Flexible nanodot sensor having nt3 / gnp integrated hydrogel for improving drug evaluation in glioblastoma-midbrain assembloid model applied thereto, and method for manufacturing same
A flexible nanodot sensor with NT3/GNP hydrogel and electrode addresses adhesion and connectivity issues in glioblastoma assembloids, enabling accurate electrophysiological signal measurement for effective drug screening.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SOGANG UNIV RES & BUSINESS DEV FOUND
- Filing Date
- 2025-07-16
- Publication Date
- 2026-05-15
AI Technical Summary
Existing 3D culture systems for glioblastoma, such as assembloids, face challenges with adhesion instability and limited sensing technologies that are primarily planar and rigid, hindering accurate electrophysiological signal analysis and drug screening.
A flexible nanodot sensor is developed using an adhesive hydrogel with gold nanoparticles (GNP) conjugated with neurotrophic factor-3 (NT3) to enhance neural connectivity and a flexible nanodot electrode to increase contact surface area, enabling non-invasive electrophysiological signal measurement.
The sensor maintains stable adhesion and enhances neural connectivity, allowing for accurate, simultaneous measurement of electrophysiological signals from each organoid, facilitating effective drug screening in glioblastoma-midbrain assembloid models.
Smart Images

Figure KR2025010460_15052026_PF_FP_ABST
Abstract
Description
Flexible nanodot sensor with NT3 / GNP integrated hydrogel for improved drug evaluation in glioblastoma-midbrain assembloid model and method for manufacturing the same
[0001] The present invention relates to a flexible nanodot sensor incorporating an NT3 / GNP integrated hydrogel for improving drug evaluation in a glioblastoma-midbrain assembleoid model, a method for manufacturing the same, a drug screening method using the same, and a drug screening method for the prevention or treatment of glioblastoma using the same.
[0002]
[0003] Glioblastoma (GBM) is the most common malignant brain tumor in the central nervous system (CNS), with a median survival of only 8 months and an overall 5-year survival rate of just 6.9%. Despite the urgent need for strategies to enhance scientific understanding of GBM and discover new therapeutic approaches, a significant barrier remains in advancing GBM treatment due to a lack of reliable in vitro models for evaluating potential pharmaceutical agents. To address the limitations of existing models, there is an urgent need to develop in vitro systems that more accurately mimic the tumor microenvironment and cellular interactions inherent in GBM. This need spurs the exploration of innovative approaches, such as biotechnological matrices and advanced 3D culture technologies, which facilitate more representative modeling of tumor behavior and therapeutic response. Two-dimensional (2D) monolayer culture systems are the most commonly used models for studying GBM. However, these 2D cultures are inherently unable to replicate the complex microenvironment of the human brain.
[0004] To overcome these limitations, 3D culture systems, including tumor spheroids, neurospheres, and organoids, have been developed as a result of advancements in cell culture technology. These systems are rapidly emerging as valuable tools in biological and preclinical research, providing access to human brain development and disorders, including brain tumors. Brain tumor organoids are particularly valuable because they faithfully mimic the characteristics of brain tumors, as patient-derived mouse xenografts or tumor stem cells in 2D cultures do not exhibit the same behavior as in vivo tumors. For example, neoplastic cerebral organoid (neoCOR) models demonstrate brain tumorigenesis by introducing oncogenic mutations into brain organoids via CRISPR / Cas9 and transposon-mediated mutations. In the early stages of tumorigenesis, precise mutation engineering is possible due to the potential of CRISPR / Cas9-based gene editing technologies. Combining genetic engineering with brain organoids enables tumor modeling through defined mutations and targeted gene therapy.
[0005] However, these advanced organoid models are essential for understanding the complex interactions between glioblastoma and the brain microenvironment, thereby facilitating the discovery of new therapeutic strategies. Consequently, there is growing interest in developing stable and highly connected GBM assembloids to create more complex disease models and accurately assess their impact on surrounding brain tissues. Conventional assembloid generation methods that involve direct contact between two different organoids to promote connectivity face challenges due to instability and low connectivity. This instability hinders the efficient observation of inter-organoid interactions. On the other hand, given the complexity and 3D nature of GBM assembloids, effective sensing technologies are crucial for accurately capturing electrophysiological signals that reflect biological activities and interactions to monitor pathophysiological changes stimulated by drugs. Most current sensing technologies, originally designed for 2D culture, are planar and rigid, limiting the interface to a small contact area of the 3D organoid, typically near the bottom contact surface. While 3D sensors are available for use in single organoids, no sensors have been developed for use in assembleoids. Various sensors are being developed to monitor signals from these promising organoid models.
[0006] Electrophysiological signal analysis is a core technology capable of real-time monitoring of neural activity within organoids and is essential in organoid research. To this end, various sensors and measurement techniques have been developed, and currently, methods such as planar multielectrode arrays (MEAs) are primarily used. Conventional technologies developed to measure electrophysiological signals have mainly involved inserting thin electrodes into organoids, wrapping the organoid with flexible electrodes for measurement, or cutting more complex assemblies in half and measuring using a patch clamp method.
[0007] Specifically, conventional techniques have been developed to fabricate assemblebloids by fabricating and contacting cerebral cortex and striatal organoids, respectively, to study the cerebral cortex-striatal pathway and dysfunction. For the electrophysiological signal analysis of the assemblebloids, the assemblebloids were cut in half and examined using a patch clamp method (see Miura, Yuki, et al. "Generation of human striatal organoids and cortico-striatal assembloids from human pluripotent stem cells." Nature Biotechnology 38.12(2020): 1421-1430.).
[0008] In addition, conventional techniques for analyzing electrophysiological signals in assembleoids using self-folding polymer bilayers have been developed. Flexible multi-aligned electrodes were fabricated on silicon wafers using Ge, SU8, gold, and PEDOT:PSS, enabling the realization of customized 3D MEA electrodes with a larger contact area compared to conventional MEAs. The transparency of these customized 3D MEA electrodes improved the convenience of microscopy and fluorescence analysis. Furthermore, it was confirmed that signals increased with increasing glutamate concentration in organoids using 3D MEAs, and more spikes were observed in the 3D electrodes compared to the 2D electrodes (see Huang, Qi, et al. "Shell microelectrode arrays (MEAs) for brain organoids." Science advances 8.33(2022): eabq5031).
[0009] However, conventional technology fabricates assembleoids through simple gravity and physical contact, lacking technological advancements to improve this process. During electrophysiological signal analysis, destructive measurements are performed using a patch clamp method that cuts the assembleoid, raising the need for non-destructive methods. Furthermore, existing sensors are limited in that they are primarily suitable for measuring single organoids and are unsuitable for efficiently measuring the electrical signals of complex assembleoids.
[0010]
[0011] Accordingly, the inventors solved the existing problem of assembloid culture, in which adhesion between the two organoids was not maintained during long-term culture, by culturing glioblastoma-midbrain assembloids in an adhesive hydrogel containing gold nanoparticles (GNP) conjugated with neurotrophic factor-3 (NT3). They also enhanced the neural connectivity between the two organoids and facilitated accurate electrophysiological signal analysis using gold nanoparticles, which are conductive materials. Furthermore, by developing a flexible nanodot electrode, they increased the contact surface area with the assembloids, allowing for the simultaneous, accurate, and non-invasive measurement of electrophysiological signals from each organoid. Thus, they completed a nanodot sensor that can be effectively used for drug screening in assembloid models using an improved method compared to existing ones.
[0012] Accordingly, the object of the present invention is to provide a nanodot sensor for drug screening comprising: an adhesive hydrogel for organoid culture comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer; and a nanodot electrode located beneath the adhesive hydrogel, wherein a metal is deposited in a nanodot pattern on a metal-coated substrate.
[0013] Another objective of the present invention is to provide a drug screening method using a nanodot sensor according to the present invention.
[0014] Another objective of the present invention is to provide a drug screening method for the prevention or treatment of glioblastoma using a nanodot sensor according to the present invention.
[0015] Another objective of the present invention is to provide a method for manufacturing a nanodot sensor according to the present invention.
[0016]
[0017] The present invention relates to a nanodot sensor for drug screening, a method for manufacturing the same, a drug screening method using the same, and a drug screening method for the prevention or treatment of glioblastoma using the same. When using the nanodot sensor for drug screening according to the present invention, glioblastoma-midbrain assembleoids are cultured in an adhesive hydrogel containing gold nanoparticles (GNP) conjugated with neurotrophic factor-3 (NT3), thereby solving the existing problem of assembloid culture in which adhesion between the two organoids is not maintained well during long-term culture, strengthening the neural connectivity between the two organoids, facilitating accurate electrophysiological signal analysis by a conductive material, namely metal nanoparticles, and also, due to the nanodot electrode with a flexible structure, the contact surface area with the assembloid is increased, allowing the electrophysiological signals of each organoid to be measured simultaneously, accurately, and non-invasively, thus enabling effective drug screening in an assembloid model.
[0018] The present invention will be described in more detail below.
[0019] One aspect of the present invention is an adhesive hydrogel for organoid culture comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer; and
[0020] A nanodot sensor for drug screening comprising a nanodot electrode located on the lower part of the adhesive hydrogel, wherein a metal is deposited in a nanodot pattern on a metal-coated substrate.
[0021] In the present invention, the metal may be gold (Au), silver (Ag), platinum (Pt), or an alloy thereof, but is not necessarily limited thereto, and any conductive material may be used in the present invention without limitation.
[0022] In the present invention, the neurotrophic factor may be one or more selected from the group consisting of neurotrophic factor-3 (NT3), neurotrophin-4 (NT-4), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), and nerve growth factor (NGF), but is not necessarily limited thereto.
[0023] In the present invention, the neurotrophic factor-3 (NT3) is also referred to as neurotrophin-3 (NT-3), and the term neurotrophic factor-3 may be used interchangeably with neurotrophin-3 in this specification.
[0024] In the present invention, the biocompatible polymer may be one or more selected from the group consisting of gelatin, dextran, dextran aldehyde, hyaluronic acid, collagen, alginate, alginic acid, starch, chitosan, cellulose, chondroitin sulfate, and heparin, but is not necessarily limited thereto.
[0025] In the present invention, the nanodot sensor for drug screening may further include a concave mold that supports the adhesive hydrogel and the nanodot electrode.
[0026] In the present invention, the mold may be made of one or more materials selected from the group consisting of PDMS (Polydimethylsiloxane), polyethylene, polystyrene, and polypropylene, but is not necessarily limited thereto.
[0027] In the present invention, the nanodot electrode may be fabricated with a flexible structure that increases the contact surface area with the organoid.
[0028] In the present invention, the substrate may be made of one or more materials selected from the group consisting of polyethylene terephthalate (PET) and polyimide (PI).
[0029] In the present invention, the substrate may be made of a flexible material that increases the contact surface area with the organoid.
[0030] In the present invention, the nanodot sensor for drug screening may include at least two nanodot electrode strips.
[0031] In the present invention, the organoid may be at least two organoids of different cell types.
[0032] In the present invention, the organoid may be one or more organoids selected from the group consisting of kidney, brain, skin, heart, optic cup, liver, pancreas, bile duct, neural tube, stomach, large intestine, small intestine, prostate, breast, salivary gland, endometrium, mammary gland, thyroid, tongue, esophagus, lung, blood vessel, muscle and adrenal cortex.
[0033] In the present invention, the organoid may be one or more organoids selected from the group consisting of the forebrain, dorsal forebrain, ventral forebrain, midbrain, hindbrain, brainstem, cerebrum, cerebellum, thalamus, hypothalamus, pituitary gland, amygdala, hippocampus, basal ganglia, and spinal cord.
[0034] In the present invention, the organoid is selected from the group consisting of glioblastoma, astrocytoma, ependymoma, oligodendroglioma, mixed glioma, brainstem glioma, optic nerve glioma, pituitary adenoma, craniopharyngioma, medulloblastoma, primitive neuroectodermal tumor, pineal tumors, meningioma, schwannoma, metastatic brain tumor, central nervous system lymphoma, neurofibromatosis, pseudotumor cerebri, and tuberous sclerosis. It may be one or more types of brain cancer organoids.
[0035] In the present invention, the organoid may be an assembloid formed by combining at least two organoids of different cell types.
[0036] In the present invention, the term "assembloid," also referred to as an assembly, means a self-organizing cellular system in which integration is achieved through the combination of different types of organoids or organoids of different cell lineages. For example, it may be a combination of organoids from different brain regions.
[0037] In one embodiment of the present invention, the organoid may have an oncogenic mutation introduced.
[0038] In one embodiment of the present invention, the organoid may have one or more oncogenes selected from the group consisting of JAK2, HER2, KRAS, NRAS, HRAS, MUC16, MYC, BCR-ABL, EGFR, ALK, MDM2, Cyclin D1, VEGF, AKT, SRC, CDK4, PIK3CA, and BRAF that have gained-of-function mutations.
[0039] In another embodiment of the present invention, the organoid may have one or more tumor suppressor genes selected from the group consisting of PTEN, NF1, Rb, p53, VHL, BCL2, SWI / SNF, TP53, RB1, APC, VHL, CDKN2A, STK11, TSC1, TSC2, CSMD3, LRP1B, and SMAD4 that have undergone a loss-of-function mutation.
[0040] In another embodiment of the present invention, the organoid may have a mutation introduced into one or more DNA repair genes selected from the group consisting of APC, BRCA1, BRCA2, MGMT, MLH1, MSH2, MSH6, and PMS2.
[0041] Another aspect of the present invention is a drug screening method using a nanodot sensor according to the present invention, comprising the following steps:
[0042] A culture step of culturing an organoid in an adhesive hydrogel comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer;
[0043] A drug delivery step of bringing the above organoid into contact with a test drug; and
[0044] A signal measurement step for measuring the electrophysiological signal of the organoid using a nanodot electrode in which metal is deposited in a nanodot pattern on a metal-coated substrate located below the adhesive hydrogel.
[0045] In the present invention, the organoid may be an assembleoid formed by combining a first organoid and a second organoid.
[0046] In the present invention, the first organoid and the second organoid may have different types of cells.
[0047] In the present invention, the nanodot electrode may measure separate electrophysiological signals in each of the first organoid and the second organoid.
[0048] In the present invention, the nanodot sensor may include at least two nanodot electrode strips.
[0049] Another aspect of the present invention is a drug screening method for the prevention or treatment of glioblastoma using a nanodot sensor according to the present invention, comprising the following steps:
[0050] A culture step of culturing a glioblastoma-midbrain assembleoid, in which a glioblastoma organoid and a midbrain organoid are combined, in an adhesive hydrogel comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer;
[0051] A drug delivery step of bringing the above-mentioned glioblastoma-midbrain assembleoid into contact with a test drug; and
[0052] A signal measurement step for measuring the electrophysiological signal of the glioblastoma-midbrain assembleoid using a nanodot electrode in which metal is deposited in a nanodot pattern on a metal-coated substrate located below the adhesive hydrogel.
[0053] In the present invention, the drug screening method for the prevention or treatment of glioblastoma may further include the step of determining the test drug as a candidate drug for the prevention or treatment of glioblastoma if the electrophysiological signal of the glioblastoma organoid is reduced in a glioblastoma-midbrain assembleoid treated with the test drug compared to a glioblastoma-midbrain assembleoid not treated with the test drug.
[0054] In the present invention, the glioblastoma organoid may be obtained by culturing induced pluripotent stem cells (iPSCs) in which one or more genes selected from the group consisting of NF1 (neurofibromin 1) and PTEN10 (phosphatase and tensin homolog on chromosome 10) have been knocked out.
[0055] In the present invention, the nanodot electrode may measure separate electrophysiological signals in each of the glioblastoma organoid and the midbrain organoid.
[0056] Another aspect of the present invention is a method for manufacturing a nanodot sensor for drug screening, comprising the following steps:
[0057] A step of preparing an adhesive hydrogel by mixing metal nanoparticles conjugated with neurotrophic factors and a biocompatible polymer;
[0058] A step of forming a nanodot electrode by coating a metal on a substrate and then depositing the metal in a nanodot pattern; and
[0059] A step of attaching the nanodot electrode onto a concave mold and positioning the adhesive hydrogel on the nanodot electrode.
[0060] In the present invention, the substrate may be made of one or more materials selected from the group consisting of polyethylene terephthalate (PET) and polyimide (PI).
[0061] In the present invention, the substrate may be coated with a metal having a thickness of 50 to 200 nm.
[0062] In the present invention, the substrate may be coated with gold (Au), silver (Ag), platinum (Pt), or an alloy thereof.
[0063] In the present invention, the substrate may be additionally coated with chromium.
[0064] In the present invention, the nanodot pattern can be manufactured by a method comprising the following steps:
[0065] A step of forming a grid pattern photoresist layer on a metal-coated substrate;
[0066] A step of depositing metal on the above substrate; and
[0067] Step of removing the photoresist layer of the above grid pattern.
[0068] In the present invention, the metal may be gold (Au), silver (Ag), platinum (Pt), or an alloy thereof.
[0069] In the present invention, the neurotrophic factor may be one or more selected from the group consisting of neurotrophic factor-3 (NT3), neurotrophin-4 (NT-4), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), and nerve growth factor (NGF).
[0070] In the present invention, the biocompatible polymer may be one or more selected from the group consisting of gelatin, dextran, dextran aldehyde, hyaluronic acid, collagen, alginate, alginic acid, starch, chitosan, cellulose, chondroitin sulfate, and heparin.
[0071] In the present invention, the mold may be made of one or more materials selected from the group consisting of PDMS (Polydimethylsiloxane), polyethylene, polystyrene, and polypropylene.
[0072] In the present invention, the nanodot electrode may be fabricated with a flexible structure that increases the contact surface area with the organoid.
[0073]
[0074] The present invention relates to a nanodot sensor for drug screening, a method for manufacturing the same, a drug screening method using the same, and a drug screening method for the prevention or treatment of glioblastoma using the same. When using the nanodot sensor for drug screening according to the present invention, the problem of existing assembled synthoid cultures, in which adhesion between the two organoids is not maintained well during long-term culture, is solved by culturing glioblastoma-midbrain assembled synthoids in an adhesive hydrogel containing gold nanoparticles conjugated with neurotrophic factor-3. Furthermore, the neural connectivity between the two organoids is enhanced, and accurate electrophysiological signal analysis by a conductive material is facilitated. Additionally, due to the nanodot electrode having a flexible structure, the contact surface area with the assembled synthoid is increased, allowing the electrophysiological signals of each organoid to be measured simultaneously, accurately, and non-invasively, thus enabling effective drug screening in an assembled synthoid model.
[0075]
[0076] FIG. 1 is a schematic diagram of a flexible nanodot sensor capable of analyzing electrophysiological signals of a glioblastoma-midbrain (GBM-MB) assembleoid with enhanced connectivity cultured in an adhesive hydrogel containing NT3 (neurotrophic factor-3) / GNP (gold nanoparticle) according to one embodiment of the present invention. In the present invention, neurotrophic factor-3 (NT3) is also referred to as neurotrophin-3 and is used interchangeably.
[0077] FIG. 2 is a schematic diagram of a flexible nanodot sensor with an NT3 / GNP integrated hydrogel applied for improving drug evaluation in a glioblastoma-midbrain assembloid model according to one embodiment of the present invention, and a drug evaluation method using the same.
[0078] FIG. 3 is a schematic diagram of a flexible nanodot sensor according to one embodiment of the present invention. FIG. 3(a) is a schematic diagram of a method for fabricating a GBM-MB assembledoid using an adhesive hydrogel containing NT3 and GNP, and FIG. 3(b) is a schematic diagram of a flexible nanodot sensor for drug screening of a GBM-MB assembledoid by measuring separated electrophysiological signals.
[0079] FIG. 4a is a schematic diagram of a cerebral organoid (CO), a midbrain organoid (MB), and a glioblastoma organoid (GBM) developed from human induced pluripotent stem cells (hiPSC) according to one embodiment of the present invention.
[0080] FIG. 4b is a figure showing (a) a timeline of generating a midbrain organoid from hiPSCs according to one embodiment of the present invention and (b) optical images (scale bar = 200 μm) showing the general shape and size expansion of the cells at each step.
[0081] FIG. 4c is a figure showing (a) a timeline for generating a cerebral organoid from hiPSCs according to one embodiment of the present invention and (b) optical images (scale bar = 200 μm) showing the general shape and size expansion of the cell at each step.
[0082] FIG. 4d is a figure showing (a) a timeline for generating glioblastoma organoids from transfected hiPSCs according to one embodiment of the present invention, (b) optical images showing the general morphology and size expansion of the cells at each stage (scale bar = 200 μm), and (c) sequences of the PTEN and NF1 gene CRISPR target regions in the transfected cells.
[0083] Figure 4e is a figure showing immunostaining images (scale bar = 200 μm) of MB, CO, and GBM organoids developed from iPSCs according to one embodiment of the present invention.
[0084] FIGS. 4f to 4h are figures showing the results of qRT-PCR analysis (30 days and 60 days) of midbrain markers (DAT, NURR1, LMX1A) identified in MB organoids developed from iPSCs according to one embodiment of the present invention.
[0085] FIGS. 4i to 4k show the results of qRT-PCR analysis (30 days) of glioblastoma markers (SOX2, GFAP, OLIG2) identified in CO and GBM organoids developed from iPSCs according to one embodiment of the present invention.
[0086] FIG. 41 is a figure showing (a) a raster plot of neural spike data of cerebral and GBM organoids and (b) a quantitative plot of electrophysiological activity of cerebral and GBM organoids at 60 days according to one embodiment of the present invention. The standard error for the mean of four measurements is indicated by error bars (**p<0.01).
[0087] FIG. 5a is a schematic diagram of a conductive adhesive hydrogel comprising gelatin, dextran aldehyde, and an NT3 / GNP complex according to one embodiment of the present invention.
[0088] FIG. 5b is a figure showing a photograph of an adhesive hydrogel (bare hydrogel) containing gelatin and dextran aldehyde according to one embodiment of the present invention, and a conductive adhesive hydrogel containing gold nanoparticles containing gelatin, dextran aldehyde and NT3 / GNP complex.
[0089] FIG. 5c is a graph showing the surface charge of bare-GNP and NT3 / GNP without NT3 bonding according to one embodiment of the present invention.
[0090] FIG. 5d is a figure showing cyclic voltammetry curves of an adhesive hydrogel and a bare hydrogel with various concentrations of GNP (0.4 M, 2 M, 4 M) added according to one embodiment of the present invention.
[0091] FIG. 5e is a graph showing the quantitative analysis of the impedance at 1 Hz in the EIS spectrum according to one embodiment of the present invention.
[0092] FIG. 5f is a figure showing Live / Dead stained images of a Day 7 GBM-MB assembled using an NT3 / GNP hydrogel for biocompatibility analysis according to one embodiment of the present invention. The scale bar is 100 μm.
[0093] FIG. 6a is a figure showing a PDMS mold for producing an assembled (assembly) according to one embodiment of the present invention and a photograph of a glioblastoma-midbrain assembled therefrom.
[0094] FIG. 6b is an immunohistochemical image of GFP-expressing CO and MB assembleroids cultured in a hydrogel containing or not containing NT3 / GNP to confirm the connectivity of the assembleroids according to one embodiment of the present invention. The scale bar is 100 μm.
[0095] FIG. 6c is a figure confirming the connectivity of CO-MB assembleoids cultured in a hydrogel containing NT3 / GNP through TH marker staining (blue: Hoechst(dsDNA); green: TH) according to one embodiment of the present invention. The scale bar is 100 μm.
[0096] FIG. 6d is a figure showing the results of monitoring the spontaneous electrophysiological activity of assemblioids cultured in a control hydrogel or NT3 / GNP hydrogel using an MEA device according to one embodiment of the present invention.
[0097] FIG. 6e is a figure showing the results of a quantitative analysis of the electrophysiological activity of an assemblyoid cultured in a control hydrogel or an NT3 / GNP hydrogel according to one embodiment of the present invention.
[0098] FIG. 7a is a figure showing the connectivity of GBM-MB assembleroids through TH marker staining according to one embodiment of the present invention.
[0099] FIG. 7b is a figure showing the results of monitoring spontaneous electrophysiological activity in GBM-MB assembleoids in NT3 / GNP hydrogel and bare hydrogel using an MEA device according to one embodiment of the present invention.
[0100] FIG. 7c is a figure showing a quantitative analysis of electrophysiological activity in a bare hydrogel and an NT3 / GNP hydrogel assembleoid according to one embodiment of the present invention.
[0101] FIG. 8a is a figure showing SEM images of a bare electrode (gold electrode) and a nanodot electrode according to one embodiment of the present invention. The scale bar is 1 μm.
[0102] FIGS. 8B and 8C are figures showing the cyclic voltammetry curves and oxidation current peak intensity of a bare electrode and a nanodot electrode to confirm an increase in the redox signal according to one embodiment of the present invention.
[0103] FIG. 8d is a photograph of an assembleoid cultured on a concave PDMS mold with a flexible nanodot electrode attached thereon to improve the contact area with the organoid in a non-invasive manner according to one embodiment of the present invention.
[0104] FIG. 8e is a figure showing the results of electrophysiological signal measurements obtained from a GBM-MB assembled using bare electrodes according to an embodiment of the present invention. The standard error for the average of four measurements is indicated by error bars. * p < 0.05, ** p < 0.01.
[0105] FIG. 8f is a figure showing the results of electrophysiological signal measurements obtained from a GBM-MB assembled using a nanodot electrode according to an embodiment of the present invention. The standard error for the mean of four measurements is indicated by error bars. * p < 0.05, ** p < 0.01.
[0106] FIG. 8g is a figure comparing the results of electrophysiological signal measurements obtained from a GBM-MB assembleloid using a bare electrode or a nanodot electrode according to one embodiment of the present invention. The standard error for the mean of four measurements is indicated by error bars. * p < 0.05, ** p < 0.01.
[0107] FIG. 8h is a figure comparing the results of measuring the electrophysiological signals of GBM-MB assembleoids cultured in an adhesive hydrogel that does not contain or contains NT3 / GNP according to one embodiment of the present invention using a bare electrode or a nanodot electrode.
[0108] FIG. 9a is a schematic image of a method for analyzing electrophysiological signals of a CO-MB assembledoid according to one embodiment of the present invention.
[0109] FIG. 9b is a figure showing a spike raster plot of a CO-MB assembledoid according to one embodiment of the present invention.
[0110] FIG. 9c is a figure showing a spike raster plot of a GBM-MB assembleloid according to one embodiment of the present invention.
[0111] FIG. 9d is a schematic image of a method for analyzing the electrophysiological signal of a GBM-MB assembleoid treated with everolimus drug according to one embodiment of the present invention.
[0112] FIG. 9e is a figure showing a spike raster plot of a GBM-MB assembled equiloid treated with everolimus drug according to one embodiment of the present invention.
[0113] FIG. 9f is a graph evaluating the effect of everolimus on a GBM-MB assembled diagram through quantitative analysis of electrophysiological activity according to an embodiment of the present invention. The standard error for the mean of four measurements is indicated by error bars. * p < 0.05, *** p < 0.001.
[0114]
[0115] The present invention will be explained in more detail below through the following examples. However, these examples are merely illustrative of the invention, and the scope of the invention is not limited by these examples.
[0116] Throughout this specification, "%" used to indicate the concentration of a particular substance is (weight / weight)% for solid / solid, (weight / volume)% for solid / liquid, and (volume / volume)% for liquid / liquid, unless otherwise noted.
[0117]
[0118] Flexible nanodot sensor with NT3 / GNP integrated hydrogel for improving drug evaluation in a glioblastoma-midbrain assembloid model according to the present invention
[0119] As can be seen in FIGS. 1 to 3, the inventors developed a flexible nanodot sensor with an NT3 / GNP integrated hydrogel that improves drug evaluation performance through accurate measurement of electrophysiological signals of each organoid in a glioblastoma-midbrain assembloid (GBM-MB assembloid) model.
[0120] To address the challenge of maintaining adhesion in long-term cultured organoids that tend not to adhere well to each other, the inventors developed an adhesive hydrogel containing gold nanoparticles (GNP) conjugated with neurotrophic factor-3 (NT3).
[0121] NT3, a neurotrophic factor known to enhance neural connectivity, was conjugated to GNP within the hydrogel. The hydrogel design of the present invention provides a transient support matrix that ensures a stable environment for cell interactions. By incorporating a conductive material into the hydrogel, accurate electrophysiological signal analysis regarding tumor behavior and therapeutic interventions was facilitated. As the adhesive hydrogel containing NT3 / GNP hydrolyzed, NT3-modified GNP was gradually released, promoting neurogenesis and strengthening connectivity within the assembleoid. The adhesive hydrogel of the present invention played a key role in successfully fabricating stable and highly connected glioblastoma-midbrain (GBM-MB) assembleoids and effectively overcame the adhesion challenges typically faced by long-term cultured organoids. Furthermore, the inventors designed a flexible nanodot sensor to increase the contact surface area with the assembleoid, thereby enabling the simultaneous measurement of electrophysiological signals from each organoid. The flexible nanodot sensor of the present invention enabled accurate electrophysiological recording in each organoid of the assembly. The nanodot sensor according to the present invention has a flexible structure because gold is deposited and thinly coated onto a thin, flexible polyimide (PI) film.
[0122] In drug screening, specific pharmacological agents must be utilized to evaluate the efficacy of assembleoid models. In this invention, everolimus was selected for the treatment of GBM organoids because it possesses the ability to inhibit the mTOR (mammalian target of rapamycin) pathway, which is activated by deletions of the NF1 (neurofibromin 1) and PTEN (phosphatase and tensin homolog on chromosome 10) genes. By targeting mTOR, everolimus is effective in reducing cell growth and proliferation in these modified GBM models. The efficacy of the sensor was demonstrated by the observation that electrophysiological signals were significantly reduced upon treatment of GBM-MB assembleoids with everolimus. These results indicate that the developed flexible nanodot sensor can be universally applied to various assembleoids. It is expected that utilizing the flexible nanodot sensor of this invention in various assembleoids will aid in evaluating new therapeutic strategies, ultimately paving the way for effective treatments.
[0123]
[0124] Experimental materials
[0125] Miltenyi Biotec's StemMACS TMHuman induced pluripotent stem cells (hiPSCs) were cultured using human, NIP's iMatrix-511 silk, BioGems' Y-27632 dihydrochloride, and Corning's 96-well round-bottom ultra-low adhesion plates to generate embryoid bodies (EBs). Welgene's DMEM-F-12, Neurobasal medium, N2 supplement, B27 supplement (Vitamin A-free), GlutaMAX supplement, and Gibco's penicillin-streptomycin, 2-mercaptoethanol, MEM-NEAA solution, human insulin solution, heparin sodium salt, CHIR99021, Sigma-Aldrich's L-ascorbic acid, SelleckChem's SB431542, human Noggin, human / muline FGF-8b, human GDNF, human / muline / rat BDNF, PeproTech's human SHH (Sonic Hedgehog), BioGems' Dibutyryl-cAMP, and Corning's Matrigel Matrix were used for organoid culture. hiPSC 1383D6 from the RIKEN BRC in Japan was used to generate midbrain organoids, and NIH-CR's 1383D6 and NCRM5AS1 were both used to generate cerebral organoids.
[0126] Bioneer's 1383D6 AccuTool pRGEN-sniper Cas9-CMV / T7 plasmid (ATS-0084), AccuTool sgRNA synthesis (dRGEN: GFP-CMV) plasmid (ATC-0052), Invitrogen's Lipofectamine 3000 transformation reagent, and Gibco's Opti-MEM were used for the transformation to introduce tumor suppressor mutations into hiPSCs.
[0127] Biosesang's 4% paraformaldehyde, Junsei's sucrose, Sakura's Tissue-Tek OCT compound, Sigma-Aldrich's Triton X and bovine serum albumin (BSA), Abcam's anti-SOX2 (ab93689), anti-S100 beta (ab52642), anti-MAP2 (ab32454), anti-TH (Tyrosine Hydroxylase) (ab76442), anti-Rabbit Texas Red (ab6719), anti-Mouse Texas Red (ab6787), anti-Rabbit FITC (ab97050), anti-Chicken FITC (ab6749), Santa Cruz's anti-Ki67 (sc-23900) and anti-PAX6 (sc-81649), and Thermo Scientific's Hoechst 33342 (62249) was used for cryosectioning and immunostaining analysis of organoids.
[0128] CUBIC-1 solution composed of 10% (w / w) urea, 5% (w / w) NNNN-tetrakis(2-HP) ethylenediamine, distilled water, and Triton X-100, and CUBIC-2 solution composed of 10% (w / w) triethanolamine, 50% (w / w) sucrose, distilled water, and 25% (w / w) urea were used for immunofluorescence staining of the assemblies. A Zeiss (Germany) LSM 710 confocal microscope was used to obtain immunostaining images.
[0129] Ambion's TRIzol reagent, Invitrogen's DEPC-treated water, Sigma-Aldrich's ethyl alcohol and chloroform, Wako's isopropyl alcohol, Thermo Scientific's Nanodrop 2000, Bioneer's AccuPower® CycleScript TMRT premix (dT20) and Analytik Jena's FlexCycler2 PCR Thermal Cycler were used for RT-PCR. Bioneer's AccuPower® 2X GreenStar TM qPCR Master Mix and ExiCycler TM 96 was used for RT-PCR.
[0130] Spontaneous neural activity in midbrain, cerebral organoids, and glioblastoma organoids was recorded and analyzed using Axion BioSystems' Multielectrode Array System (Maestro Edge system), Axion Integrated Studio (AxIS 20.4.21), Biocircuit MEA 24 plates, and Neural Metric Tool. Spontaneous neural activity in assembleoids was recorded and analyzed using Intan Technologies' RHS 128-channel stimulation / recording controller and RHS 16-channel stimulation / recording headstage. For drug evaluation, Santa Cruz's Everolimus was used in conjunction with a flexible nanodot electrophysiology sensor.
[0131] A Formlabs SLA (Stereolithography) 3D printer and photocurable resin were used. Polydimethylsiloxane (PDMS) and the curing agent were purchased from Dow Chemical. Polyethylene terephthalate (PET) film (100 μm) and polyimide (PI) tape (55 μm) were used. Au-coated PI-PET substrates (100 nm Au and 20 nm chrome on PI-PET) were custom-made at Gmek. Au and Ag plating solutions were purchased from Alfa Aesar. The photoresist solvent (AZEBR solvent), UV crosslinking photoresist (AZ2020), and developer (AZ 300MIF developer) were purchased from Merck KgaA. Dimethyl sulfoxide (DMSO) was purchased from Corning, and silver nitrate was purchased from DAE JUNG. The equipment used included a JS301 spin coater, a He-Cd laser from Kimmon Koha Laser System, and a CHI 600E potentiostat from CH Instruments, Inc.
[0132] The following materials were used for the synthesis of GNP / NT3: sodium citrate, tannic acid, tetrachloroauric acid, dextran (average molecular weight 1,500,000–2,800,000), sodium periodate, gelatin extracted from porcine skin, BSA, potassium hexacyanoferrate III, potassium hexacyanoferrate II trihydrate, and isoprenaline were purchased from Sigma-Aldrich; potassium carbonate and ethylene glycol were purchased from Daejung; and neurotrophic factor-3 was purchased from Peprotech. Dialysis membranes (Spectra / Por TM3 RC dialysis membrane tubing (3500 Mw cutoff) and a polyethersulfone concentrator (50 kDa molecular cutoff) were purchased from Fisher Scientific. A rotary mixer was provided by Korea Bio-Tech. A CHI 600E potentiostat was used to investigate the electrochemical properties of the adhesive hydrogel incorporating NT3 / GNP.
[0133]
[0134] Example 1: Generation and Characterization of Midbrain, Cerebrum, and Glioblastoma Organoids
[0135] 1-1. Culture of Human Induced Pluripotent Stem Cells
[0136] All cell lines were obtained free from contamination and with confirmed normal karyotypes. Human induced pluripotent stem cells (hiPSCs) were prepared using StemMACS on iMatrix-511 silk-coated plates according to established protocols. TM The medium was maintained at 37°C with 5% CO2. hiPSCs were subcultured every 7 days at 80% confluence. Before subculturing, colonies containing noticeably differentiated cells were identified and physically removed.
[0137]
[0138] 1-2. Method for Manufacturing Midbrain Organoids
[0139] As can be seen in FIGS. 4a and 4b, the inventors generated midbrain organoids (MBs) from human induced pluripotent stem cells (hiPSCs) by applying a self-organizing midbrain-specific organoid protocol derived from previously established principles (see Mohamed, Nguyen-Vi, et al. "Generation of human midbrain organoids from induced pluripotent stem cells." MNI Open Research 3(2021): 1.).
[0140] Briefly, cultured human induced pluripotent stem cells (hiPSCs) (1383D6) were added to 96-wells at a rate of 10,000 cells / mL and cultured in neural induction solution for 4 days, and then cultured in midbrain patterning solution for 3 days. After that, they were wrapped in Matrigel and cultured in tissue induction solution for 1 day, then placed in a shaker in midbrain differentiation solution, and the midbrain differentiation solution was exchanged every 3 days.
[0141] The midbrain organoid (MB) was cultured for several months according to the experimental schedule. During this culture period, the organoid grew in size and reached a diameter of about 1.6 mm 60 days after differentiation.
[0142] The detailed method for constructing midbrain organoids is as follows. Human iPSC (1383D6) is StemMACS TM They were cultured in iMatrix-511 silk-coated culture dishes. For the generation of midbrain organoids, StemMACS was used in ultra-low adhesion round-bottom 96-well plates with 50 μM of ROCK (Rho-associated protein kinase) inhibitor (Y-27632 dihydrochloride). TM 1.0 x 10 per well from the badge 4 Canine cells were cultured to generate embryonic bodies (EB) from hiPSCs for 24 hours.
[0143] The next day, EB was placed in a 60 mm Petri dish and cultured in 1:1 DMEM / F-12:neural basal medium (Thermo Fisher Scientific) with the addition of N2 supplement (1% v / v), vitamin A-free B27 supplement (2% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (1% v / v), a 1:100 dilution of 2-mercaptoethanol in DMEM / F-12 (0.35 μL / ml), heparin 1 μg / ml, SB431542 10 μM, Noggin 200 ng / ml, CHIR99021 0.8 μM, and a ROCK inhibitor 10 μM for neuronal induction.
[0144] On day 2, the medium was replaced with the same medium except that no ROCK inhibitor was added, and the cells were left for another 2 days. On day 4 of culture, EBs were cultured in 1:1 DMEM / F-12:neural basal medium containing N2 supplement (1% v / v), vitamin A-free B27 supplement (2% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (1% v / v), a 1:100 dilution of 2-mercaptoethanol in DMEM / F-12 (0.35 μL / ml), 1 μg / ml heparin, 10 μM SB431542 (SelleckChem), 200 ng / ml Noggin, 0.8 μM CHIR99021, 100 ng / ml SHH, and 100 ng / ml FGF8b (PeproTech) for midbrain patterning.
[0145] On day 7, midbrain organoids were embedded in 3 μL Matrigel droplets and cultured in neural basal medium supplemented with N2 supplement (1% v / v), vitamin A-free B27 supplement (2% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (1% v / v), 1:100 dilution of 2-mercaptoethanol in DMEM / F-12 (0.35 μL / ml), 2.5 μg / ml insulin, 200 ng / ml laminin, 100 ng / ml SHH, 100 ng / ml FGF8b, and penicillin (10 U / ml) to promote tissue growth.
[0146] On day 8, the medium was replaced with neural basal medium supplemented with N2 supplement (1% v / v), vitamin A-free B27 supplement (2% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (1% v / v), a 1:100 dilution of 2-mercaptoethanol in DMEM / F-12 (0.35 μL / ml), 10 ng / ml GDNF, 10 ng / ml BDNF, 100 μM ascorbic acid, 125 μM db-cAMP, and penicillin (10 U / ml). The final differentiation medium was replaced every 2–3 days on an orbital shaker with the plates rotated at 55 rpm.
[0147]
[0148] 1-3. Immunofluorescence Staining Method
[0149] Organoids were fixed in formalin at room temperature for 1 hour, washed with DPBS, and incubated overnight in 30% (w / v) sucrose at 4°C. Then, the organoids were fully mounted in OCT embedding compounds and frozen at -80°C. After sectioning, the sectioned tissues were washed with DPBS to remove excess OCT compounds and incubated at room temperature in 0.2% (v / v) Triton X-100 for 20 minutes and in 2% (w / v) BSA for 1 hour. The sections were incubated overnight at 4°C with the primary antibody in DPBS. After washing three times with DPBS, the sections were incubated at room temperature with the secondary antibody in DPBS for 2 hours. The sections were washed three times with PBS and stained with Hoechst 33342 for 10 minutes. Finally, fluorescence imaging of the sections was performed using a confocal microscope.
[0150]
[0151] 1-4. Midbrain Organoid Immunofluorescence Staining Results
[0152] As can be seen in Figure 4e, immunofluorescence (IF) staining of frozen sections of the day 30 midbrain organoid (MB) revealed the presence of dopaminergic neurons stained with TH (tyrosine hydroxylase) and neurons stained with MAP2 (microtubule-associated protein 2). Additionally, IF staining confirmed that the expression of the neurotransmitter SOX2 (SRY-box transcription factor 2) decreased as differentiation progressed from day 30 to day 60.
[0153]
[0154] 1-5. RNA Isolation and cDNA Synthesis
[0155] The organoids were homogenized with 1 ml of Trizol reagent and 0.2 ml of chloroform. The homogenized organoids were vigorously shaken, incubated on ice for 15 minutes, and centrifuged at 12,000 g for 15 minutes at 4°C. Next, for RNA precipitation, the aqueous phase of the centrifuged mixture was transferred to a new tube and mixed with isopropyl alcohol. The tube was incubated on ice for 10 minutes and centrifuged at 12,000 g for 10 minutes. After centrifugation, the RNA pellet was washed with 70% (v / v) ethanol, dried for 30 minutes, and dissolved in RNase-free water. RNA concentration was measured using a Nanodrop 2000. The extracted RNA was processed according to the manufacturer's instructions using CycleScript. TM RT premix was used as a template for cDNA production.
[0156]
[0157] 1-6. Quantitative RT-PCR Analysis Method
[0158] qPCR was performed on an Exicycler 96 system using the 2X GreenStar PCR Master Mix according to the manufacturer's instructions. Gene expression of all target genes was normalized to the beta-actin (Actin Beta, ACTB) expression levels of each sample. The forward and reverse primers used are listed in Table 1 below.
[0159] 시이번다명치서열(5'-3')1DAT forward primerCATGAGTCCCACGGAGCATT2DAT reverse primerCACCAGGTATGTCCCTAGCC3NURR1 forward primerCTGTGCGCTGCAAAAGGAG4NURR1 reverse primerATCGTAGACCCAGTCACATAAC5LMX1A forward primerCATACCAAGGGCCCACACT6LMX1A reverse primerTGGGGCAAACAAACCCTTCT7SOX2 forward primerAAGGATAAGTACACGCTGCCC8SOX2 reverse primer primerGTTCATGTGCGCGTAACTGT9GFAP forward primerAGGACACTTGAATACCTGCCTC10GFAP reverse primerCTCATCCTCCAGACAAGTCCTC11OLIG2 forward primerGTGTGTT TGCTGCGTGGTG12OLIG2 reverse primerGAGGCTTCGGGCTTTCAGTT13ACTB forward primerATTGGGGACAAAGGAAGCCG14ACTB reverse primerTGTTTGAACCGGGCGGAG
[0160]
[0161] 1-7. RT-PCR analysis results of the central nervous system
[0162] As can be seen in Figures 4f to 4h, the results of qRT-PCR (Quantitative reverse transcription polymerase chain reaction) analysis using the forward and reverse primers listed in Table 1 showed that the expression of midbrain markers such as DAT (dopamine transporter), NURR1 (Nuclear receptor-related factor 1), and LMX1A (LIM Homeobox Transcription Factor 1 Alpha) increased over time to 30 and 60 days of differentiation, confirming the identity of the midbrain organoid (MB). Therefore, it was confirmed that a midbrain organoid containing midbrain dopamine neurons was successfully generated.
[0163]
[0164] 1-8. Method for manufacturing cerebral organoids
[0165] As can be seen in Figures 4a and 4c, cerebral organoids (COs) were generated using self-organizing cerebral-specific organoid technology based on previously established principles (see Hattori, Nobutaka. "Cerebral organoids model human brain development and microcephaly." Movement Disorders 2.29(2014): 185-185).
[0166] Briefly, cultured human induced pluripotent stem cells were added to 96-wells at a density of 10,000 cells / mL and cultured in STEM MAX solution for 6 days, followed by culture in Neural induction solution for 5 days. Then, the cells were wrapped in Matrigel and cultured in a cerebral differentiation solution without Vitamin A for 4 days, after which they were placed in a shaker containing Vitamin A and the cerebral differentiation solution was exchanged every 3 days.
[0167] Similar to midbrain organoids (MB), cerebral organoids (CO) could be cultured for several months according to an experimental schedule and reached a diameter of approximately 1.5 mm after 60 days of differentiation.
[0168] The detailed method for fabricating cerebral organoids is as follows. Human iPSC lines 1383D6 and NCRM5AS1 are StemMACS TM In the medium, iMatrix-511 silk-coated plates were maintained at 37°C and 5% CO2, and fed every two days. Using U-shaped bottom ultra-low adhesion 96-well plates, 10 x 10⁶ hiPSCs per well were used to induce EB. 4 StemMACS supplemented with ROCK inhibitor (50 μM) at cell density TM Seeding was performed with the medium for 24 hours. After 24 hours of seeding, the medium was a new StemMACS without ROCK inhibitors. TM Replaced with a badge.
[0169] On day 6, EB was transferred to a 24-well ultra-low adhesion plate, and DMEM / F-12 supplemented with N2 supplement (1% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (1% v / v), and heparin (1 μg / ml) was used as the medium every 2 days to form neuroepithelial tissue. On day 11, EB was embedded in a 60 mm dish using Matrigel droplets (2.5 μl). Then, a medium consisting of 1:1 DMEM / F-12:neural basal medium supplemented with N2 supplement (0.5% v / v), vitamin A-free B-27 supplement (1% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (0.5% v / v), insulin (2.5 μg / ml), penicillin (10 U / ml), and insulin (2.5 μg / ml) was added. The plates containing the inserted tissues were shaken at 60 revolutions per minute (rpm) on day 15 using an orbital shaker installed in a CO2 incubator. Every 4 days, the medium was replaced with 1:1 DMEM / F-12:neural basal medium supplemented with N2 (0.5% v / v), vitamin A-free B-27 supplement (1% v / v), GlutaMAX (1% v / v), MEM-NEAA solution (0.5% v / v), insulin 2.5 μg / ml, and a 1:100 dilution of 2-mercaptoethanol in DMEM-F12 (0.35 μl / ml).
[0170] On day 11, EB was embedded in a 60 mm dish using Matrigel drops (2.5 μl), and 1:1 DMEM / F-12:neural basal medium supplemented with N2 supplement (0.5% v / v), vitamin A-free B-27 supplement (1% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (0.5% v / v), insulin (2.5 μg / ml), a 1:100 dilution of 2-mercaptoethanol in DMEM-F12 (0.35 μl / ml), and penicillin (10 U / ml) was added to the medium.
[0171] On day 15, the plate containing the embedded tissue was placed on an orbital shaker installed in a CO2 incubator and shaken at 60 rpm. The medium was replaced every 4 days with 1:1 DMEM / F-12:neural basal medium supplemented with N2 supplement (0.5% v / v), B-27 supplement containing vitamin A (1% v / v), GlutaMAX supplement (1% v / v), MEM-NEAA solution (0.5% v / v), insulin (2.5 μg / ml), a 1:100 dilution of 2-mercaptoethanol in DMEM-F12 (0.35 μl / ml), penicillin (10 U / ml), and streptomycin (10 μg / ml).
[0172]
[0173] 1-9. Method for preparing glioblastoma organoids
[0174] As can be seen in Figures 4a and 4d, for glioblastoma organoids (GBMs), glioblastoma hiPSCs were generated by transforming hiPSCs with a CRISPR / Cas9 and GFP-tagged plasmid containing gRNAs targeting the tumor suppressor genes NF1 (neurofibromin 1) and PTEN10 (phosphatase and tensin homolog on chromosome 10). The human NF1-specific gRNA sequences and human PTEN10-specific gRNA sequences are shown in Table 2 below. After transformation, GFP-expressing cells were sorted using FACS, and glioblastoma organoids (GBMs) were generated using a cerebral organoid (CO) production protocol. The glioblastoma organoids also grew larger, reaching a diameter of approximately 1.6 mm after 60 days of differentiation. Sanger sequencing confirmed frame shifts of the NF1 and PTEN genes, indicating successful plasmid transport and target genome modification (see Fig. 4d(c)).
[0175] SEQ ID NO NAME SEQUENCE (5'-3')15NF1 gRNA sequenceCTCGTCGAAGGCGGCTGACCACGG16PTEN10 gRNA sequenceGAACTTGTCT TCCCGTCGTGTGG
[0176]
[0177] The detailed method for constructing GBM organoids is as follows. Cells were seeded into 6-well plates at a density of 70–90%. The preparation of plasmid DNA-lipid complexes was performed in accordance with the manufacturer's instructions. Using 250 μl of Opti-MEM medium per well, 7.5 μl of Lipofectamine 3000 reagent, 5 μl of P3000 reagent, and 2.5 mg of plasmid DNA (Cas9 and sgRNA plasmids) were mixed. The mixture was then incubated for 15 minutes and applied to the cells. After 2 days, the transfected cells were trypsinized, and the GBM organoids were cultured as described above. The CRISPR target sequences are as shown in Table 2 above. After transfection, GFP + Cells were classified using FACS (Biosciences), and genomic DNA was isolated using a genomic DNA extraction kit according to the manufacturer's instructions. For genotyping analysis, RT-PCR and Sanger sequencing were performed using Bioneer's Sanger sequencing service. In Table 3 below, primers for PCR amplification are shown as SEQ ID NOs 17 to 20, and primers for Sanger sequencing are shown as SEQ ID NOs 21 to 24. Then, glioblastoma organoids were produced using the cerebral organoid generation protocol described above.
[0178] SEQ ID NO: Name Sequence (5'-3') 17NF1 forward primerGAACACTGGGAGCCTGCA18NF1reverse primerTCCCCTCACCTACTCTGTCC19PTEN forward primerCCTCAGTTTGTGGTCTGCC20PTEN reverse primerCATGTTACAATGCCATAAGGCC21NF1 forward primerATGTCACCACAAACAGAAAC22NF1 reverse primerTCGCATGTACCTGCA GTAGC23PTEN forward primerGATTTGCTTGAGATCAAGATTGCAG24PTEN reverse primerAGAAAAGTGGTTTGTGTCACTACA
[0179]
[0180] 1-10. Immunofluorescence staining results of cerebral and glioblastoma organoids
[0181] To confirm the proper differentiation of glioblastoma organoids (GBMs), 60-day-old GBMs were compared with cerebral organoids (COs). GBMs are characterized by the dominance of glial cells and various forms of high-grade astrocytomas. The glial cell marker S100B (S100 calcium-binding protein B) and the cell proliferation marker Ki67 (Antigen Kiel 67) are used for the diagnosis of GBM.
[0182] As can be seen in Figure 4e, immunofluorescence staining confirmed that S100B and Ki67 markers are expressed at significantly higher levels in glioblastoma organoids (GBM) compared to cerebral organoids (CO).
[0183]
[0184] 1-11. Results of Quantitative RT-PCR Analysis of Cerebral and Glioblastoma Organoids
[0185] In addition, as can be seen in Figures 4i to 4k, qRT-PCR was performed on GBM neural stem cell markers SOX2 and OLIG2 (Oligodendrocyte transcription factor) and glial cell marker GFAP (Glial fibrillary acidic protein) using the forward and reverse primers listed in Table 1, and as a result, it was found that the expression levels of these markers were significantly higher in glioblastoma organoids (GBM) compared to cerebral organoids (CO).
[0186]
[0187] 1-12. Electrophysiological Signal Analysis Methods for Cerebral and Glioblastoma Organoids
[0188] Spontaneous electrophysiological activity of organoids was recorded using a multielectrode array (MEA). Each organoid was placed on a Biocircuit MEA 24 plate (Axion BioSystems, USA) equipped with 16 gold electrodes, and spontaneous electrophysiological signals were recorded for up to 10 minutes at a sampling frequency of 12.5 kHz. Using Axion Integrated Studio (AxIS 20.4.21), a Butterworth bandpass filter with a threshold of 6x standard deviation (SD) was set, and cutoff frequencies were set between 200 Hz and 3000 Hz to minimize false-positive signals. Spontaneous electrophysiological signals from neurons were analyzed using NeuroMetricTool.
[0189]
[0190] 1-13. Results of Electrophysiological Signal Analysis of Cerebral and Glioblastoma Organoids
[0191] Next, electrophysiological activity was analyzed using an MEA system to investigate whether the organoids form neural networks connected to functionally active neurons. The analysis was performed on 60-day-old cerebral organoids and glioblastoma organoids.
[0192] As can be seen in Fig. 4l, it was observed that more electrophysiological signals were measured in glioblastoma organoids compared to cerebral organoids. This indicates tumor-related interictal activity and shows more and abnormal signals compared to cerebral organoids.
[0193] The combined results of the above immunohistochemistry, qRT-PCR, and electrophysiological signals demonstrate that midbrain, cerebral, and glioblastoma organoids were successfully generated and characterized.
[0194]
[0195] Example 2: Method for preparing an adhesive hydrogel containing NT3 / GNP and results of characterization analysis thereof
[0196] 2-1. Method for manufacturing NT3 / GNP adhesive hydrogel
[0197] As can be seen in Figures 5a and 5b, an adhesive hydrogel containing NT3-conjugated GNP was prepared to effectively develop an assembleoid. The adhesive hydrogel is a water-soluble, self-degrading hydrogel that exhibits adhesion in an aqueous solution containing dextranaldehyde, gelatin, and an NT3 / GNP complex, and was designed to function as a temporary support when connecting two organoids. To enhance connectivity between organoids, neurotrophic proteins were attached to gold nanoparticles (GNP) of 11 to 13 mm, e.g., 12 nm, which can be delivered into the organoids. By improving conductivity through the nanoparticles, more signals were measured during electrophysiological signal analysis.
[0198] First, dextranaldehyde was synthesized according to a previously reported protocol (see Brunueel, Dorine, and Etienne Schacht. "Chemical modification of pullulan: 1. Periodate oxidation." Polymer 34.12(1993): 2628-2632.). Subsequently, 12.5 nm GNPs were synthesized according to a previously reported protocol, and their size and morphology were confirmed using a transmission electron microscope (TEM) (see Piella, Jordi, Neus G. Bastus, and Victor Puntes. "Size-Controlled Synthesis of Sub-10-nanometer Citrate-Stabilized Gold Nanoparticles and Related Optical Properties." Chemistry of Materials 28.4(2016): 1066-1075.).
[0199] Briefly, 50 μL of NT3 (1.25 ng / ml in 1% BSA) was added to 950 μL of GNP solution (0.4 M, 2 M, or 4 M) in an EP tube, and NT3 was conjugated to the surface of GNP under tube shaker conditions in a 4°C refrigerator for 12 hours. The NT3-conjugated GNP contained in 10 wt% dextran aldehyde and 0.01 M PBS was mixed, and then 10 wt% gelatin was added to prepare an NT3 / GNP-containing adhesive hydrogel through a Schiff base formation reaction.
[0200] The detailed method for preparing the adhesive hydrogel containing NT3 / GNP is as follows. A reducing solution for preparing 3.5 nm Au seeds was prepared by mixing sodium citrate (2.2 mM), tannic acid (0.1 ml, 2.5 mM), and potassium carbonate (1 ml, 150 mM) with 150 ml of water. This solution was vigorously shaken in a 250 ml three-necked flask at 70°C, after which 1 ml of 25 mM tetrachloroauric acid was injected. After 5 minutes at 70°C, approximately 7 x 10⁶ 13 Approximately 3.5 nm Au seeds with a concentration of NP / ml were produced. Then, 55 ml of the solution was removed and 55 ml of sodium citrate (2.2 mM) was added. After the temperature returned to 70°C, tetrachloroauric acid (0.5 ml, 25 mM) was injected twice at 10-minute intervals, and this dilution and injection process was performed 11 times.
[0201] NT3 / GNP was prepared as follows. 950 μL of GNP (0.4 M) was incubated with 50 μL of NT3 (1.25 ng / ml) and dissolved in autoclaved, deionized water supplemented with 1% BSA, then shaken overnight in a tube shaker at 4°C. Afterward, excess unbound NT3 in the GNP and NT3 combination was carefully removed three times using a polyethersulfone concentrator. NT3 / GNP was stored at 4°C prior to characterization and use. The synthesis of NT3 / GNP was verified by investigating the zeta potential using UV-vis spectroscopy and dynamic light scattering (Zetasizer Ultra Red Label, Malvern Panalytical, Malvern, UK).
[0202] Dextran was chemically oxidized to produce dextranaldehyde. A 2 g dextran solution was prepared with 200 ml of deionized water. Separately, 1.07 g of NaIO4 was dissolved in 8 ml of deionized water, and then the mixture was vigorously stirred with a magnetic rod while adding it dropwise to the dextran solution. The mixture was continuously stirred at 25°C in the dark for 2 hours. The process was stopped by adding 0.278 ml of ethylene glycol to the mixture. The mixture was incubated with stirring for an additional 1 hour. After dialyzing the oxidized dextran against deionized water using a dialysis membrane (3500 Mw cutoff) for 3 days, the dextran was freeze-dried. First, a dextran aldehyde solution containing NT3 / GNP was prepared in a tube by mixing dextran aldehyde (10 wt%) and NT3 / GNP (0, 0.4, 2, 4 M) in 0.01 M PBS. A 10% gelatin solution was prepared in PBS in a separate tube. The gelatin solution and the dextran aldehyde solution containing NT3 / GNP were combined, and the mixture was incubated for 30 minutes at 37°C with 5% CO2 and humidity control.
[0203]
[0204] 2-2. Confirmation of Successful Synthesis and Functionalization of GNP / NT3
[0205] The successful synthesis of GNP and NT3 functionalization were confirmed through UV-vis spectroscopy and dynamic light scattering analysis according to a previously reported protocol (see Di Pietro, Patrizia, et al. "Immobilization of neurotrophin peptides on gold nanoparticles by direct and lipid-mediated interaction: a new multipotential therapeutic nanoplatform for CNS disorders." ACS omega 2.8(2017): 4071-4079). UV-vis spectroscopy confirmed the synthesis of GNP by exhibiting a characteristic absorption peak corresponding to the plasmon resonance of GNP. The functionalization of GNP using NT3 was confirmed through a shift in the absorption spectrum, indicating that NT3 was successfully bound to the nanoparticle surface.
[0206] As can be seen in Fig. 5c, the attachment of NT3, a highly negatively charged protein, may have changed the surface charge density of GNP, causing a significant shift in the zeta potential.
[0207]
[0208] 2-3. Method for Verifying Electrochemical Properties - Method for Verifying Nanodots and Bare Electrodes
[0209] Cyclic voltammetry (CV) was performed using a potentiostat with 10 mM potassium hexacyanoferrate(II) and 10 mM potassium hexacyanoferrate(III). The fabricated electrode was used as the working electrode, a platinum wire as the counter electrode, and an Ag / AgCl (1 M KCl) electrode as the reference electrode. For CV analysis, a 10 mM potassium ferricyanide solution was placed in a fabricated PDMS concave mold. The scan rate was 0.1 V / s and the scan range was -0.2 to 0.6 V.
[0210]
[0211] 2-4. Method for Verifying Electrochemical Properties - Method for Verifying Hydrogels
[0212] Cyclic voltammetry (CV) was performed using a potentiostat with 10 mM potassium hexacyanoferrate(II) and 10 mM potassium hexacyanoferrate(III). A cylindrical mold was attached to an ITO substrate and a hydrogel (20 μL) was placed on top to serve as the working electrode, a platinum wire was used as the counter electrode, and an Ag / AgCl (1 M KCl) electrode was used as the reference electrode. For CV analysis, a 10 mM potassium ferricyanide solution (80 μL) was placed in the fabricated cylindrical mold. The scan rate was 0.1 V / s and the scan range was -0.2 to 0.6 V.
[0213] Electrochemical impedance spectroscopy (EIS) in the above environment with an initial potential of 0.31 V, 10 5 It was conducted with a high frequency of Hz, a low frequency of 0.1 Hz, an amplitude of 0.01 V, and a quiet time of 2 seconds.
[0214]
[0215] 2-5. Results of Electrochemical Characteristics Verification of NT3 / GNP Adhesive Hydrogel
[0216] Considering the importance of electrochemical properties in measuring electrophysiological signals, various adhesive hydrogels were characterized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS).
[0217] As can be seen in Figure 5d, the adhesive hydrogel with a 2M GNP content had 1.78 times higher electrical conductivity and 1.93 times lower resistance compared to the hydrogel without GNP. Although conductivity increased with increasing GNP content in the adhesive hydrogel, no significant difference was observed between the conductivity of the hydrogels with 2M and 4M GNP content.
[0218] In addition, as can be seen in Figure 5e, EIS indicated that the adhesive hydrogel with a high GNP content had a lower impedance value than the adhesive hydrogel with a low GNP content.
[0219] Overall, it was found that the insertion of GNP improved the electrical and electrochemical properties of the adhesive hydrogel. These results suggest that GNP-inserted adhesive hydrogels can facilitate electrical connections in assembleoids. Since the adhesive hydrogel with a 2M GNP content was found to be the most suitable because it provided the highest electrical and electrochemical properties, it was used in subsequent experiments.
[0220]
[0221] 2-6. Biocompatibility Analysis Results of NT3 / GNP Adhesive Hydrogel
[0222] In addition, as can be seen in Figure 5f, when organoids were exposed to a live / dead test staining solution (Live / Dead Cell test Kit, Abcam, ab115347) for 10 minutes and observed using a Zeiss LSM 710 confocal microscope, the biocompatibility of the adhesive hydrogel containing NT3 / GNP was confirmed through live / dead staining, and both the hydrogel containing NT3 / GNP (NT3 / GNP hydrogel) and the adhesive hydrogel without NT3 / GNP (bare hydrogel) were found to have high biocompatibility.
[0223]
[0224] Example 3: Method for manufacturing CO-MB assembleoid and verification of connectivity
[0225] 3-1. Method for manufacturing a concave PDMS mold
[0226] As can be seen in Fig. 6a, a glioblastoma-midbrain assembleoid was fabricated on a concave PDMS (Polydimethylsiloxane) mold. The concave PDMS (Polydimethylsiloxane) mold was designed using 3D MAX and fabricated using a stereolithography (SLA) printer with a photocurable resin (Formlabs, USA). PDMS (SYLGARD 184, Dow Chemical, USA) and a curing agent (Dow Chemical, USA) were mixed in a weight ratio of 10:1, poured into the mold, and cured at 70°C for at least 8 hours before being removed from the mold. The mold prepared for the assembleoid was washed with ethanol and distilled water.
[0227]
[0228] 3-2. Method for manufacturing CO-MB assembleoid
[0229] To verify the neural connectivity of the assembleoid, a cerebral organoid was formed using hiPSC NCRM5AS1 cells and then connected to a midbrain organoid to form a cerebrum-midbrain (CO-MB) assembleoid.
[0230] Briefly, two cerebral and midbrain organoids cultured for two months were placed together on a concave PDMS mold, and the remaining solution was removed. Then, 10 μL of the adhesive hydrogel according to the present invention was added and incubated for 30 minutes at 37°C in an environment with 5% CO2 and humidity to solidify, and a solution of cerebral and midbrain media mixed in a 1:1 ratio was added and incubated for 1 to 2 weeks.
[0231]
[0232] 3-3. Tissue Clearing and Immunofluorescence Staining Methods in CO-MB Assembloids
[0233] CUBIC (Clear, Unobstructed Brain Imaging Cocktail) was used for clearing staining. The assembleoids were fixed in 4% paraformaldehyde overnight at 4°C and washed with DPBS. They were then placed in CUBIC-1 solution (10% Triton X-100, 5% (w / w) N,N,N',N'-tetrakis(2-hydroxypropyl)ethylenediamine, 10% (w / w) urea, and 75 mL distilled water) and incubated in a shaker at room temperature for 3 days. Subsequently, the organoids were washed three times with DPBS. After the clearing process, the primary antibody was reacted in a shaker at room temperature (25°C) for 3 days. Then, the organoids were washed three times with DPBS and the secondary antibody was reacted in a shaker at room temperature for 2 days. After washing three times with PBS, the nuclei of the organoids were stained with Hoechst 33342 (3 μg / ml) for 5 minutes. Then, the organoids were placed in CUBIC-2 solution (25% (w / w) urea, 50% (w / w) sucrose, 10% (w / w) triethanolamine, and 15 mL of distilled water), and after 24 hours, fluorescence imaging of the samples was finally performed using a Zeiss LSM 710 confocal microscope.
[0234]
[0235] 3-4. Confirmation of Excellent Connectivity of CO-MB Assembloids - Immunofluorescence Staining Results
[0236] Connectivity between the two organoids in the cerebrum-midbrain assembleoid was verified using confocal microscopy through GFP expression.
[0237] As can be seen in Figure 6b, in particular, comparative observations at both 7 and 14 days showed that the assembled pods using a hydrogel containing NT3 / GNP exhibited the highest GFP expression on the 14th day, indicating superior connectivity compared to assembled pods using a hydrogel without GNP.
[0238] As can be seen in Figure 6c, connectivity was confirmed by detecting the expression of TH (Tyrosine Hydroxylase) using immunofluorescence staining. Blue fluorescence indicates Hoechst staining, and green fluorescence indicates TH expression. Effective connectivity was observed 2 weeks after linkage. In particular, the assembleoids treated with the NT3 / GNP hydrogel at 2 weeks showed the highest TH expression, emphasizing that the NT3 / GNP hydrogel has a significant effect on promoting dopaminergic neuronal differentiation.
[0239]
[0240] 3-5. Verification of Excellent Connectivity of CO-MB Assembloids - Electrophysiological Signal Measurement
[0241] Electrophysiological signals were measured using an MEA platform to verify the neural connectivity of the assembleroid. The fabricated assembleroid was placed on an MEA substrate, and the signals were measured.
[0242] Electrophysiological recordings of the assembleoid were obtained using an acute RHS 16-channel stimulation / recording headstage attached to an Intan RHS 128-channel stimulation / recording controller (Intan Technologies). Analysis was performed using a custom Python program. Band-pass filtering was initially applied to raw recordings between 300 and 3000 Hz. Spikes in the filtered signal were identified using an amplitude threshold set to five times the standard deviation determined for each electrode based on the noise level.
[0243] As can be seen in Figures 6d and 6e, the assembleloids using the NT3 / GNP hydrogel were observed to emit more than twice the signal compared to the control group. In addition, electrophysiological signal analysis revealed that the assembleloids using the NT3 / GNP adhesive hydrogel exhibited twice as much electrophysiological signal compared to the assembleloids using a bare hydrogel that did not contain NT3 / GNP.
[0244]
[0245] Example 4: Method for manufacturing GBM-MB assembleoid and verification of connectivity
[0246] 4-1. Method for manufacturing GBM-MB assembleoid
[0247] Glioblastoma organoids and midbrain organoids were formed separately, and then the glioblastoma organoids and midbrain organoids were connected to form a glioblastoma-midbrain (GBM-MB) assembleoid.
[0248] Briefly, two glioblastoma and midbrain organoids cultured for two months were placed together on a concave PDMS mold, and the remaining solution was removed. Then, 10 μL of the adhesive hydrogel according to the present invention was added and incubated for 30 minutes at 37°C in a humid environment with 5% CO2 to solidify, and a solution of glioblastoma and midbrain media mixed in a 1:1 ratio was added and cultured for 1 to 2 weeks.
[0249] More specifically, an adhesive hydrogel containing NT3 / GNP according to the present invention was used to generate glioblastoma-midbrain (GBM-MB) assembloids. First, a midbrain organoid was placed in a PDMS mold. Second, a glioblastoma organoid was placed to the right of the midbrain organoid. After transfer, the residual medium surrounding the organoids was completely removed to ensure that each organoid was properly positioned. After about 2 minutes, 10 μL of the adhesive hydrogel containing NT3 / GNP according to the present invention was applied to the assembloid, and then incubated for 30 minutes at 37°C with 5% CO2 and humidity controlled. The assembloids were cultured in a 12-well plate containing culture medium for 7 days. During this process, the adhesive hydrogel containing NT3 / GNP according to the present invention acted as a temporary scaffold and gradually degraded over time, releasing NT3 / GNP.
[0250]
[0251] 4-2. Confirmation of Excellent Connectivity of GBM-MB Assemblioids - Immunostaining
[0252] As can be seen in Figure 7a, connectivity was confirmed by detecting TH expression using immunofluorescence staining, and effective connectivity was observed at both 1 and 2 weeks after connection. Therefore, it was confirmed that the glioblastoma-midbrain assembleoid exhibited excellent connectivity in an adhesive hydrogel containing NT3 / GNP.
[0253]
[0254] 4-3. Confirmation of Excellent Connectivity of GBM-MB Assembloids - Electrophysiological Signals
[0255] As can be seen in Figures 7b and 7c, electrophysiological signals were measured using an MEA platform to verify the neural connectivity of the assembleloids, and it was observed that the assembleloids using NT3 / GNP hydrogel emitted more than twice the signal compared to the assembleloids using bare hydrogel.
[0256]
[0257] 4-4. Confirmation of Biocompatibility of Adhesive Hydrogel Containing NT3 / GNP in GBM-MB Assembloid
[0258] As can be seen in Figure 5f, the biocompatibility of the adhesive hydrogel containing NT3 / GNP was confirmed using Live / Dead staining, and high biocompatibility was observed for both the hydrogel containing GNP / NT3 and the bare adhesive hydrogel.
[0259]
[0260] Example 5: Method for manufacturing a flexible nanodot sensor
[0261] 5-1. Fabrication of Photoresist (PR) Patterns
[0262] A PI-PET substrate was made using a polyethylene terephthalate (PET) film (100 μm) and a polyimide (PI) tape (55 μm), and an Au-coated PI-PET substrate made of Au (100 nm) and chromium (20 nm) was custom-made at Gmek (Korea) on the PI-PET substrate.
[0263] A gold (Au) coated PI-PET substrate was washed with 1% Triton X-100 under sonication for 10 minutes, followed by washing with ethanol and DIW under sonication for 10 minutes in sequence. After drying the Au-coated PI-PET substrate with N2 gas, a diluted PR solution was applied to the substrate via spin-coating. The PR solution was prepared by mixing the PR solvent at a ratio of 1:0.8. The spin-coating process was performed using a spin-coater at a speed of 4,000 rpm for 20 seconds. The PR spin-coated substrate was pre-baked on a hot plate at 95°C for 60 seconds and then exposed to UV light (λ = 325 nm, 1.0 mW) using a He-Cd laser light source. Simultaneously, a periodic intensity profile of the light emitted from the light source was generated using a Lloyd's mirror interferometer. This resulted in the formation of a regular pattern on the substrate through a combination of direct incoming light and light reflected from a Lloyd mirror. To form a PR pattern with a pitch of 1,000 nm, the angle of incidence was set to 144.35°. To create a grid PR pattern, the PR spin-coated substrate underwent a UV light exposure process twice. After the first exposure, the substrate was rotated 90° and exposed again for 10 seconds each time. Then, the UV-exposed PR substrate underwent a post-baking step at 105°C for 60 seconds to cure the UV-exposed PR areas. The unexposed portions of the PR substrate were removed by immersing the substrate in a developer solution for 45 seconds. Finally, a PR pattern consisting of 500 nm holes was successfully fabricated on an Au-coated PI-PET substrate.
[0264]
[0265] 5-2. Gold Deposition Method
[0266] A 3D printed hole chamber was attached to a grid PR pattern substrate using PDMS. The electrochemical deposition process was performed on the substrate using a conventional three-electrode system. This system consists of a platinum wire electrode as the counter electrode, a silver / silver chloride (Ag / AgCl) double-junction electrode as the reference electrode, and a grid PR pattern substrate as the working electrode. First, the electrochemical deposition of Au was performed in multiple potential steps using a CHI600E potentiostat workstation at an applied potential of -0.95 V. The parameters used included a sample interval of 0.1 seconds, a quiet time of 2 seconds, and 1.0 x 10⁻¹⁰ -4 A sensitivity of (A / V) was included. This deposition formed a metal bottom region composed of Au. Next, Au was electrochemically deposited for a total of 50 seconds. The parameters for this step were similar to the previous step, with an applied potential of -0.95 V, a sample interval of 0.1 seconds, a quiet time of 2 seconds, and 1.0 x 10⁻¹⁰ -2 It had a sensitivity of (A / V). This deposition formed a chessboard-like Au nanodot pattern. Then, the substrate was treated with dimethyl sulfoxide (DMSO) to remove the PR pattern. Finally, Au nanopatterned dots were fabricated on an Au-coated PI-PET substrate. The prepared Au nanopatterned dots were stored in ethanol until the next experiment. For the bare electrode (gold electrode) not containing gold nanopatterned dots, an Au-coated PI-PET film was used.
[0267]
[0268] 5-3. Electrochemical Properties of Gold Nanodot Electrodes
[0269] To increase the contact area with the assembleoid, a nanodot-patterned electrode was fabricated as described in Examples 5-1 and 5-2 above. One strategy for amplifying electrochemical signals is to increase the surface area. Due to the limitations of conventional 2D sensors in measuring organoids, a nanodot-patterned electrode was developed to increase the contact area with the assembleoid. Applying a concave nanodot sensor significantly improves the contact area with the organoid, enhancing signal detection and enabling the collection of more reliable data. Although a bare electrode (gold electrode) was also fabricated to be concave to maximize contact, the nanodot-patterned electrode showed improved performance due to its increased surface area. Therefore, a nanodot-patterned electrode was fabricated, and its electrochemical properties were compared with those of the bare electrode.
[0270] The bare electrode (gold electrode) was composed of gold (Au)-coated polyimide (PI) and polyethylene terephthalate (PET) films without additional processing, whereas the nanodot electrode was fabricated using laser interference lithography (LIL) and then Au was deposited on the bare electrode.
[0271] As can be seen in Fig. 8a, unlike the bare electrode (gold electrode), it was confirmed through SEM image analysis that nanodots were formed on the nanodot electrode. The size of the nanodots can be 800 to 850 nm, and preferably 800 to 833 nm. As can be seen in Figs. 8b and 8c, the CV results at 0.05 V indicated that the nanodot patterned electrode generated a significantly higher redox signal (430 ± 0.69 μA) compared to the bare electrode (35.5 ± 0.055 μA). These results suggest that the flexible nanodot electrode effectively increased the surface area, thereby improving the electrochemical properties of the electrode.
[0272]
[0273] 5-4. Electrophysiological Signal Analysis Methods
[0274] The spontaneous electrophysiological activity of the organoids was recorded using an MEA. Each organoid was placed on a Biocircuit MEA 24 plate (Axion BioSystems, USA) equipped with 16 gold electrodes, and spontaneous electrophysiological signals were recorded for up to 10 minutes at a sampling frequency of 12.5 kHz. Using Axion Integrated Studio (AxIS 20.4.21), a Butterworth bandpass filter with a threshold of 6x standard deviation (SD) was set, and cutoff frequencies were set between 200 Hz and 3000 Hz to minimize false-positive signals. The spontaneous electrophysiological signals of the neurons were analyzed using NeuroMetricTool.
[0275]
[0276] 5-5. Method for Attaching Gold Nanodot Electrodes to PDMS Mold
[0277] As can be seen in Fig. 8d, the Au nanodot film was uniformly cut to a size of 0.25 cm x 2 cm. The Au nanodot-coated PI-PET film was separated from the polyethylene terephthalate (PET) film and attached to a PDMS concave mold. The concave 3D nanodot electrode was rinsed twice with deionized water and ethanol for 3 minutes each, and then completely dried with N2 gas. The modified electrode was stored at room temperature.
[0278]
[0279] 5-6. Electrophysiological signal results measured in a GBM-MB assembled using a gold nanodot sensor
[0280] As can be seen in Fig. 8d, a flexible nanodot electrode was attached to a concave PDMS mold to improve the contact area with the organoid in a non-invasive manner, and then electrophysiological signals were measured in a 60-day-old midbrain organoid to perform a comparative analysis of the bare electrode and the nanodot electrode.
[0281] As can be seen in Figures 8e and 8f, electrophysiological signal measurements obtained from GBM-MB assembleoids using nanodot electrodes showed signal intensity approximately twice as high as that recorded with bare electrodes. These results demonstrate that nanodot electrodes improve the performance of capturing signals in specific regions of GBM-MB assembleoids, enabling simultaneous measurements in individual organoids. As can be seen in Figure 8g, the summarized results are displayed as a bar graph.
[0282] As can be seen in Fig. 8h, i) electrophysiological signals obtained using a nanodot electrode in GBM-MB assembleoids cultured in a bare hydrogel without NT3 / GNP, ii) electrophysiological signals obtained using a bare electrode in GBM-MB assembleoids cultured in an adhesive hydrogel containing NT3 / GNP, and iii) electrophysiological signals obtained using a nanodot electrode in GBM-MB assembleoids cultured in an adhesive hydrogel containing NT3 / GNP were compared and analyzed. In case i), the electrophysiological signals measured in GBM were small and few in number, so an average value could not be calculated, and in cases i) and iii), the intensity of the electrophysiological signals measured in MB was similar.
[0283] When comparing the electrophysiological signals of the GBM in the three cases, it was confirmed that a significantly increased electrophysiological signal of the GBM was measured in case iii) compared to cases i) and ii) (see Fig. 8h).
[0284] From the above results, the inventors confirmed that only by using both an adhesive hydrogel containing NT3 / GNP and a nanodot electrode can significantly enhanced electrophysiological signals be obtained in GBM-MB assembleoids, particularly in GBM organoids of assembleoids.
[0285]
[0286] Example 6: Drug evaluation function of a nanodot sensor by electrophysiological signal measurement in an assembleoid
[0287] The electrophysiological signals of the fabricated assembleroids were measured using the developed flexible nanodot sensor. As shown in Fig. 9a, the CO-MB assembleroid was first placed on the flexible nanodot sensor to measure the electrophysiological signals. This design allowed for the targeting and localized measurement of electrophysiological signals in specific regions corresponding to each organoid within the assembleroid, enabling a more accurate evaluation of organoid interactions and responses. Observation of the characteristic waveforms of the action potentials revealed that the spike amplitudes generally ranged from 30 to 100 μV. As shown in Figs. 9b and 9c, the spikes observed in the GBM-MB assembleroids exhibited 20 to 30 times more signals compared to the CO-MB assembleroids.
[0288] As can be seen in Fig. 9d, to evaluate the glioblastoma treatment drug, the electrophysiological signal of GBM-MB assembleoids treated with everolimus (0.1 μM) for one week was measured using a flexible nanodot sensor. The assembleoids were placed on the nanodot electrode for examination after a culture period of 7 days. All experiments were repeated three times at a temperature of 25°C. As can be seen in Fig. 9e, a decrease in signal was observed in both glioblastoma and midbrain organoids due to drug treatment.
[0289] As can be seen in Figure 9f, the signal of glioblastoma organoids (GMB) after treatment with 10 μM everolimus was reduced by up to 2.46 times compared to the untreated signal.
[0290] In conclusion, a flexible nanodot sensor comprising a GBM-MB assembleoid cultured in an NT3 / GNP-containing hydrogel and a flexible nanodot electrode successfully evaluated glioblastoma treatment drugs. This indicates that the developed flexible nanodot sensor can be utilized as a drug evaluation platform.
[0291]
[0292] Sintering
[0293] In the present invention, the inventors successfully synthesized an adhesive hydrogel containing NT3 / GNP to produce GBM-MB assembleoids with enhanced neural connectivity and electrical properties. The developed adhesive hydrogel was confirmed to possess excellent conductivity and biocompatibility through various analyses, including UV-vis spectroscopy, dynamic light scattering, CV, and EIS. These results demonstrate that the inclusion of GNP significantly improves the electrical and electrochemical properties of the hydrogel. GBM-MB assembleoids exhibited significantly more electrophysiological signals on the MEA platform compared to CO-MB assembleoids, indicating improved neural network connectivity. The successful connectivity of the assembleoids was confirmed through GFP expression and immunofluorescence staining. Live / Dead staining also verified the high biocompatibility of the hydrogel containing NT3 / GNP, making it a suitable candidate for neural tissue engineering and disease modeling applications. Electrophysiological signals were measured in each organoid of the assembleoids using a flexible nanodot sensor according to the present invention. When GBM-MB assembleoids were treated with everolimus (1, 10 μM) for one week, the signal was significantly reduced, demonstrating the effectiveness of the sensor and the potential of the hydrogel containing NT3 / GNP as a drug evaluation platform. Overall, the adhesive hydrogel containing NT3 / GNP provides a promising method for connecting 3D cell tissues and advancing therapeutic strategies for neuroregeneration and neurological disorders. The flexible nanodot sensor according to the present invention is valuable for both basic research and therapeutic applications in brain tissue engineering due to its enhanced electrical properties and biocompatibility.
Claims
1. An adhesive hydrogel for organoid culture comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer; and A nanodot sensor for drug screening comprising: a nanodot electrode located below the adhesive hydrogel, wherein a metal is deposited in a nanodot pattern on a metal-coated substrate.
2. In Paragraph 1, A nanodot sensor for drug screening, wherein the metal is gold (Au), silver (Ag), platinum (Pt), or an alloy thereof.
3. In Paragraph 1, A nanodot sensor for drug screening, wherein the above-mentioned neurotrophic factor is one or more selected from the group consisting of neurotrophic factor-3 (NT3), neurotrophin-4 (NT-4), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), and nerve growth factor (NGF).
4. In Paragraph 1, A nanodot sensor for drug screening, wherein the above biocompatible polymer is one or more selected from the group consisting of gelatin, dextran, dextran aldehyde, hyaluronic acid, collagen, alginate, alginic acid, starch, chitosan, cellulose, chondroitin sulfate, and heparin.
5. In Paragraph 1, The above-described nanodot sensor for drug screening further comprises a concave mold that supports the adhesive hydrogel and the nanodot electrode.
6. In Paragraph 5, The above mold is a nanodot sensor for drug screening, made of one or more materials selected from the group consisting of PDMS (Polydimethylsiloxane), polyethylene, polystyrene, and polypropylene.
7. In Paragraph 1, A nanodot sensor for drug screening, wherein the substrate is made of one or more materials selected from the group consisting of polyethylene terephthalate (PET) and polyimide (PI).
8. In Paragraph 1, A nanodot sensor for drug screening, wherein the organoids are at least two or more organoids of different cell types.
9. In Paragraph 1, A nanodot sensor for drug screening, wherein the organoid is one or more organoids selected from the group consisting of kidney, brain, skin, heart, optic cup, liver, pancreas, bile duct, neural tube, stomach, large intestine, small intestine, prostate, breast, salivary gland, endometrium, mammary gland, thyroid, tongue, esophagus, lung, blood vessel, muscle, and adrenal cortex.
10. In Paragraph 1, A nanodot sensor for drug screening, wherein the organoid is one or more organoids selected from the group consisting of the forebrain, dorsal forebrain, ventral forebrain, midbrain, hindbrain, brainstem, cerebrum, cerebellum, thalamus, hypothalamus, pituitary gland, amygdala, hippocampus, basal ganglia, and spinal cord.
11. In Paragraph 1, The above organoid comprises one or more types selected from the group consisting of glioblastoma, astrocytoma, ependymoma, oligodendroglioma, mixed glioma, brainstem glioma, optic nerve glioma, pituitary adenoma, craniopharyngioma, medulloblastoma, primitive neuroectodermal tumor, pineal tumors, meningioma, schwannoma, metastatic brain tumor, central nervous system lymphoma, neurofibromatosis, pseudotumor cerebri, and tuberous sclerosis. Nanodot sensor for drug screening, which is a brain cancer organoid.
12. In Paragraph 1, A nanodot sensor for drug screening, wherein the organoid is an assembloid formed by combining at least two organoids of different cell types.
13. A drug screening method using a nanodot sensor of any one of claims 1 to 12, comprising the following steps: A culture step of culturing an organoid in an adhesive hydrogel comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer; A drug delivery step of bringing the above organoid into contact with a test drug; and A signal measurement step for measuring the electrophysiological signal of the organoid using a nanodot electrode in which metal is deposited in a nanodot pattern on a metal-coated substrate located below the adhesive hydrogel.
14. A drug screening method for the prevention or treatment of glioblastoma using a nanodot sensor of any one of claims 1 to 7, comprising the following steps: A culture step of culturing a glioblastoma-midbrain assembleoid, in which a glioblastoma organoid and a midbrain organoid are combined, in an adhesive hydrogel comprising metal nanoparticles, a neurotrophic factor conjugated thereto, and a biocompatible polymer; A drug delivery step of bringing the above-mentioned glioblastoma-midbrain assembleoid into contact with a test drug; and A signal measurement step for measuring the electrophysiological signal of the glioblastoma-midbrain assembleoid using a nanodot electrode in which metal is deposited in a nanodot pattern on a metal-coated substrate located below the adhesive hydrogel.
15. In Paragraph 14, The above-described method for screening drugs for the prevention or treatment of glioblastoma further comprises the step of determining the test drug as a candidate drug for the prevention or treatment of glioblastoma if the electrophysiological signal of the glioblastoma organoid is reduced in a glioblastoma-midbrain assembled assembly 16. In Paragraph 14, A method for screening drugs for the prevention or treatment of glioblastoma, wherein the glioblastoma organoid is obtained by culturing induced pluripotent stem cells in which one or more genes selected from the group consisting of NF1 (neurofibromin 1) and PTEN10 (phosphatase and tensin homolog on chromosome 10) have been knocked out.