Method for targeting UBE3a allele to establish animal model of angelman syndrome and use thereof
By using CRISPR/Cas9 technology to target and downregulate the exon5 intron of the maternal UBE3A gene in non-human primates, the problem that existing models cannot fully simulate the clinical characteristics of Angelman syndrome patients has been solved, and a stable animal model that closely resembles the human disease phenotype has been established for drug screening and disease mechanism research.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- CENT FOR EXCELLENCE IN BRAIN SCI & INTELLIGENCE TECH CHINESE ACAD OF SCI
- Filing Date
- 2025-10-22
- Publication Date
- 2026-05-15
AI Technical Summary
Existing fruit fly and mouse models cannot fully mimic the clinical characteristics of Angelman syndrome patients, especially the severe phenotype caused by large deletions in the maternal q11-13 region of chromosome 15, and therefore cannot effectively evaluate potential treatments.
Using CRISPR/Cas9 gene editing technology, the upstream and downstream introns of the maternal UBE3A gene exon5 in non-human primates such as cynomolgus monkeys were targeted and downregulated to create an animal model with specific knockout of the maternal UBE3A allele. Gene editing was performed using sgRNA and Cas9 mRNA.
An animal model that can stably present the typical symptoms of Angelman syndrome has been established, providing a research tool that is closer to the human disease phenotype, supporting drug screening and disease mechanism research, and enhancing the effectiveness of new drug development.
Smart Images

Figure PCTCN2025129281-FTAPPB-I100001 
Figure PCTCN2025129281-FTAPPB-I100002 
Figure PCTCN2025129281-FTAPPB-I100003
Abstract
Description
Methods and applications for establishing an animal model of Angelman syndrome by targeting the UBE3A allele
[0001] This invention claims priority to patent application CN 202411579960.8, filed on November 6, 2024, the entire contents of which are incorporated herein by reference. Technical Field
[0002] This invention belongs to the medical field, and more specifically, this invention relates to the method and application of establishing an animal model of Angelman syndrome by targeting the UBE3A allele. Background Technology
[0003] Angelman syndrome (AS) is a neurogenetic disorder characterized by intellectual disability, language impairment, sleep disturbances, motor incoordination, seizures, and a tendency to display excessive joy. The estimated prevalence of Angelman syndrome is approximately 1 in 20,000–1 in 12,000, with similar rates in men and women. Life expectancy is near normal, and full-time family care is required. Currently, there are no approved treatments specifically for AS; clinical treatment primarily involves interventional therapy and symptomatic management, with the main goals being to reduce seizures and improve sleep. In 2018, AS was included in my country's first batch of rare disease catalogues. AS is caused by the deletion or defective expression of the maternal allele UBE3A in the q11-13 region of chromosome 15. In neurons of the central nervous system, the UBE3A gene is influenced by genomic imprinting, with the maternal allele expressing the gene while the paternal allele does not. There are several molecular genetic mechanisms leading to ankylosing spondylitis (AS). One is a large deletion (6 Mb) in the maternal q11-q13 region of chromosome 15 (containing the UBE3A gene), accounting for approximately 75% of cases. Another is due to point mutations in the maternal UBE3A allele, accounting for approximately 15%. A third is due to paternal uniparental diploidy (these cases inherit two epigenetically silent paternal UBE3A alleles), accounting for approximately 7%. A fourth is due to microdeletions in the maternal q11-q13 region of chromosome 15, accounting for approximately 2-4% of cases. The deletion of the UBE3A gene is sufficient to cause the core phenotype of AS; therefore, UBE3A is considered a key gene leading to AS.
[0004] Currently, the main animal models of ankylosing spondylitis (AS) include fruit fly, mouse, and rat models. The fruit fly Ube3a (Dube3a) is highly homologous to human Ube3a in its amino acid sequence, indicating that its function is likely conserved. Researchers have found that knocking out Dube3a does not affect the survival of fruit flies. However, the loss of Dube3a activity reduces dendritic branching of sensory neurons in the peripheral nervous system and slows down the process of fine processing in terminal dendrites. Another study showed that fruit flies lacking the Dube3a protein exhibited abnormal motor behavior and circadian rhythms, as well as defective long-term memory; after introducing a missense mutation found in AS patients into the fruit fly Dube3a gene, the Dube3a protein exhibited loss of function.
[0005] Currently established AS mouse models include mouse models with maternal Ube3a gene exon2 knockout, mouse models with maternal Ube3a gene exons 15-16 knockout, and UBE3A-Gabrb3 large fragment knockout mouse models. Among these, the most commonly used AS mouse model is established by knocking out the Ube3a gene exon2. The mouse Ube3a gene exon2 is conserved in major isoforms; knockout causes a frameshift, prematurely terminating Ube3a protein expression. In this model, the Ube3a... m- / p+ Heterozygous mice exhibited reduced brain weight, ataxia, motor dysfunction, and abnormal EEG patterns. Another AS mouse model was established by knocking out exon 15-16 of the human UBE3A gene. Researchers introduced the LacZ reporter gene after the deletion site to facilitate the detection of truncated protein expression. The truncated protein lost its ubiquitin ligase activity. This mouse model exhibited motor deficits, learning and memory impairments, abnormal EEG patterns, and sleep-wake cycle disturbances, but lacked seizures.
[0006] While deletion of the UBE3A gene is sufficient to trigger the core phenotype of AS, large deletions of the maternal chromosome 15q11-q13 are most common in patients, and these patients exhibit more severe clinical phenotypes, possibly due to insufficient haploid doses of neighboring genes such as GABRB3 and ATP10A. To establish a mouse model simulating 15q11-q13 deletions, researchers used Cre / loxP and Hprt (hypoxanthine-guanine phosphoribosyltransferase) techniques to knock out a 1.6 Mb sequence in the maternal 15q11-q13 region of mice, containing the genes Ube3a, Atp10a, and Gabrb3. Like mice with Ube3a deletion alone, these large deletion mice also exhibited AS-related defects, including abnormal EEG patterns, seizures, and motor and cognitive behavioral dysfunctions. Unfortunately, these large deletion mice did not show a more severe phenotype compared to mice with Ube3a deletion alone.
[0007] While some existing animal models in this field have mimicked many classic characteristics associated with AS patients to some extent and provided a tool for studying molecular pathways affected by UBE3A deficiency, neither Drosophila models nor mouse and rat models can fully mimic the patient phenotype. Therefore, it is essential to establish an animal model that better reflects the clinical characteristics of patients. Summary of the Invention
[0008] The purpose of this invention is to provide a method and application for establishing an animal model of Angelman syndrome by targeting the UBE3A allele.
[0009] In a first aspect of the invention, a method for preparing an Angelman syndrome animal is provided, comprising: downregulating the maternal UBE3A gene of the animal, wherein the downregulation targets the upstream intron and / or downstream intron of exon5 of the maternal UBE3A gene; wherein the animal is a non-human primate.
[0010] In another aspect of the present invention, a method for preparing animal cells is provided, comprising: downregulating the maternal UBE3A gene in the animal cells, wherein the downregulation targets the upstream and / or downstream introns of the maternal UBE3A gene exon5; wherein the animal is a non-human primate; preferably, the cells comprise fertilized eggs.
[0011] In one or more preferred embodiments, the downregulation includes: targeting the target sequence SEQ ID NO:3 (Indel L3), SEQ ID NO:1 (SNP L1), or SEQ ID NO:2 (SNP L2) in the upstream intron of the maternal UBE3A gene exon5; and / or, targeting the target sequence SEQ ID NO:4 (SNP R1) or SEQ ID NO:5 (SNP R2) in the downstream intron of the maternal UBE3A gene exon5.
[0012] In one or more preferred embodiments, the downregulation targets the target sequence SEQ ID NO:4 (SNP R1) in the downstream intron of the maternal UBE3A gene exon5; and the target sequences SEQ ID NO:3 (Indel L3), SEQ ID NO:1 (SNP L1), or SEQ ID NO:2 (SNP L2) in the upstream intron.
[0013] In one or more preferred embodiments, the downregulation targets SNP R1 and Indel L3 of the maternal UBE3A gene exon5.
[0014] In one or more embodiments, the downregulation targets SNP R1 and SNP L1 of the maternal UBE3A gene exon5.
[0015] In one or more embodiments, the downregulation targets SNP R1 and SNP L2 of the maternal UBE3A gene exon5.
[0016] In one or more preferred embodiments, the downregulation includes knockout using a CRISPR (CRISPR / Cas) gene editing method; preferably, sgRNA is used as a guide to perform the knockout, wherein:
[0017] The sgRNA targeting the target sequence SEQ ID NO:3 has the nucleotide sequence shown in SEQ ID NO:8;
[0018] The sgRNA targeting the target sequence SEQ ID NO:1 has the nucleotide sequence shown in SEQ ID NO:6;
[0019] The sgRNA targeting the target sequence SEQ ID NO:2 has the nucleotide sequence shown in SEQ ID NO:7;
[0020] sgRNA targeting the target sequence SEQ ID NO:4, whose nucleotide sequence is as shown in SEQ ID NO:9; or
[0021] The sgRNA targeting the target sequence SEQ ID NO:5 has the nucleotide sequence shown in SEQ ID NO:10.
[0022] In one or more preferred embodiments, the sgRNA and Cas mRNA (preferably Cas9 mRNA) or a construct capable of forming the sgRNA and Cas mRNA are introduced into the fertilized egg of an animal; preferably, the process further includes: allowing the fertilized egg to develop to obtain the Angelman syndrome animal.
[0023] In one or more embodiments, the method for preparing Angelman syndrome animals or the method for preparing animal cells are methods for "non-therapeutic purposes".
[0024] In one or more embodiments, the non-human primates include: monkeys, orangutans, and apes.
[0025] In another aspect of the invention, sgRNA for preparing Angelman syndrome animals is provided, which targets the target sequence SEQ ID NO:3 (Indel L3), SEQ ID NO:1 (SNP L1) or SEQ ID NO:2 (SNP L2) in the upstream intron of the maternal UBE3A gene exon5 of the animal; and / or, targets the target sequence SEQ ID NO:4 (SNP R1) or SEQ ID NO:5 (SNP R2) in the downstream intron of the maternal UBE3A gene exon5.
[0026] In one or more preferred embodiments, the sgRNA is a combination of sgRNAs, including: a target sequence SEQ ID NO:4 (SNP R1) targeting the downstream intron of the maternal UBE3A gene exon5; and a target sequence SEQ ID NO:3 (Indel L3), SEQ ID NO:1 (SNP L1), or SEQ ID NO:2 (SNP L2) targeting the upstream intron.
[0027] In one or more preferred embodiments, the sgRNA targeting the target sequence SEQ ID NO:3 has a nucleotide sequence as shown in SEQ ID NO:8; the sgRNA targeting the target sequence SEQ ID NO:1 has a nucleotide sequence as shown in SEQ ID NO:6; the sgRNA targeting the target sequence SEQ ID NO:2 has a nucleotide sequence as shown in SEQ ID NO:7; the sgRNA targeting the target sequence SEQ ID NO:4 has a nucleotide sequence as shown in SEQ ID NO:9; or, the sgRNA targeting the target sequence SEQ ID NO:5 has a nucleotide sequence as shown in SEQ ID NO:10.
[0028] In another aspect of the invention, the application of Angelman syndrome animals prepared by any of the preceding methods is provided for: serving as an animal model for screening candidate drugs or therapeutic agents to alleviate or treat Angelman syndrome; serving as an animal model for studying Angelman syndrome; or for conducting drug metabolism and toxicology tests.
[0029] In one or more embodiments, the method or application is a non-diagnostic or non-therapeutic method or application, and is not intended for the diagnosis or treatment of a disease.
[0030] In another aspect of the invention, a kit for preparing Angelman syndrome animals is provided, comprising the sgRNA for preparing Angelman syndrome animals as described above.
[0031] In one or more preferred embodiments, the kit further contains Cas mRNA or a construct capable of forming Cas mRNA.
[0032] In another aspect of the invention, a method is provided for screening candidate drugs or therapeutic agents for alleviating or treating Angelman syndrome, the method comprising: (1) preparing an animal model of Angelman syndrome using any of the methods described above; (2) administering a candidate substance to the animal model of (1) and observing whether the candidate substance has an alleviating or therapeutic effect on Angelman syndrome; if the symptoms of Angelman syndrome in the animal model are observed to be relieved, then the candidate substance is a substance for alleviating or treating Angelman syndrome; preferably, the observation includes (but is not limited to) analyzing the following phenotypes: cognitive function, motor function, and electroencephalogram (EEG) characteristics.
[0033] In one or more embodiments, the test may include setting up control animals that are not given the candidate substance.
[0034] In one or more embodiments, the candidate drug includes known or newly developed: compounds (e.g., compounds derived from or modified from public compound libraries); biomacromolecules (proteins (e.g., binding molecules such as antibodies or ligands), nucleic acids (e.g., nucleic acid inhibitors, interfering molecules, etc.)), etc.
[0035] In one or more embodiments, the method further includes: conducting further cell experiments and / or animal experiments on the obtained potential substances to further select and identify substances from the candidate substances that are useful for alleviating or treating Angelman syndrome.
[0036] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description
[0037] Figure 1. Design and efficiency test of maternal UBE3A gene-specific guide RNA in cynomolgus monkeys.
[0038] (A) SNP and indel sites that can be used to design allele-specific guide RNA between male monkey #43 and its paired female monkey. (B) Maternal UBE3A allele-specific guide RNA sequence. (C) Amplification results of the target sequence in embryos injected with maternal UBE3A allele-specific guide RNA / Cas9 mRNA. P: Positive control; N: Negative control. (D) Editing rate of embryos injected with maternal UBE3A allele-specific guide RNA / Cas9 mRNA.
[0039] Figure 2. Knockout efficiency and specificity of maternal UBE3A gene at the embryo level.
[0040] (A) Guide RNA location and SNP1 and SNP2 locations used for parental sequence analysis. (B) SNP1 and SNP2 base types. (C) Amplification results of embryos injected with maternally specific guide RNA / Cas9 mRNA. P: Positive control; N: Negative control. (D) Deep sequencing analysis of SNP2 base types from amplification products.
[0041] Figure 3. Genotyping of newborn cynomolgus monkeys.
[0042] (A) Guide RNA location and SNP1 and SNP2 locations used for parental sequence analysis. (B) SNP1 and SNP2 base types. (C) Sequence amplification results between two guide RNAs in newborn monkeys. (D) SNP2 amplification results near exon 5 of the UBE3A gene in newborn monkeys. (E) Deep sequencing analysis of SNP1 base type using amplification products. (F) Deep sequencing analysis of SNP2 base type using amplification products. (G) Protein analysis of A3 brain tissue from dystocia monkeys.
[0043] Figure 4. Expression of UBE3A protein in neurons induced by activation model monkey.
[0044] (A) Detection of UBE3A protein expression levels in neurons derived from iPSCs of different cynomolgus monkey genotypes. (B) Topotecan effectively activates paternal UBE3A protein expression in AS neurons. NC, water treatment control.
[0045] Figure 5. Screenshots of video recordings and analysis after the monkeys were born.
[0046] Figure 6. Cognitive impairment exists in cynomolgus monkeys with maternal UBE3A gene knockout.
[0047] (A) Time taken to complete the three phases of the Wisconsin black and white patch test. (B) Daily test accuracy during the five-day Hamilton Phase II test. (C) Daily test accuracy during the five-day Hamilton Phase III test. (D) Percentage of monkeys who passed the Hamilton Phase III test on the fifth day (an accuracy rate greater than 75% is considered passing). Detailed Implementation
[0048] The inventors conducted in-depth research and screening of the UBE3A gene sequence in a large number of primate genomes, obtaining suitable targets for gene modification: the upstream and / or downstream introns of the maternal UBE3A gene exon 5. Downregulation targeting these targets can obtain an Angelman syndrome animal model. The animal model is stable and controllable, exhibits typical disease phenotypes, is easy to observe, and has good application prospects.
[0049] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art.
[0050] As used in this invention, the animals are non-human primates, including but not limited to: monkeys, orangutans, and apes; preferably, the monkeys include monkeys selected from the group consisting of: cynomolgus monkeys, rhesus monkeys, macaques, green monkeys, marmosets, squirrel monkeys, etc.
[0051] As used herein, “sgRNA” refers to “single-guide RNA” or “single-guide RNA”, which is designed based on “target sites on target genes”. The sequence it contains is sufficient to work synergistically with endonucleases Cas (such as Cas9) to guide Cas enzyme-mediated DNA double-strand breaks at the target sites.
[0052] As used in this invention, the term "sgRNA target" refers to a target region in the gene of interest suitable for gene editing. For example, regulation can be achieved by introducing exogenous gene editing reagents (such as sgRNA and Cas mRNA) targeting this target.
[0053] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between cells and hosts from different sources. For example, if the combination of nucleic acid and host cell is not naturally occurring, the nucleic acid is heterologous to that host cell. A particular sequence is "heterogeneous" to the cell or organism into which it is inserted.
[0054] As used herein, the terms “introduction” or “transformation” refer to the transfer of exogenous polynucleotides into a host (an animal or animal cell in this invention).
[0055] As used herein, the term "construction" includes "plasmid".
[0056] Angelman syndrome (AS) is a severe neurodevelopmental disorder characterized by intellectual disability, language impairment, sleep disturbances, motor incoordination, seizures, and a tendency to exhibit excessively cheerful expressions. AS is caused by the deletion or defective expression of the maternal allele of UBE3A in the q11-13 region of chromosome 15. The UBE3A gene is specifically imprinted in neurons, and the UBE3A protein is expressed only from the maternal allele. While the paternal allele is present, it is suppressed by the antisense transcript known as SNHG14 (also called UBE3A-ATS) due to genomic imprinting. When introducing guide RNA and Cas9 mRNA, if the paternal and maternal allele sequences of the target gene are completely identical, both alleles have an equal probability of being edited. This non-specific gene editing makes it difficult to obtain animals with a specific knockout of the maternal UBE3A allele. Due to the difference between maternal and paternal UBE3A alleles, and the limited number of SNPs in the coding region of the animal UBE3A gene, it is difficult to find a suitable site for targeted knockout in the animal UBE3A gene. To date, no Angelman syndrome model has been successfully established in non-human primates, such as monkeys.
[0057] Robust disease phenotypes are crucial for developing new treatments because they provide sufficient capability to evaluate drug efficacy. However, current fruit fly, mouse, and rat models used in basic research still fall short in replicating the phenotypes of AS patients, for example, only exhibiting mild cognitive impairment and rare seizures. On the other hand, to determine the effectiveness of gene therapy and ensure the successful translation of these new therapies into clinical applications, it is necessary to create animal models with genes, physiological structures, and disease phenotypes more similar to humans.
[0058] The inventors are dedicated to establishing an animal model of Angelman syndrome. By using guide RNAs specifically targeting the maternal UBE3A allele based on SNP and INDEL sites and injecting the two guide RNAs into the embryo, they obtained a cynomolgus monkey model with specific knockout of the maternal UBE3A gene. This is the first model in the field of specific knockout of the maternal allele in a non-human primate. The establishment of this model is also of great significance for exploring the pathogenesis of AS disease and accelerating the development of gene therapy drugs for AS disease.
[0059] In their preliminary research, the inventors conducted detailed analyses targeting multiple targets and aspects, ultimately identifying the upstream and / or downstream introns of exon 5 of the maternal UBE3A gene in the animal genome. Using these as targets, they downregulated the target sites to obtain an Angelman syndrome animal model. In a preferred embodiment, the inventors further incorporated CRISPR / Cas knockout technology to prepare the animal model.
[0060] The coding region of UBE3A is 2,700 bp long, encoding 865 amino acids. Isotypes 2 and 3 have additional 20 and 23 amino acids at their N-terminus, respectively. UBE3A gene ID: 101865547. Through repeated research, analysis, and experimentation, the inventors determined that an appropriate position in exon 5 of the UBE3A gene is the target site, and optimally, targeted knockout is performed at suitable upstream and downstream locations.
[0061] Gene downregulation includes “knockout,” “deletion / reduction,” or “inactivation” or “repression,” meaning that the gene or the protein it encodes is not produced, or is produced in the host cell in an inactive form, or is produced in the host cell at a level lower than that found in the wild-type form in the host cell under the same or similar growth conditions.
[0062] Under the guidance of this invention, various gene-disrupting methods known in the art can be employed to target the gene targets identified in this invention. These can be achieved, for example (but not limited to), through one or more of the following methods: CRISPR / Cas technology, homologous recombination, RNA interference-based techniques, ZFN, and TALEN, etc.
[0063] As a preferred embodiment of the present invention, a CRISPR / Cas (such as Cas9) system can be used for targeted gene editing to modify the UBE3A gene in the target region. Common knockout methods include co-transferring sgRNA or nucleic acids that can form said sgRNA, Cas mRNA or nucleic acids that can form said Cas mRNA to the target region or target cells. After the target site is identified, known methods can be used to introduce sgRNA and Cas into the cell.
[0064] In a specific implementation scheme, the CRISPR / Cas technology is CRISPR / Cas9. This includes introducing a specific sgRNA targeting the UBE3A gene in animals, while simultaneously introducing Cas9 mRNA to facilitate gene editing.
[0065] After using the CRISPR / Cas9 system for gene editing as the basis for constructing animal models, suitable sgRNA target sites will lead to more ideal gene editing efficiency and better animal phenotypic performance. In the preferred embodiment of this invention, preferred target sites were designed and identified, and sgRNAs were designed based on these sites. The inventors conducted repeated analysis and experimental verification on the UBE3A gene, and determined that in the preferred scheme, targeted mutations are performed at appropriate positions in the upstream and / or downstream exon regions of exon 5 of the UBE3A gene.
[0066] After identifying the target site, sgRNA or a nucleic acid capable of forming said sgRNA, and Cas9 mRNA or a nucleic acid capable of forming said Cas9 mRNA are co-transferred into animal zygotes to obtain gene-edited animals. Alternatively, the nucleic acid capable of forming said sgRNA can be a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA can be a nucleic acid construct or expression vector. These expression vectors are introduced into cells, thereby forming active sgRNA and Cas9 mRNA within the cells. Furthermore, Cas9 mRNA and sgRNA can also be obtained through in vitro transcription.
[0067] As an alternative approach, homologous recombination can be used to specifically target the UBE3A gene, causing expression defects or deletions. Alternatively, the Cre and LoxP methods can be applied to selectively knock out, reduce, or inactivate related genes in the cell genome.
[0068] The animal models constructed in this invention can be used for screening and testing specific drugs. In drug screening, candidate drugs or therapeutics refer to substances known to have certain pharmacological activities or substances currently being tested that may have certain pharmacological activities, including but not limited to nucleic acids, proteins, carbohydrates, chemically synthesized small or large molecular compounds, and cells. The administration routes for candidate drugs or therapeutics can be oral, intravenous, intraperitoneal, subcutaneous, spinal, or direct intracerebral injection.
[0069] As those skilled in the art will understand, due to the complexity of the organism's genes, the influence of multiple signaling pathways on diseases, and the existence of the body's own compensatory or repair mechanisms, it is difficult to obtain animal models that exhibit typical disease symptoms. However, this invention, through optimized design, overcomes these technical difficulties. The animal model constructed by this invention can serve as a powerful tool for scientific research and new drug evaluation.
[0070] In the study of disease mechanisms, the animal model of Angelman syndrome constructed in this invention, which stably presents the syndrome, can be used to investigate the disease mechanism, explore the key factors leading to Angelman syndrome due to UBE3A protein deficiency, and explore the intermediate mechanisms that can prevent or delay the development of this disease. The model system of this invention helps to better understand Angelman syndrome and to explore / identify candidate drugs / therapeutic agents that can prevent, delay, or reverse the disease process.
[0071] In preclinical drug testing, the animal model constructed using this invention, which stably exhibits Angelman syndrome, is expected to be used for preclinical drug metabolism, toxicity, and efficacy testing. This animal model is physiologically close to the human body and supports long-term sampling, detection, and tracking, facilitating the advancement of new drug development. In this invention, there are no particular limitations on the types of candidate drugs used for drug testing; they can be obtained from various sources, including synthetic or natural compound libraries. For example, there are various methods for the random and directed synthesis of a variety of organic compounds and biomolecules, including the expression of random oligonucleotides and oligopeptides; or, natural compound libraries in the form of bacterial, fungal, plant, and animal extracts can be obtained or readily generated. Furthermore, libraries and compounds generated by natural or synthetic methods can be readily modified by conventional chemical, physical, and biochemical methods and can be used to generate combinatorial libraries. Known pharmacological reagents can be directed or randomly chemically modified (e.g., acylation, alkylation, esterification, amidation, etc.) to generate structural analogs.
[0072] The method for preparing the animal model of this invention is simple to operate, and the resulting animal model has good stability, can well simulate the Angelman syndrome phenotype, and the resulting disease symptoms are very typical and the phenotypic changes are easy to observe. The animal model of this invention provides a new approach for studying the pathogenesis of Angelman syndrome, drug screening, and clinical treatment.
[0073] Based on the method of the present invention, the present invention also provides a kit for preparing an animal model of Angelman syndrome, the kit comprising: sgRNA that targets and downregulates the UBE3A gene based on the CRISPR / Cas system; preferably, the gRNA targets specific regions upstream and downstream of exon 5 of the UBE3A gene.
[0074] Other reagents commonly used in transgenic operations may also be included in the kit for the convenience of those skilled in the art, such as reagents for microinjection. Furthermore, the kit may include instructions for use by those skilled in the art.
[0075] After obtaining the animal model of the present invention, substances of interest can be screened based on this model, which can (or potentially can) alleviate or treat Angelman syndrome. Following screening, truly useful drugs can be identified from the substances of interest.
[0076] Therefore, the present invention also provides a method for screening potential substances, the method comprising: (1) preparing an Angelman syndrome animal model using the method or kit described above; (2) administering a candidate substance to the animal model of (1) and observing whether the candidate substance has an alleviating or therapeutic effect on Angelman syndrome; if the Angelman syndrome symptoms of the animal model are observed to be relieved, then the candidate substance is a substance for alleviating or treating Angelman syndrome.
[0077] According to the animal model of the present invention, the observation of whether the candidate substance has an alleviating or therapeutic effect on Angelman syndrome includes (but is not limited to) analyzing the following phenotypes: cognitive function, motor function, EEG characteristics, etc. If the phenotype is alleviated / improved, then the candidate substance is a substance for alleviating or treating Angelman syndrome.
[0078] In a preferred embodiment of the present invention, during screening, a control group may be set up to make it easier to observe changes in the symptoms of Angelman syndrome. The control group may be the animal model in which the candidate substance is not added.
[0079] As a preferred embodiment of the invention, the method further includes: conducting further cell experiments and / or animal experiments and / or clinical trials on the obtained potential substances to further select and identify truly useful substances.
[0080] On the other hand, the present invention also provides potential substances of interest obtained using the aforementioned screening method. These initially screened substances can form a screening library, from which relatively ideal, safe substances that can ultimately be screened out can be identified as having a real effect on alleviating or treating Angelman syndrome.
[0081] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Science Press, or according to the manufacturer's recommendations.
[0082] Materials and methods
[0083] I. UBE3A gene sequencing of cynomolgus monkey groups
[0084] An allele-specific gene editing strategy was used to construct an AS cynomolgus monkey model. The inventors first sequenced the UBE3A gene in a group of sexually mature cynomolgus monkeys (including males and females) to identify suitable egg and sperm donors.
[0085] (1) Collection of cynomolgus monkey tissue. With the help of a veterinarian, approximately 50 mg of ear tip tissue was collected from cynomolgus monkeys.
[0086] (2) Genomic DNA extraction from cynomolgus monkey ear tip tissue. Add 200 μL of lysis buffer (containing 10 mg / ml protease) to each ear tip tissue and lyse overnight at 55°C. Add an equal volume of isopropanol and mix by inverting the tube. Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μL of 75% ethanol for rinsing, and centrifuge at 12000 rpm for 5 min. Remove as much supernatant as possible and invert the EP tube to air dry. Dissolve in 30 μL of pure water and measure DNA concentration using a Nano 2000.
[0087] (3) Gene amplification. Based on the UBE3A gene sequence of the cynomolgus monkey, multiple primer pairs were designed approximately 1500 bp upstream and downstream of exon 5 to amplify the UBE3A gene sequence, including exon 5. The amplification primers are:
[0088] (4) PCR amplification products are used for Sanger sequencing or TA cloning analysis. Sequencing primers are:
[0089] II. Transcription of sgRNA
[0090] 1. Synthesis of sgRNA template. The sgRNA transcription sequence containing the T7 promoter was amplified using PCR. The F primer for PCR contained the T7 promoter sequence and the sgRNA sequence, 5'-GAAATTAATACGACTCACTATAGG (SEQ ID NO:30)-sgRNA-GTTTTAGAGCTAGAAATAGC-3' (SEQ ID NO:31). The reverse primer was a universal primer, 5'-TTGTGAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO:32).
[0091] 2. sgRNA transcription
[0092] Transcription was performed using the MEGA Shortscript T7 kit (Life Technologies). All components required for transcription were thoroughly mixed and placed in a PCR instrument. The reaction temperature was 37°C for 3 hours. After transcription, 1.5 μL of DNase was added to each reaction mixture, and the mixture was incubated at 37°C for 30 minutes to remove the DNA template.
[0093] 3. sgRNA purification
[0094] Purification was performed using the MEGA clear kit (Life Technologies). The transcript was diluted 5-fold with DEPC water, and then half a volume of Binding Solution and 5 volumes of anhydrous ethanol were added and mixed thoroughly. The mixture was then transferred to an RNA adsorption column, incubated at room temperature for 5 min, and centrifuged at 12,000 rpm for 1 min. The centrifuged liquid was discarded, and 500 μL of wash buffer was added to the adsorption column. The column was centrifuged at 12,000 rpm for 1 min, and the wash was repeated once. The column was then incubated at 12,000 rpm for 10 min, incubated at room temperature for 10 min, and finally eluted with 50 μL of DEPC water. The concentration of the recovered sgRNA was determined using a Nano2000 instrument. 1 μL of the recovered product was subjected to agarose gel electrophoresis to check for degradation. The recovered sgRNA was aliquoted into 5 μL tubes and stored at -80°C for immediate use.
[0095] III. In vitro transcription and purification of Cas9 mRNA
[0096] 1. Obtaining the Cas9 transcription template
[0097] The Cas9 expression cassette was amplified from the px260 vector using primers Cas9-F and Cas9-R, with the Cas9-F sequence containing the T7 promoter sequence. Amplification was performed using Novizan high-fidelity DNA polymerase.
[0098] Five tubes of each sgRNA amplification were subjected to gel extraction. Electrophoresis was performed on a 1% agarose gel, and the target region band was excised and recovered using a Novizan gel extraction kit. The specific steps were as follows: the gel block was dissolved in lysis buffer in a 50°C water bath; the dissolved liquid was added to the separation column and centrifuged at 12000 rpm for 1 min; the liquid was then discarded; wash buffer was added to the column, and the column was centrifuged at 12000 rpm for 1 min, followed by two washes. Finally, the empty column was centrifuged at 12000 rpm for 3 min, allowed to air dry at room temperature for 10 min, and then eluted with an appropriate amount of DEPC-H2O.
[0099] 2. Transcription of Cas9 mRNA
[0100] Transcription was performed using the MEGA Shortscript T7 kit (Life Technologies). All components required for transcription were thoroughly mixed and placed in a PCR instrument. The reaction temperature was 37°C for 3 hours. After transcription, 1.5 μL of DNase was added to each reaction mixture, and the mixture was incubated at 37°C for 30 minutes to remove the DNA template.
[0101] 3. Purification of Cas9 mRNA
[0102] Purification was performed using the MEGA clear kit (Life Technologies). The transcript was diluted 5-fold with DEPC water, and then half a volume of Binding Solution and 5 volumes of anhydrous ethanol were added and mixed thoroughly. The mixture was then transferred to an RNA adsorption column, incubated at room temperature for 5 min, and centrifuged at 12,000 rpm for 1 min. The centrifuged liquid was discarded, and 500 μL of wash buffer was added to the adsorption column. The column was centrifuged at 12,000 rpm for 1 min, and the wash was repeated once. The column was then incubated at 12,000 rpm for 10 min, incubated at room temperature for 10 min, and finally eluted with 50 μL of DEPC water. The concentration of recovered Cas9 mRNA was determined using a Nano2000 analyzer.
[0103] IV. RNA microinjection, culture, and transplantation of cynomolgus monkey fertilized eggs
[0104] Intracytoplasmic sperm injection (ICSI) was performed on oocytes at the MII stage. First, the oocytes were transferred to a new TH3 droplet, fixed with a needle, and a single sperm was aspirated using a needle with the head facing the needle tip. This sperm was then injected into the oocyte cytoplasm. The resulting fertilized eggs were then transferred to a HECM-9 culture medium and cultured at 37°C in a 5% CO2 incubator. After 6-8 hours, the formation of two pronuclei was observed; the appearance of two pronuclei indicated successful fertilization. Cas9 mRNA and sgRNA were thawed on ice beforehand and mixed at final concentrations of 100 ng / μL and 50 ng / μL, respectively. Successfully fertilized cynomolgus embryos were aspirated and transferred to a new TH3 droplet (containing 5 μg / mL cytochalasin B). The fertilized eggs were fixed with a needle, and the Cas9 mRNA and sgRNA mixture was slowly injected into the cytoplasm of the fertilized eggs using a needle. After injection, the manipulated embryos were transferred to HECM-9 medium and cultured in a 37°C, 5% CO2 incubator. Transfer was performed the afternoon of the day after Cas9 mRNA and sgRNA injection, when the embryos were at the 2-cell stage. Sexually mature female cynomolgus monkeys with synchronized menstrual cycles were selected as embryo transfer recipients. Under laparoscopic guidance, a glass transfer tube was inserted into the fallopian tube through the fimbriae, and the embryo was then injected into the fallopian tube. One to two embryos were transferred to each recipient monkey. One month after embryo transfer, ultrasound was used to determine if the recipient monkey was pregnant.
[0105] V. Guide RNA editing efficiency detection
[0106] 1. Using an oocyte aspiration needle, transfer a single embryo that has developed to the blastocyst stage from HECM-9 medium into a PCR tube. Add 5 μL of embryo lysis buffer (containing 50 mM DTT and 200 mM NaOH) and lyse at 65 °C for 10 min. After lysis, add 5 μL of neutralization buffer (containing 200 mM HCl and 300 mM KCl) to neutralize.
[0107] 2. Random genomic amplification was performed on the embryos. The PCR reaction program was 95℃ for 1 min denaturation, 37℃ for 2 min annealing, and then ramping up to 55℃ at a rate of 10 s / ℃, holding at 55℃ for 4 min for polymerization extension. A total of 50 cycles of amplification were performed.
[0108] 3. The target gene was amplified using randomly amplified embryonic genome products as templates. The PCR products were then used for Sanger sequencing and TA cloning analysis.
[0109] 4. TA Cloning. The target sequence was amplified using rTaq polymerase, and the PCR product was directly recovered. The product fragment was then constructed into a T vector. The above mixture was incubated overnight at 16°C, and transformation was performed the following day. Twenty clones from each sample were selected for sequencing.
[0110] VI. Genotypic Analysis of Model Monkeys
[0111] Blood was collected from newborn monkeys, and red blood cells were removed using red blood cell lysis buffer. Genomic DNA was then extracted from white blood cells. Additionally, brain tissue was collected from monkeys that experienced miscarriage or dystocia to extract genomic DNA. Primers were designed to amplify the entire fragment between the two guide RNAs and the sequence containing SNP19611 (SNP2) 10 bp downstream of exon 5. The former can determine whether a large segment of the gene has been deleted, and, in conjunction with SNP20873 (SNP1), confirm the parental origin of the edited sequence. The latter can be used to calculate the knockout rate of the maternal UBE3A gene by performing deep sequencing on the amplified product SNP19611 (SNP2). The primer sequences for amplifying the entire fragment between the two guide RNAs are as follows:
[0112] UBE3A-F1:5'-AGCACCAGAATGAATTGAATCTGTGTG-3' (SEQ ID NO:33),
[0113] UBE3A-R1:5'-TGGTGCAGACTACTTAATACTTACGC-3' (SEQ ID NO:34),
[0114] The primer sequences for amplifying the sequence containing SNP19611 (SNP2) are as follows:
[0115] UBE3A-F2:5'-CTCAGCTTACCTTGAGAACTCGAAAGG-3' (SEQ ID NO:35),
[0116] UBE3A-R2: 5'-TTGGTTCTACGGTATCAAATGTCTTAATGTCAC-3' (SEQ ID NO: 36).
[0117] VII. Protein Immunoblotting
[0118] Add 100 μL of RIPA strong lysis buffer (50 mM Tris (pH 7.4), 1% sodium deoxycholate, 1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM sodium pyrophosphate, 25 mM β-glycerophosphate, 1 mM EDTA) to each well of the cell culture plate, pre-contained with cocktail, PMSF, NaF, and a phosphatase inhibitor. Incubate on ice for 10 minutes, then pipette the cells completely. Transfer the cells to EP tubes, add loading buffer and DTT, and boil in boiling water for 8 minutes to denature them. Aliquot the samples and store at -80°C for long-term storage. Load the boiled proteins into the wells of a polyacrylamide gel, with the gel concentration varying from 7% to 15% depending on the size of the target protein. Electrophoresis program: 80 V, 30 min; 120 V, 90 min. After electrophoresis, remove the polyacrylamide gel and place it in transfer solution. Then, place it in the transfer clamp in the following order: sponge-filter paper-gel-PVDF membrane-filter paper-sponge. Rotate at a constant current of 300 mA for 60-90 min, depending on the size of the target protein. After transfer, remove the PVDF membrane, ensuring the side facing the gel is the front, and cut a corner at the upper right as a mark. Place the membrane in TBST containing 5% skim milk powder and block on a shaker at room temperature for 2 h. After blocking, cut the target band and place it in primary antibody diluted with blocking buffer, incubating overnight at 4°C on a shaker. The next day, rinse the membrane three times with TBST for 15 min each time. Finally, place the membrane in secondary antibody diluted with blocking buffer and incubate on a shaker at room temperature for 2 h. Develop and analyze using ECL chemiluminescence solution, adjusting the exposure time according to the signal intensity.
[0119] 8. Observational Records of the Daily Behavior of Crab-Eating Macaques
[0120] The living and behavioral monitoring cages used in the experiment had standardized dimensions: 1.5 meters long, 1 meter wide, and 1.1 meters high. To record the monkeys' daily behavioral patterns in detail, one-hour video recordings were made on each day for the first three months after birth, and weekly recordings were made after three months. Video recordings were scheduled during the animals' most active periods, namely 9:00 AM to 12:00 PM and 2:00 PM to 5:00 PM, intentionally avoiding the monkeys' regular sleep cycles.
[0121] IX. Working Memory Assessment in Model Monkeys
[0122] To accurately assess the cognitive function of maternally UBE3A knockout cynomolgus monkeys, this study employed the black-and-white patch experiment using the Wisconsin General Test Apparatus (WGTA) as the evaluation paradigm. The experimental setup consisted of a cage containing a display tray with four food troughs, a door allowing the monkeys to enter and exit, a sliding door separating the monkeys from the display tray, and a recording camera. All tests were conducted in a quiet room with standard lighting. At the start of each test, the sliding door opened, allowing the monkey to touch and open the food troughs on the display tray (defined as a response). After a response occurred, the opaque sliding door closed to evaluate the correctness of the response and prepare for the next round of testing. To motivate the monkeys to complete the test tasks, they were not fed before the test day. During the black-and-white patch and Hamiltonian search tasks, all wild-type control monkeys and maternally UBE3A knockout monkeys followed the same brief fasting procedure. This experimental design aimed to assess the working memory capacity of the monkeys. These data are crucial for understanding the impact of maternal UBE3A gene knockout on the cognitive function of cynomolgus monkeys and provide an animal model for cognitive deficits in AS. The black-and-white patch test experiment consisted of three phases: adaptation, discrimination, and reversal. In the adaptation phase, the monkeys' ability to retrieve food rewards from the display board was assessed. Prior to the formal adaptation phase, a series of pre-testing steps were performed to ensure readiness, including placing rewards under different conditions (in front of the food trough, in the food trough, in a food trough with a gray adaptation cover nearby, and in a food trough half-covered by a gray adaptation cover). In the adaptation phase, monkeys had to successfully retrieve food when the food trough was completely covered by the gray adaptation cover. Each monkey performed a maximum of 25 trials per day for each item, with 23 correct responses being the success criterion. In the discrimination phase, monkeys had to choose food rewards from food troughs covered by black or white patches. Each monkey performed 25 trials per day, and a correct response rate of 23 or higher was required to proceed to the next phase. The reversal phase used the same procedure as the discrimination phase, but the color of the reward was reversed. The monkeys were tested 25 times a day, five days a week, to assess their performance on a reversal task. The number of days they passed the test was used to measure their cognitive abilities.
[0123] 10. Assessment of cognitive flexibility in model monkeys
[0124] To assess and quantify the cognitive flexibility of these monkeys, this study employed the Hamiltonian search experiment based on the Wisconsin General Testing Apparatus (WGTA) described in previous literature. The Hamiltonian search task was designed according to previously published methods. In this experiment, the monkeys faced four identical food troughs, each with a movable lid. Only one trough contained a food reward, and the monkeys' goal was to minimize the number of times they had to open the lid to find the reward. Before performing this task, the monkeys had to successfully complete the adaptation phase of the black-and-white patch test. The Hamiltonian search task consisted of three phases: Phase 1: Set Making. In this phase, the monkeys needed to develop a search strategy to find the food reward. The reward was randomly placed in any hole in one of the four troughs, but the same location would not be offered a reward twice consecutively. The monkeys had to lift the corresponding lid to obtain the reward. One trial consisted of a series of responses until the monkey successfully found the food. The optimal strategy was to avoid opening the trough that had previously contained a reward and to find the food by opening only the other three troughs once. The experimenters recorded the order and number of times the monkeys explored. The trial ended either when the monkey found the food or 60 seconds later, whichever occurred first. Monkeys are considered proficient when they successfully complete the trial five times consecutively. Monkeys perform 25 trials per day for five consecutive days. Phase Two: Set Breaking. In Phase Two, the best well selected in the previous phase is consistently placed with a reward in each trial. Monkeys can open any number of troughs to find the reward, and the reward hole remains constant throughout the test session. The ideal strategy is to quickly identify the specific location that always contains the reward and open only that hole in each trial. Monkeys perform 25 trials per day for five consecutive days in this phase. To evaluate performance, the number of times a monkey successfully opens the correct well on its first attempt is recorded (denoted as "X"). For each monkey, the difference between the value of X on day five and day one is calculated, called "delta," which represents the change in outcome due to learning, reflecting the monkey's improved ability to identify and open reward holes over the five days. Phase Three: Forced Set Breaking. In Phase Three, the task setup is similar to Phase Two, but with two major differences: first, the reward location is different from Phase Two; second, monkeys are only allowed to open one hole per trial. The monkeys had to make a single choice, which was rated as correct or incorrect depending on the presence or absence of a reward. During the forced-break search strategy phase, the monkeys performed 25 trials per day for five consecutive days. To evaluate performance, the percentage of correct trials per day was calculated for each of the five days.
[0125] Example 1: UBE3A gene sequencing of cynomolgus monkey groups
[0126] CRISPR / Cas9-mediated gene editing uses guide RNA sequences as a guide. When guide RNA and Cas9 mRNA are injected into fertilized eggs, if the paternal and maternal allele sequences of the target gene are completely identical, then both alleles have an equal chance of being edited. The inventors found that this non-specific gene editing makes it difficult to obtain cynomolgus monkeys with specific knockout of the UBE3A maternal allele.
[0127] In order to achieve maternally specific editing of the UBE3A allele, the inventors sequenced and analyzed the UBE3A gene of sexually mature cynomolgus monkeys from the non-human primate platform of the Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences, hoping to find male and female monkeys carrying SNP sites or indel sites suitable for designing maternally specific guide RNA.
[0128] After extensive analysis and screening, the inventors gradually focused on exon 5 and its upstream and downstream introns. The UBE3A gene was sequenced from 4 sexually mature male monkeys and 233 sexually mature female monkeys. No SNP sites were found on the UBE3A exon 5 in any monkey, but multiple SNPs and indel sites were present in the upstream and downstream intron sequences of exon 5. Using ENSMFAG00000037265.2 from ensembl as a reference sequence, the UBE3A gene was listed. The major SNPs and indels within a 1.5kb range upstream and downstream of exon5 are listed in Table 1. Among them, the SNPs are 3393667 (17933), 3394110 (18376), 3395345 (19611), 3395447 (19713), 3396309 (20575) and 3396607 (20873). The indel between the SNPs 3394480 and 3394487 is 18746, which is an insertion or deletion of GTAACACT.
[0129] Table 1. Partial SNPs of the UBE3A gene in cynomolgus monkey groups
[0130] The inventors discovered that the SNPs in the UBE3A gene region 3393667-3396607 of the male cynomolgus monkey #43 exhibited uniqueness. All SNPs were homozygous, and the base types of the SNPs showed significant differences from those of other tested cynomolgus monkeys. Further analysis revealed that some of the tested female cynomolgus monkeys carried SNP base types completely different from those of the male cynomolgus monkey #43, and some SNP sites had CRISPR / Cas9 PAM sequences near them, which is beneficial for designing allele-specific guide RNAs.
[0131] Based on the extensive analysis described above, the inventors obtained several potential suitable locations for designing guide RNAs at the 5' and 3' ends of exon 5 of the UBE3A gene. Exon 5 is 299 bp in length. The sequence of exon 5 of the UBE3A gene is as follows:
[0132] 5'-GAAGCGAGCAGCTGCAAAGCATCTAATAGAACGCTACTACCACCAGTTAACTGAGGGCTGTGGAAATGAAGCCTGCACGAATGAGTTTTGTGCTTCCTGTCCAACTTTTCTTCGTATGGATAATAATGCAGCAGCTATTAAAGCCCTCGAG CTTTATAAGATTAATGCAAAACTCTGTGATCCTCATCCCTCCAAGAAAGGAGCAAGCTCAGCTTACCTTGAGAACTCGAAAGGTGCCCCCAACAACTCCTGCTCTGAGATAAAAATGAACAAGAAAGGCACTAGAATTGATTTTAAAG-3'(SEQ ID NO:17).
[0133] Example 2: Design and efficiency detection of maternal UBE3A gene-specific guide RNA in cynomolgus monkeys
[0134] The inventors designed and transcribed a series of guide RNAs and analyzed their targeted editing capabilities. Further screening revealed five guide RNAs specifically targeting the maternal UBE3A allele, three located at the 5' end of exon 5 and two at the 3' end of exon 5 (Figures 1A and 1B).
[0135] The target sequence of the sgRNA against maternal UBE3A is:
[0136] The sequence located at the 5' end (upstream) of exon 5 (the 3' terminal tribase is the PAM site):
[0137] Maternal (SNP L1): 5'-ATGTAGGACTAAATGACCAATGG-3' (SEQ ID NO: 1);
[0138] Maternal (SNP L2): 5'-AGATTTAAGATTGTATACTTTGG-3' (SEQ ID NO: 2);
[0139] Maternal (Indel L3): 5'-TTTCAGTGTAACACTAGCTTTGG-3' (SEQ ID NO: 3);
[0140] Maternal (SNP R1): 5'-CTCACACACTGTGGAAAAATAGG-3' (SEQ ID NO: 4);
[0141] Maternal (SNP R2): 5'-ССΤGСΤTΤСΤΑΑΤСΤGСΤΑСTGG-3' (SEQ ID NO: 5);
[0142] The corresponding sgRNA sequences are as follows:
[0143] sgRNA17933(sgRNAL1):5'-ATGTAGGACTAAATGACCAA-3'(SEQ ID NO:6);
[0144] sgRNA18376 (sgRNAL2): 5'-AGATTTAAGATTGTATACTT-3' (SEQ ID NO: 7);
[0145] sgRNA18746 (sgRNAL3): 5'-TTTCAGTGTAACACTAGCTT-3' (SEQ ID NO: 8);
[0146] sgRNA20575 (sgRNAR1): 5'-CTCACACACTGTGGAAAAAT-3' (SEQ ID NO: 9);
[0147] sgRNA20873 (sgRNAR2): 5'-CCTGCTTTCTAATCTGCTAC-3' (SEQ ID NO: 10).
[0148] The editing efficiency of a single guide RNA was further examined in parthenogenetic embryos of cynomolgus monkeys. Embryos developed to the blastocyst stage were randomly amplified, and the sequence containing the guide RNA was amplified using these embryos as templates (Figure 1C). The amplification primers were:
[0149] UBE3A-F1:5'-AGCACCAGAATGAATTGAATCTGTGTG-3' (SEQ ID NO: 11);
[0150] UBE3A-R1:5'-TGGTGCAGACTACTTAATACTTACGC-3'(SEQ ID NO:12);
[0151] Sanger sequencing was then performed. Of the 8 embryos collected from the sgRNA17933 (sgRNAL1) group, 5 were successfully amplified, and sequencing of the PCR products showed that all 5 embryos were edited. Of the 12 embryos collected from the sgRNA18376 (sgRNAL2) group, 9 were successfully amplified, and sequencing of the PCR products showed that 6 embryos were edited. Of the 10 embryos collected from the sgRNA18746 (sgRNAL3) group, 6 were successfully amplified, and sequencing of the PCR products showed that 3 embryos were edited. Of the 9 embryos collected from the sgRNA20575 (sgRNAR1) group, 5 were successfully amplified, and sequencing of the PCR products showed that all 5 embryos were edited. Of the 12 embryos collected from the sgRNA20873 (sgRNAR2) group, 8 were successfully amplified, and sequencing of the PCR products showed that all 8 embryos were edited (Figure 1D). The five sgRNAs tested showed editing efficiencies of over 50% in cynomolgus embryos, especially the sgRNA17933 (sgRNAL1), sgRNA20575 (sgRNAR1), and sgRNA20873 (sgRNAR2) groups (Figure 1D).
[0152] Example 3: Detection of the knockout efficiency and specificity of the dual guide RNA combination on the maternal UBE3A gene at the embryo level.
[0153] Based on the site characteristics of the sgRNA obtained above, the inventors further proposed a strategy of simultaneously targeting the 5' and 3' ends of exon 5 of the maternal UBE3A allele to knock out the entire exon 5 sequence. Since exon 5 is 299 bp long, its deletion would cause a frameshift mutation, leading to premature termination of protein expression and thus knocking out the maternal UBE3A gene. Considering that SNP20575 is located in the PAM sequence of sgRNA20575 (sgRNAR1), and that sgRNA20575 (sgRNAR1) can only edit the maternal sequence, with a relatively low possibility of off-target editing of the paternal sequence, sgRNA20575 (sgRNAR1) was chosen to target the 3' end of exon 5 of the maternal UBE3A allele (Figure 1B). The inventors injected sgRNA20575 (sgRNAR1) with three guide RNAs at the 5' end of exon 5 into cynomolgus monkey embryos. Embryos that developed to the blastocyst stage were randomly amplified, and the sequence between the two guide RNAs was amplified using these as templates (Figure 2A). The amplification primers were:
[0154] UBE3A-F1:5'-AGCACCAGAATGAATTGAATCTGTGTG-3' (SEQ ID NO:13);
[0155] UBE3A-R1:5'-TGGTGCAGACTACTTAATACTTACGC-3' (SEQ ID NO:14);
[0156] Electrophoresis of the PCR amplification products showed that the target band was successfully amplified in all tested embryos. Most of the amplification products in the three groups of embryos were smaller than those in the embryos that did not receive sgRNA / Cas9 injection, suggesting that the three sgRNA combinations can effectively delete the UBE3A gene fragment (Figure 2C).
[0157] Next, the inventors performed deep sequencing on the amplified products and linkage analysis with the SNP1 site to determine the parental origin of the amplified products (Figure 2B).
[0158] The inventors further amplified and performed deep sequencing on SNP2 located 10 bp downstream of exon5 to determine the knockout ratio of exon5 in the maternal UBE3A gene. The primer sequences for amplifying the SNP2 sequence are as follows:
[0159] UBE3A-F2:5'-CTCAGCTTACCTTGAGAACTCGAAAGG-3' (SEQ ID NO:15);
[0160] UBE3A-R2:5'-TTGGTTCTACGGTATCAAATGTCTTAATGTCAC-3' (SEQ ID NO: 16);
[0161] The results (Table 2) show that among the 6 embryos with the sgRNAR1 and sgRNAL1 combination, only 2 embryos had 100% paternal SNP2 base types. Among the 15 embryos with the sgRNAR1 and sgRNAL2 combination, only 5 embryos had 100% paternal SNP2 base types; the other 3 embryos had 1 embryo without editing, 2 embryos with editing of the paternal gene, and low knockout rates. Among the 15 embryos with the sgRNAR1 and sgRNAL3 combination, 10 embryos had 100% paternal SNP2 base types, indicating that these 10 embryos achieved complete knockout of the maternal UBE3A gene exon 5. The other embryos had a high average knockout rate of the maternal UBE3A gene exon 5 (Figure 2D).
[0162] Table 2
[0163] In summary, the combination of sgRNAR1 and sgRNAL3 can achieve particularly efficient and specific knockout of the maternal UBE3A gene exon5. The inventors further used this combination to construct a mammary monkey model with maternal UBE3A gene knockout.
[0164] Example 4: Genotyping of newborn cynomolgus monkeys
[0165] The inventor transplanted a total of 58 embryos to 30 recipients. Eight recipients became pregnant, resulting in a total of nine fetuses. Six of these fetuses were born and survived, two miscarried at 100 days, and one was born at full term but experienced a difficult labor (Table 3).
[0166] Table 3. Embryo manipulation and monkey birth details
[0167] Blood was collected from surviving monkeys, and after red blood cells were removed by treating with red blood cell lysis buffer, genomic DNA was extracted from white blood cells. In addition, brain tissue was collected from monkeys that had miscarried or had dystocia to extract genomic DNA.
[0168] Amplification of the entire fragment between the two guide RNAs revealed large-fragment knockout in two of the six surviving monkeys (M1-M6), namely M2 and M6 (Figures 3C and 3D). Deep sequencing analysis of the SNP1s on the amplified fragment showed that both M2 and M6 exhibited maternal base types in the SNP1s, indicating specific knockout of the maternal UBE3A gene exon 5 (Figure 3E). This result also demonstrates that the method of this invention can obtain monkeys with a high probability of large-fragment knockout.
[0169] Amplification and deep sequencing of SNP2 showed that 100% of the base types of M2 at SNP2 were paternal, and 71.9% of the base types of M6 at SNP2 were paternal. The calculated knockout rates of exon5 of the maternal UBE3A gene by M2 and M6 were 100% and 60.92%, respectively (Figure 3F).
[0170] Of the three monkeys that miscarried or had dystocia, A1 was not edited, while A2 and A3 both achieved specific knockout of the maternal UBE3A gene exon5, with knockout rates of 40.25% and 100%, respectively (Figures 3E and 3F).
[0171] The brain tissue of A3 monkey, which achieved complete knockout of the maternal UBE3A gene exon5, was analyzed for UBE3A protein. The results showed that the expression level of UBE3A protein in the prefrontal cortex and cerebellum of A3 was significantly lower than that in the WT control (Figure 3G).
[0172] The above results demonstrate that the UBE3A protein was effectively knocked out.
[0173] Example 5: Activation of a model monkey to induce expression of paternal UBE3A protein in neurons
[0174] The UBE3A gene is specifically imprinted in neurons, and the UBE3A protein is expressed only from the maternal (mat) allele, while the paternal (pat) allele, although present, is repressed by a long non-coding antisense transcript called SNHG14 (also known as UBE3A-ATS). The inventors isolated monkey skin fibroblasts and further induced them into pluripotent stem cells (iPSCs) and cortical neurons.
[0175] Immunoblotting analysis of cultured neurons showed that no UBE3A protein expression was detected in the UBE3A gene knockout neuron culture, and only very low levels of UBE3A protein were detected in the maternal UBE3A gene knockout neuron cell culture, which may be residual UBE3A expressed in non-neuronal cells (Figure 4A).
[0176] Immunofluorescence experiments also demonstrated that there was no expression of UBE3A protein in mature maternally knocked-out UBE3A neurons.
[0177] Subsequently, neurons were treated with topotecan (1 μM), a drug that can activate the expression of paternal UBE3A protein, and the expression level of UBE3A protein was analyzed by Western blotting. The results showed that topotecan could significantly increase the expression level of UBE3A protein in induced neurons of model monkeys (Figure 4B).
[0178] This result also proves that the present invention specifically knocked out the maternal UBE3A gene of cynomolgus monkeys while completely preserving the paternal UBE3A gene, thus successfully establishing an AS cynomolgus monkey model.
[0179] Example 6: Angelman syndrome phenotype observed in maternally UBE3A gene knockout cynomolgus monkeys.
[0180] 1. Maternally knocked-out UBE3A gene cynomolgus monkeys exhibit severe developmental delays.
[0181] Close video recording and analysis were conducted after the monkeys were born. Crab-eating macaques were able to stand and climb about a week after birth. However, it was found that the maternal UBE3A gene knockout cynomolgus monkeys (M2 and M6) were unable to stand and climb for one month after birth, and spent most of their time in a prone or supine position (Figure 5). After one month, the maternal UBE3A gene knockout cynomolgus monkeys gradually became able to stand and climb normally, but it took much longer than the unedited control group monkeys. This indicates that the maternal UBE3A gene knockout cynomolgus monkeys have a serious problem of motor developmental delay, which is very similar to the motor development characteristics of patients.
[0182] 2. Maternally knocked-out UBE3A gene cynomolgus monkeys exhibit severe cognitive impairment.
[0183] We assessed the cognitive function of the monkeys using the Wisconsin-Hamilton test and the Hamilton search test. The test results are shown in Figure 6.
[0184] In the three phases of the black-and-white patch test—adaptation, discrimination, and reversal—the unedited control group monkeys completed all three phases in no more than 20 days, while the maternally UBE3A knockout cynomolgus monkeys remained in the adaptation phase, failing to pass the first phase test even on day 150 (Figure 6A). This result suggests that the maternally UBE3A knockout cynomolgus monkeys may have impaired working memory.
[0185] The Hamiltonian Search Test was used to assess and quantify the cognitive flexibility of these monkeys. In this test, the trends in daily task completion accuracy differed significantly between the two groups in both the second and third phases: the wild-type control monkeys were able to quickly establish and adjust strategies to accurately locate food rewards, while the maternally UBE3A knockout cynomolgus monkeys did not show significant improvement. Specifically, in the second phase, the wild-type control monkeys were able to quickly learn and adapt to new reward patterns as the experiment progressed. Conversely, the maternally UBE3A knockout cynomolgus monkeys did not show a significant improvement in accuracy, further indicating their deficiency in cognitive flexibility (Figures 6B-C).
[0186] These results suggest that maternally UBE3A gene knockout cynomolgus monkeys suffer from severe cognitive impairment, consistent with their performance in mimicking cognitive impairment in AS patients.
[0187] discuss
[0188] Asthma (AS) is a neurogenetic disorder. Patients primarily exhibit symptoms such as intellectual disability, language impairment, sleep disturbances, motor incoordination, seizures, and a tendency to express joy. The estimated prevalence of AS is approximately 1 in 20,000–1 in 12,000, with similar rates in men and women. Their life expectancy is near normal, and they require full-time family care. Currently, there are no approved therapies specifically for AS; clinical treatment mainly focuses on interventional therapy and symptomatic relief, primarily aimed at reducing seizures and improving sleep. AS is caused by the deletion or defective expression of the maternal allele UBE3A in the q11-13 region of chromosome 15. In neurons of the central nervous system, the UBE3A gene is influenced by genomic imprinting, with the maternal allele expressing the gene while the paternal allele does not.
[0189] Currently, the main animal models for ankylosing spondylitis (AS) include fruit fly, mouse, and rat models. While these models mimic some characteristics of AS patients, none of them can completely replicate the patient's phenotype, posing significant limitations in AS research. Therefore, establishing an animal model that better simulates the clinical characteristics of AS patients is essential. Although non-human primates are more evolutionarily close to humans, establishing suitable non-human primate models that match the genetic characteristics of patients remains extremely difficult. Given the complexity of target genes and the need for extensive screening, research, and experimentation, this has not yet been achieved in this field. This invention, through extensive screening, obtained suitable target molecules, and the established maternal UBE3A gene-specific knockout cynomolgus monkey model fills a gap in this field, providing a better platform for AS disease mechanism research and drug development.
[0190] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.
Claims
1. A method for preparing Angelman syndrome animals, comprising: Downregulate the maternal UBE3A gene in animals, wherein the downregulation targets the upstream and / or downstream introns of exon 5 of the maternal UBE3A gene; The animal in question is a non-human primate.
2. A method for preparing animal cells, comprising: Downregulation of the maternal UBE3A gene in animal cells, wherein the downregulation targets the upstream and / or downstream introns of the maternal UBE3A gene exon5; wherein the animal is a non-human primate; preferably, the cells comprise fertilized eggs.
3. The method as described in claim 1 or 2, characterized in that, The downregulation includes: targeting the target sequence SEQ ID NO:3, SEQ ID NO:1 or SEQ ID NO:2 in the upstream intron of the maternal UBE3A gene exon5; and / or targeting the target sequence SEQ ID NO:4 or SEQ ID NO:5 in the downstream intron of the maternal UBE3A gene exon5.
4. The method as described in claim 1 or 2, characterized in that, The target sequence SEQ ID NO:4 is downregulated in the downstream intron of the maternal UBE3A gene exon5; and the target sequences SEQ ID NO:3, SEQ ID NO:1 or SEQ ID NO:2 are in the upstream intron.
5. The method as described in claim 4, characterized in that, The downregulation includes knockout using CRISPR gene editing; preferably, sgRNA is used as a guide to perform the knockout, wherein: The sgRNA targeting the target sequence SEQ ID NO:3 has the nucleotide sequence shown in SEQ ID NO:8; The sgRNA targeting the target sequence SEQ ID NO:1 has the nucleotide sequence shown in SEQ ID NO:6; The sgRNA targeting the target sequence SEQ ID NO:2 has the nucleotide sequence shown in SEQ ID NO:7; sgRNA targeting the target sequence SEQ ID NO:4, whose nucleotide sequence is as shown in SEQ ID NO:9; or The sgRNA targeting the target sequence SEQ ID NO:5 has the nucleotide sequence shown in SEQ ID NO:
10.
6. The method as described in claim 5, characterized in that, The sgRNA and Cas mRNA, or constructs capable of forming the sgRNA and Cas mRNA, are introduced into the fertilized egg of an animal.
7. The method as described in claim 6, characterized in that, Also includes: The fertilized egg was allowed to develop, resulting in the Angelman syndrome animal.
8. An sgRNA for preparing Angelman syndrome animals, wherein the target sequence SEQ ID NO:3, SEQ ID NO:1 or SEQ ID NO:2 is located in the upstream intron of the maternal UBE3A gene exon5 of the animal; and / or, the target sequence is located in the downstream intron of the maternal UBE3A gene exon5: SEQ ID NO:4 or SEQ ID NO:
5.
9. The sgRNA as described in claim 8, characterized in that, The sgRNA is a combination of sgRNAs, including: a target sequence SEQ ID NO:4 targeting the downstream intron of the maternal UBE3A gene exon5; and a target sequence SEQ ID NO:3, SEQ ID NO:1 or SEQ ID NO:2 targeting the upstream intron.
10. The sgRNA for preparing Angelman syndrome animals as described in claim 9, characterized in that, The sgRNA targeting the target sequence SEQ ID NO:3 has the nucleotide sequence as shown in SEQ ID NO:8; the sgRNA targeting the target sequence SEQ ID NO:1 has the nucleotide sequence as shown in SEQ ID NO:6; the sgRNA targeting the target sequence SEQ ID NO:2 has the nucleotide sequence as shown in SEQ ID NO:7; the sgRNA targeting the target sequence SEQ ID NO:4 has the nucleotide sequence as shown in SEQ ID NO:9; or, the sgRNA targeting the target sequence SEQ ID NO:5 has the nucleotide sequence as shown in SEQ ID NO:
10.
11. The use of the Angelman syndrome animal prepared by the method of any one of claims 1 to 7, for: Animal models used to screen candidate drugs or therapeutics for alleviating or treating Angelman syndrome; As an animal model for studying Angelman syndrome; or Drug metabolism and toxicology tests were conducted.
12. A kit for preparing Angelman syndrome animals, comprising the sgRNA for preparing Angelman syndrome animals as described in any one of claims 8 to 10.
13. The kit according to claim 12, characterized in that, The kit also contains Cas mRNA or a construct that can form Cas mRNA.
14. A method for screening candidate drugs or therapeutic agents to alleviate or treat Angelman syndrome, the method comprising: (1) Prepare an animal model of Angelman syndrome using any of the methods described above; (2) The candidate substance is given to the animal model of (1) and the candidate substance is observed to have an alleviating or therapeutic effect on Angelman syndrome. If the symptoms of Angelman syndrome in the animal model are observed to be relieved, the candidate substance is a substance that can alleviate or treat Angelman syndrome.
15. The method as described in claim 14, characterized in that, The observations included the analysis of the following phenotypes: motor function and cognitive function.