, isobutylamino group, (sec-butyl)amino group, (tert-butyl)amino group, pentylamino group, isopentylamino group, (tert-pentyl)amino group, hexylamino group, and the like.
[0066] The term “dialkylamino’' as used herein is represented by the formula — N(-alkyl)2 where alkyl is a described herein. Representative examples include, but are not limited to, dimethylamino group, diethylamino group, dipropylamino group, diisopropylamino group, dibutylamino group, diisobutylamino group, di(sec-butyl)amino group, di(tert-butyl)amino group, dipentylamino group, diisopentylamino group, di (tert-pentyl )ami no group, dihexylamino group, N-ethyl-N-methylamino group, N-methyl-N-propylamino group, N-ethyl-N-propylamino group and the like.
[0067] The term “carboxylic acid” as used herein is represented by the formula — C(O)OH.
[0068] The term “ester” as used herein is represented by the formula — OC(O)A1or — C(O)OA1, where A1can be alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein. The term “polyester” as used herein is represented by the formula — (A1O(O)C-A2-C(O)O)a— or — (A1O(O)C-A2-OC(O))a—, where A1and A2can be, independently, an alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group described herein and “a” is an integer from 1 to 500. “Polyester” is as the term used to describe a group that is produced by the reaction between a compound having at least two carboxylic acid groups with a compound having at least two hydroxyl groups.
[0069] The term “ether” as used herein is represented by the formula AXOA2, where A1and A2can be, independently, an alky l, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group described herein. The term “polyether” as used herein is represented by the formula — (A1O-A2O)a—, where A1and A2can be, independently, an alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group described herein and “a” is an integer of from 1 to 500. Examples of polyether groups include polyethylene oxide, polypropylene oxide, and polybutylene oxide.
[0070] The terms “halo,” “halogen,” or “halide” as used herein can be used interchangeably and refer to F, Cl, Br, or I.
[0071] The terms "pseudohalide." "pseudohalogen." or "pseudohalo" as used herein can be used interchangeably and refer to functional groups that behave substantially similar to halides. Such functional groups include, by way of example, cyano, thiocyanato, azido, trifluoromethyl, trifluoromethoxy, perfluoroalkyl, and perfluoroalkoxy groups.
[0072] The term “heteroalkyl,” as used herein refers to an alkyl group containing at least one heteroatom. Suitable heteroatoms include, but are not limited to, O, N, Si, P and S, wherein the nitrogen, phosphorous and sulfur atoms are optionally oxidized, and the nitrogen heteroatom is optionally quatemized. Heteroalkyls can be substituted as defined above for alkyl groups.
[0073] The term “heteroaryl,” as used herein refers to an aromatic group that has at least one heteroatom incorporated within the ring of the aromatic group. Examples of heteroatoms include, but are not limited to, nitrogen, oxygen, sulfur, and phosphorus, where N-oxides, sulfur oxides, and dioxides are permissible heteroatom substitutions. The heteroaryl group can be substituted or unsubstituted. The heteroaryl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol as described herein. Heteroaryl groups can be monocyclic, or alternatively fused ring systems. Heteroaryl groups include, but are not limited to, furyl, imidazolyl, pyrimidinyl, tetrazolyl, thienyl, pyridinyl, pyrrolyl, A'- methyl pyrrolyl. quinolinyl, isoquinolinyl, pyrazolyl, triazolyl, thiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, isothiazolyl, pyridazinyl, pyrazinyl, benzofuranyl, benzodioxolyl, benzothiophenyl, indolyl, indazolyl, benzimidazolyl, imidazopyridinyl, pyrazolopyridinyl, and pyrazolopyrimidinyl. Further not limiting examples of heteroary l groups include, but are not limited to, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, thiophenyl, pyrazolyl, imidazolyl, benzo|t / |oxazolyl. benzo[< / ]thiazolyl, quinolinyl, quinazolinyl, indazolyl, imidazo[l,2-b]pyridazinyl, imidazo[l,2-a]pyrazinyl, benzo[c][l,2,5]thiadiazolyl, benzofc] [1, 2, 5]oxadiazolyl, and pyrido[2,3-b]pyrazinyl.
[0074] The terms “heterocycle” or “heterocyclyl,” as used herein can be used interchangeably and refer to single and multi-cyclic aromatic or non-aromatic ring systems in which at least one of the ring members is other than carbon. Thus, the term is inclusive of, but not limited to, “heterocycloalkyl,” “heteroaryl,” “bicyclic heterocycle,” and “polycyclic heterocycle.” Heterocycle includes pyridine, pyrimidine, furan, thiophene, pyrrole, isoxazole, isothiazole, pyrazole, oxazole, thiazole, imidazole, oxazole, including. 1,2,3-oxadiazole, 1,2,5-oxadiazole and 1,3,4-oxadiazole, thiadiazole, including, 1,2,3-thiadiazole,1,2,5-thiadiazole, and 1, 3, 4-thiadiazole, triazole, including, 1.2.3 -triazole, 1,3,4-triazole, tetrazole, including 1,2,3,4-tetrazole and 1,2,4,5-tetrazole, pyridazine, pyrazine, triazine, including 1,2,4-triazine and 1,3,5-triazine, tetrazine, including 1,2,4,5-tetrazine, pyrrolidine, piperidine, piperazine, morpholine, azetidine, tetrahydropyran, tetrahydrofuran, dioxane, and the like. The term heterocyclyl group can also be a C2 heterocyclyl, C2-C3 heterocyclyl, C2-C4 heterocyclyl, C2-C5 heterocyclyl, C2-C6 heterocyclyl, C2-C7 heterocyclyl, C2-C8 heterocyclyl, C2-C9 heterocyclyl, C2-C10 heterocyclyl, C2-C11 heterocyclyl, and the like up to and including a C2-C18 heterocyclyl. For example, a C2 heterocyclyl comprises a group which has two carbon atoms and at least one heteroatom, including, but not limited to, aziridinyl, diazetidinyl, dihydrodiazetvl. oxiranyl. thiiranyl. and the like. Alternatively, for example, a C5 heterocyclyl comprises a group which has five carbon atoms and at least one heteroatom, including, but not limited to, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, diazepanyl, pyridinyl, and the like. It is understood that a heterocyclyl group may be bound either through a heteroatom in the ring, where chemically possible, or one of carbons comprising the heterocyclyl ring.
[0075] The term “bicyclic heterocycle” or “bicyclic heterocyclyl” as used herein refers to a ring system in which at least one of the ring members is other than carbon. Bicyclic heterocyclyl encompasses ring systems wherein an aromatic ring is fused with another aromatic ring, or wherein an aromatic ring is fused with a non-aromatic ring. Bicyclic heterocyclyl encompasses ring systems wherein a benzene ring is fused to a 5- or a 6-membered ring containing 1, 2 or 3 ring heteroatoms or wherein a pyridine ring is fused to a 5- or a 6-membered ring containing 1, 2 or 3 ring heteroatoms. Bicyclic heterocyclic groups include, but are not limited to, indolyl, indazolyl, pyrazolo[l,5-a]pyridinyl. benzofuranyl, quinolinyl, quinoxalinyl, 1,3-benzodioxolyl, 2,3-dihydro-l,4-benzodioxinyl, 3,4-dihydro-2H-chromenyl, lH-pyrazolo[4,3-c]pyridin-3-yl; lH-pyrrolo[3,2-b]pyridin-3-yl; and 1H-pyrazolo[3,2-b]pyridin-3-yl.
[0076] The term “heterocycloalkyl” as used herein refers to an aliphatic, partially unsaturated or fully saturated, 3- to 14-membered ring system, including single rings of 3 to 8 atoms and bi- and tricyclic ring systems. The heterocycloalkyl ring-systems include one to four heteroatoms independently selected from oxygen, nitrogen, and sulfur, wherein a nitrogen and sulfur heteroatom optionally can be oxidized and a nitrogen heteroatom optionally can be substituted. Representative heterocycloalkyl groups include, but are not limited to, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl.piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, and tetrahydrofuryl.
[0077] The term “hydroxy” or “hydroxyl” as used herein is represented by the formula — OH.
[0078] The term “ketone” as used herein is represented by the formula A1C(O)A2, where A1and A2can be, independently, an alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, ary l. or heteroaryl group as described herein.
[0079] The term “azide” or “azido” as used herein is represented by the formula — Ns.
[0080] The term “nitro” as used herein is represented by the formula — NO2.
[0081] The term “nitrile” or “cyano” as used herein is represented by the formula — CN or — C=N.
[0082] The term “silyl” as used herein is represented by the formula — SiA1A2A3, where A1, A2, and A3can be, independently, hydrogen or an alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl. aryl, or heteroaryl group as described herein.
[0083] The term “sulfo-oxo” as used herein is represented by the formulas — S(O)A1, — S(O)2A1, — OS(O)2A', or — OS(O)2OA1, where A1can be hydrogen or an alkyl, cycloalkyl, alkenyl, cy cloalkenyl, alkynyl, cycloalkynyl, ary l, or heteroaryl group as described herein. Throughout this specification “S(O)” is a short hand notation for S=O. The term “sulfonyl” is used herein to refer to the sulfo-oxo group represented by the formula — S(O)2A1, where A1can be hydrogen or an alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalky nyl, ary l, or heteroaryl group as described herein. The term “sulfone” as used herein is represented by the formula A'S(O)2A2, where A1and A2can be, independently, an alkyl, cycloalkyd, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein. The term “sulfoxide” as used herein is represented by the formula A3S(O)A2, where A1and A2can be, independently, an alkyd, cycloalkyl, alkenyl, cycloalkeny 1, alkynyl, cycloalkynyl, ary l, or heteroary 1 group as described herein.
[0084] The term “thiol” as used herein is represented by the formula — SH.
[0085] “R1,” “R2,” “R3,” “Rn,” where n is an integer, as used herein can, independently, possess one or more of the groups listed above. For example, if R1is a straight chain alkyl group, one of the hydrogen atoms of the alkyd group can optionally be substituted with a hydroxyl group, an alkoxy group, an alkyl group, a halide, and the like. Depending upon the groups that are selected, a first group can be incorporated within second group or, alternatively, the first group can be pendant (z.e., attached) to the second group. For example,with the phrase “an alkyl group comprising an amino group,” the amino group can be incorporated within the backbone of the alkyl group. Alternatively, the amino group can be attached to the backbone of the alkyl group. The nature of the group(s) that is (are) selected will determine if the first group is embedded or attached to the second group.
[0086] As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogen of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are those that result in the formation of stable or chemically feasible compounds. In is also contemplated that, in certain aspects, unless expressly indicated to the contrary, individual substituents can be further optionally substituted (i.e., further substituted or unsubstituted).
[0087] The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain aspects, their recovery, purification, and use for one or more of the purposes disclosed herein.
[0088] Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen; -(CH2)o 4R0; -(CH2)o 4OR0; -0(CH2)o-4R°, -0-(CH2)O^C(0)OR°; -(CH2)O4CH(ORO)2; -(CH2)O^SR°; -(CH2)O4Ph. which may be substituted with R°; -(CH2)o 40(CH2)o iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)o-40(CH2)o i-pyridyl which may be substituted with R°; -NO2; -CN; -N3; -(CH2)O4N(RO)2; -(CH2)O^N(R°)C(0)R°; -N(R°)C(S)R°; -(CH2)O 4N(RO)C(O)NR°2; -N(RO)C(S)NR°2; -(CH2)O-IN(R°)C(0)OR°; -N(R°)N(R°)C(O)R°; -N(RO)N(R°)C(O)NRO2; -N(R°)N(R°)C(O)OR°; -(CH2)o4C(O)R°; -C(S)R°; -(CH2)O4C(O)ORO; -(CH2)O-4C(0)SR°; -(CH2)O4C(O)OSIR°3; -(CH2O4OC(O)RO: -OC(0)(CH2)O4SR-. SC(S)SR°; -(CH2)O4SC(O)RO; -(CH2)O4C(0)NRO2; -C(S)NRO2; -C(S)SR°; -(CH2)O4OC(O)NRO2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)RO; -C(NOR°)R°; -(CH2)o 4SSR0; -(CH2)o4S(O)2R°; -(CH2)o4S(O)2OR°; -(CH2)o4OS(O)2R°: -S(O)2NR°2; -(CH2)O 4S(O)RO; -N(R°)S(O)2NR°2; -N(RO)S(O)2R°; -N(0R°)R°; -C(NH)NR°2; -P(O)2RO; -P(O)RO2; -OP(O)RO2; -OP(O)(ORO)2; SiR°3; -(Ci 4 straight or branched alkylene)O-N(R°)2; or -(C1-4 straight or branched alkylene)C(O)O-N(R°)2,wherein each R° may be substituted as defined below and is independently hydrogen, Ci-6 aliphatic, -CH2Ph, -0(CH2)o iPh, -CH2-(5-6 membered heteroaryl ring), or a 5-6-membered saturated, partially unsaturated, or ar l ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.
[0089] Suitable monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen, -(CH2)O 2R*, -(haloR*), -(CH2)o 2OH, -(CH2)o2OR*, -(CH2)o2CH(OR*)2; -O(haloR’), -CN, -N3, -(CH2)O2C(O)R*, -(CH2)O2C(O)OH, -(CH2)O2C(O)OR*, -(CH2)O2SR*. -(CH2)O2SH, -(CH2)O2NH2, -(CH2)O 2NHR*, -(CH2)O2NR*2, -NO2, -SiR*3, -OSIR*3, -C(O)SR* -(Ci 4 straight or branched alkylene)C(O)OR’, or -SSR* wherein each R* is unsubstituted or where preceded by ‘‘halo'’ is substituted only with one or more halogens, and is independently selected from Cr -4 aliphatic, -CH2Ph, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.
[0090] Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =0, =S, =NNR*2, =NNHC(O)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =NOR*, -O(C(R*2))23O-, or -S(C(R*2))2-3S-, wherein each independent occurrence of R* is selected from hydrogen, C1-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: -O(CR*2)2-3O-, wherein each independent occurrence of R* is selected from hydrogen, C1-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0091] Suitable substituents on the aliphatic group of R* include halogen, - R*. -(haloR*), -OH, -OR*. -O(haloR’), -CN. -C(O)OH, -C(O)OR*. -NH2, -NHR*. -NR*2,or -NO2. wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1-4 aliphatic, -CH2PI1, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or ary l ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0092] Suitable substituents on a substitutable nitrogen of an “optionally substituted"’ group include -R1, -NR'2, -C(O)R', -C(O)ORt, -C(O)C(O)R', -C(O)CH2C(O)R', - S(O)2R'. -S(O)2NRt2, -C(S)NRf2, -C(NH)NRt2, or -N(Rt)S(O)2Rt; wherein each R' is independently hydrogen, C 1-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R’f taken together with their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0093] Suitable substituents on the aliphatic group of R' are independently halogen, - R*, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by “halo’’ is substituted only with one or more halogens, and is independently Ci-4 aliphatic, -CH2PI1, -0(CH2)o iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0094] The term “leaving group” refers to an atom (or a group of atoms) with electron withdrawing ability- that can be displaced as a stable species, taking with it the bonding electrons. Examples of suitable leaving groups include halides and sulfonate esters, including, but not limited to, triflate, mesylate, tosylate, and brosylate.
[0095] The terms “hydrolysable group” and “hydrolysable moiety” refer to a functional group capable of undergoing hydrolysis, e.g., under basic or acidic conditions. Examples of hydrolysable residues include, without limitation, acid halides, activated carboxylic acids, and various protecting groups known in the art (see, for example, “Protective Groups in Organic Synthesis,” T. W. Greene, P. G. M. Wuts, Wiley-Interscience, 1999).
[0096] The term “organic residue” defines a carbon containing residue, i.e., a residue comprising at least one carbon atom, and includes but is not limited to the carbon-containing groups, residues, or radicals defined hereinabove. Organic residues can contain various heteroatoms, or be bonded to another molecule through a heteroatom, including oxygen,nitrogen, sulfur, phosphorus, or the like. Examples of organic residues include but are not limited alkyl or substituted alkyls, alkoxy or substituted alkoxy, mono or di-substituted amino, amide groups, etc. Organic residues can preferably comprise 1 to 18 carbon atoms, 1 to 15, carbon atoms, 1 to 12 carbon atoms, 1 to 8 carbon atoms, 1 to 6 carbon atoms, or 1 to 4 carbon atoms. In a further aspect, an organic residue can comprise 2 to 18 carbon atoms, 2 to 15, carbon atoms, 2 to 12 carbon atoms, 2 to 8 carbon atoms, 2 to 4 carbon atoms, or 2 to 4 carbon atoms.
[0097] A very close synonym of the term “residue” is the term “radical,” which as used in the specification and concluding claims, refers to a fragment, group, or substructure of a molecule described herein, regardless of how the molecule is prepared. For example, a 2,4-thiazolidinedione radical in a particular compound has the structure:regardless of whether thiazolidinedione is used to prepare the compound. In some embodiments the radical (for example an alkyl) can be further modified (i.e.. substituted alkyl) by having bonded thereto one or more “substituent radicals.” The number of atoms in a given radical is not critical to the present invention unless it is indicated to the contrary elsewhere herein.
[0098] “Organic radicals,” as the term is defined and used herein, contain one or more carbon atoms. An organic radical can have, for example, 1-26 carbon atoms, 1-18 carbon atoms, 1-12 carbon atoms, 1-8 carbon atoms, 1-6 carbon atoms, or 1-4 carbon atoms. In a further aspect, an organic radical can have 2-26 carbon atoms, 2-18 carbon atoms, 2-12 carbon atoms, 2-8 carbon atoms, 2-6 carbon atoms, or 2-4 carbon atoms. Organic radicals often have hydrogen bound to at least some of the carbon atoms of the organic radical. One example, of an organic radical that comprises no inorganic atoms is a 5, 6, 7, 8-tetrahydro-2-naphthyl radical. In some embodiments, an organic radical can contain 1-10 inorganic heteroatoms bound thereto or therein, including halogens, oxygen, sulfur, nitrogen, phosphorus, and the like. Examples of organic radicals include but are not limited to an alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, mono-substituted amino, di-substituted amino, acyloxy, cyano, carboxy, carboalkoxy, alkylcarboxamide, substituted alkylcarboxamide, dialkylcarboxamide, substituted dialkylcarboxamide, alky lsulfonyl, alkydsulfinyl, thioalkyl, thiohaloalkyl, alkoxy, substituted alkoxy, haloalkyl. haloalkoxy, ary l, substituted aryl,heteroaryl, heterocyclic, or substituted heterocyclic radicals, wherein the terms are defined elsewhere herein. A few non-limiting examples of organic radicals that include heteroatoms include alkoxy radicals, trifluoromethoxy radicals, acetoxy radicals, dimethylamino radicals and the like.
[0099] ‘Inorganic radicals ’ as the term is defined and used herein, contain no carbon atoms and therefore comprise only atoms other than carbon. Inorganic radicals comprise bonded combinations of atoms selected from hydrogen, nitrogen, oxygen, silicon, phosphorus, sulfur, selenium, and halogens such as fluorine, chlorine, bromine, and iodine, which can be present individually or bonded together in their chemically stable combinations. Inorganic radicals have 10 or fewer, or preferably one to six or one to four inorganic atoms as listed above bonded together. Examples of inorganic radicals include, but not limited to, amino, hydroxy, halogens, nitro, thiol, sulfate, phosphate, and like commonly known inorganic radicals. The inorganic radicals do not have bonded therein the metallic elements of the periodic table (such as the alkali metals, alkaline earth metals, transition metals, lanthanide metals, or actinide metals), although such metal ions can sometimes serve as a pharmaceutically acceptable cation for anionic inorganic radicals such as a sulfate, phosphate, or like anionic inorganic radical. Inorganic radicals do not comprise metalloids elements such as boron, aluminum, gallium, germanium, arsenic, tin, lead, or tellurium, or the noble gas elements, unless otherwise specifically indicated elsewhere herein.
[0100] Compounds described herein can contain one or more double bonds and, thus, potentially give rise to cis / trans (E / Z) isomers, as well as other conformational isomers. Unless stated to the contrary, the invention includes all such possible isomers, as well as mixtures of such isomers.
[0101] Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible isomer, e.g., each enantiomer and diastereomer, and a mixture of isomers, such as a racemic or scalemic mixture. Compounds described herein can contain one or more asymmetric centers and, thus, potentially give rise to diastereomers and optical isomers. Unless stated to the contrary, the present invention includes all such possible diastereomers as well as their racemic mixtures, their substantially pure resolved enantiomers, all possible geometric isomers, and pharmaceutically acceptable salts thereof. Mixtures of stereoisomers, as well as isolated specific stereoisomers, are also included. During the course of the synthetic procedures used to prepare such compounds, or in using racemization or epimerization procedures known tothose skilled in the art. the products of such procedures can be a mixture of stereoisomers.
[0102] Many organic compounds exist in optically active forms having the ability to rotate the plane of plane-polarized light. In describing an optically active compound, the prefixes D and L or R and S are used to denote the absolute configuration of the molecule about its chiral center(s). The prefixes d and 1 or (+) and (-) are employed to designate the sign of rotation of plane-polarized light by the compound, with (-) or meaning that the compound is levorotatory. A compound prefixed with (+) or d is dextrorotatory. For a given chemical structure, these compounds, called stereoisomers, are identical except that they are non-superimposable mirror images of one another. A specific stereoisomer can also be referred to as an enantiomer, and a mixture of such isomers is often called an enantiomeric mixture. A 50:50 mixture of enantiomers is referred to as a racemic mixture. Many of the compounds described herein can have one or more chiral centers and therefore can exist in different enantiomeric forms. If desired, a chiral carbon can be designated with an asterisk (*). When bonds to the chiral carbon are depicted as straight lines in the disclosed formulas, it is understood that both the (R) and (S) configurations of the chiral carbon, and hence both enantiomers and mixtures thereof, are embraced within the formula. As is used in the art, when it is desired to specify the absolute configuration about a chiral carbon, one of the bonds to the chiral carbon can be depicted as a wedge (bonds to atoms above the plane) and the other can be depicted as a series or wedge of short parallel lines is (bonds to atoms below the plane). The Cahn-Ingold-Prelog system can be used to assign the (R) or (S) configuration to a chiral carbon.
[0103] Compounds described herein comprise atoms in both their natural isotopic abundance and in non-natural abundance. The disclosed compounds can be isotopically-labeled or isotopically-substituted compounds identical to those described, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number typically found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine and chlorine, such as2H,3H,13C,14C,k'N.18O,170,35S,18F and36C1, respectively. Compounds further comprise prodrugs thereof, and pharmaceutically acceptable salts of said compounds or of said prodrugs which contain the aforementioned isotopes and / or other isotopes of other atoms are within the scope of this invention. Certain isotopically-labeled compounds of the present invention, for example those into which radioactive isotopes such as3H and14C are incorporated, are usefulin drug and / or substrate tissue distribution assays. Tritiated, z.e.,3H, and carbon-14, i.e.,14C. isotopes are particularly preferred for their ease of preparation and detect ability. Further, substitution with heavier isotopes such as deuterium, i.e.,2H, can afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life or reduced dosage requirements and, hence, may be preferred in some circumstances.Isotopically labeled compounds of the present invention and prodrugs thereof can generally be prepared by carrying out the procedures below, by substituting a readily available isotopically labeled reagent for a non- isotopically labeled reagent.
[0104] The compounds described in the invention can be present as a solvate. In some cases, the solvent used to prepare the solvate is an aqueous solution, and the solvate is then often referred to as a hydrate. The compounds can be present as a hydrate, which can be obtained, for example, by crystallization from a solvent or from aqueous solution. In this connection, one, tw o, three or any arbitrary number of solvent or water molecules can combine with the compounds according to the invention to form solvates and hydrates. Unless stated to the contrary, the invention includes all such possible solvates.
[0105] The term '‘co-crystal” means a physical association of two or more molecules which ow e their stability through non-covalent interaction. One or more components of this molecular complex provide a stable framework in the crystalline lattice. In certain instances, the guest molecules are incorporated in the crystalline lattice as anhydrates or solvates, see e.g. “Crystal Engineering of the Composition of Pharmaceutical Phases. Do Pharmaceutical Co-crystals Represent a New' Path to Improved Medicines?” Almarasson, O., et. al., The Royal Society of Chemistry, 1889-1896, 2004. Examples of co-crystals include p-toluenesulfonic acid and benzenesulfonic acid.
[0106] It is also appreciated that certain compounds described herein can be present as an equilibrium of tautomers. For example, ketones with an a-hydrogen can exist in an equilibrium of the keto form and the enol form.keto form enol form amide form imidic acid form Likewise, amides with an N-hydrogen can exist in an equilibrium of the amide form and the imidic acid form. As another example, pyrazoles can exist in two tautomeric forms, A1-unsubstituted, 3-A3and / V1-unsubstituted, 5-A3as shown below.Unless stated to the contrary, the invention includes all such possible tautomers.
[0107] It is known that chemical substances form solids which are present in different states of order which are termed polymorphic forms or modifications. The different modifications of a polymorphic substance can differ greatly in their physical properties. The compounds according to the invention can be present in different polymorphic forms, with it being possible for particular modifications to be metastable. Unless stated to the contrary, the invention includes all such possible polymorphic forms.
[0108] In some aspects, a structure of a compound can be represented by a formula:which is understood to be equivalent to a formula:wherein n is typically an integer. That is, R” is understood to represent five independent substituents, R"(a), R"(b), R”(c), R”(d), R”(e). By “independent substituents,” it is meant that each R substituent can be independently defined. For example, if in one instance R"(a)is halogen, then R”(b)is not necessarily halogen in that instance.
[0109] Certain materials, compounds, compositions, and components disclosed herein can be obtained commercially or readily synthesized using techniques generally known to those of skill in the art. For example, the starting materials and reagents used in preparing the disclosed compounds and compositions are either available from commercial suppliers such as Aldrich Chemical Co., (Milwaukee, Wis.), Acres Organics (Morris Plains, N. J.), Fisher Scientific (Pittsburgh, Pa.), or Sigma (St. Louis, Mo.) or are prepared by methods know n to those skilled in the art following procedures set forth in references such as Fieser and Fieser's Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd’s Chemistry of Carbon Compounds, Volumes 1-5 and supplemental volumes (Elsevier Science Publishers, 1989); Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991); March’s Advanced Organic Chemistry, (John Wiley and Sons, 4th Edition); and Larock’sComprehensive Organic Transformations (VCH Publishers Inc., 1989).
[0110] Unless otherwise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order.Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherwise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including: matters of logic with respect to arrangement of steps or operational flow; plain meaning derived from grammatical organization or punctuation; and the number or type of embodiments described in the specification.
[0111] Disclosed are the components to be used to prepare the compositions of the invention as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds cannot be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular compound is disclosed and discussed and a number of modifications that can be made to a number of molecules including the compounds are discussed, specifically contemplated is each and every combination and permutation of the compound and the modifications that are possible unless specifically indicated to the contrary7. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the compositions of the invention. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the methods of the invention.
[0112] It is understood that the compositions disclosed herein have certain functions. Disclosed herein are certain structural requirements for performing the disclosed functions.and it is understood that there are a variety’ of structures that can perform the same function that are related to the disclosed structures, and that these structures will typically achieve the same result.B. COMPOUNDS
[0113] Generally, the invetion relates to sequence selective deoxyribonucleic acid (DNA) binding compounds comprising a polyamide moiety configured to bind a DNA sequence. Such compounds can be useful for restoring expression of autoimmune regulator (AIRE) gene and for treating an autoimmune disease (e.g, Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and ty pe I diabetes).
[0114] It is contemplated that each disclosed derivative can be optionally further substituted. It is also contemplated that any one or more derivative can be optionally omitted from the invention. It is understood that a disclosed compound can be provided by the disclosed methods. It is also understood that the disclosed compounds can be employed in the disclosed methods of using.1. STRUCTURE
[0115] In one aspect, disclosed are sequence selective deoxyribonucleic acid (DNA) binding compounds comprising a polyamide moiety configured to bind a DNA sequence, or a pharmaceutically acceptable salt thereof, wherein the polyamide moiety is tethered via a first chemical linker to a bromodomain extraterminal domain (BET) binding ligand, and wherein the polyamide moiety' is configured to bind a sequence5TTATTA3.
[0116] In various aspects, the compound has a structure represented by a formula selected from:wherein n’ is an integer selected from 3 to 8; wherein n” is 2, 3, or 4; wherein u is an integer selected from 1 to 20; wherein Q is selected from O, NH, and CH2; wherein each occurrencewherein R1is selected from:wherein BRD is a BET binding ligand.
[0117] In various aspects, the compound is selected from:and
[0118] In various aspects, the compound further comprises a Ubiquitin-Proteosome System (UPS) targeting moiety or a PBX or TCF3-PBX transcription factor binding moiety tethered to the polyamide moiety via a second chemical linker.
[0119] In various aspects, the compound does not comprise a Ubiquitin-Proteosome System (UPS) targeting moiety or a PBX or TCF3-PBX transcription factor binding moiety.
[0120] In various aspects, n’ is an integer selected from 1 to 20. In a further aspect, n' is an integer selected from 1 to 15. In a still further aspect, n' is an integer selected from 1 to 10. In yet a further aspect, n’ is an integer selected from 1 to 5. In an even further aspect, n’ is an integer selected from 5 to 20. In a still further aspect, n’ is an integer selected from 10 to 20. In yet a further aspect, n’ is an integer selected from 15 to 20. In an even further aspect, n' is an integer selected from 5 to 15.
[0121] In various aspects, n’ is an integer from 3 to 8. In a further aspect, n’ is an integer from 4 to 8. In a still further aspect, n’ is an integer from 5 to 8. In yet a further aspect, n’ is an integer from 6 to 8. In an even further aspect, n’ is an integer from 7 to 8. In an even still further aspect, n’ is an integer from 3 to 7. In yet an even further aspect, n’ is an integer from 3 to 6. In a further aspect, n’ is an integer from 3 to 5. In a still further aspect, n’ is an integer from 3 to 4. In yet a further aspect, n’ is 3. In an even further aspect, n’ is 4. In an even still further aspect, n’ is 5. In yet an even further aspect, n’ is 6. In a further aspect, n' is 7. In a still further aspect, n’ is 8.
[0122] In various aspects, n” is 2, 3, or 4. In a futher aspects, n’" is 2 or 3. In a still further aspect, n” is 2 or 4. In yet a further aspect, n” is n’ is 3 or 4. In an even further aspect, n” is 2. In a still further aspect, n” is 3. In yet a further aspect, n” is 4.
[0123] In one aspect, u is an integer selected from 1 to 20. In a further aspect, u is an integer selected from 1 to 15. In a still further aspect, u is an integer selected from 1 to 10. In yet a further aspect, u is an integer selected from 1 to 5. In an even further aspect, u is aninteger selected from 5 to 20. In a still further aspect, u is an integer selected from 10 to 20. In yet a further aspect, u is an integer selected from 15 to 20. In an even further aspect, u is an integer selected from 5 to 15.
[0124] In one aspect, each of u and u’ is independently an integer selected from 1 to 10. In a further aspect, each of u and u' is independently an integer selected from 4 to 10. In a still further aspect, each of u and u’ is independently an integer selected from 8 to 10. In yet a further aspect, each of u and u’ is independently an integer selected from 1 to 8. In an even further aspect, each of u and u’ is independently an integer selected from 1 to 4. In a still further aspect, each of u and u’ is independently an integer selected from 4 to 8.
[0125] In one aspect, each of u, u’, and u” is independently an integer selected from 1 to 10. In a further aspect, each of u, u’, and u’ ’ is independently an integer selected from 4 to 10. In a still further aspect, each of u, u’, and u” is independently an integer selected from 8 to 10. In yet a further aspect, each of u, u‘, and u" is independently an integer selected from 4 to 10. In an even further aspect, each of u, u’. and u” is independently an integer selected from 8 to 10. In a still further aspect, each of u, u’, and u” is independently an integer selected from 4 to 8.a. POLYAMIDE MOIETIES
[0126] In one aspect, the disclosed sequence selective DNA binding compound comprises a polyamide moiety. The polyamide moiety is tethered via a first chemical linker to a bromodomain extraterminal domain (BET) binding ligand, and wherein the polyamide moiety is configured to bind a sequence 5’TTATTA3’.
[0127] In varous aspects, the polyamide moiety comprises a monomeric unit having a structure represented by a formula:wherein R1is selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(0)CH3, methyl, and methoxy; and wherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy.
[0128] In various aspects, the polyamide moiety comprises a plurality’ of monomeric units having a structure represented by a formula:wherein each occurrence ofis independently selected from:
[0129] In various aspects, the polyamide moiety comprises a monomeric unit having a structure represented by a formula selected from:wherein each of m, o, and p is independently an integer selected from 1 to 20. In a further aspect, the polyamide moiety comprises at least two different monomeric units. In a still further aspect, the polyamide moiety comprises each of:
[0130] In a further aspect, the linear polyamide moiety has a structure represented by a formula:wherein n’ is an integer selected from 1 to 20: wherein R1is selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy: and wherein each of R11aand R11bis independently selected from hydrogen, -OH,A)methyl, and methoxy; and wherein each occurrence of is independently selected from:
[0131] In various aspects, the polyamide moiety is a U-pin polyamide moiety’. In a further aspect, the U-pin polyamide moiety is a residue of a structure represented by a formula:wherein each of n, n', and n” is independently an integer selected from 1 to 20; wherein R1is selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy: and wherein each of R11aand R11bis independently selected from hydrogen, -OH,A)methyl, and methoxy: and wherein each occurrence of — is independently selected from:
[0132] In various aspects, the polyamide moiety is an H-pin polyamide moiety. In a further aspect, the H-pin polyamide moiety is a residue of a structure represented by a formula:wherein each occurrence of n’ is independently an integer selected from 1 to 20; wherein R1is selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy; and wherein each of R11aand R11bis independently selected from hydrogen, -OH,(A)methyl, and methoxy; and wherein each occurrence of is independently selected from:
[0133] In various aspects, the polyamide moiety is a tandem hairpin poly amide moiety. In a further aspect, the tandem hairpin polyamide moiety is a residue of a structure represented by a formula:wherein each of n’, n”, n”\ and n'”’ is independently an integer selected from 1 to 20; wherein H is a polyamide turn linker; wherein each occurrence of R1is independently selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy; and wherein each of R11aand R11bis independently selected from hydrogen, -OH,(A)methyl, and methoxy; and wherein each occurrence of ' — ' is independently selected from:
[0134] In various aspects, the polyamide moiety is a hairpin polyamide moiety. In a further aspect, the hairpin polyamide moiety is a residue of a structure represented by a formula:wherein each of n’ and n” is independently an integer selected from 1 to 20; wherein G is a polyamide turn linker; wherein R1is selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy; and wherein each of R11aand R11bis independently selected from hydrogen, -OH,( A )methyl, and methoxy; and wherein each occurrence of - is independently selected from:
[0135] In various aspects, the polyamide moiety is a cyclic polyamide moiety. In a further aspect, the cyclic polyamide moiety is a residue of a structure represented by a formula:wherein each of n’ and n” is independently an integer selected from 1 to 20; wherein G is a polyamide turn linker; wherein each occurrence ofis independently selected from:
[0136] In a still further aspect, G is a polyamide turn linker having a structure selected from:
[0137] In various aspects, the polyamide moiety is selected from residues of:wherein each occurrence of X is independently selected from N and CH.
[0138] In various aspects, the polyamide moiety is selected from:
[0139] In one aspect, each of m, o, and p is independently an integer selected from 1 to 20. In a further aspect, each of m, o, and p is independently an integer selected from 1 to 15. In a still further aspect, each of m, o, and p is independently an integer selected from 1 to 10. In yet a further aspect, each of m, o, and p is independently an integer selected from 1 to 5. In an even further aspect, each of m, o, and p is independently an integer selected from 5 to 20. In a still further aspect, each of m, o, and p is independently an integer selected from 10 to 20. In yet a further aspect, each of m, o. and p is independently an integer selected from15 to 20. In an even further aspect, each of m, o, and p is independently an integer selected from 5 to 15.
[0140] In one aspect, each of m, o, and p is independently selected from 1, 2, 3, and 4, and the sum of m, o, and p is equal to t. In a further aspect, each of m, o, and p is independently selected from 1, 2, and 3. In a still further aspect, each of m, o, and p is independently selected from 1 and 2. In yet a further aspect, each of m, o, and p is independently selected from 1 and 3. In an even further aspect, each of m, o, and p is independently selected from 1 and 4. In a still further aspect, each of m, o, and p is independently selected from 2 and 3. In yet a further aspect, each of m, o, and p is independently selected from 2 and 4. In an even further aspect, each of m, o. and p is independently selected from 3 and 4. In a still further aspect, each of m, o, and p is 4. In yet a further aspect, each of m, o, and p is 3. In an even further aspect, each of m, o, and p is 2.
[0141] In one aspect, n is an integer selected from 1 to 20. In a further aspect, n is an integer selected from 1 to 15. In a still further aspect, n is an integer selected from 1 to 10. In yet a further aspect, n is an integer selected from 1 to 5. In an even further aspect, n is an integer selected from 5 to 20. In a still further aspect, n is an integer selected from 10 to 20. In yet a further aspect, n is an integer selected from 15 to 20. In an even further aspect, n is an integer selected from 5 to 15.
[0142] In one aspect, n’ is an integer selected from 1 to 20. In a further aspect, n’ is an integer selected from 1 to 15. In a still further aspect, n’ is an integer selected from 1 to 10. In yet a further aspect, n’ is an integer selected from 1 to 5. In an even further aspect, n’ is an integer selected from 5 to 20. In a still further aspect, n' is an integer selected from 10 to 20. In yet a further aspect, n’ is an integer selected from 15 to 20. In an even further aspect, n’ is an integer selected from 5 to 15.
[0143] In various aspects, n’ is an integer from 3 to 8. In a further aspect, n’ is an integer from 4 to 8. In a still further aspect, n' is an integer from 5 to 8. In yet a further aspect, n’ is an integer from 6 to 8. In an even further aspect, n’ is an integer from 7 to 8. In an even still further aspect, n’ is an integer from 3 to 7. In yet an even further aspect, n’ is an integer from 3 to 6. In a further aspect, n’ is an integer from 3 to 5. In a still further aspect, n’ is an integer from 3 to 4. In yet a further aspect, n’ is 3. In an even further aspect, n’ is 4. In an even still further aspect, n is 5. In yet an even further aspect, n' is 6. In a further aspect, n’ is 7. In a still further aspect, n’ is 8.
[0144] In one aspect, each of n’ and n” is independently an integer selected from 1 to20. In a further aspect, each of n’ and n” is independently an integer selected from 1 to 15. In a still further aspect, each of n’ and n” is independently an integer selected from 1 to 10. In yet a further aspect, each of each of n’ and n” is independently an integer selected from 1 to 5. In an even further aspect, each of n’ and n” is independently an integer selected from 5 to 20. In a still further aspect, each of n’ and n” is independently an integer selected from 10 to 20. In yet a further aspect, each of n’ and n” is independently an integer selected from 15 to 20. In an even further aspect, each of n’ and n” is independently an integer selected from 5 to 15.
[0145] In one aspect, each of n’, n”, and n’” is independently an integer selected from 1 to 20. In a further aspect, each of n’. n”, and n’” is independently an integer selected from 1 to 15. In a still further aspect, n’, n”, and n”’ is independently an integer selected from 1 to 10. In yet a further aspect, each of n’, n”, and n’” is independently an integer selected from 1 to 5. In an even further aspect, each of n', n’', and n'” is independently an integer selected from 5 to 20. In a still further aspect, each of n', n”, and n'” is independently an integer selected from 10 to 20. In yet a further aspect, each of n’, n”, and n’” is independently an integer selected from 15 to 20. In an even further aspect, each of n’, n”, and n’” is independently an integer selected from 5 to 15.
[0146] In one aspect, each of n’, n”. n’"’, and n”” is independently an integer selected from 1 to 20. In a further aspect, each of n’, n”, n’”, and n”” is independently an integer selected from 1 to 15. In a still further aspect, each of n’, n”, n’”, and n”” is independently an integer selected from 1 to 10. In yet a further aspect, each of n’, n”, n”’, and n”” is independently an integer selected from 1 to 5. In an even further aspect, each of n', n”, n’”, and n”” is independently an integer selected from 5 to 20. In a still further aspect, each of n’, n”, n”’, and n”” is independently an integer selected from 10 to 20. In yet a further aspect, each of n’, n”, n’”, and n”” is independently an integer selected from 15 to 20. In an even further aspect, each of n’, n’", n’”, and n’"” is independently an integer selected from 5 to 15.
[0147] In one aspect, each of u and v is independently an integer selected from 1 to 20. In a further aspect, each of u and v is independently an integer selected from 1 to 15. In a still further aspect, each of u and v is independently an integer selected from 1 to 10. In yet a further aspect, each of u and v is independently an integer selected from 1 to 5. In an even further aspect, each of u and v is independently an integer selected from 5 to 20. In a still further aspect, each of u and v is independently an integer selected from 10 to 20. In yet afurther aspect, each of u and v is independently an integer selected from 15 to 20. In an even further aspect, each of u and v is independently an integer selected from 5 to 15.
[0148] In one aspect, each of u’ and v‘ is independently an integer selected from 1 to 20. In a further aspect, each of u’ and v’ is independently an integer selected from 1 to 15. In a still further aspect, each of u’ and v’ is independently an integer selected from 1 to 10. In yet a further aspect, each of u’ and v’ is independently an integer selected from 1 to 5. In an even further aspect, each of u’ and v’ is independently an integer selected from 5 to 20. In a still further aspect, each of u’ and v’ is independently an integer selected from 10 to 20. In yet a further aspect, each of u' and v’ is independently an integer selected from 15 to 20. In an even further aspect, each of u’ and v’ is independently an integer selected from 5 to 15.(i) A GROUPS
[0149] In one aspect, each occurance of A is selected from:(ii) B GROUPS
[0150] In one aspect, each occurrence of is independently selected from:(iii) G GROUPS
[0151] In one aspect, G is a polyamide turn linker such as, for example, a polyamide turn linker having two points of attachment to the remainder of the compound. Examples of such polyamide turn linkers include, but are not limited to:
[0152] In various aspects, G is a structure selected from:(iv) H GROUPS
[0153] In one aspect, H is a polyamide turn linker such as, for example, a polyamide turn linker having three points of attachment. Examples of polyamide turn linkers include, but are not limited to, structures selected from:(v) X GROUPS
[0154] In one aspect, each occurrence of X is independently selected from N or CH.In a further aspect. X is N. In a still further aspect, X is CH.(vi) MONOMERIC UNIT GROUPS
[0155] In one aspect, each occurrence of R is independently selected from:
[0156] In a further aspect, each occurrence of R is independently selected from:
[0157] In a further aspect, each occurrence of R is independently selected from:
[0158] In a further aspect, each occurrence of R is independently selected from:(vii) R1GROUPS
[0159] In one aspect R1is selected from:(viii) R10GROUPS
[0160] In one aspect, R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy. In a still further aspect, R10, when present, is selected from hydrogen, fluoro, chloro, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy. In a still further aspect, R10. when present, is selected from hydrogen, fluoro, and chloro. In a still further aspect, R10, when present, is fluoro. In a still further aspect, R10, when present, is chloro.
[0161] In various aspects, R10, when present, is selected from hydrogen, -OH, -NH2, -NHC(O)CH3. methyl, and methoxy. In a further aspect, R10, when present, is selected from hydrogen, -OH, and -NH2. In a further aspect, R10, when present, is selected from hydrogen and -OH. In a further aspect, R10, when present, is selected from hydrogen and -NH2.
[0162] In various aspects, R10, when present, is selected from hydrogen, -NH2, -NHC(O)CH3. In a further aspect, R10. when present, is selected from hydrogen and -NH2. In a further aspect, R10, when present, is selected from hydrogen and -NHC(O)CH3. In a yet further aspect, R10, when present, is -NH2. In a yet further aspect, R10, when present, is -NHC(O)CH3.
[0163] In various aspects, R10, when present, is selected from hydrogen, -OH, methyl, and methoxy. In a further aspect, R10, when present, is selected from hydrogen, -OH, and methoxy. In a further aspect, R10, when present, is selected from hydrogen and -OH. In a further aspect, R10, when present, is selected from hydrogen and methoxy. In a further aspect, R10, when present, is selected from hydrogen and methyl. In a yet furher aspect, R10, when present, is -OH. In a yet further aspect, R10, when present, is methoxy. In a yet further aspect, R10, when present, is methyl.
[0164] In various aspects, R10, when present, is hydrogen.(ix) R11AAND R11BGROUPS
[0165] In one aspect, each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy. In a further aspect, each of R11aand R11b, when present, is independently selected from hydrogen, methyl, and methoxy. In a further aspect, each of R11aand R11b, when present, is independently selected from hydrogen, -OH, and methoxy. In a further aspect, each of R11aand R11b. when present, is independently selected from hydrogen, -OH. and methyl. In a still further aspect, each of R11aand R11b, when present, is independently selected from -OH, methyl, and methoxy. In yet a further aspect, each of R11aand R11b, when present, is independently selected from hydrogen, and -OH. In yet a further aspect, each of R11aand R11b, when present, is independently selected from hydrogen and methyl. In yet a further aspect, each of R11aand R11b, when present, is independently selected from hydrogen and methoxy. In yet a further aspect, each occurrence of R11, when present, is independently selected from -OH and methyl. In yet a further aspect, each of R11aand R11b, when present, is independently selected from -OH and methoxy. In yet a further aspect, each of R11aand R11b, when present, is independently selected from methyl and methoxy.
[0166] In various aspects, each of R11aand R11b, when present, is hydrogen.b. UBIQUITIN-PROTEOSOME SYSTEM (UPS) TARGETING MOIETIES
[0167] In one aspect, the disclosed sequence selective DNA binding compound comprises a Ubiquitin-Proteosome System (UPS) targeting moiety. In a further aspect, the UPS targeting moiety is an E3 ligase binding ligand. Examples of E3 ligase binding ligandsinclude, but are not limited to:
[0168] In a further aspect, the UPS targeting moiety is an E3 ligase binding ligand. In a further aspect, the E3 ligase binding ligand is selected from residues of:
[0169] In various aspects, the UPS targeting moiety has a structure selected from:c. BROMODOMAIN EXTRATERMINAL DOMAIN (BET) BINDING LIGANDS (BRD GROUPS)
[0170] In various aspects, the disclosed sequence selective DNA binding compound comprises a bromodomain (BET) binding ligand. In a further aspect, the BET binding ligand is tethered to the polyamide moiety via a second chemical linker. In a still further aspect, the polyamide, the UPS targeting moiety, and the BET binding ligand are tethered via a first chemical linker and via a second chemical linker. In yet a further aspect, the polyamide, the transcription factor binding moiety', and the BET binding ligand are tethered via a first chemical linker and a second chemical linker.
[0171] In various aspects, the BET binding ligand is a residue of a structure selected from:
[0172] In various aspects, the BET binding ligand has a structure:d. PBX OR TCF3-PBX TRANSCRIPTION FACTOR BINDING MOIETIES
[0173] In various aspects, the disclosed sequence selective DNA binding compound comprises a PBX or TCF3-PBX transcription factor binding moiety. In a further aspect, the PBX or TCF3-PBX transcription factor binding moiety is tethered to the polyamide moiety via a second chemical linker. In a still further aspect, the UPS targeting moiety or the PBX or TCF3-PBX transcription factor binding moiety are tethered to the polyamide moiety7via a second chemical linker.
[0174] In various aspects, the transcription factor binding moiety is selected from:e. CHEMICAL LINKERS
[0175] In one aspect, the disclosed sequence selective deoxyribonucleic acid (DNA) binding compound comprises a first chemical linker. In a further aspect, the disclosed sequence selective DNA binding compound also comprises a second chemical linker. In this way, the various components of the compound (e.g., the polyamide moiety, the UPS targeting moiety, the BET binding ligand, the PBX or TCF3-PBX transcription factor binding moiety) can be tethered together.
[0176] Thus, in various aspects, the compound comprises the first chemical linker. In a further aspect, the compound comprises the second chemical linker. In a still further aspect, the compound comprises the first and the second chemical linker.
[0177] In various aspects, the first and the second chemical linker are the same. In a further aspect, the first and the second chemical linker are different.
[0178] In various aspects, the first chemical linker has a structure represented by a formula selected from:wherein * denotes a bond connected to the BET binding ligand and ** denotes a bond connected to the polyamide moiety; wherein Q is selected from O, NH. and CH2: and wherein each of u and v is independently an integer selected from 1 to 20.
[0179] In various aspects, the first chemical linker has a structure represented by a formula:
[0180] In various aspects, the first chemical linker is the only chemical linker in the compound.
[0181] In various aspects, the second chemical linker has a structure represented by a formula selected from:wherein * denotes a bond connected to the UPS targeting moiety or the transcription factor binding moiety and ** denotes a bond connected to the polyamide moiety; wherein Q’ is selected from O, NH, and CH2; and wherein each of u’ and v‘ is independently an integer selected from 1 to 20.
[0182] In various aspects, the second chemical linker has a structure represented by a formula:
[0183] In one aspect, each of u and v is independently an integer selected from 1 to 20. In a further aspect, each of u and v is independently an integer selected from 1 to 15. In a still further aspect, each of u and v is independently an integer selected from 1 to 10. In yet a further aspect, each of u and v is independently an integer selected from 1 to 5. In an evenfurther aspect, each of u and v is independently an integer selected from 5 to 20. In a still further aspect, each of u and v is independently an integer selected from 10 to 20. In yet a further aspect, each of u and v is independently an integer selected from 15 to 20. In an even further aspect, each of u and v is independently an integer selected from 5 to 15.
[0184] In one aspect, each of u' and v‘ is independently an integer selected from 1 to 20. In a further aspect, each of u’ and v’ is independently an integer selected from 1 to 15. In a still further aspect, each of u and v is independently an integer selected from 1 to 10. In yet a further aspect, each of u’ and v’ is independently an integer selected from 1 to 5. In an even further aspect, each of u‘ and v’ is independently an integer selected from 5 to 20. In a still further aspect, each of u’ and v’ is independently an integer selected from 10 to 20. In yet a further aspect, each of u’ and v’ is independently an integer selected from 15 to 20. In an even further aspect, each of u’ and v’ is independently an integer selected from 5 to 15.f. Q GROUPS
[0185] In one aspect. Q is selected from O, NH, and CH2. In a further aspect, Q is selected from O and NH. In a still further aspect, Q is selected from O and CH2. In yet a further aspect, Q is selected from O and NH. In an even further aspect, Q is O. In an even still further aspect, Q is NH. In yet an even further aspect, Q is CH2.
[0186] In various aspect, Q is O.2. EXAMPLE COMPOUNDS
[0187] In one aspect, a compound can be present as one or more of the following structures:or a pharmaceutically acceptable salt thereof.3. PROPHETIC EXAMPLE COMPOUNDS
[0188] The following compound examples are prophetic, and can be prepared using the synthesis methods described herein above and other general methods as needed as wouldbe known to one skilled in the art. It is anticipated that the prophetic compounds would promote AIRE target expression, as further detailed herein, and such activity can be determined using the assay methods described herein below.
[0189] In one aspect, a compound can be present as one or more of the following structures:oror a pharmaceutically acceptable salt thereof.
[0190] It is contemplated that one or more compounds can optionally be omitted from the disclosed invention.
[0191] It is understood that the disclosed compounds can be used in connection with the disclosed methods, compositions, kits, and uses.
[0192] It is understood that pharmaceutical acceptable derivatives of the disclosed compounds can be used also in connection with the disclosed methods, compositions, kits, and uses. The pharmaceutical acceptable derivatives of the compounds can include any suitable derivative, such as pharmaceutically acceptable salts as discussed below, isomers, radiolabeled analogs, tautomers, and the like.C. METHODS OF MAKING A COMPOUND
[0193] The compounds of this invention can be prepared by employing reactions as shown in the following schemes, in addition to other standard manipulations that are known in the literature, exemplified in the experimental sections or clear to one skilled in the art. For clarity, examples having a single substituent are shown where multiple substituents are allowed under the definitions disclosed herein.
[0194] Reactions used to generate the compounds of this invention are prepared by employing reactions as shown in the following Reaction Schemes, as described and exemplified below. In certain specific examples, the disclosed compounds can be prepared by Routes I- VIII, as described and exemplified below. The following examples are provided so that the invention might be more fully understood, are illustrative only, and should not be construed as limiting.1. ROUTE 1
[0195] In one aspect, the disclosed polyamides (e.g, linear, U-pin, H-pin) can beprepared as shown below.SCHEME 1A.1.8
[0196] Compounds are represented in generic form, wherein each occurrence of PG is independently an amine protecting group (e.g, carbobenzyloxy, g-melhoxy benzyl carbonyl, / -butyloxy carbonyl, 9-fluorenylmethyloxycarbonyl, acetyl, benzoyl, benzyl, carbamate, p-methoxybenzyl, 3,4-dimethoxybenzyl, / -methox phen l. tosyl, 4-nitrobenzenesulfonyl), R’ is H, benzotriazole (Bt), or any other activated moiety, and with other substituents as noted in compound descriptions elsewhere herein. A specific non-limiting example of the synthesis shown in Scheme 1A is provided below.SCHEME IBii) DMF, DI PEA, Aceticanhydrideiii) 80% TFA, 10% DCM, 10% TIPS 1.14Reptw
[0197] In one aspect, compounds of type 1.19, and similar compounds, can be prepared according to reaction Scheme IB above. Thus, compounds of type 1.10 can be prepared by deprotection of an appropriate resin having an protected amine, e.g, 1.9 as shown above. The deprotection is carried out by suspending the resin in an appropriate solvent, e.g., dichloromethane (DCM), for an appropriate period of time, e.g., 10 minutes, followed by addition of an appropriate deprotecting agent, e.g., 80% triflouroacetic acid (TFA). an appropriate reducing agent, e.g., 10% triisopropyl silane (TIPS), in an appropriate solvent, e.g., 10% DCM, for an appropriate period of time, e.g., 30 minutes. Compounds of type 1.12 can be prepared by a coupling reaction between an appropriate amine, e.g., 1.10 as shown above, and an appropriate carboxylic acid, e.g., 1.11 as shown above. The coupling reaction can be carried out in the presence of an appropriate coupling agent, e.g.. hexafluorophosphate azabenzotriazole tetramethyl uronium (HATU), and an appropriate base, e.g., / V.. V-diisopropylethylamine (DIPEA), in an appropriate solvent, e.g., dimethylformamide (DMF), followed by suspension in an appropriate solvent, e.g., DMF, in the presence of an appropriate base, e.g, DIPEA, and capping with an appropriate acetate, e.g, acetic anhydride as shown above. The protecting group is then removed using deprotection conditions such as, for example, those detailed above for Step 1. Compounds of type 1.14 can be prepared by a coupling reaction between an appropriate amine, e.g., 1.12 as shown above, and an appropriate carboxylic acid, e.g., 1.13 as shown above. The coupling reaction can be carried out in the presence of an appropriate base, e.g, DIPEA. in an appropriate solvent, e.g., DMF, followed by suspension in an appropriate solvent, e.g., DMF, in the presence of an appropriate base, e.g., DIPEA, and capping with an appropriate acetate, e.g., acetic anhydride or aceticanhydride as shown above. The protecting group is then removed using deprotection conditions such as, for example, those detailed above for Step 1. Steps 2 and 3 can be repeated as needed such that the desired n groups are included in the peptide, e.g., peptide 1.15 as shown above. Compounds of type 1.17 can be prepared by a coupling reaction between an appropriate amine, e.g., 1.15 as shown above, and anappropriate carboxylic acid, e.g., 1.16 as shown above. The coupling reaction can be carried out in the presence of an appropriate coupling agent, e.g., HATU, and an appropriate base, e.g., / V. A-DIPEA. in an appropriate solvent, e.g., DMF, followed by suspension in an appropriate solvent, e.g., DMF, in the presence of an appropriate base, e.g., DIPEA, and capping with an appropriate acetate, e.g., acetic anhydride or aceticanhydride as shown above. Compounds of type 1.19 can be prepared by cleavage of the resin using an appropriate amine, e.g., 1.18 as shown above. The cleavage can be achieved at an appropriate temperature, e.g., 55 °C, for an appropriate period of time, e.g., 16 hours. As can be appreciated by one skilled in the art the above reaction provides an example of a generalized approach wherein compounds similar in structure to the specific reactions above (compounds similar to 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, and 1.7) can be substituted in the reaction to provide polyamides similar to Formula 1.8.2. ROUTE 2
[0198] In one aspect, the disclosed polyamides (e.g., tandem hairpin, hairpin, cyclic) can be prepared as shown below.SCHEME 2A.2.5
[0199] Compounds are represented in generic form, wherein each occurrence of PG independently is an amine protecting group (e.g., carbobenzyloxy, -methoxybenzyl carbonyl, / -butyloxycarbonyl. 9-fluorenylmethyloxy carbonyl, acetyl, benzoyl, benzy l, carbamate, p-methoxy benzyl, 3,4-dimethoxybenzyl, / 7-methoxy phenyl, tosyl, 4-nitrobenzenesulfonyl), R' is H, benzotriazole (Bt), and with other substituents as noted in compound descriptions elsewhere herein. A specific non-limiting example of the synthesis shown in Scheme 2A is provided below.SCHEME 2B.2.10
[0200] In one aspect, compounds of type 2.10, and similar compounds, can be prepared according to reaction Scheme 2B above. Thus, compounds of type 2.8 can be prepared by a coupling reaction between an appropriate amine, e.g, 2.6 as shown above, and an appropriate carboxylic acid, e.g., 2.9 as shown above. The coupling reaction can be carried out in the presence of an appropriate base, e.g., DIPEA, in an appropriate solvent, e.g., DMF, followed by suspension in an appropriate solvent, e.g., DMF, in the presence of an appropriate base, e.g, DIPEA. and capping with an appropriate acetate, e.g, acetic anhydride or aceticanhydride as shown above. The protecting group is then removed using an appropriate deprotecting agent, e.g., 80% triflouroacetic acid (TFA), and an appropriate reducing agent, e.g., 10% triisopropyl silane (TIPS), in an appropriate solvent, e.g., 10% DCM. Compounds of type 2.10 can be prepared by a coupling reaction between an appropriate amine, e.g., 2.8 as shown above, and an appropriate carboxylic acid, e.g., 2.9 as shown above. The coupling reaction can be carried out in the presence of an appropriate base, e.g., / V. V-DIPEA. in an appropriate solvent, e.g., DMF, followed by suspension in an appropriate solvent, e.g., DMF, in the presence of an appropriate base, e.g, DIPEA, and capping with an appropriate acetate, e.g., acetic anhydride or aceticanhydride as shown above. The protecting group is then removed as described for Step 1. As would be understood by one of skill in the art, Step 2 can be repeated as needed such that the desired n groups are included in the peptide, e.g., peptide 2.10 as shown above. Capping of the terminal amine and resin cleavage can then be achieved as described for Scheme 1A and Scheme IB above. As can be appreciated by one skilled in the art the above reaction provides an example of a generalized approach wherein compounds similar in structure to the specific reactions above (compounds similar to 2.1, 2.2, 2.3, and 2.4) can be substituted in the reaction to provide polyamides similar to Formula 2.5.3. ROUTE 3
[0201] In one aspect, the compounds disclosed herein can be prepared as shown below.SCHEME 3A.3.13.2polyamide moiety— NHNH— chemical linker^2O3.3
[0202] Compounds are represented in generic form, wherein PG is an amine protecting group (e g., carbobenzyloxy, p-methoxybenzyl carbonyl, / -butyl oxycarbonyl, 9-fluorenylmethyloxycarbonyl, acety l, benzoyl, benzyl, carbamate, p-methoxybenzyl, 3,4-dimethoxybenzyl. -methoxyphenyl. tosyl, 4-nitrobenzenesulfonyl), and with other substituents as noted in compound descriptions elsewhere herein. A specific non-limiting example of the synthesis shown in Scheme 3A is provided below;SCHEME 3B.
[0203] In one aspect, compounds of type 3.6, and similar compounds, can be prepared according to reaction Scheme 3B above. Thus, compounds of type 3.6 can be prepared by coupling a polyamide moiety, e.g., 3.4 as shown above, and an appropriate protected aminoterminated chemical linker, e.g.. 3.5 as shown above, followed by removal of the amino protecting group. The coupling reaction can be carried out in the presence of an appropriate base, e.g., DIPEA, in an appropriate solvent, e.g., DMF, at an appropriate temperature, e.g., room temperature, for an appropriate period of time, e.g., 2 hours. The deprotection can be carried out in the presence of an appropriate base, e.g., piperidine, in an appropriate solvent, e.g., DMF, at an appropriate temperature, e.g., room temperature, for an appropriate period of time, e.g., 1 hours. As can be appreciated by one skilled in the art, the above reaction provides an example of a generalized approach wherein compounds similar in structure to the specific reactants above (compounds similar to 3.1 and 3.2) can be substituted in the reaction to provide compounds similar to Formula 3.3.4. ROUTE 4
[0204] In one aspect, the sequence selective BET binding compounds disclosed herein can be prepared as shown below..SCHEME 4A.polyamide moiety— NHNHBET O— chemical linker^2targeting —O moiety OH4.1 4.24.3
[0205] Compounds are represented in generic form, with substituents as noted in compound descriptions elsewhere herein. A specific non-limiting example of the synthesis shown in Scheme 4A is provided below.SCHEME 4B.4.6
[0206] In one aspect, compounds of type 4.6 and similar compounds, can be prepared according to reaction Scheme 4B above. Thus, compounds of type 4.6 can be prepared by coupling an appropriate amine, e.g., 4.4 as shown above, to an appropriate carboxylic acid-terminated BET targeting moiety, e.g., 4.5 as shown above. The coupling reaction is carried out in the presence of an appropriate coupling agent, e.g., HATU. and an appropriate base, e.g., DIPEA, in an appropriate solvent, e.g., DMF. As can be appreciated by one skilled in the art, the above reaction provides an example of a generalized approach wherein compounds similar in structure to the specific reactants above (compounds similar to 4.1 and 4.2) can be substituted in the reaction to provide sequence selective DNA binding compounds similar to Formula 4.3.D. PHARMACEUTICAL COMPOSITIONS
[0207] In one aspect, disclosed are pharmaceutical compositions comprising an effective amount of a disclosed sequence selective deoxyribonucleic acid (DNA) binding compound comprising a polyamide moiety configured to bind a DNA sequence, or a pharmaceutically acceptable salt thereof, wherein the polyamide moiety is tethered via a first chemical linker to a bromodomain extraterminal domain (BET) binding ligand, and wherein the polyamide moiety is configured to bind a sequence 5’TTATTA3’ or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0208] In various aspects, the compositions further comprising a second sequence selective DNA binding compound comprising a polyamide moiety configured to bind a different DNA sequence than 5 ’TT ATT A3’. In a futher aspect, the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequencecomprising one or more repeats of GAAA. In a still further aspect, the second sequence selective DNA binding compound has a structure selected from:or a pharmaceutically acceptable salt thereof.
[0209] In yet a further aspect, the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence comprising one or more repeats of GAA, CTG, or CAG. In an even further aspect, wherein the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence 5 AAGAAGAAG3’.
[0210] In a further aspect, the second sequence selective DNA binding compound includes SEQ ID NO: 1 as further detailed herein. Thus, in various aspects, the second sequence selective DNA binding compound is selected from:or a pharmaceutically acceptable salt thereof.
[0211] In a further aspect, the second sequence selective DNA binding compound includes SEQ ID NO: 2 as further detailed herein. Thus, in various aspects, the second sequence selective DNA binding compound is selected from:or a pharmaceutically acceptable salt thereof.
[0212] In a further aspect, the second sequence selective DNA binding compound has a structure selected from:or a pharmaceutically acceptable salt thereof.
[0213] In various aspects, the compounds and compositions of the invention can be administered in pharmaceutical compositions, which are formulated according to the intended method of administration. The compounds and compositions described herein can be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. For example, a pharmaceutical composition can be formulated for local or systemic administration, e.g, administration by drops or injection into the ear, insufflation (such as into the ear), intravenous, topical, or oral administration.
[0214] The nature of the pharmaceutical compositions for administration is dependent on the mode of administration and can readily be determined by one of ordinary skill in the art. In various aspects, the pharmaceutical composition is sterile or sterilizable. The therapeutic compositions featured in the invention can contain carriers or excipients, many of which are known to skilled artisans. Excipients that can be used include buffers (for example, citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, polypeptides (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, water, and glycerol. The nucleic acids, polypeptides, small molecules, and other modulatory compounds featured in the invention can be administered by any standard route of administration. For example, administration can be parenteral, intravenous, subcutaneous, or oral. A modulatory compound can be formulated in various ways, according to the corresponding route of administration. For example, liquid solutions can be made for administration by drops into the ear, for inj ection, or for ingestion; gels or powders can be made for ingestion or topical application. Methods for making such formulations are well known and can be found in, for example, Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA 1990.
[0215] In various aspects, the disclosed pharmaceutical compositions comprise the disclosed compounds (including pharmaceutically acceptable salt(s) thereof) as an activeingredient, a pharmaceutically acceptable carrier, and, optionally, other therapeutic ingredients or adjuvants. The instant compositions include those suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severi ty of the conditions for which the active ingredient is being administered. The pharmaceutical compositions can be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
[0216] In various aspects, the pharmaceutical compositions of this invention can include a pharmaceutically acceptable carrier and a compound or a pharmaceutically acceptable salt of the compounds of the invention. The compounds of the invention, or pharmaceutically acceptable salts thereof, can also be included in pharmaceutical compositions in combination with one or more other therapeutically active compounds.
[0217] The pharmaceutical carrier employed can be, for example, a solid, liquid, or gas. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. Examples of liquid earners are sugar syrup, peanut oil, olive oil, and w ater. Examples of gaseous carriers include carbon dioxide and nitrogen.
[0218] In preparing the compositions for oral dosage form, any convenient pharmaceutical media can be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like can be used to form oral solid preparations such as powders, capsules and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, tablets can be coated by standard aqueous or nonaqueous techniques
[0219] A tablet containing the composition of this invention can be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants. Compressed tablets can be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed w ith a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets can be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
[0220] The pharmaceutical compositions of the present invention comprise a compound of the invention (or pharmaceutically acceptable salts thereof) as an active ingredient, a pharmaceutically acceptable carrier, and optionally one or more additional therapeutic agents or adjuvants. The instant compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered. The pharmaceutical compositions can be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
[0221] Pharmaceutical compositions of the present invention suitable for parenteral administration can be prepared as solutions or suspensions of the active compounds in water. A suitable surfactant can be included such as, for example, hydroxypropylcellulose.Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Further, a preservative can be included to prevent the detrimental growth of microorganisms.
[0222] Pharmaceutical compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. In all cases, the final injectable form must be sterile and must be effectively fluid for easy syringability. The pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), vegetable oils, and suitable mixtures thereof.
[0223] Pharmaceutical compositions of the present invention can be in a form suitable for topical use such as. for example, an aerosol, cream, ointment, lotion, dusting powder, mouth washes, gargles, and the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations can be prepared, utilizing a compound of the invention, or pharmaceutically acceptable salts thereof, via conventional processing methods. As an example, a cream or ointment is prepared by mixing hydrophilic material and water, together with about 5 wt% to about 10 wt% of the compound, to produce a cream or ointment having a desired consistency.
[0224] In addition to the aforementioned carrier ingredients, the pharmaceutical formulations described above can include, as appropriate, one or more additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like. Furthermore, other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient. Compositions containing a compound of the invention, and / or pharmaceutically acceptable salts thereof, can also be prepared in powder or liquid concentrate form.
[0225] In a further aspect, an effective amount is a therapeutically effective amount. In a still further aspect, an effective amount is a prophylactically effective amount.
[0226] In a further aspect, the pharmaceutical composition is administered to a mammal. In a still further aspect, the mammal is a human. In an even further aspect, the human is a patient.
[0227] In a further aspect, the pharmaceutical composition is used to treat an autoimmune disease (e.g., Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes)..
[0228] It is understood that the disclosed compositions can be prepared from the disclosed compounds. It is also understood that the disclosed compositions can be employed in the disclosed methods of using.E. METHODS FOR RESTORING EXPRESSION OF AUTOIMMUNE REGUEATOR (AIRE) GENE IN A CELT
[0229] In one aspect, disclosed are methods for restoring expression of autoimmune regulator (AIRE) gene in a cell, the method comprising contacting the cell with an effective amount of sequence selective deoxyribonucleic acid (DNA) binding compound, or a pharmaceutically acceptable salt thereof.
[0230] In a further aspect, the the cell is mammalian. In a still further aspect, the cell is human.
[0231] In a further aspect, the cell has been isolated from a mammal prior to the contacting step.
[0232] In a further aspect, the contacting is ex vivo.
[0233] In a further aspect, the contacting is in vitro.
[0234] In a further aspect, contacting is via administration to a mammal.
[0235] In a further aspect, the mammal has been diagnosed with a need for restoration of AIRE gene expression prior to the administering step.
[0236] In a further aspect, the mammal has been diagnosed with a need for restoration of AIRE gene expression prior to the administering step.F. METHODS FOR RESTORING EXPRESSION OF AUTOIMMUNE REGUEATOR (AIRE) GENE IN A SUBJECT
[0237] In one aspect, disclosed are methods for restoring expression of autoimmune regulator (AIRE) gene in a subject, the method comprising administering to the subject an effective amount of sequence selective deoxyribonucleic acid (DNA) binding compound, or a pharmaceutically acceptable salt thereof.
[0238] In a further aspect, the subject is a mammal. In a still further aspect, the mammal is a human.
[0239] In a further aspect, the subject has been diagnosed with a need for restoration of AIRE gene expression prior to the administering step.
[0240] In a further aspect, further comprising identifying a subject in need of restoration of AIRE gene expression.
[0241] In a further aspect, the method further restores expression of a gene selected from frataxin (FXN) gene, transcription factor 4 (TCF4) gene, Huntingtin (HTT) gene. DMPK, autoimmune regulator (AIRE) gene, insulin (INS) gene, S100A8 gene, HL A complex P5 (HCP5) gene. In a still further aspect, further comprising administering to the subject an effective amount of a second sequence selective DNA binding compound comprising a polyamide moiety configured to bind a different DNA sequence than5 TT ATT A3’. In yet a further aspect, the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence comprising one or more repeats of GAAA, GAA, CTG, or CAG or a sequence 5 AAGAAGAAG3’.G. METHODS OF TREATING AN AUTOIMMUNE DISEASE IN A SUBJECT
[0242] In one aspect, disclosed are methods of treating an autoimmune disease in a subject in need thereof, the method comprising administering to the subject an effective amount of a disclosed sequence selective binding compound, thereby treating an autoimmune disease. In a further aspect, the autoimmune disease is selected from Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory boweldisease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes.
[0243] In a further aspect, the subject is a mammal. In a still further aspect, the mammal is a human.
[0244] In a further aspect, the subject has been diagnosed with a need for treatment of the autoimmune disease prior to the administering step.
[0245] In a further aspect, further comprising the step of identifying a subject in need of treatment of the autoimmune disease.
[0246] In a further aspect, the effective amount is a therapeutically effective amount. In a still further aspect, the effective amount is a prophylactically effective amount.
[0247] In a further aspect, the autoimmune disease is selected from Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes.
[0248] In a further aspect, the autoimmune disease has a mutation of an autoimmune regulator (AIRE) gene.
[0249] In a further aspect, the disorder is autoimmune polyendocrine syndrome 1 (APS1), autoimmune polyendocrinopathy -candidiasis-ectodermal dystrophy (APECED), or polyglandular autoimmune syndrome type-1 (PGA).H. METHODS OF USING THE COMPOSITIONS
[0250] Provided are methods of using of a disclosed composition or medicament. In one aspect, the method of use is directed to the treatment of a disorder. In a further aspect, the disclosed compounds can be used as single agents or in combination with one or more other drugs in the treatment, prevention, control, amelioration, or reduction of risk of the aforementioned diseases, disorders and conditions for which the compound or the other drugs have utility, where the combination of drugs together are safer or more effective than either drug alone. The other drug(s) can be administered by a route and in an amount commonly used therefore, contemporaneously or sequentially with a disclosed compound. When a disclosed compound is used contemporaneously with one or more other drugs, a pharmaceutical composition in unit dosage form containing such drugs and the disclosed compound is preferred. However, the combination therapy can also be administered on overlapping schedules. It is also envisioned that the combination of one or more active ingredients and a disclosed compound can be more efficacious than either as a single agent.
[0251] The pharmaceutical compositions and methods of the present invention can further comprise other therapeutically active compounds as noted herein which are usually applied in the treatment of the above mentioned pathological conditions.1. MANUFACTURE OF A MEDICAMENT
[0252] In one aspect, the invention relates to a method for the manufacture of a medicament for treating for treating an autoimmune disease (c.g.. Addison disease. Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes), the method comprising combining a therapeutically effective amount of a disclosed sequence selective DNA binding compound or product of a disclosed method with a pharmaceutically acceptable carrier or diluent.
[0253] As regards these applications, the present method includes the administration to an animal, particularly a mammal, and more particularly a human, of a therapeutically effective amount of the compound effective in the inhibition of uncontrolled cellular proliferation, such as of treating an autoimmune disease. The dose administered to an animal, particularly a human, in the context of the present invention should be sufficient to affect a therapeutic response in the animal over a reasonable time frame. One skilled in the art will recognize that dosage will depend upon a variety of factors including the condition of the animal, the body weight of the animal, as well as the severity and stage of the disorder.
[0254] Thus, in one aspect, the invention relates to the manufacture of a medicament comprising combining a disclosed sequence selective DNA binding compound or a product of a disclosed method of making, or a pharmaceutically acceptable salt, solvate, or polymorph thereof, with a pharmaceutically acceptable carrier or diluent.2. USE OF COMPOUNDS AND COMPOSITIONS
[0255] Also provided are the uses of the disclosed compounds and compositions. Thus, in one aspect, the invention relates to the uses of sequence selective DNA binding compounds.In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or product of a disclosed method in the manufacture of a medicament for the treatment of treating an autoimmune disease (e.g., Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease,multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes).
[0256] In a further aspect, the use relates to a process for preparing a pharmaceutical composition comprising a therapeutically effective amount of a disclosed sequence selective DNA binding compound or a product of a disclosed method, and a pharmaceutically acceptable carrier, for use as a medicament.
[0257] In a further aspect, the use relates to a process for preparing a pharmaceutical composition comprising a therapeutically effective amount of a disclosed sequence selective DNA binding compound or a product of a disclosed method, wherein a pharmaceutically acceptable carrier is intimately mixed with a therapeutically effective amount of the disclosed compound or the product of a disclosed method.
[0258] In various aspects, the use relates to the treatment of uncontrolled cellular proliferation in a vertebrate animal. In a further aspect, the use relates to the treatment of uncontrolled cellular proliferation in a human subject.
[0259] In a further aspect, the use is the treatment of an autoimmune disease (e.g., Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes).
[0260] It is understood that the disclosed uses can be employed in connection with the disclosed compounds, methods, compositions, and kits. In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or composition of a medicament for the treatment of a disorder associated with uncontrolled cellular proliferation in a mammal.
[0261] In a further aspect, the invention relates to the use of a disclosed sequence selective DNA binding compound or composition in the manufacture of a medicament for the treatment of an autoimmune disease (e.g., Addison disease, Celiac disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes).3. SUBJECTS
[0262] In various aspects, the subject of the disclosed methods is a vertebrate, e.g., a mammal. Thus, the subject of the herein disclosed methods can be a human, non-human primate, horse, pig, rabbit, dog, sheep, goat, cow, cat, guinea pig, or rodent. The term doesnot denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. A patient refers to a subject afflicted with a disease or disorder. The term “patient’' includes human and veterinary subjects.
[0263] In some aspects of the disclosed methods, the subject has been diagnosed with a need for treatment prior to the administering step. In some aspects of the disclosed method, the subject has been diagnosed with a disorder associated with uncontrolled cellular proliferation prior to the administering step. In some aspects of the disclosed methods, the subject has been identified with a need for treatment prior to the administering step. In one aspect, a subject can be treated prophylactically with a compound or composition disclosed herein, as discussed herein elsewhere.a. DOSAGE
[0264] Toxicity and therapeutic efficacy of the agents and pharmaceutical compositions described herein can be determined by standard pharmaceutical procedures, using either cells in culture or experimental animals to determine the LD50 (the dose lethal to 50% of the population) and the EDso (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50 / ED50. Polypeptides or other compounds that exhibit large therapeutic indices are preferred.
[0265] Data obtained from cell culture assays and further animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity, and with little or no adverse effect on a human's ability to hear. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any agents used in the methods described herein, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (that is. the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Exemplary dosage amounts of a differentiation agent are at least from about 0.01 to 3000 mg per day, e.g., at least about 0.00001, 0.0001, 0.001, 0.01, 0.1, 1, 2, 5, 10, 25, 50, 100, 200, 500, 1000, 2000, or 3000 mg per kg per day. or more.
[0266] The formulations and routes of administration can be tailored to the disease ordisorder being treated, and for the specific human being treated. For example, a subject can receive a dose of the agent once or twice or more daily for one week, one month, six months, one year, or more. The treatment can continue indefinitely, such as throughout the lifetime of the human. Treatment can be administered at regular or irregular intervals (once every other day or twice per week), and the dosage and timing of the administration can be adjusted throughout the course of the treatment. The dosage can remain constant over the course of the treatment regimen, or it can be decreased or increased over the course of the treatment.
[0267] In various aspects, the dosage facilitates an intended purpose for both prophylaxis and treatment without undesirable side effects, such as toxicity, irritation, or allergic response. Although individual needs may vary, the determination of optimal ranges for effective amounts of formulations is within the skill of the art. Human doses can readily be extrapolated from animal studies (Katocs et al., (1990) Chapter 27 in Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, PA). In general, the dosage required to provide an effective amount of a formulation, which can be adjusted by one skilled in the art, will vary depending on several factors, including the age, health, physical condition, weight, type and extent of the disease or disorder of the recipient, frequency of treatment, the nature of concurrent therapy, if required, and the nature and scope of the desired effect(s) (Nies et al., (1996) Chapter 3, In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed.. Hardman et al., eds., McGraw-Hill, New York, NY).b. ROUTES OF ADMINISTRATION
[0268] Also provided are routes of administering the disclosed sequence selective DNA binding compounds and compositions. The compounds and compositions of the present invention can be administered by direct therapy using systemic administration and / or local administration. In various aspects, the route of administration can be determined by a patient's health care provider or clinician, for example following an evaluation of the patient. In various aspects, an individual patient's therapy may be customized, e.g, the type of agent used, the routes of administration, and the frequency of administration can be personalized. Alternatively, therapy may be performed using a standard course of treatment, e.g, using preselected agents and pre-selected routes of administration and frequency of administration.
[0269] Systemic routes of administration can include, but are not limited to, parenteral routes of administration, e.g.. intravenous injection, intramuscular injection, and intraperitoneal injection; enteral routes of administration e.g., administration by the oralIl lroute, lozenges, compressed tablets, pills, tablets, capsules, drops (e.g, ear drops), syrups, suspensions and emulsions; rectal administration, e.g., a rectal suppository or enema; a vaginal suppository; a urethral suppository: transdermal routes of administration; and inhalation (e.g., nasal sprays).
[0270] In various aspects, the modes of administration described above may be combined in any order.I. EXAMPLES
[0271] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.
[0272] The Examples are provided herein to illustrate the invention, and should not be construed as limiting the invention in any way. Examples are provided herein to illustrate the invention and should not be construed as limiting the invention in any way.1. CHEMISTRY METHODSa. SYNTHESIS OF POLYAMIDE (PAI)i) HATU, DIPEA, DMFii) DMF, DIPEA, Aceticanhydrideii) 80% TFA, 10% DCM, 10% TIPS
[0273] Polyamides were synthesized by manual solid-phase synthesis using Boc-beta-ala-PAM resin (1 g, 0.6 mmol) following established procedures (Boc = tert-butoxy carbonyl) (Mohammed, A. et al. (2023) J. Am. Chem. Soc. 145 (45), 24568- 24579 Erwin G. S., et al., (2023) Science 358(6370): 1617-1622). After synthesis was complete, 200 mg of polyamide was dissolved in 3.3'-diamino-N-methyldipropylamine (2 mL) and the reaction mixture was stirred at 55 °C for 12 h. The reaction mixture was dissolved in 2 mL of DCM and filtered; the filtrate was precipitated in ether (15 mL). The precipitate was dissolved in 15%acetonitrile / H₂O and purified by reverse-phase preparative HPLC on a C 18 column. Fractions that showed pure polyamide were frozen in liquid nitrogen and lyophilized to afford a white or off-white powder (40-50 mg). Identity and purity were confirmed by LC-MS and HPLC.b. SYNTHESIS OF MA-SYNGR-AIREMA-SynGR-AIRE4
[0274] To a stirred solution of MA-PA1 (30 mg, 0.03 mmol, 1 eq) and diisopropylethylamine (16 pL. 0.09 mmol, 3 eq) in dimethylformamide was added FmocNH-PEG6-NHS ester (20 mg. 0.03 mmol). The reaction mixture was stirred at room temperature for 30 min followed by 10% of piperidine was added. The reaction was monitored by LCMS. After completion of reaction, it was diluted with 15% of acetonitrile in water and purified by using Prep-HPLC. Fractions that showed pure MA-PAI-PEG6-NH2 were frozen in liquid nitrogen and lyophilized to afford a white or off-white powder (20-25 mg). Identity and purity were confirmed by LC-MS and analytical HPLC. HATU (10 mg, 0.02 mmol) was added to the stirred solution of JQ1-COOH (10 mg, 0.02 mmol) followed by diisopropylethylamine and reaction mixture was stirred for 5 min. After 5 min, MA-PA1-PEG6-NH2 (20 mg, 0.01 mmol) was added to the reaction mixture and stirring was continued for further 1 h. After completion of reaction compound was dissolved in acetonitrile and water and purified by Prep-HPLC. The pure fractions were lyophilized to obtain the compound MA-SynGR-AIRE4. Yield: 6-7 mg; 40-50%.
[0275] Similar synthetic procedures were used to synthesis other MA-SynGR-AIREs.2. BIOLOGICAL METHODS
[0276] HEK293T cells (0.2 million per well) were seeded into a 6-well plate. After 24 hours, the indicated concentrations of SYNGR or PA were incubated with a DNA fragment (10-mer TTATTA. a T-AIRE binding motif) for 1 hour at room temperature, followed by the addition of Dharmafect2™ (DF2) and a 30-minute incubation. It was then added to HEK293T cells and incubated for 24 hours. RNA was isolated using the Qiagen RNeasy isolation kit (74106), and 400 ng of RNA was used to synthesize cDNA using the iScript cDNA synthesis kit (Bio-Rad 1708891). The expression of T-AIRE target genes, including Insulin, A100S8, HCP5, and AIRE, was quantified using qPCR.
[0277] Similarly, 0.2 million Jurkat cells were plated per well in a 6-well plate. After 24 hours, the indicated concentrations of SYNGR or PA were added directly to the culture, and the cells were incubated for 24 hours. RNA was isolated and cDNA was synthesized. The expression of T-AIRE target genes (Insulin. A100S8, HCP5, or AIRE) was assessed via qPCR.
[0278] Cell lines: Jurkat T lymphocytes (ATCC, TIB-152) were cultured in RPMI-1640 (Sigma- Aldrich, St. Louis, MO) supplemented with 10% v / v fetal bovine serum. Cells were passaged every 2-3 days and discarded prior to passage 25. For sample isolation, cells were plated at 100,000 cells per well and directly treated with selected small molecule for 24hr or 48hr.
[0279] RNA was isolated using RNeasy Mini kit (Qiagen, Germantown MD) according to manufacturer’s recommended protocol. Prior to cellular lysis and RNA isolation, lysis buffer RLT was supplemented with 1% v / v beta-mercaptoethanol. RNA was quantified using NanoDrop eight spectrophotometer (Thermo Fisher, Waltham MA). Using Luna One-Step RT-qPCR kit (New England Biolabs, Ipswich MA), 25ng RNA were loaded per well, reverse transcribed for lOmin at 55 °C, and PCR amplified for 45 cycles with 10s of melting at 95 °C followed by annealing at 60 °C for 30s with continuous Cq measurement during cycling conditions. Cq values were collected for S100A8, Insulin, HCP5, AIRE and GAPDH housekeeping gene control, and analyzed using Design and Analysis (DA2, Thermo Fisher) and Prism 10 (GraphPad, San Diego CA).
[0280] Primer sequences include: S 100 A8 (Forward:CTCAGTATATCAGGAAAAAGGGTGCAGAC (SEQ ID NO: 3), Reverse:CACGCCCATCTTTATCACCAGAATGAG) (SEQ ID NO: 4), Insulin (Forward:GCAGCCTTTGTGAACCAACA (SEQ ID NO: 5), Reverse:GTGTGTAGAAGAAGCCTCGTTCC) (SEQ ID NO: 6). HCP5 (Forward: GGCAGATTACAATTACAATCAAGG (SEQ ID NO: 7), Reverse:TTGCATCTCAGTCTATTGCC) (SEQ ID NO: 8), AIRE (Forward:CTGCCAAGGATGACACTGCCA (SEQ ID NO: 9), Reverse:CGAAGGTGTGCTCGCTCAGAAG) (SEQ ID NO: 10) and GAPDH (Forward:CTGAGCTCATTTCCTGGTATGA (SEQ ID NO: 11), Reverse:CTTCCTCTTGTGCTCTTGCTG) (SEQ ID NO: 12). Primers were originally identified by Org et al., (2009), Human Molecular Genetics, 18(24): 4699-4710.
[0281] Refering to FIG. 1A and FIG. IB, representative data illustrates relative expression of SI 00 A8 mRNA. a known target of T-AIRE in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, 1 pM or 1 OpM) of SYNGR consisting of either hairpin or linear polyamide. Uptake of the molecules was facilitated using Dharmafect2 (DF2) transfection reagent. Prior to cell treatment, SYNGR was incubated with a lOmer TTATTA DNA fragment for Ihr. DNA alone was used as a negative control.Refering to FIG. 2, representative data illustrates relative expression of HCP5 mRNA, a know n target of T-AIRE in HEK293T cells after 24hr of treatment w ith varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of either hairpin or linear polyamide. Uptake of the molecules was facilitated using Dharmafect2 (DF2) transfection reagent. Prior to cell treatment, SYNGR was incubated with a lOmer TTATTA DNA fragment for Ihr. DNA alone was used as a negative control. Refering to FIG. 3, representative data illustrates relative expression of Insulin mRNA, a known target of T-AIRE in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of either hairpin or linear polyamide. Uptake of the molecules was facilitated using Dharmafect2 (DF2) transfection reagent. Prior to cell treatment, SYNGR was incubated with a lOmer TTATTA DNA fragment for Ihr. DNA alone was used as a negative control. Refering to FIG. 4, representative data illustrates relative expression of S 100 A8 and Insulin mRNA in Jurkat cells after 24 hours of treatment with different concentrations (0.5 pM, 1 pM, or 10 pM) of SYNGR with linear polyamide. PA treatment alone was used as a negative control. Refering to FIG.5, representative data is shown of a quantitative real time polymerase chain reaction (qRT-PCR) data relevant to a candidate small molecule (termed AIRE4) designed to target the TTATTA moiety relevant to AIRE. In these data, AIRE target genes (S100A8. Insulin. HCP5. AIRE) were consistently elevated upon micromolar-level treatment of Jurkat T lymphocytes. Refering to FIG. 6A and FIG.6B. representative data illustrates relative expression of insulin mRNA and S100A8 in Jurkat cells after 24 hr of treatment with lOpM of SYNGR with linear polyamide. PA treatment was used as a negative control. Average of three independent experiments are plotted. Error bars represent SEM (**** pcO. OOOl; ** p= 0.009). Refering to FIG. 7A-C, representative data illustrates relative expression of HCP5, SI 00 and AIRE mRNA in HEK293T cells after 24hr of treatment with varying concentrations (0.5pM, IpM or lOpM) of SYNGR consisting of linear polyamide. Uptake of the molecules was facilitated using Dharmafect2 (DF2) transfection reagent. Prior to cell treatment, SYNGR / PA was incubated with a 1 Omer TTATTA DNA fragment for Ihr. DNA and PA treatments were used as negative control. Refering to FIG. 8, representative data illustrates relative expression of S 100 A8. a known targets of T-AIRE in HEK293T cells following treatment for 24 hr with varying (1 pM or lOpM) of SYNGR comprising of hairpin polyamide. Uptake of the molecules was facilitated using Dharmafect2 (DF2) transfection reagent. Prior to cell treatment, SYNGR / PA was incubated with a lOmer TTATTA DNA fragment for Ihr. DNA and PA treatments were used as negative control.3. DEVELOPMENT OF SYNGR-TAIRE
[0282] Synthetic gene regulator T autoimmune regulator (SynGR-TAIRE) is a sequence selective DNA binding polyamide that is conjugated to small molecule (JQ 1) and can recruit the BET family of proteins.
[0283] SynGR-TAIRE also offers the possibility of novel small molecule library development. Specifically, a li brary of SynGR-TAIRE molecules has been developed.Among them one of the molecules (MA-SynGR-TAIRE4) mimics key properties of the natural T-AIRE transcription factor in cells. The previously described prototype.SynGRl / SynTEFl; that was designed to target GAA repeats and license Frataxin gene expression in cells derived from Friedreich’s ataxia patients, was also tested but did not show a response in upregulating T-AIRE targeted genes. The newly designed SynGR-TAIRE molecules disclosed here, were designed to target an anticipated T-AIRE target sequence of TTATTA. Preliminary studies were conducted to assess TAIRE target gene expression following compound treatment. Using the T-lymphocyte cell line Jurkat, elevated expression of AIRE target genes insulin and S 100 A8 were observed.
[0284] A promising pharmaceutical / small molecule-based approach to restore the expression of AIRE and its network of downstream target genes is disclosed. A rationally designed SynGR-TAIRE molecule significantly increased the expression of AIREdownstream target genes such as insulin and S 100A8. An important feature of AIRE is its promiscuous binding activity, allowing it to regulate diverse clonal deletion and clonal deviation in auto-reactive T cells leading to variable T cell lineages (Mathis, D. and Benoist, C., (2007) Nature Reviews Immunology 7, 645-650; Malchow, S., et al., (2016) Immunity’ vol.44, no. 5. pp. 1102-1113). The disclosed SynGR-TAIRE design, contrary to other SynGR designs, allows for promiscuous binding to a plurality of genomic sites, an essential step in facilitating broad stimulation of the transcriptome, a feature that is essential for the antigen-associated activity of AIRE.4. EXEMPLARY SYNGR-TAIRE COMPOUNDS
[0285] A summary of the exemplary SynGR-TAIRE having a polyamide linked to a BET binding ligand is shown in Table 1 below.TABLE 1.
[0286] Synthetic gene regulator T autoimmune regulator (SynGR-TAIRE) is a sequence selective DNA binding polyamide that is conjugated to small molecule (JQ 1 ) and can recruit the BET family of proteins.
[0287] SynGR-TAIRE also offers the possibility7of novel small molecule library development. Specifically, we have developed a library of SynGR-TAIRE molecules. Among them one of the molecules (MA-SynGR-TAIRE4) mimics key properties of the natural T-AIRE transcription factor in cells. The previously described prototype, SynGRl / SynTEFl; that was designed to target GAA repeats and license Frataxin gene expression in cells derived from Friedreich’s ataxia patients, was also tested but did not show a response in upregulating T-AIRE targeted genes. The newly designed SynGR-TAIRE molecules disclosed here, were designed to target an anticipated T-AIRE target sequence of TT ATTA. Preliminary7studies were conducted to assess TAIRE target gene expression following compound treatment. Using the T-lymphocyte cell line Jurkat. elevated expression of AIRE target genes insulin and S100A8 were observed.
[0288] It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary7only, with a true scope and spirit of the invention being indicated by the following claims.
Claims
CLAIMSWhat is claimed is:
1. A sequence selective deoxyribonucleic acid (DNA) binding compound comprising a polyamide moiety configured to bind a DNA sequence, or a pharmaceutically acceptable salt thereof, wherein the polyamide moiety is tethered via a first chemical linker to a bromodomain extraterminal domain (BET) binding ligand, and wherein the polyamide moiety is configured to bind a sequence5TTATTA3.
2. The compound of claim 1, wherein the polyamide moiety comprises a monomeric unit having a structure represented by a formula:wherein R1is selected from:wherein R10is selected from hydrogen, halogen. -OH, -NH2, -NHC(O)CH3, methyl, and methoxy; andwherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy.
3. The compound of claim 1 or claim 2, wherein the polyamide moiety comprises a plurality of monomeric units having a structure represented by a formula:wherein each occurrence ofis independently selected from:
4. The compound of any one of claims 1 to 3, wherein the polyamide moiety comprises a monomeric unit having a structure represented by a formula selected from:wherein each of m, o, and p is independently an integer selected from 1 to 20.
5. The compound of claim 4, wherein the polyamide moiety comprises at least two different monomeric units.
6. The compound of claim 4, wherein the polyamide moiety comprises each of:
7. The compound of claim 1, wherein the polyamide moiety is a linear polyamide moiety.
8. The compound of claim 7, wherein the linear polyamide moiety has a structure represented by a formula:wherein n’ is an integer selected from 1 to 20;wherein R1is selected from:wherein R10is selected from hydrogen, halogen. -OH, -NH2, -NHC(O)CH3. methyl, and methoxy; andwherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy: and'A')wherein each occurrence of ' — ' is independently selected from:
9. The compound of claim 1, wherein the polyamide moiety is a U-pin polyamide moiety.
10. The compound of claim 9, wherein the U-pin polyamide moiety has a structure represented by a formula:wherein each of n, n', and n” is independently an integer selected from 1 to 20; wherein R1is selected from:wherein R10is selected from hydrogen, halogen, -OH, -NH2, -NHC(O)CH3, methyl, and methoxy; andwherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy; andA')wherein each occurrence of ' — ' is independently selected from:
11. The compound of claim 1, wherein the polyamide moiety is an H-pin polyamide moiety.
12. The compound of claim 11, wherein the H-pin polyamide moiety has a structure represented by a formula:wherein each of n, n’, and n” is independently an integer selected from 1 to 20; wherein R1is selected from:wherein R10is selected from hydrogen, halogen. -OH, -NH2, -NHC(O)CH3, methyl, and methoxy: andwherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy: andwherein each occurrence ofis independently selected from:
13. The compound of claim 1, wherein the polyamide moiety7is a tandem hairpin polyamide moiety.
14. The compound of claim 0, wherein the tandem hairpin polyamide moiety has a structure represented by a formula:wherein each of n’, n”, n’”, and n’"” is independently an integer selected from 1 to 20; wherein H is a polyamide turn linker;wherein each occurrence of R1is independently selected from:wherein R10is selected from hydrogen, halogen. -OH, -NH2, -NHC(O)CH3, methyl, and methoxy; andwherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy: andwherein each occurrence of ' — ' is independently selected from:
15. The compound of claim 14, wherein H is a polyamide turn linker having a structure selected from:
16. The compound of claim 1, wherein the polyamide moiety7is a hairpin polyamide moiety.
17. The compound of claim 16, wherein the hairpin moiety has a structure represented by a formula:wherein each of n’ and n” is independently an integer selected from 1 to 20;wherein G is a polyamide turn linker;wherein R1is selected from:wherein R10is selected from hydrogen, halogen. -OH, -NH2, -NHC(O)CH3, methyl, and methoxy: andwherein each of R11aand R11bis independently selected from hydrogen, -OH, methyl, and methoxy: andwherein each occurrence ofis independently selected from:
18. The compound of claim 17, wherein G is a polyamide turn linker having a structure selected from:
19. The compound of claim 1, wherein the polyamide moiety is a cyclic polyamide moiety.
20. The compound of claim 0, wherein the cyclic polyamide moiety has a structure represented by a formula:wherein each of n’ and n” is an integer selected from 1 to 20;wherein each occurrence of G is independently a polyamide turn linker;( A )wherein each occurrence of is independently selected from:
21. The compound of claim 20, wherein G is a polyamide turn linker having a structure selected from:
22. The compound of claim 1, wherein the polyamide moiety has a structure represented by a formula selected from:wherein each occurrence of X is independently selected from N and CH.
23. The compound of claim Error! Reference source not found., wherein the polyamide moiety has a structure selected from:
24. The compound of any one of claims 1 to 23, wherein the first chemical linker has a structure represented by a formula selected from:wherein * denotes a bond connected to the BET binding ligand and ** denotes a bond connected to the polyamide moiety;wherein Q is selected from O, NH, and CH2; andwherein each of u and v is independently an integer selected from 1 to 20.
25. The compound of claim 24, wherein each of u' and v' is independently an integer selected from 1 to 15.
26. The compound of claim 24, wherein the first chemical linker has a structure represented by a formula:
27. The compound of any one of claims 1 to 26. wherein the first chemical linker is the only chemical linker in the compound.
28. The compound of any one of claims 1 to 27, wherein the BET binding ligand has a structure selected from:
29. The compound of any one of claims 1 to 27, wherein the BET binding ligand has a structure:
30. The compound of claim 1, wherein the compound has a structure represented by a formula selected from:wherein n’ is an integer selected from 3 to 8;wherein n" is 2, 3, or 4;wherein u is an integer selected from 1 to 20;wherein Q is selected from O, NH. and CH2;wherein each occurrence ofis independently selected from:wherein R1is selected from:wherein BRD is a BET binding ligand.
31. The compound of claim 30, wherein u is 6.
32. The compound of claim 30, wherein Q is O.
33. The compound of claim 30, wherein the BET binding ligand has a structure:The compound of claim 1, wherein the compound is selected from.
35. The compound of any one of claims 1 to 34, wherein the compound further comprises a Ubiquitin-Proteosome System (UPS) targeting moiety or a PBX or TCF3-PBX transcription factor binding moiety tethered to the polyamide moiety via a second chemical linker.
36. The compound of claim 35, wherein the UPS targeting moiety is an E3 ligase binding ligand.
37. The compound of claim 36, wherein the E3 ligase binding ligand has a structure selected from:
38. The compound of claim 35, wherein the UPS targeting moiety has a structure selected from:
39. The compound of claim 35, wherein the transcription factor binding moiety has a structure selected from:
40. The compound of claim 35, wherein the second chemical linker has a structure represented by a formula selected from:wherein * denotes a bond connected to the UPS targeting moiety or the transcription factor binding moiety and ** denotes a bond connected to the polyamide moiety;wherein Q’ is selected from O, NH, and CH2; andwherein each of u’ and v" is independently an integer selected from 1 to 20.
41. The compound of claim 40, wherein each of u' and v' is independently an integer selected from 1 to 15.
42. The compound of claim 40, wherein the second chemical linker has a structure represented by a formula:
43. The compound of any one of claims 1 to 42, wherein the compound does not comprise a Ubiquitin-Proteosome System (UPS) targeting moiety or a PBX or TCF3-PBX transcription factor binding moiety.
44. A pharmaceutical composition comprising the compound of any one of claims 1 to 43, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
45. The pharmaceutical composition of claim 44, further comprising a second sequence selective DNA binding compound comprising a polyamide moiety configured to bind a different DNA sequence than5TTATTA3.
46. The pharmaceutical composition of claim 45, wherein the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence comprising one or more repeats of GAAA.
47. The pharmaceutical composition of claim 46, wherein the second sequence selective DNA binding compound has a structure selected from:or a pharmaceutically acceptable salt thereof.
48. The pharmaceutical composition of claim 45, wherein the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence comprising one or more repeats of GAA, CTG, or CAG.
49. The pharmaceutical composition of claim 45, wherein the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence5AAGAAGAAG3.
50. The pharmaceutical composition of claim 49, wherein the second sequence selective DNA binding compound has a structure selected from:or a pharmaceutically acceptable salt thereof.
51. A method for restoring expression of autoimmune regulator (AIRE) gene in a cell, the method comprising contacting the cell with an effective amount of the compound of any one of claims 1 to 43 or a pharmaceutically acceptable salt thereof.
52. The method of claim 51, wherein the cell is mammalian.
53. The method of claim 51, wherein the cell is human.
54. The method of claim 51, wherein the cell has been isolated from a mammal prior to the contacting step.
55. The method of claim 51, wherein the contacting is ex vivo.
56. The method of claim 51, wherein the contacting is in vitro.
57. The method of claim 51, wherein contacting is via administration to a mammal.
58. The method of claim 57, wherein the mammal has been diagnosed with a need for restoration of AIRE gene expression prior to the administering step.
59. The method of claim 51, wherein the mammal has been diagnosed with a need for restoration of AIRE gene expression prior to the administering step.
60. A method for restoring expression of autoimmune regulator (AIRE) gene in a subject in need thereof, the method comprising administering to the subject an effective amount of the compound of any one of claims 1 to 43 or a pharmaceutically acceptable salt thereof.
61. The method of claim 60, wherein the subject is a mammal.
62. The method of claim 60, wherein the subject is a human.
63. The method of claim 60, wherein the subject has been diagnosed with a need for restoration of AIRE gene expression prior to the administering step.
64. The method of claim 60, further comprising identifying a subject in need of restoration of AIRE gene expression.
65. The method of claim 60, wherein the method further restores expression of a gene selected from frataxin (FXN) gene, transcription factor 4 (TCF4) gene, Huntingtin (HTT) gene, DMPK, autoimmune regulator (AIRE) gene, insulin (INS) gene, S100A8 gene, HLA complex P5 (HCP5) gene.
66. The method of claim 65, further comprising administering to the subject an effective amount of a second sequence selective DNA binding compound comprising a polyamide moiety configured to bind a different DNA sequence than5TTATTA3.
67. The method of claim 66, wherein the polyamide moiety of the second sequence selective DNA binding compound is configured to bind a sequence comprising one or more repeats of GAAA, GAA. CTG, or CAG or a sequence5A AG A AGA AG3’.
68. A method of treating an autoimmune disease in a subject in need thereof, the method comprising administering to the subject an effective amount of the compound of any one of claims 1 to 43 or a pharmaceutically acceptable salt thereof.
69. The method of claim 68, wherein the subject is a mammal.
70. The method of claim 68, wherein the subject is a human.
71. The method of claim 68, wherein the subject has been diagnosed with a need for treatment of the autoimmune disease prior to the administering step.
72. The method of claim 68, further comprising the step of identifying a subject in need of treatment of the autoimmune disease.
73. The method of claim 68, wherein the effective amount is a therapeutically effective amount.
74. The method of claim 68, wherein the effective amount is a prophylactically effective amount.
75. The method of any one of claims 68 to 74. wherein the autoimmune disease is selected from Addison disease. Celiac disease, dermatomyositis. Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis (MS), myasthenia gravis, pernicious anemia, reactive arthritis, Sjogren syndrome, systemic lupus erythematosus, and type I diabetes.
76. The method of any one of claims 68 to 74, wherein the autoimmune disease has a mutation of an autoimmune regulator (AIRE) gene.
77. The method of claim 76 or claim 76, wherein the disorder is autoimmune poly endocrine syndrome 1 (APS1), autoimmune poly endocrinopathy-candidiasis-ectodermal dystrophy (APECED), or polyglandular autoimmune syndrome type-1 (PGA).
Citation Information
Patent Citations
Sequence-selective gene expression regulators
US20190343873A1
Compounds and methods for modulating frataxin expression
US20200129522A1
Next Generation Synthetic Transcription Factors
US20220177489A1
Methods and compounds for modulating huntington's disease
US20240042046A1
A sequence selective DNA binding molecule (syngrader)
WO2024229287A1