Dsrna molecule for regulating ALK7 expression

Abstract

Provided are a double-stranded RNA used for inhibiting ALK7 gene expression, a cell comprising same, and a method for treating ALK7-mediated or ALK7-related diseases or symptoms in a subject by using the dsRNA or the cell.

Description

dsRNA molecules that regulate ALK7 expression

[0001] This application claims priority to Chinese application No. 202411649755.4, filed on November 18, 2025, the entire application of which is incorporated herein by reference. Technical Field

[0002] This invention relates to the field of RNA interference. Background Technology

[0003] ALK7, also known as Activin Receptor-like Kinase 7, is a member of the TGF-β (Transforming Growth Factor β) signaling pathway. It belongs to the type I receptor family and is primarily responsible for forming a complex with type II receptors, thereby activating downstream signal transduction pathways.

[0004] ALK7 plays a role in a variety of biological processes, including but not limited to cell proliferation, differentiation, apoptosis, and embryonic development. Specifically, ALK7 can respond to specific ligands, such as Nodal or Activin, which play a key role in early embryonic development, influencing processes such as the establishment of the anterior-posterior axis, the disruption of bilateral symmetry, and organ formation.

[0005] Furthermore, the study also found that ALK7 is associated with several disease states. For example, in cancer research, changes in ALK7 expression levels may be related to tumor development and progression. Meanwhile, other studies have shown that abnormalities in the ALK7 signaling pathway may be related to the development of various diseases, including metabolic and cardiovascular diseases.

[0006] There is a need in the art for compositions and methods for treating ALK7-related diseases.

[0007] One treatment approach is to reduce ALK7 expression using small interfering RNA (siRNA) based on RNA interference mechanisms to treat ALK7-related diseases. Summary of the Invention

[0008] This invention provides novel double-stranded RNA (dsRNA) for inhibiting ALK7 gene expression, cells, and pharmaceutical compositions and kits containing said dsRNA or cells, as well as methods for inhibiting or reducing ALK7 gene expression or treating diseases or conditions that benefit from reduced ALK7 gene expression using said dsRNA, cells, and pharmaceutical compositions and kits.

[0009] In a first aspect, the present invention provides a double-stranded RNA (dsRNA) for inhibiting ALK7 gene expression, the dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the length of the sense strand and the antisense strand is each independently 15-30 nucleotides, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:595-1188.

[0010] In some preferred embodiments, the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:820, SEQ ID NO:890, SEQ ID NO:1003, SEQ ID NO:868, SEQ ID NO:967, SEQ ID NO:975, SEQ ID NO:974, SEQ ID NO:930, SEQ ID NO:979, SEQ ID NO:999, SEQ ID NO:948, SEQ ID NO:1011, SEQ ID NO:989, SEQ ID NO:998, SEQ ID NO:1013, SEQ ID NO:1017, or SEQ ID NO:1025.

[0011] In some embodiments, the positive chain comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:1-594.

[0012] In some preferred embodiments, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:226, SEQ ID NO:296, SEQ ID NO:409, SEQ ID NO:274, SEQ ID NO:373, SEQ ID NO:381, SEQ ID NO:380, SEQ ID NO:336, SEQ ID NO:385, SEQ ID NO:405, SEQ ID NO:354, SEQ ID NO:417, SEQ ID NO:395, SEQ ID NO:404, SEQ ID NO:419, SEQ ID NO:423, or SEQ ID NO:431. In some embodiments, a hairpin loop is formed between the sense strand and the antisense strand in the dsRNA. In other embodiments, the dsRNA is siRNA.

[0013] In some embodiments, the length of the positive and negative strands is independently 15-27 nucleotides, preferably 18-25 nucleotides, more preferably 19-21 nucleotides. In some embodiments, the length of the positive strand is 15-27 nucleotides, preferably 17-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19-21 nucleotides, and most preferably 19 amino acids. In some embodiments, the length of the negative strand is 15-27 nucleotides, preferably 17-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19-22 nucleotides, and most preferably 21 amino acids.

[0014] In some embodiments, the length of the double-stranded region is 15-25 nucleotide pairs, preferably 16-23 nucleotide pairs, more preferably 18-20 nucleotide pairs, and most preferably 19 nucleotide pairs.

[0015] In some embodiments, one or both of the sense strand and the antisense strand include a 3' overhang and / or a 5' overhang having at least one nucleotide, for example, one or both of the sense strand and the antisense strand include a 3' overhang and / or a 5' overhang having at least two nucleotides. In some embodiments, the antisense strand has a 3' overhang and / or a 5' overhang having at least one nucleotide, preferably the antisense strand includes a 3' overhang and / or a 5' overhang having two nucleotides. In some specific embodiments, the dsRNA has two nucleotide overhangs at the 3' end of the antisense strand and a blunt end at the 5' end of the antisense strand.

[0016] In some embodiments, the antisense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, or at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 595-1188. In a preferred embodiment, the antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NO: 595-1188.

[0017] In some preferred embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NO:820, SEQ ID NO:890, SEQ ID NO:1003, SEQ ID NO:868, SEQ ID NO:967, SEQ ID NO:975, SEQ ID NO:974, SEQ ID NO:930, SEQ ID NO:979, SEQ ID NO:999, SEQ ID NO:948, SEQ ID NO:1011, SEQ ID NO:989, SEQ ID NO:998, SEQ ID NO:1013, SEQ ID NO:1017, or SEQ ID NO:1025.

[0018] In some embodiments, the positive strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, or at least 18 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:1-594. In a preferred embodiment, the positive strand comprises a nucleotide sequence shown in any one of SEQ ID NO:1-594.

[0019] In some preferred embodiments, the positive strand comprises the nucleotide sequence shown in any one of SEQ ID NO:226, SEQ ID NO:296, SEQ ID NO:409, SEQ ID NO:274, SEQ ID NO:373, SEQ ID NO:381, SEQ ID NO:380, SEQ ID NO:336, SEQ ID NO:385, SEQ ID NO:405, SEQ ID NO:354, SEQ ID NO:417, SEQ ID NO:395, SEQ ID NO:404, SEQ ID NO:419, SEQ ID NO:423, or SEQ ID NO:431.

[0020] In some embodiments, the dsRNA comprises any pair of paired sense and antisense sequences as shown in Table 3 of the specification.

[0021] In some implementation schemes,

[0022] (a) The justice chain contains GCGGUAUCUGAAUAUCAA (SEQ ID NO:226), and the antisense chain contains UUGAUAUUCAGAUACCAGCCA (SEQ ID NO:820).

[0023] (b) The justice chain contains CUGUGAAGCAUGAUUCAAA (SEQ ID NO:296), and the antisense chain contains UUUGAAUCAUGCUUCACAGCC (SEQ ID NO:890);

[0024] (c) The justice chain contains AAGACAGUACAGUAUUUAA (SEQ ID NO:409), and the antisense chain contains UUAAAUACUGUACUGUCUUAU (SEQ ID NO:1003);

[0025] (d) The justice chain contains UGCUAUUGCUCAUCGAGAA (SEQ ID NO:274), and the antisense chain contains UUCUCGAUGAGCAAUAGCAGG (SEQ ID NO:868).

[0026] (e) The justice chain contains CAGUGGCAAAGUUGUGAAA (SEQ ID NO:373), and the antisense chain contains UUUCACAACUUUGCCACUGGU (SEQ ID NO:967);

[0027] (f) The justice chain contains CCUAACUGCUCUUCGUAUA (SEQ ID NO:381), and the antisense chain contains UUACGAAGAGCAGUUAGGCG (SEQ ID NO:975).

[0028] (g) The justice chain contains GCCUAACUGCUCUUCGUAA (SEQ ID NO:380), and the antisense chain contains UUACGAAGAGCAGUUAGGCGG (SEQ ID NO:974).

[0029] (h) The justice chain contains GAUGAUACAAUGAAUGUGA (SEQ ID NO:336), and the antisense chain contains UCACAUUCAUUGUAUCAUCAA (SEQ ID NO:930).

[0030] (i) The justice chain contains GCUCUUCGUAUUAAGAAGA (SEQ ID NO:385), and the antisense chain contains UCUUCUUAAUACGAAGAGCAG (SEQ ID NO:979);

[0031] (j) The justice chain contains AAGAUAAGACAGUACAGUA (SEQ ID NO:405), and the antisense chain contains UACUGUACUGUCUUAUCUUUG (SEQ ID NO:999);

[0032] (k) The justice chain contains AUGACCAAUUGCCUUAUUA (SEQ ID NO:354), and the antisense chain contains UAUAAGGCAAUUGGUACUCC (SEQ ID NO:948).

[0033] (l) The justice chain contains GGGCAGGAGUUGACUUCAA (SEQ ID NO:417), and the antisense chain contains UUGAAGUCAACUCCUGCCCAU (SEQ ID NO:1011).

[0034] (m) The justice chain contains CCUAAUGAUGAUAAUUAUA (SEQ ID NO:395), and the antisense chain contains UAUAAUUAUCAUCAUUAGGCU (SEQ ID NO:989);

[0035] (n) The justice chain contains AAAGAUAAGACAGUACAGA (SEQ ID NO:404), and the antisense chain contains UCUGACUGUCUUAUCUUUGA (SEQ ID NO:998);

[0036] (o) The justice chain contains AGGAGUUGACUUCAUCCAA (SEQ ID NO:419), and the antisense chain contains UUGGAUGAAGUCAACUCCUGC (SEQ ID NO:1013).

[0037] (p) The justice chain contains CAAAAGUAUAAAAUAAGCA (SEQ ID NO:423), and the antisense chain contains UGCUUAUUUUAUACUUUUGUA (SEQ ID NO:1017); or

[0038] (q) The justice chain contains AGUUAGCAGGACUUUUUAA (SEQ ID NO:431), and the antisense chain contains UUAAAAAGUCCUGCUAACUUA (SEQ ID NO:1025).

[0039] In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides, or all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0040] In some embodiments, the sense strand and the antisense strand each independently comprise one or more modified nucleotides selected from the group consisting of: 2'-O-alkyl modified nucleotides (e.g., 2'-O-methyl modified nucleotides), 2'-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, baseless nucleotides, reverse baseless deoxyribonucleotides, nucleotides containing a thiophosphate group, vinylphosphonate modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, and 2'-C-alkyl-modified nucleotides. Nucleotides modified with 2'-O-allyl, morpholinonucleotides, aminophosphates, nucleotides containing non-natural bases, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid di ...

[0041] In some embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, nucleotides containing a thiophosphate group, reverse abase-free deoxyribonucleotides, and SCP modifications.

[0042] In some embodiments, the sense strand and / or the antisense strand comprises at least two 2'-fluorinated nucleotides. In some embodiments, the sense strand and / or the antisense strand comprises at least eight 2'-O-methylated nucleotides. In some embodiments, the 3' and / or 5' ends of the sense strand and / or the antisense strand comprise 1-5 phosphate thioester nucleotide bonds, preferably 2-4 phosphate thioester nucleotide bonds.

[0043] In some embodiments, the antisense strand has a length of 21 nucleotides and has

[0044] (i) (counting from the 5' end) nucleotides with 2'-O-methyl modification at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and nucleotides with 2'-fluoro modification at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20; and / or

[0045] (ii) Bonding between 1-2 phosphate thioester nucleotides located in the 5' and 3' end regions.

[0046] In some embodiments, the antisense strand has a length of 21 nucleotides and has

[0047] (i) (counting from the 5' end) SCP modification located at position 1;

[0048] (ii) (counting from the 5' end) 2'-fluorinated modifications at positions 2, 4, 6, 8, 10, 12, 14, 16 and 18;

[0049] (iii) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, and 21; and / or

[0050] (iv) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

[0051] In some embodiments, the antisense strand has a length of 21 nucleotides and has

[0052] (i) (counting from the 5' end) SCP modification located at position 1;

[0053] (ii) (counting from the 5' end) 2'-fluorinated modifications at positions 2, 7, 12, 14 and 16;

[0054] (iii) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 4, 5, 6, 8, 9, 10, 11, 13, 15, 17, 19, 20, and 21; and / or

[0055] (iv) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

[0056] In some embodiments, the antisense strand has a length of 21 nucleotides and has

[0057] (i) (counting from the 5' end) SCP modification located at position 1;

[0058] (ii) (counting from the 5' end) 2'-fluorinated modifications at positions 2, 5, 7, 12 and 14;

[0059] (iii) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or

[0060] (iv) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

[0061] In some embodiments, the antisense strand has a length of 21 nucleotides and has

[0062] (i) (counting from the 5' end) 2'-deoxygenation modifications located at positions 2, 5, 7 and 12;

[0063] (ii) (Counting from the 5' end) SCP modification located at position 1;

[0064] (iii) (Counting from the 5' end) 2'-fluorinated modification at position 14;

[0065] (iv) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or

[0066] (v) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

[0067] In some embodiments, the positive strand has a length of 19 nucleotides and has:

[0068] (i) (counting from the 5' end) nucleotides with 2'-O-methyl modification at positions 1 to 6 and 10 to 19, and nucleotides with 2'-fluoro modification at positions 7 to 9;

[0069] (ii) Optional IB modifications located at the 5' end and / or the 3' end; and / or

[0070] (iii) Bonding between 1-2 thiophosphate nucleotides located in the 5' end region and the 3' end region.

[0071] In some embodiments, the positive strand has a length of 21 nucleotides and has:

[0072] (i) (counting from the 5' end) nucleotides with 2'-O-methyl modification at positions 1 to 8 and 12 to 21, and nucleotides with 2'-fluoro modification at positions 9 to 11; and / or

[0073] (ii) Optional IB modifications located at the 5' end and / or the 3' end; and / or

[0074] (iii) Bonding between 1-2 thiophosphate nucleotides located in the 5' end region and the 3' end region.

[0075] In some embodiments, the dsRNA comprises any one of the modified antisense strands shown in Tables 5, 14, 17 or 19, and / or any one of the modified sense strands shown in Tables 4, 14, 17 or 19.

[0076] In some embodiments, the dsRNA comprises paired modified sense strand sequences and modified antisense strand sequences. In some embodiments, the dsRNA comprises paired modified sense strand sequences and modified antisense strand sequences as shown in Tables 4 and 5, Table 14, Table 17 and Table 19, preferably paired modified sense strand sequences and modified antisense strand sequences shown in Tables 6, 14, 17 or 19.

[0077] In some implementation schemes,

[0078] (1) The chain of justice includes

[0079] GmCmUmGmGmUmAfUfCfUmGmAmAmUmAmCmAmAm(SEQ ID NO:1254), and the antisense chain contains (SCPUm)sUfsGmAmUfAmUfUmCmAmGmAfUmAfCmCmAmGmCmsCmsAm(SEQ ID NO:1255);

[0080] (2) The justice chain includes

[0081] CmUmGmUmGmAmAfGfCfAmUmGmAmUmUmCmAmAmAm(SEQ ID NO:1256), and the antisense chain contains (SCPUm)sUfsUmGmAfAmUfCmAmUmGmCfUmUfCmAmCmAmGmsCmsCm(SEQ ID NO:1257);

[0082] (3) The justice chain includes

[0083] AmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAm(SEQ ID NO:1258), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm(SEQ ID NO:1259);

[0084] (4) The chain of justice includes

[0085] UmGmCmUmAmUmUfGfCfUmCmAmUmCmGmAmGmAmAm(SEQ ID NO:1260), and the antisense chain contains (SCPUm)sUfsCmUmCfGmAfUmGmAmGmCfAmAfUmAmGmCmAmsGmsGm(SEQ ID NO:1261);

[0086] (5) The justice chain includes

[0087] CmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAm(SEQ ID NO:1262), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm(SEQ ID NO:1263);

[0088] (6) The justice chain includes

[0089] CmCmUmAmAmCmUfGfCfUmCmUmUmCmGmUmAmUmAm(SEQ ID NO:1264), and the antisense chain contains (SCPUm)sAfsUmAmCfGmAfAmGmAmGmCfAmGfUmUmAmGmGmsCmsGm(SEQ ID NO:1265);

[0090] (7) The justice chain includes

[0091] GmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAm(SEQ ID NO:1266), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm(SEQ ID NO:1267);

[0092] (8) The justice chain includes

[0093] GmAmUmGmAmUmAfCfAfAmUmGmAmAmUmGmUmGmUmGmAm(SEQ ID NO:1268), and the antisense chain contains (SCPUm)sCfsAmCmAfUmUfCmAmUmUmGfUmAfUmCmAmUmCmsAmsAm(SEQ ID NO:1269);

[0094] (9) The chain of justice includes

[0095] GmCmUmCmUmUmCfGfUfAmUmUmAmAmGmAmAmGmAm(SEQ ID NO:1270), and the antisense chain contains (SCPUm)sCfsUmUmCfUmUfAmAmUmAmCfGmAfAmGmAmGmCmsAmsGm(SEQ ID NO:1271);

[0096] (10) The justice chain includes

[0097] AmAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAm(SEQ ID NO:1272), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm(SEQ ID NO:1273);

[0098] (11) The chain of justice includes

[0099] GmGmAmGmUmAmCmCmAfAfUfUmGmCmCmUmUmAmUmUmAm(SEQ ID NO:1274), and the antisense chain contains (SCPUm)sAfsAmUmAfAmGfGmCmAmAmUfUmGfGmUmAmCmUmsCmsCm(SEQ ID NO:1275);

[0100] (12) The justice chain includes

[0101] AmUmGmGmGmCmAmGmGfAfGfUmUmGmAmCmUmUmCmAmAm(SEQ ID NO:1276), and the antisense chain contains (SCPUm)sUfsGmAmAfGmUfCmAmAmCmUfCmCfUmGmCmCmCmsAmsUm(SEQ ID NO:1277);

[0102] (13) The chain of justice includes

[0103] CmCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAm(SEQ ID NO:1278), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm(SEQ ID NO:1279);

[0104] (14) The chain of justice includes

[0105] AmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAm(SEQ ID NO:1280), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm(SEQ ID NO:1281);

[0106] (15) The chain of justice includes

[0107] AmGmGmAmGmUmUfGfAfCmUmUmCmAmUmCmCmAmAm(SEQ ID NO:1282), and the antisense chain contains (SCPUm)sUfsGmGmAfUmGfAmAmGmUmCfAmAfCmUmCmCmUmCmUmsGmsCm(SEQ ID NO:1283);

[0108] (16) The chain of justice includes

[0109] CmAmAmAmAmGmUfAfUfAmAmAmAmUmAmAmGmCmAm(SEQ ID NO:1284), and the antisense chain contains (SCPUm)sGfsCmUmUfAmUfUmUmUmAmUfAmCfUmUmUmUmGmsUmsAm(SEQ ID NO:1285);

[0110] (17) The chain of justice includes

[0111] AmGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAm(SEQ ID NO:1286), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm(SEQ ID NO:1287);

[0112] (18) The chain of justice includes

[0113] AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAm(SEQ ID NO:1288), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm(SEQ ID NO:1259);

[0114] (19) The chain of justice includes

[0115] CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAm(SEQ ID NO:1289), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm(SEQ ID NO:1263);

[0116] (20) The justice chain includes

[0117] GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAm(SEQ ID NO:1290), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm(SEQ ID NO:1267);

[0118] (21) The chain of justice includes

[0119] AmsAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAm(SEQ ID NO:1291), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm(SEQ ID NO:1273);

[0120] (22) The justice chain includes

[0121] CmsCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAm(SEQ ID NO:1292), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm(SEQ ID NO:1279);

[0122] (23) The justice chain includes

[0123] CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAm(SEQ ID NO:1289), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm(SEQ ID NO:1263);

[0124] (24) The chain of justice includes

[0125] GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAm(SEQ ID NO:1290), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm(SEQ ID NO:1267);

[0126] (25) The justice chain includes

[0127] AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAm(SEQ ID NO:1293), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm(SEQ ID NO:1281);

[0128] (26) The chain of justice includes

[0129] AmsGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAm(SEQ ID NO:1294), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm(SEQ ID NO:1287);

[0130] (27) The justice chain includes

[0131] AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm(SEQ ID NO:1296);

[0132] (28) The chain of justice includes

[0133] AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)CfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm(SEQ ID NO:1297);

[0134] (29) The chain of justice includes

[0135] AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm(SEQ ID NO:1281);

[0136] (30) The justice chain includes

[0137] AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm(SEQ ID NO:1296);

[0138] (31) The chain of justice includes

[0139] AmsAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAm(SEQ ID NO:1298), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm(SEQ ID NO:1296);

[0140] (32) The justice chain includes

[0141] UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAm(SEQ ID NO:1299), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm(SEQ ID NO:1296);

[0142] (33) The justice chain includes

[0143] UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAm(SEQ ID NO:1299), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm(SEQ ID NO:1281);

[0144] (34) The justice chain includes

[0145] AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAm (SEQ ID NO:1300), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1259);

[0146] (35) The justice chain includes

[0147] AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAm(SEQ ID NO:1300), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm(SEQ ID NO:1301);

[0148] (36) The justice chain includes

[0149] AmsAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAm (SEQ ID NO:1302), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO:1301);

[0150] (37) The justice chain includes

[0151] AmUmAmAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAm(SEQ ID NO:1303), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm(SEQ ID NO:1301);

[0152] (38) The justice chain includes

[0153] CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmsAm(SEQ ID NO:1304), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm(SEQ ID NO:1263);

[0154] (39) The chain of justice includes

[0155] GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmsAm(SEQ ID NO:1305), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUmAfGmGmCmsGmsGm(SEQ ID NO:1267);

[0156] (40) The chain of justice includes

[0157] GmsCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAm(SEQ ID NO:1306), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUmAfGmGmCmsGmsGm(SEQ ID NO:1267); or

[0158] (41) The chain of justice includes

[0159] CmCmGmCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAm(SEQ ID NO:1307), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUmAfGmGmCmsGmsGm(SEQ ID NO:1267).

[0160] In some embodiments, the dsRNA of the present invention is further conjugated to a ligand portion targeting adipocytes, preferably the sense strand is conjugated to the ligand portion, more preferably the 5' and 3' ends of the sense strand are conjugated to the ligand portion via phosphate esters or thiophosphate esters, respectively.

[0161] As used herein, a "ligand moiety targeting adipocytes" refers to a group that provides enhanced affinity of the compound for adipocytes or adipose tissue compared to compounds lacking this moiety. Preferably, the ligand moiety does not participate in the double-strand pairing of dsRNA. Such ligand moieties are well known in the art, and in some preferred embodiments, the adipocyte-targeting ligand moiety may be a lipid-based ligand, such as the compounds disclosed in PCT Publications WO2025146138 or WO2024148329A1.

[0162] In some embodiments, the 5' end of the positive chain is conjugated to S' via a phosphate ester or a thiophosphate ester, and the 3' end of the positive chain is conjugated to S via a phosphate ester or a thiophosphate ester, wherein S' is selected from DL0359-NHC6s-IB, DL0363-NHC6s-IB, DL0370-NHC6, DL0370-NHC6s-IB, and DL0456, and S is selected from IB-C6NH-DL0359, IB-C6NH-DL0363, DL0426, and DL0455.

[0163] In some preferred embodiments, S' and S are selected from the following combinations (1)-(5) of S' and S respectively:

[0164] (1) S' is DL0359-NHC6s-IB, and S is IB-C6NH-DL0359;

[0165] (2) S' is DL0363-NHC6s-IB, and S is IB-C6NH-DL0363;

[0166] (3) S' is DL0370-NHC6, and S is DL0426;

[0167] (4) S' is DL0370-NHC6s-IB, and S is DL0426; and

[0168] (5) S' is DL0456, and S is DL0455.

[0169] In some implementation schemes,

[0170] (1) The positive chain contains DL0359-NHC6s-IBs-GmCmUmGmGmUmAfUfCfUmGmAmAmUmUmCmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1193), and the negative chain contains (SCPUm)sUfsGmAmUfAmUfUmCmAmGmAfUmAfCmCmAmGmCmsCmsAm (SEQ ID NO:1194);

[0171] (2) The positive chain contains DL0359-NHC6s-IBs-CmUmGmUmGmAmAfGfCfAmUmGmAmUmUmCmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1195), and the negative chain contains (SCPUm)sUfsUmGmAfAmUfCmAmUmGmCfUmUfCmAmCmAmGmsCmsCm (SEQ ID NO:1196);

[0172] (3) The positive chain contains DL0359-NHC6s-IBs-AmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1197), and the negative chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1198);

[0173] (4) The positive chain contains DL0359-NHC6s-IBs-UmGmCmUmAmUmUfGfCfUmCmAmUmCmGmAmGmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1199), and the negative chain contains (SCPUm)sUfsCmUmCfGmAfUmGmAmGmCfAmAfUmAmGmCmAmsGmsGm (SEQ ID NO:1200);

[0174] (5) The positive chain contains DL0359-NHC6s-IBs-CmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1201), and the negative chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1202);

[0175] (6) The sense chain contains DL0359-NHC6s-IBs-CmCmUmAmAmCmUfGfCfUmCmUmUmCmGmUmAmUmAms-IB-C6NH-DL0359 (SEQ ID NO:1203), and the antisense chain contains (SCPUm)sAfsUmAmCfGmAfAmGmAmGmCfAmGfUmUmAmGmGmsCmsGm (SEQ ID NO:1204);

[0176] (7) The positive chain contains DL0359-NHC6s-IBs-GmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1205), and the negative chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1206);

[0177] (8) The positive chain contains DL0359-NHC6s-IBs-GmAmUmGmAmUmAfCfAfAmUmGmAmAmUmGmUmGmUmGmAms-IB-C6NH-DL0359 (SEQ ID NO:1207), and the negative chain contains (SCPUm)sCfsAmCmAfUmUfCmAmUmUmGfUmAfUmCmAmUmCmsAmsAm (SEQ ID NO:1208);

[0178] (9) The positive chain contains DL0359-NHC6s-IBs-GmCmUmCmUmUmCfGfUfAmUmUmAmAmGmAmAmGmAms-IB-C6NH-DL0359 (SEQ ID NO:1209), and the negative chain contains (SCPUm)sCfsUmUmCfUmUfAmAmUmAmCfGmAfAmGmAmGmCmsAmsGm (SEQ ID NO:1210);

[0179] (10) The positive chain contains DL0359-NHC6s-IBs-AmAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAmS-IB-C6NH-DL0359 (SEQ ID NO:1211), and the negative chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm (SEQ ID NO:1212);

[0180] (11) The positive chain contains DL0363-NHC6s-IBs-GmGmAmGmUmAmCmCmAfAfUfUmGmCmCmUmUmAmUmUmAms-IB-C6NH-DL0363 (SEQ ID NO:1213), and the negative chain contains (SCPUm)sAfsAmUmAfAmGfGmCmAmAmUfUmGfGmUmAmCmUmsCmsCm (SEQ ID NO:1214);

[0181] (12) The positive chain contains DL0363-NHC6s-IBs-AmUmGmGmGmCmAmGmGfAfGfUmUmGmAmCmUmUmCmAmAmAms-IB-C6NH-DL0363 (SEQ ID NO:1215), and the negative chain contains (SCPUm)sUfsGmAmAfGmUfCmAmAmCmUfCmCfUmGmCmCmCmsAmsUm (SEQ ID NO:1216);

[0182] (13) The positive chain contains DL0359-NHC6s-IBs-CmCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAms-IB-C6NH-DL0359 (SEQ ID NO:1217), and the negative chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm (SEQ ID NO:1218);

[0183] (14) The positive chain contains DL0359-NHC6s-IBs-AmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAmS-IB-C6NH-DL0359 (SEQ ID NO:1219), and the negative chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1220);

[0184] (15) The positive chain contains DL0359-NHC6s-IBs-AmGmGmAmGmUmUfGfAfCmUmUmCmAmUmCmCmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1221), and the negative chain contains (SCPUm)sUfsGmGmAfUmGfAmAmGmUmCfAmAfCmUmCmCmUmsGmsCm (SEQ ID NO:1222);

[0185] (16) The positive chain contains DL0359-NHC6s-IBs-CmAmAmAmAmGmUfAfUfAmAmAmAmUmAmAmGmCmAms-IB-C6NH-DL0359 (SEQ ID NO:1223), and the negative chain contains (SCPUm)sGfsCmUmUfAmUfUmUmUmAmUfAmCfUmUmUmUmGmsUmsAm (SEQ ID NO:1224);

[0186] (17) The positive chain contains DL0359-NHC6s-IBs-AmGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1225), and the negative chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm (SEQ ID NO:1226);

[0187] (18) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAmAms-DL0426 (SEQ ID NO:1227), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1198);

[0188] (19) The justice chain contains DL0370-NHC6s-CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-DL0426 (SEQ ID NO:1228), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1202);

[0189] (20) The justice chain contains DL0370-NHC6s-GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0426 (SEQ ID NO:1229), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1206);

[0190] (21) The justice chain contains DL0370-NHC6s-AmsAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAms-DL0426 (SEQ ID NO:1230), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm (SEQ ID NO:1212);

[0191] (22) The justice chain contains DL0370-NHC6s-CmsCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAms-DL0426 (SEQ ID NO:1231), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm (SEQ ID NO:1218);

[0192] (23) The justice chain contains DL0456s-CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-DL0455 (SEQ ID NO:1232), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1202);

[0193] (24) The justice chain contains DL0456s-GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0455 (SEQ ID NO:1233), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1206);

[0194] (25) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAms-DL0426 (SEQ ID NO:1234), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1220);

[0195] (26) The justice chain contains DL0370-NHC6s-AmsGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAms-DL0426 (SEQ ID NO:1235), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm (SEQ ID NO:1226);

[0196] (27) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1236), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO:1251);

[0197] (28) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1237), and the antisense chain contains (SCPUm)CfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1252);

[0198] (29) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1238), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1220);

[0199] (30) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1239), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO:1251);

[0200] (31) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1240), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO:1251);

[0201] (32) The justice chain contains DL0370-NHC6s-Ibs-UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1241), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO:1251);

[0202] (33) The positive chain contains DL0370-NHC6s-Ibs-UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1242), and the negative chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1220);

[0203] (34) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1243), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1198);

[0204] (35) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1244), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO:1253);

[0205] (36) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1245), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO:1253);

[0206] (37) The justice chain contains DL0370-NHC6s-IBs-AmUmAmAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1246), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO:1253);

[0207] (38) The justice chain contains DL0370-NHC6s-CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmsAms-DL0426 (SEQ ID NO:1247), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1202);

[0208] (39) The justice chain contains DL0370-NHC6s-GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:1248), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1206);

[0209] (40) The justice chain contains DL0370-NHC6s-GmsCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:1249), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1206);

[0210] (41) The justice chain contains DL0370-NHC6s-IBs-CmCmGmCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:1250), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1206);

[0211] (42) The justice chain contains DL0370-NHC6s-IBs-AmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAms-DL0426 (SEQ ID NO:2659), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1281);

[0212] (43) The justice chain contains DL0370-NHC6s-IBs-UmCmAmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAms-DL0426 (SEQ ID NO:2660), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1281);

[0213] (44) The justice chain contains DL0370-NHC6s-IBs-UmCmAmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:2661), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1281);

[0214] (45) The justice chain contains DL0370-NHC6s-IBs-UmsCmAmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAms-DL0426 (SEQ ID NO:2662), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO:1281);

[0215] (46) The justice chain contains DL0370-NHC6s-IBs-GmCmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:2663), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsCm (SEQ ID NO:2679);

[0216] (47) The justice chain contains DL0370-NHC6s-IBs-AmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAmAms-DL0426 (SEQ ID NO:2664), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1259);

[0217] (48) The justice chain contains DL0370-NHC6s-IBs-AmUmAmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAmAms-DL0426 (SEQ ID NO:2665), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1259);

[0218] (49) The justice chain contains DL0370-NHC6s-IBs-AmUmAmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:2666), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1259);

[0219] (50) The justice chain contains DL0370-NHC6s-IBs-AmsUmAmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAmAms-DL0426 (SEQ ID NO:2667), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO:1259);

[0220] (51) The justice chain contains DL0370-NHC6s-IBs-CmUmAmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:2668), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsGm (SEQ ID NO:2680);

[0221] (52) The justice chain contains DL0370-NHC6s-IBs-CmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-DL0426 (SEQ ID NO:2669), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1263);

[0222] (53) The justice chain contains DL0370-NHC6s-IBs-AmCmCmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAmAms-DL0426 (SEQ ID NO:2670), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1263);

[0223] (54) The justice chain contains DL0370-NHC6s-IBs-AmCmCmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmsAms-DL0426 (SEQ ID NO:2671), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1263);

[0224] (55) The justice chain contains DL0370-NHC6s-IBs-AmsCmCmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-DL0426 (SEQ ID NO:2672), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO:1263);

[0225] (56)DL0370-NHC6s-IBs-GmCmCmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmsAms-DL0426 (SEQ ID NO:2673), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsCm (SEQ ID NO:2681);

[0226] (57)DL0456s-IBs-CmCmGmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmsAms-DL0455 (SEQ ID NO:2674), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1267);

[0227] (58)DL0370-NHC6s-IBs-GmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0426 (SEQ ID NO:2675), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1267);

[0228] (59)DL0370-NHC6s-IBs-CmCmGmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0426 (SEQ ID NO:2676), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1267);

[0229] (60)DL0370-NHC6s-IBs-CmCmGmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:2677), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1267); or

[0230] (61)DL0370-NHC6s-IBs-CmsCmGmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0426 (SEQ ID NO:2678), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO:1267).

[0231] In a second aspect, the present invention provides a cell containing the dsRNA described in the first aspect of the present invention.

[0232] In a third aspect, the present invention provides a pharmaceutical composition comprising the dsRNA described in the first aspect of the invention or the cells described in the second aspect of the invention, and optionally a pharmaceutically acceptable carrier or excipient.

[0233] In a fourth aspect, the present invention provides a kit comprising the dsRNA described in the first aspect of the invention, the cells described in the second aspect of the invention, or the pharmaceutical composition described in the third aspect of the invention.

[0234] In a fifth aspect, the present invention provides a method for inhibiting ALK7 gene expression in cells, the method comprising contacting the cells with dsRNA as described in the first aspect of the invention or a pharmaceutical composition as described in the third aspect of the invention. In some embodiments, the method is performed in vitro.

[0235] In a sixth aspect, the present invention provides a method for inhibiting ALK7 gene expression in cells of a subject, the method comprising administering to the subject dsRNA as described in the first aspect of the invention, cells as described in the second aspect of the invention, or a pharmaceutical composition as described in the third aspect of the invention.

[0236] The present invention also provides a method for treating a disease or condition in a subject that benefits from reduced ALK7 gene expression, the method comprising administering to the subject dsRNA as described in the first aspect of the invention, cells as described in the second aspect of the invention, or a pharmaceutical composition as described in the third aspect of the invention.

[0237] The present invention also provides a method for preventing at least one symptom in a subject suffering from a disease or condition that benefits from reduced ALK7 gene expression, the method comprising administering to the subject dsRNA as described in the first aspect of the invention, cells as described in the second aspect of the invention, or a pharmaceutical composition as described in the third aspect of the invention.

[0238] The present invention also provides a method for preventing the progression of a disease or condition in a subject that benefits from reduced ALK7 gene expression, the method comprising administering to the subject dsRNA as described in the first aspect of the invention, cells as described in the second aspect of the invention, or a pharmaceutical composition as described in the third aspect of the invention.

[0239] In some embodiments, the diseases or conditions that benefit from reduced ALK7 gene expression are ALK7-related diseases. In some preferred embodiments, the ALK7-related diseases are selected from the group consisting of: metabolic syndrome, cardiovascular disease, hypertension, type II diabetes, obesity, elevated triglyceride levels, lipid metabolism disorders, liver inflammation, fatty liver disease, liver enzyme-related diseases, non-alcoholic cirrhosis, cardiomyopathy, heart failure, and kidney disease.

[0240] In some embodiments, the dsRNA, cellular or pharmaceutical composition is administered subcutaneously or intravenously.

[0241] In some implementations, the subject is a human being. Attached Figure Description

[0242] Figure 1 shows the activity evaluation results in cynomolgus monkeys (normalized to pre-drug administration).

[0243] Invention Details

[0244] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0245] It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0246] In this specification and claims, unless otherwise expressly stated herein, the singular forms “a,” “one,” and “this” include the plural forms.

[0247] When numerical ranges are given in the implementation scheme, it should be understood that, unless otherwise stated in this invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, devices, and materials used in the embodiments, based on the prior art mastery of one of ordinary skill in the art and the description of this invention, any prior art methods, devices, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention may be used to implement this invention, and all such methods, devices, and materials fall within the protection scope of this invention. The embodiments of this invention are described in more detail below.

[0248] definition

[0249] In this paper, a “double-stranded region” refers to a region containing two antiparallel and complementary or substantially complementary nucleic acid strands.

[0250] As used herein, the term "double-stranded RNA" or "dsRNA" refers to a ribonucleic acid molecule or ribonucleic acid molecule complex containing the double-stranded region as defined above. The two parts forming the double-stranded region can be two distinct parts of a larger RNA molecule, or they can be separate RNA molecules.

[0251] When the two parts are separate RNA molecules, the dsRNA in this article is referred to as small interfering RNA or short interfering RNA, or simply siRNA.

[0252] When two parts are two distinct portions of a larger molecule, i.e., when the 3' end of one part is linked to the 5' end of the other part to form a double-stranded region by one or more uninterrupted nucleotides, the uninterrupted nucleotide used for the linkage is called a "hairpin loop." When the two parts are covalently linked to form a double-stranded region by a method other than a hairpin loop, the linkage structure is called a "linkosome." After such dsRNA is introduced into the cell, it is cleaved into siRNA by an intracellular endonuclease called Dicer.

[0253] The term "siRNA" in this article refers to a class of double-stranded RNA molecules comprising a sense strand and an antisense strand, which can mediate the silencing of target RNAs (e.g., mRNAs, such as transcripts of genes encoding proteins) that are complementary or substantially complementary to the antisense strand. siRNAs are typically double-stranded, consisting of an antisense strand complementary to the target RNA and a sense strand complementary or substantially complementary to that antisense strand. For convenience, such mRNAs are also referred to herein as mRNAs to be silenced. Such genes are also referred to as target genes. Typically, the RNA to be silenced is an endogenous gene or a pathogen gene. Additionally, RNAs other than mRNAs (e.g., tRNAs) and viral RNAs can also be targeted.

[0254] As used herein, the term "antisense strand" refers to a strand in dsRNA (especially siRNA) that contains regions that are fully or substantially complementary to the target sequence.

[0255] As used herein, the term "complementary region" refers to a region on the antisense strand that is perfectly or substantially complementary to the target mRNA sequence. In cases where the complementary region is not perfectly complementary to the target sequence, mismatches can occur within the molecule or at the ends. Typically, the most tolerant mismatches are located in the end regions, for example, within 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends. The portion of the antisense strand most sensitive to mismatches is called the "seed region." For example, in a siRNA containing a 19-nt strand, the 19th position (from 5' to 3') can tolerate some mismatches.

[0256] When used in this context, the term "complementarity" refers to the ability of a first polynucleotide to hybridize with a second polynucleotide under certain conditions, such as stringent conditions. For example, stringent conditions may include 400 mM NaCl, 40 mM PIPES at pH 6.4, and 1 mM EDTA at 50 or 70°C for 12–16 hours.

[0257] As used herein, in order to satisfy the above requirements regarding their hybridization ability, "complementary" sequences may also include base pairs formed entirely from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U swing base pairs or Hoogstein base pairs.

[0258] As used herein, a polynucleotide that is “at least partially complementary” or “substantially complementary” to messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a continuous portion of the mRNA of interest (e.g., the mRNA encoding apolipoprotein(a)). For example, if the sequence is substantially complementary to an uninterrupted portion of the mRNA encoding apolipoprotein(a), then the polynucleotide is at least partially complementary to the mRNA encoding apolipoprotein(a).

[0259] The terms “complementary,” “fully complementary,” and “substantially complementary” as used herein can be used relative to the base pairing between the sense and antisense strands of dsRNA, particularly siRNA, or between the antisense strand of dsRNA, particularly siRNA, and the target sequence.

[0260] As used herein, the term "sense chain" refers to a chain of siRNA that includes regions substantially complementary to the regions defined herein as antisense chains.

[0261] "Nucleoside" is a compound composed of two substances: a purine or pyrimidine base and ribose or deoxyribose. "Nucleotide" is a compound composed of three substances: a purine or pyrimidine base, ribose or deoxyribose, and phosphate. "Oligonucleotide" refers to nucleic acid molecules (RNA or DNA) with a length of less than 100, 200, 300, or 400 nucleotides.

[0262] A "base" is the basic building block for the synthesis of nucleosides, nucleotides, and nucleic acids. Its constituent elements include nitrogen, hence it is also called a "nitrogenous base." In this article, unless otherwise specified, the capital letters A, U, T, G, and C represent the base composition of nucleotides, namely adenine, uracil, thymine, guanine, and cytosine, respectively.

[0263] As used herein, the term "nucleotide overhang" refers to at least one unpaired nucleotide that protrudes from the double-stranded region of siRNA. A nucleotide overhang exists, for example, when the 3' end of one strand of siRNA extends beyond the 5' end of the other strand, or vice versa. siRNA may contain overhangs having at least one nucleotide, at least two nucleotides, at least three nucleotides, at least four nucleotides, or at least five or more nucleotides. A nucleotide overhang may contain or consist of nucleotides / modified nucleotides (including deoxynucleotides / nucleosides). One or more overhangs may be located on the sense or antisense strand, or any combination thereof. An overhang having one or more nucleotides may be present at the 5' end, 3' end, or both ends of the antisense or sense strand of siRNA.

[0264] "Flat-ended" or "blunt-ended" means that there are no unpaired nucleotides at that end of the double-stranded siRNA, i.e., no nucleotide overhangs. "Flat-ended siRNA" is a double-stranded siRNA that is double-stranded along its entire length, meaning that there are no nucleotide overhangs at either end of the molecule.

[0265] The dsRNA (especially siRNA) of the present invention comprises substantially all modified nucleotides. For example, substantially all nucleotides of the sense strand are modified nucleotides, or substantially all nucleotides of the antisense strand are modified nucleotides, or substantially all nucleotides of both the sense and antisense strands are modified nucleotides. In other embodiments of the invention, all nucleotides of the dsRNA (especially siRNA) of the present invention are modified nucleotides. For example, substantially all nucleotides of the sense strand are modified nucleotides, or substantially all nucleotides of the antisense strand are modified nucleotides, or substantially all nucleotides of both the sense and antisense strands are modified nucleotides. As used herein, “substantially all nucleotides are modified” means that the majority, but not all, nucleotides of the dsRNA (especially siRNA) of the present invention are modified, and may include no more than 5, 4, 3, 2, or 1 unmodified nucleotides.

[0266] In this document, "modified nucleotides" include, but are not limited to, 2'-O-alkyl-modified nucleotides (e.g., 2'-O-methyl-modified nucleotides, 2'-methoxyethyl-modified nucleotides), 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, abase-free nucleotides, reverse abase-free deoxyribonucleotides, nucleotides containing a thiophosphate group, thiophosphate ester nucleotide bonds, vinylphosphonate-modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, 2'-C-alkyl-modified nucleotides, and 2'-O-ene nucleotides. Propyl-modified nucleotides, morpholinonucleotides, aminophosphates, nucleotides containing non-natural bases, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid didecylamide groups, deoxyribonucleotides, 3'-terminal deoxythymidine (dT) nucleotides, conformation-restricted nucleotides, restricted ethyl nucleotides, 2'-hydroxy-modified nucleotides, nucleotides containing methylphosphonic acid groups, nucleotides containing 5'-phosphate, nucleotides containing 5'-phosphate mimics, diol-modified nucleotides (GNA), 2-O-(N-methylacetamide)-modified nucleotides, SCP-modified nucleotides, etc.

[0267] For example, "2'-fluorinated nucleotides" refer to nucleotides in which the 2'-hydroxyl group of the ribosome is replaced by fluorine. "2'-O-methyl nucleotides" refer to nucleotides in which the 2'-hydroxyl group of the ribosome is replaced by a methoxy group.

[0268] "A nucleotide containing a thiophosphate group" refers to a nucleotide in which one or more oxygen atoms on the phosphate group are replaced by sulfur atoms. "Modification of internucleotide thiophosphate bonding" refers to a modification in which two adjacent nucleotides are linked by a thiophosphate group.

[0269] In some embodiments, the sense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 5 (counting from the 5' end) and / or has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 5 (counting from the 3' end), and / or the antisense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 5 (counting from the 5' end) and / or has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 5 (counting from the 3' end).

[0270] In some embodiments, the sense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 4 (counting from the 5' end) and / or has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 4 (counting from the 3' end), and / or the antisense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 4 (counting from the 5' end) and / or has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 4 (counting from the 3' end).

[0271] In some embodiments, the sense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 3 (counting from the 5' end) and / or has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 3 (counting from the 3' end), and / or the antisense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 3 (counting from the 5' end) and / or has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 3 (counting from the 3' end).

[0272] In some embodiments, the sense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 and 2 (counting from the 5' end) and / or a modification of one or two phosphate thioester nucleotides bonded at positions 1 and 2 (counting from the 3' end), and / or the antisense strand of the dsRNA (especially siRNA) of this disclosure has a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 2 (counting from the 5' end) and / or a modification of one or two phosphate thioester nucleotides bonded at positions 1 to 2 (counting from the 3' end).

[0273] As used herein, the term “inhibition” is used interchangeably with “reduction,” “silence,” “downregulation,” and other similar terms, and includes any level of inhibition.

[0274] The phrase "suppress ALK7 gene expression" refers to suppressing the expression of any ALK7 gene, as well as its variants or mutants. Therefore, the ALK7 gene can be the wild-type ALK7 gene, the mutant ALK7 gene, or, in the case of genetically manipulated cells, cell groups, or organisms, a transgenic ALK7 gene.

[0275] "Suppression of ALK7 gene expression" includes suppression of any level of the ALK7 gene, such as at least partial suppression of ALK7 gene expression. ALK7 gene expression can be assessed based on the level or level change of any variable associated with ALK7 gene expression, such as the mRNA level encoding ALK7 or the protein level of ALK7. This level can be assessed in a single cell or in a group of cells, including, for example, samples derived from a subject.

[0276] Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with ALK7 gene expression compared to a control level. The control level can be any type of control level utilized in the art, such as baseline levels before administration or levels determined from similar untreated or controlled (e.g., buffer-only control or inert agent control) subjects, cells, or samples.

[0277] As used herein, the terms “treatment,” “management,” etc., refer to the administration of a drug or the performance of a procedure to achieve an effect. These effects may be preventative in terms of complete or partial prevention of a disease or its symptoms, and / or therapeutic in terms of partial or complete cure of the disease and / or its symptoms. As used herein, “treatment” may include treating a disease or condition in mammals, particularly humans, and includes: (a) preventing the occurrence of the disease or its symptoms in subjects susceptible to the disease but not yet diagnosed with it (e.g., including diseases that may be related to or caused by the primary disease); (b) suppressing the disease, i.e., halting its development; and (c) alleviating the disease, i.e., causing its remission. Treatment may refer to any indication of success in treating, improving, or preventing cancer, including any objective or subjective parameter, such as elimination; relief; reduction of symptoms or making the disease condition more tolerable for the patient; slowing the rate of deterioration or decline; or weakening the endpoint of deterioration. Treatment or improvement of symptoms is based on one or more objective or subjective parameters; including the results of a physician’s examination. Therefore, the term "treatment" includes the application of the dsRNA, cellular, or pharmaceutical compositions disclosed in this invention to prevent or delay, alleviate, stop, or inhibit the development of disease-related symptoms or conditions. The term "therapeutic effect" refers to the reduction, elimination, or prevention of disease, disease symptoms, or disease side effects in a subject.

[0278] The term "effective amount" as used in this invention refers to an amount sufficient to treat a disease when administered to a subject for the purpose of treating that disease.

[0279] As used herein, the term “subject” refers to any mammalian subject for diagnosis, treatment, or therapy. For therapeutic purposes, “mammal” means any animal classified as a mammal, including humans, livestock, and laboratory animals, zoo animals, sporting animals, or pet animals, such as dogs, horses, cats, cattle, sheep, goats, pigs, mice, rats, rabbits, guinea pigs, monkeys, etc.

[0280] I.dsRNA

[0281] The present invention provides a double-stranded RNA (dsRNA) for inhibiting ALK7 gene expression, the dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the length of the sense strand and the antisense strand is each independently 15-30 nucleotides, and the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:595-1188.

[0282] In some implementations, the bistranded regions formed by the sense and antisense strands are completely complementary. In other implementations, the bistranded regions formed by the sense and antisense strands are substantially complementary, and may contain one, two, three, four, or five non-complementary sites.

[0283] In some specific embodiments, the positive chain comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:1-594.

[0284] In some implementations, the lengths of the sense strand and the antisense strand are each independently 15-27 nucleotides, preferably 18-25 nucleotides, and more preferably 19-21 nucleotides.

[0285] In some embodiments, the length of the double-stranded region is 15-25 nucleotide pairs, preferably 16-23 nucleotide pairs, and more preferably 18-20 nucleotide pairs.

[0286] In some embodiments, the dsRNA of the present invention is siRNA. In other embodiments, a hairpin loop is formed between the sense and antisense strands of the dsRNA of the present invention.

[0287] One or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang having at least one nucleotide. In some embodiments, one or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang having at least one nucleotide. In some specific embodiments, one or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang having one nucleotide. In some specific embodiments, one or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang having two nucleotides. In some specific embodiments, one or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang having three nucleotides. In some specific embodiments, one or both of the positive and negative strands comprise a 3' overhang and / or a 5' overhang having four nucleotides.

[0288] In some specific embodiments, the antisense strand includes a 3' overhang and / or a 5' overhang of 1 nucleotide. In some embodiments, the antisense strand includes a 3' overhang and / or a 5' overhang of 2 nucleotides. In some embodiments, the antisense strand includes a 3' overhang and / or a 5' overhang of 3 nucleotides. In some embodiments, the antisense strand includes a 3' overhang and / or a 5' overhang of 4 nucleotides. In some preferred embodiments, the antisense strand has a 3' overhang and / or a 5' overhang of at least 2 nucleotides.

[0289] Preferably, the antisense strand comprises a 3' overhang and / or a 5' overhang with 2 nucleotides.

[0290] In some implementations, the justice chain and the antisense chain are of the same length.

[0291] In some implementations, the full length of the justice chain is complementary to the full length of the antisense chain, forming a double chain, i.e., having flat ends.

[0292] In other embodiments, the sense strand and the antisense strand are of the same length, and a portion of the sense strand is complementary to a portion of the antisense strand, i.e., both the sense strand and the antisense strand have a 5' overhang. In some embodiments, the sense strand and the antisense strand are of different lengths. In a preferred embodiment, the 5' end of the antisense strand has an overhang of at least one nucleotide, more preferably two or three nucleotides.

[0293] The dsRNA of the present invention includes dsRNA having a nucleotide overhang at one end (i.e., a reagent having one overhang and one blunt end) or having nucleotide overhangs at both ends. For example, the 5' end of the sense strand of the dsRNA includes an overhang of one or more nucleotides and the 3' end of the sense strand includes an overhang of one or more nucleotides. For example, the 5' end of the antisense strand of the dsRNA includes an overhang of one or more nucleotides and the 3' end of the antisense strand includes an overhang of one or more nucleotides. For example, the 5' end of the sense strand of the dsRNA includes an overhang of one or more nucleotides and the 5' end of the antisense strand includes an overhang of one or more nucleotides. For example, the 3' end of the sense strand of the dsRNA includes an overhang of one or more nucleotides and the 3' end of the antisense strand includes an overhang of one or more nucleotides. For example, the 5' end of the sense strand of the dsRNA includes an overhang of one or more nucleotides and the 3' end of the sense strand includes a blunt end. For example, the 3' end of the sense strand of dsRNA contains a protruding end with one or more nucleotides, and the 5' end of the sense strand contains a blunt end. Similarly, the 5' end of the antisense strand of dsRNA contains a protruding end with one or more nucleotides, and the 3' end of the antisense strand contains a blunt end.

[0294] In some preferred embodiments, the 3' end of the antisense strand of the dsRNA of the present invention includes a protrusion having one or more nucleotides, and the 5' end of the antisense strand includes a blunt end. In some more preferred embodiments, the 3' end of the antisense strand of the dsRNA of the present invention includes a protrusion having one, two, three, or four nucleotides, and the 5' end of the antisense strand includes a blunt end. In some more preferred embodiments, the 3' end of the antisense strand of the dsRNA of the present invention includes a protrusion having two nucleotides, and the 5' end of the antisense strand includes a blunt end.

[0295] In some embodiments, the antisense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, or at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 595-1188, preferably the antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NO: 595-1188.

[0296] In some embodiments, the positive chain comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, or at least 18 consecutive nucleotides of any of the nucleotide sequences shown in SEQ ID NO:1-594, preferably the positive chain comprises a nucleotide sequence shown in any of SEQ ID NO:1-594.

[0297] In some embodiments, the dsRNA comprises any pair of paired sense and antisense sequences as shown in Table 3.

[0298] II. Nucleotide Modification

[0299] In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least 80% of the nucleotides of the sense strand are modified nucleotides, and / or at least 80%, at least 85%, at least 90%, at least 92%, or at least 95% of the nucleotides of the antisense strand are modified nucleotides. In some embodiments, at least 80% of the nucleotides of the antisense strand are modified nucleotides, and / or at least 80%, at least 85%, at least 90%, at least 92%, or at least 95% of the nucleotides of the sense strand are modified nucleotides.

[0300] In some embodiments, all nucleotides of the sense strand are modified nucleotides and / or all nucleotides of the antisense strand are modified nucleotides.

[0301] The nucleotide modification described in this invention can be a modification on the phosphate group, ribose group and / or base group of the nucleotide.

[0302] In some specific embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-O-alkyl-modified nucleotides (e.g., 2'-O-methyl-modified nucleotides), 2'-methoxyethyl-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, baseless nucleotides, reverse baseless deoxyribonucleotides, nucleotides containing a thiophosphate group, vinylphosphonate-modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-O - Allyl-modified nucleotides, morpholinonucleotides, aminophosphates, nucleotides containing non-natural bases, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid di ...

[0303] In some preferred embodiments, the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, nucleotides containing a thiophosphate group, reverse abase-free deoxyribonucleotides, and SCP modifications. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least two 2'-fluoro modified nucleotides. In some preferred embodiments, the sense strand and / or the antisense strand comprises at least eight 2'-O-methyl modified nucleotides. In some preferred embodiments, the 3' and / or 5' ends of the sense strand and / or the antisense strand comprise 1-5 thiophosphate nucleotide bonds, preferably 2-3 thiophosphate nucleotide bonds.

[0304] In some preferred embodiments, the antisense strand comprises any one of the modified antisense strand sequences shown in Tables 5, 14, 17, or 19, and / or the sense strand comprises any one of the modified sense strand sequences shown in Tables 4, 14, 17, or 19. In some preferred embodiments, the dsRNA comprises paired modified sense strand sequences and modified antisense strand sequences.

[0305] IV. ALK7 gene expression inhibition

[0306] The dsRNA of the present invention is capable of inhibiting ALK7 gene expression by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0307] The inhibition of ALK7 gene expression can be manifested by a reduction in the amount of mRNA expressed by a first cell or cell group (such cells may be present, for example, in a sample derived from a subject), wherein the ALK7 gene is transcribed and the cell or these cells have been treated (e.g., by contacting the cell or these cells with the dsRNA of the present invention, or by administering the dsRNA of the present invention to a subject who currently or previously has these cells), such that ALK7 gene expression is inhibited compared to a second cell or cell group (one or more control cells) that is substantially the same as the first cell or cell group but has not been so treated.

[0308] In a preferred embodiment, the inhibition is assessed by expressing the level of mRNA in the treated cells as a percentage of the level of mRNA in the control cells using the following formula. In some specific embodiments, 2 is calculated. -△△Ct The value is used to compare the difference between the experimental group and the control group, where △Ct=[(Ct target gene of experimental group - Ct internal reference of experimental group) - (Ct target gene of control group - Ct internal reference of control group)].

[0309] Control cells or cell populations that can be used to assess the inhibition of ALK7 gene expression include cells or cell populations that have not been contacted with the dsRNA of the present invention. For example, such control cells or cell populations may be derived from individual subjects (e.g., human or animal subjects) prior to treatment with the dsRNA.

[0310] V. Cells

[0311] The present invention provides a cell containing the dsRNA described herein.

[0312] VI. Pharmaceutical Composition

[0313] The present invention provides pharmaceutical compositions comprising the dsRNA or cells described herein, and optionally pharmaceutically acceptable carriers or excipients.

[0314] As used in this article, "pharmaceutically acceptable" means compounds, materials, compositions, and / or dosage forms that, to the extent of proper medical judgment, are suitable for contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic reactions, or other problems or complications, and are commensurate with a reasonable benefit / risk ratio.

[0315] In this article, pharmaceutically acceptable carriers refer to drug carriers that facilitate the delivery of dsRNA or its containing cells to the human body and / or promote its absorption or efficacy. Examples include: diluents, excipients such as water; fillers such as starch and sucrose; binders such as cellulose derivatives, alginate, gelatin, and polyvinylpyrrolidone; humectants such as glycerin; disintegrants such as agar, calcium carbonate, and sodium bicarbonate; absorption enhancers such as quaternary ammonium compounds; surfactants such as hexadecyl alcohol; adsorbents such as kaolin and soap clay; and lubricants such as talc, calcium / magnesium stearate, and polyethylene glycol. Other excipients such as flavoring agents and sweeteners may also be added to the composition.

[0316] The pharmaceutical compositions of the present invention may contain a pharmaceutically acceptable diluent or a sustained-release matrix in which the dsRNA or cells of the present invention are embedded.

[0317] The pharmaceutical compositions of the present invention may comprise a drug delivery system for delivering dsRNA. The drug delivery systems of the present invention include, but are not limited to, nanoparticles (e.g., lipid nanoparticles, polymer-based nanoparticles), polymers, PEG, or cationic delivery systems, polylactic acid (PLA) microspheres, polylactic acid-glycolic acid copolymer (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid cochleates, lipid microtubules, cholesterol, PEG lipids PEG-2000-C-DMG, PEG-2000-DMG (Moderna), ALC-0159, or DSPC.

[0318] In some embodiments, the dsRNA in the pharmaceutical compositions of the present invention may be contained in polymers and polymer-based nanoparticles.

[0319] In some specific embodiments, the polymer is based on poly(lactic-co-glycolic acid) copolymer (PLGA). In some specific embodiments, the PLGA-based polymer is modified to contain individual cationic groups.

[0320] In some specific embodiments, the polymer contains amine groups capable of becoming cationic, such as polyethyleneimine (PEI) and poly(L-lysine) (PLL), which can form a complex with dsRNA via electrostatic interactions and deliver dsRNA into cells. In some embodiments, PEG and PLL are chemically modified to improve in vivo potency and tolerability.

[0321] In some embodiments, the siRNA or cells in the pharmaceutical composition of the present invention can be delivered via the cationic polymer poly(β-amino ester) (PBAE).

[0322] VII. Reagent Kit

[0323] This invention provides a kit containing the dsRNA or cells described herein.

[0324] The present invention also provides a kit for using the dsRNA or cells described herein and / or performing the methods of the present invention. Such a kit comprises one or more of the dsRNA or cells described herein, and may further comprise instructions for use. These instructions may describe methods for inhibiting ALK7 gene expression in cells by contacting the cells with the dsRNA described herein in an amount that effectively inhibits ALK7 gene expression.

[0325] In the case of in vitro contact between the dsRNA described in this invention and cells, the kit of this invention may optionally include a tool for contacting cells with the dsRNA described in this invention (e.g., an injection device) or a tool for measuring the inhibitory effect on the ALK7 gene (e.g., a device for measuring the inhibition of ALK7 mRNA or protein). Such a device for measuring the inhibition of the ALK7 gene may include a device for obtaining a sample from a subject.

[0326] When administering the dsRNA of the present invention or cells that have already been introduced with dsRNA in vitro into the body, the kit of the present invention may optionally include means for administering the dsRNA or cells of the present invention to a subject or means for determining a therapeutically effective amount or a preventatively effective amount.

[0327] VIII. Treatment methods and pharmaceutical uses

[0328] This invention provides a method for inhibiting ALK7 gene expression in cells, the method comprising contacting the cells with a dsRNA or pharmaceutical composition as described herein. In some embodiments, the method is performed in vitro. This invention provides the dsRNA or pharmaceutical composition described herein for inhibiting ALK7 gene expression in cells.

[0329] This invention provides a method for inhibiting ALK7 gene expression in cells of a subject, the method comprising administering to the subject a dsRNA, cell, or pharmaceutical composition as described herein. This invention provides dsRNA, cell, or pharmaceutical compositions of this invention for inhibiting ALK7 gene expression in cells of a subject. This invention provides the use of dsRNA, cell, or pharmaceutical compositions of this invention in the preparation of a medicament for inhibiting ALK7 gene expression in cells of a subject.

[0330] The present invention also provides a method for treating a disease or condition in which a subject benefits from reduced ALK7 gene expression, the method comprising administering to the subject a dsRNA, cell, or pharmaceutical composition as described herein. The present invention also provides a dsRNA, cell, or pharmaceutical composition of the present invention for treating a disease or condition in which a subject benefits from reduced ALK7 gene expression. The present invention further provides the use of the dsRNA, cell, or pharmaceutical composition of the present invention in the preparation of a medicament for treating a disease or condition in which a subject benefits from reduced ALK7 gene expression.

[0331] The present invention also provides a method for preventing at least one symptom in a subject suffering from a disease or condition that benefits from reduced ALK7 gene expression, the method comprising administering to the subject a dsRNA, cell, or pharmaceutical composition as described in the present invention. The present invention also provides dsRNA, cell, or pharmaceutical compositions of the present invention for preventing a disease or condition that benefits from reduced ALK7 gene expression. The present invention further provides the use of dsRNA, cell, or pharmaceutical compositions of the present invention in the preparation of a medicament for preventing a disease or condition that benefits from reduced ALK7 gene expression.

[0332] The present invention also provides a method for preventing the progression of a disease or condition in which a subject benefits from reduced ALK7 gene expression, the method comprising administering to the subject a dsRNA, cell, or pharmaceutical composition as described herein. The present invention also provides dsRNA, cell, or pharmaceutical compositions of the present invention for preventing the progression of a disease or condition in which a subject benefits from reduced ALK7 gene expression. The present invention further provides the use of dsRNA, cell, or pharmaceutical compositions of the present invention in the preparation of a medicament for preventing the progression of a disease or condition in which a subject benefits from reduced ALK7 gene expression.

[0333] In some embodiments, the diseases or conditions that benefit from reduced ALK7 gene expression are ALK7-related diseases. In some preferred embodiments, the ALK7-related diseases are selected from the group consisting of: metabolic syndrome, cardiovascular disease, hypertension, type II diabetes, obesity, elevated triglyceride levels, lipid metabolism disorders, liver inflammation, fatty liver disease, liver enzyme-related diseases, non-alcoholic cirrhosis, cardiomyopathy, heart failure, and kidney disease.

[0334] In some embodiments, the dsRNA, cellular or pharmaceutical composition is administered subcutaneously or intravenously.

[0335] In some embodiments, the subject is a mammal. In some embodiments, the subject is a primate mammal. In some embodiments, the subject is a human.

[0336] sequence

[0337] The RNA sequence provided by this invention targets the human ALK7 gene (or target gene, target mRNA sequence, target sequence). The target ALK7 mRNA sequence is, for example, the gene shown in GenBank accession number NM_145259.3.

[0338] Table 3. Nucleotide sequences of the sense and antisense strands targeting ALK7 mRNA

[0339] Tables 4 and 5 show the modified RNA sequences used in this invention.

[0340] The meanings of the abbreviations in this article are as follows:

[0341] The distributions A, U, G, and C represent naturally occurring adenine ribonucleotides, uracil ribonucleotides, guanine ribonucleotides, and cytosine ribonucleotides.

[0342] The 'd' indicates that the nucleotide adjacent to its right is a deoxyribonucleotide. For example, dA, dT, dG, and dC represent adenine deoxyribonucleotide, thymine deoxyribonucleotide, guanine deoxyribonucleotide, and cytosine deoxyribonucleotide, respectively.

[0343] i represents inosine ribonucleotide.

[0344] The 'm' indicates that the nucleotide adjacent to it on the left is a nucleotide modified with 2'-OCH3. For example, Am, Um, Gm, and Cm represent A, U, G, and C modified with 2'-OCH3, respectively.

[0345] The 'f' indicates that the nucleotide adjacent to it on the left is a 2'-fluoro modified nucleotide. For example, Af, Uf, Gf, and Cf represent 2'-fluoro modified A, U, G, and C, respectively.

[0346] “s” or s- indicates that the two adjacent nucleotides and / or ligands are linked by a thiophosphate.

[0347] VP indicates that the nucleotide adjacent to its right is a vinylphosphonate-modified nucleotide, which is well known in the art, and can be found in, for example, PCT publications WO2011139702, WO2013033230 and WO2019105419.

[0348] IB or Ib represents inverted abase-free deoxyribonucleotide, which can include the following three structures (used for the 5' end, middle, and 3' end of the nucleic acid strand, respectively) depending on its position / linking method in siRNA:

[0349] IB is well known in the art, see, for example, F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16 and PCT publications WO2016011123 and WO2019051402.

[0350] "SCP-modified nucleotides" refers to nucleotides with the following modified structures: The Base is independently selected from H, modified or unmodified bases, or leaving groups. Preferably, the Base is an unmodified base, including adenine, guanine, uracil, and cytosine bases. In other embodiments, the Base is a modified base.

[0351] (SCP-U) indicates the above structure with a base of uracil.

[0352] L96 represents a GalNAc delivery vector with the following structure well known in the art, wherein... The location indicated by the phosphate ester group or thiophosphate ester group linked to dsRNA can be found, for example, in PCT publications WO2009073809 and WO2009082607.

[0353] GL6 represents the GalNAc delivery vector with the following structure, where Indicates the position where it is linked to dsRNA via a phosphate ester group or a thiophosphate ester group.

[0354] The structures of the ligands used in this paper are shown in Table A below. This indicates the position where the intermediate compound is linked to the dsRNA via a phosphate ester group or a thiophosphate ester group. For the preparation methods of the corresponding intermediate compounds, please refer to, for example, PCT publications WO2024148329 and WO2025146138.

[0355] The structures of NHC6, C6NH and C6S can be found in PCT Publication No. WO2025146138.

[0356] Table A

[0357] Table 4. Sensitive strand sequences of modified siRNAs targeting ALK7 mRNA

[0358] Table 5. Antisense strand sequences of modified siRNAs targeting ALK7 mRNA

[0359] Table 6. Paired siRNAs targeting ALK7 mRNA: sense and antisense strands

[0360] In addition to the paired siRNAs listed in Table 6 above, the paired siRNAs targeting ALK7 mRNA of the present invention also include the corresponding positive strand sequences in Table 4 and the antisense strand sequences in Table 5. For example, the siRNA compound DR013283 of the present invention refers to an siRNA compound with a positive strand of DR013283-SS and an antisense strand of DR013283-AS.

[0361] In this paper, the paired sequences in Tables 4 and 5 include the paired positive and negative chains listed in Table 6. Except for Table 6, the paired sequences in Tables 4 and 5 refer to positive and negative chains with the same number.

[0362] Those skilled in the art will understand that the number and position of the inter-nucleotide bonds in the siRNA compounds of the present invention are not limited to the number and position shown in the sequences shown in Tables 4, 5, 14, 17 and 19. Those skilled in the art can adjust the number and position of the inter-nucleotide bonds in the siRNA compounds of the present invention without changing the sequence and methoxy / fluorinated modifications, and add or omit ligands, such as ligands targeting adipocytes, based on the teachings of Tables 4, 5, 14, 17 and 19. These adjusted sense strands, antisense strands and paired siRNAs are also included within the scope of the present invention.

[0363] The present invention will be further described below with reference to embodiments. It should be understood that the following embodiments are merely illustrative and should not be considered as limiting the scope of the present invention. Example

[0364] The following examples are for illustrative purposes only and are not intended to limit the scope of this application. Experimental methods not specifically described in the following examples were performed under conventional conditions in the art. Unless otherwise stated, all experimental materials and reagents used in the following examples are commercially available.

[0365] Example 1: Preparation of siRNA

[0366] The siRNA of the present invention was prepared using the solid-phase phosphoramide method well known in the art. Specific methods can be found, for example, in PCT publications WO2016081444 and WO2019105419, and are briefly described below.

[0367] 1.1 Synthesis of the Justice Chain (SS Chain)

[0368] The oligonucleotide was synthesized using a solid-phase phosphoramide method, starting with a blank CPG solid support. Nucleoside monomers were sequentially linked from the 3'-5' direction according to the nucleotide arrangement of the positive strand. Each linkage of a nucleoside monomer involved four steps: deprotection, coupling, capping, and oxidation or thiolation. The synthetic conditions for a scale of 5 μmol of oligonucleotides are as follows:

[0369] Commercially available phosphoramids with 2'-F, 2'-O-methyl, and other modifications were used. The nucleoside monomers were provided in a 0.05 mol / L acetonitrile solution. Each reaction step was performed under identical conditions: 25°C. Deprotection was performed three times using a 3% trichloroacetic acid-dichloromethane solution. Coupling was performed twice using a 0.25 mol / L ETT-acetonitrile solution as the activator. Capping was performed twice using a 10% acetic anhydride-acetonitrile and pyridine / N-methylimidazole / acetonitrile mixture (10:14:76, v / v / v). Oxidation was performed twice using a 0.05 mol / L iodine / tetrahydrofuran / pyridine / water mixture (70 / 20 / 10, v / v / v). Thiolysis was performed twice using 0.2 mol / L PADS in an acetonitrile / 3-methylpyridine mixture (1 / 1, v / v).

[0370] 1.2 Synthesis of the antisense chain (AS chain)

[0371] The solid-phase phosphoramide synthesis method utilizes a blank CPG solid-phase support as the starting cycle, and nucleotide monomers are sequentially linked from the 3'-5' direction according to the nucleotide arrangement sequence of the antisense strand. Each linkage of a nucleotide monomer involves four steps: deprotection, coupling, capping, and oxidation or thiolation. The synthesis conditions for 5 μmol oligonucleotides of the antisense strand are the same as those for the sense strand.

[0372] 1.3 Purification and Annealing of Oligonucleotides

[0373] 1.3.1 Ammonolysis

[0374] The synthesized solid support (sense or antisense chain) was added to a 5 mL centrifuge tube, and 3% diethylamine / ammonia (v / v) was added. The mixture was reacted in a 35°C water bath for 16 hours (or in a 55°C water bath for 8 hours). After filtration, the solid support was washed three times with 1 mL of ethanol / water each time. The filtrate was centrifuged and concentrated, and the crude product was purified.

[0375] 1.3.2 Purification

[0376] Purification and desalting methods are well known to those skilled in the art. For example, a column packed with strong anion exchange media can be used for elution purification with a sodium chloride-sodium hydroxide system, and the product can be collected and piped. Desalting can be performed using a gel-packed purification column with pure water as the elution system.

[0377] 1.3.3 Annealing

[0378] According to Tables 6, 14, 17 or 19, the sense chain (SS chain) and the antisense chain (AS chain) are mixed in a molar ratio (SS chain / AS chain = 1 / 1.05), heated in a water bath to 70-95℃, held for 3-5 minutes, and then naturally cooled to room temperature. The system is then freeze-dried to obtain the product.

[0379] Example 2: Screening of Huh7 cell line viability

[0380] Cell reverse transfection

[0381] After digesting the cell lines, resuspend them, count them, and seed them in 96-well plates at 90 μL / well, 2 × 10⁻⁶ cells / well. 4 Cells / well

[0382] Compound dilution: The 20 μM stock solution of the compound was diluted with Opti-MEM. 198 μL of Opti-MEM was added to 2 μL of the stock solution, and the mixture was thoroughly mixed by pipetting. The solution was then set aside for later use. For each experiment, the appropriate dilution procedure was performed according to the specific experimental requirements.

[0383] Transfection complex preparation: Dilute 0.9 μL of RNAiMAX (Thermo, 13778150) with 14.1 μL of Opti-MEM, gently pipette to mix, and incubate at room temperature for 5 minutes. Then, take 15 μL of the prepared RNAi-MAX mixture and 15 μL of the diluted compound, gently pipette to mix, incubate at room temperature for 10 minutes, and add 10 μL / well to a 96-well plate. Incubate at 37°C and 5% CO2 for 48 hours, then extract RNA.

[0384] RNA extraction

[0385] Cell RNA was extracted using a nucleic acid extractor (Hangzhou Aosheng, Auto-pure96) following the instructions of the high-throughput cell RNA extraction kit (Shanghai Fushen Biotechnology, FSF0035-CS-96T).

[0386] RNA reverse transcription

[0387] Refer to PrimeScript for the preparation of denaturing reaction mixtures. TM II 1st Strand cDNA Synthesis Kit (Takara, 6210B) Single well preparation volume: Oligo dT Primer 1μL, dNTP Mixture 1μL, template RNA 12.5μL. Incubate at 65℃ in a standard PCR instrument for 5 minutes, then rapidly cool on ice for 2 minutes.

[0388] The reverse transcription reaction solution was prepared according to PrimeScript. TMII 1st Strand cDNA Synthesis Kit (Takara, 6210B). Each well contains 4 μL of 5×Prime Script II Buffer, 0.5 μL of RNase Inhibitor, and 1 μL of Prime Script II RTase.

[0389] 14.5 μL of the denatured reaction solution was slowly mixed with the reverse transcription reaction solution, and the reverse transcription was performed by incubating at 42°C for 45 minutes in a conventional PCR instrument. The enzyme was then inactivated by incubating at 95°C for 5 minutes, and the reverse transcription product (cDNA) was cooled at 4°C.

[0390] After the reversal is complete, add 30 μL of distilled water (free of DNase and RNase) to each well of the cDNA sample.

[0391] Real-time PCR

[0392] ReferenceTaqMan TM The procedure for using Fast Advanced Master Mix (ABI, 4444965) was followed by quantitative real-time PCR (qPCR) in a 20 μL volume (ABI, QuantStudio3). The reaction program was: (50℃, 2 min) × 1 cycle; (95℃, 20 s) × 1 cycle; (95℃, 1 s; 60℃, 24 s) × 40 cycles.

[0393] Table 7. Primer Information

[0394] Data statistics

[0395] Calculate 2 -△△Ct The values ​​are then converted to percentages to obtain the residual inhibition rate;

[0396] △△Ct=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].

[0397] The target gene is hALK7, and the internal reference is hGAPDH.

[0398] Using the Huh7 cell line (Nanjing Kebai, catalog number CBP60202), high-throughput screening of siRNA compound cell line activity was performed at final concentrations of 10 nM and 1 nM. The experimental screening results are shown in the table below. ND indicates not detected.

[0399] Table 8. Results of Huh7 cell line viability screening ND: Not detected

[0400] Example 3: Screening of Huh7 cell line viability

[0401] Following the method described in Example 2, the Huh7 cell line was selected, and the final concentration of the compound was chosen to screen for siRNA compound activity at 10 nM. The results are shown in the table below.

[0402] Table 9. Results of Huh7 cell line viability screening

[0403] Example 4: Screening of Huh7 cell line viability

[0404] Following the method described in Example 2, the Huh7 cell line was selected, and siRNA compound activity was screened at final concentrations of 10 nM and 1 nM. The results are shown in the table below.

[0405] Table 10. Results of Huh7 cell line viability screening

[0406] Example 5 AAV Activity Screening

[0407] AAV8 virus carrying the human ALK7 gene fragment (purchased from Heyuan Biotechnology) was injected into mice via the tail vein at a dose of 1 x 10-1. 11 vg. Day -14 was defined as the day of viral injection. siRNA was administered subcutaneously on day 0 at a dose of 3 mg / kg, with 4-5 mice per group. Mice were euthanized on day 14 (D14). Subsequent tissue collection was performed: liver tissue was harvested; left lobe liver tissue was placed in an RNAlater and incubated overnight at 4°C for RNA extraction; the remaining tissue was stored at -80°C.

[0408] RNA extraction was performed using a nucleic acid extractor (Hangzhou Aosheng, Auto-pure96) following the instructions of the high-throughput cell RNA extraction kit (Shanghai Fushen Biotechnology, FSF0035-TS).

[0409] The methods for RNA reverse transcription and quantitative real-time PCR are as described above, and the primer sequences used are shown in the table below. The residual inhibition rate was calculated using the same method as described above.

[0410] Table 11. Primer Information

[0411] Table 12. Activity evaluation results in AAV mice

[0412] Example 6: In vivo activity screening in mice

[0413] Six- to eight-week-old B6-hACVR1C mice (purchased from Jicui Pharmaceutical, Strain NO. T066492) were used. All mice were acclimatized for at least 3 days after entering the facility, and their body weight was measured. Mice were randomly assigned to groups of 3-4 mice each, with the grouping day defined as Day-1.

[0414] All mice were administered the drug subcutaneously on Day 0 at a dose of 3 mg / kg. On Day 14 post-administration, the mice were euthanized, and inguinal white adipose tissue (iWAT), perigonial white adipose tissue (pgWAT), and brown adipose tissue (BAT) were collected from all mice. mRNA was extracted according to the methods described above, and the expression level of ALK7 mRNA was detected using the following primers to calculate the residual inhibition rate.

[0415] Table 13. Primer Information

[0416] Table 14. Sequences used in this embodiment

[0417] Table 15. Experimental results of RNAi reagents in mouse models

[0418] Example 7: Evaluation of the efficacy of the drug in cynomolgus monkeys

[0419] Cynomolgus monkeys were grouped according to their adipose ALK7 mRNA levels, body weight, and age, with 2-3 animals in each group. A single subcutaneous injection of 3 mg / kg was administered. Adipose tissue samples were collected on day 7 (D-7, predose) and on days 15, 29, 43, 57, 71, and 85 after administration. ALK7 mRNA expression levels were extracted using the methods described above, and the residual inhibition rate was calculated using the primers listed below.

[0420] Table 16. Primer Information

[0421] (The following information is for internal control primers only. The monkey ALK7 detection primers were purchased from Thermo Fisher Scientific, catalog number Mf00899854_m1, specification number 4351370.)

[0422] Example 8: Evaluation of the efficacy of the drug in cynomolgus monkeys

[0423] The compounds shown in Table 17 were tested according to the method in Example 7. The results are shown in Table 18.

[0424] Table 17. Sequences used in this embodiment

[0425] Table 18. Activity evaluation results in cynomolgus monkeys (expressed as residual percentage, normalized to pre-drug administration) ND: Not detected

[0426] Example 9: In vitro and in vivo efficacy evaluation

[0427] Following the methods in Examples 3-7, the naked nucleotide sequences of the compounds tested in Examples 6-8 were screened, and the compounds shown in Table 19 were synthesized and their activities were further verified.

[0428] The tested sequence effectively suppressed the expression of the target gene.

[0429] Table 19. Sequences used in this embodiment

Claims

1. A double-stranded RNA (dsRNA) for inhibiting ALK7 gene expression, said dsRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the length of the sense strand and the antisense strand are each independently 15-30 nucleotides, and said antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:595-1188. Preferably, the antisense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:820, SEQ ID NO:890, SEQ ID NO:1003, SEQ ID NO:868, SEQ ID NO:967, SEQ ID NO:975, SEQ ID NO:974, SEQ ID NO:930, SEQ ID NO:979, SEQ ID NO:999, SEQ ID NO:948, SEQ ID NO:1011, SEQ ID NO:989, SEQ ID NO:998, SEQ ID NO:1013, SEQ ID NO:1017, or SEQ ID NO:1025.

2. The dsRNA of claim 1, wherein the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1-594. Preferably, the positive chain comprises a nucleotide sequence of at least 15 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:226, SEQ ID NO:296, SEQ ID NO:409, SEQ ID NO:274, SEQ ID NO:373, SEQ ID NO:381, SEQ ID NO:380, SEQ ID NO:336, SEQ ID NO:385, SEQ ID NO:405, SEQ ID NO:354, SEQ ID NO:417, SEQ ID NO:395, SEQ ID NO:404, SEQ ID NO:419, SEQ ID NO:423, or SEQ ID NO:

431.

3. The dsRNA of claim 1 or 2, wherein the dsRNA is siRNA.

4. The dsRNA of any one of claims 1-3, wherein the length of the sense strand and the antisense strand is each independently 15-27 nucleotides, preferably 18-25 nucleotides, more preferably 19-21 nucleotides.

5. The dsRNA of any one of claims 1-4, wherein the antisense strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, or at least 20 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 595-1188, preferably the antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NO: 595-1188.

6. The dsRNA of any one of claims 1-5, wherein the positive strand comprises a nucleotide sequence of at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, or at least 18 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO: 1-594, preferably the positive strand comprises a nucleotide sequence shown in any one of SEQ ID NO: 1-594.

7. The dsRNA of any one of claims 1-6, wherein the siRNA comprises any pair of paired sense and antisense sequences as shown in Table 3 of the specification.

8. The dsRNA of claim 7, wherein: (a) The justice chain contains GCGGUAUCUGAAUAUCAA (SEQ ID NO:226), and the antisense chain contains UUGAUAUUCAGAUACCAGCCA (SEQ ID NO:820). (b) The justice chain contains CUGUGAAGCAUGAUUCAAA (SEQ ID NO:296), and the antisense chain contains UUUGAAUCAUGCUUCACAGCC (SEQ ID NO:890); (c) The justice chain contains AAGACAGUACAGUAUUUAA (SEQ ID NO:409), and the antisense chain contains UUAAAUACUGUACUGUCUUAU (SEQ ID NO:1003); (d) The justice chain contains UGCUAUUGCUCAUCGAGAA (SEQ ID NO:274), and the antisense chain contains UUCUCGAUGAGCAAUAGCAGG (SEQ ID NO:868). (e) The justice chain contains CAGUGGCAAAGUUGUGAAA (SEQ ID NO:373), and the antisense chain contains UUUCACAACUUUGCCACUGGU (SEQ ID NO:967); (f) The justice chain contains CCUAACUGCUCUUCGUAUA (SEQ ID NO:381), and the antisense chain contains UUACGAAGAGCAGUUAGGCG (SEQ ID NO:975). (g) The justice chain contains GCCUAACUGCUCUUCGUAA (SEQ ID NO:380), and the antisense chain contains UUACGAAGAGCAGUUAGGCGG (SEQ ID NO:974). (h) The justice chain contains GAUGAUACAAUGAAUGUGA (SEQ ID NO:336), and the antisense chain contains UCACAUUCAUUGUAUCAUCAA (SEQ ID NO:930). (i) The justice chain contains GCUCUUCGUAUUAAGAAGA (SEQ ID NO:385), and the antisense chain contains UCUUCUUAAUACGAAGAGCAG (SEQ ID NO:979). (j) The justice chain contains AAGAUAAGACAGUACAGUA (SEQ ID NO:405), and the antisense chain contains UACUGUACUGUCUUAUCUUUG (SEQ ID NO:999); (k) The justice chain contains AUGACCAAUUGCCUUAUUA (SEQ ID NO:354), and the antisense chain contains UAUAAGGCAAUUGGUACUCC (SEQ ID NO:948). (l) The justice chain contains GGGCAGGAGUUGACUUCAA (SEQ ID NO:417), and the antisense chain contains UUGAAGUCAACUCCUGCCCAU (SEQ ID NO:1011). (m) The justice chain contains CCUAAUGAUGAUAAUUAUA (SEQ ID NO:395), and the antisense chain contains UAUAAUUAUCAUCAUUAGGCU (SEQ ID NO:989); (n) The justice chain contains AAAGAUAAGACAGUACAGA (SEQ ID NO:404), and the antisense chain contains UCUGACUGUCUUAUCUUUGA (SEQ ID NO:998). (o) The justice chain contains AGGAGUUGACUUCAUCCAA (SEQ ID NO:419), and the antisense chain contains UUGGAUGAAGUCAACUCCUGC (SEQ ID NO:1013). (p) The justice chain contains CAAAAGUAUAAAAUAAGCA (SEQ ID NO:423), and the antisense chain contains UGCUUAUUUUAUACUUUUGUA (SEQ ID NO:1017); or (q) The justice chain contains AGUUAGCAGGACUUUUUAA (SEQ ID NO:431), and the antisense chain contains UUAAAAAGUCCUGCUAACUUA (SEQ ID NO:1025).

9. The dsRNA of any one of claims 1-8, wherein substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides, or wherein all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

10. The dsRNA of claim 9, wherein the sense strand and the antisense strand each independently comprise one or more modified nucleotides selected from the group consisting of: 2'-O-alkyl modified nucleotides (e.g., 2'-O-methyl modified nucleotides), 2'-methoxyethyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, inosine ribonucleotides, baseless nucleotides, reverse baseless deoxyribonucleotides, nucleotides containing a thiophosphate group, vinylphosphonate modified nucleotides, locked nucleotides, unlocked nucleotides, 2'-amino-modified nucleotides, 2'-C-alkyl-modified nucleotides... Nucleotides, 2'-O-allyl modified nucleotides, morpholinonucleotides, aminophosphates, nucleotides containing non-natural bases, terminal nucleotides linked to cholesterol derivatives or dodecanoic acid di ...

11. The dsRNA of claim 10, wherein the sense strand and the antisense strand each independently comprise one or more nucleotide modifications selected from the group consisting of: 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, nucleotides containing a thiophosphate group, reverse abase-free deoxyribonucleotides, and SCP modified nucleotides.

12. The dsRNA of any one of claims 9-11, wherein the 3' end and / or 5' end of the sense strand and / or the antisense strand comprises 1-5 phosphate thionucleotide bonds, preferably 2-4 phosphate thionucleotide bonds.

13. The dsRNA of any one of claims 9-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) nucleotides with 2'-O-methyl modification at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and nucleotides with 2'-fluoro modification at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20; and / or (ii) Bonding between 1-2 phosphate thioester nucleotides located in the 5' and 3' end regions.

14. The dsRNA of any one of claims 9-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) SCP modification located at position 1; (ii) (counting from the 5' end) 2'-fluorinated modifications at positions 2, 4, 6, 8, 10, 12, 14, 16 and 18; (iii) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, and 21; and / or (iv) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

15. The dsRNA of any one of claims 9-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) SCP modification located at position 1; (ii) (counting from the 5' end) 2'-fluorinated modifications at positions 2, 7, 12, 14 and 16; (iii) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 4, 5, 6, 8, 9, 10, 11, 13, 15, 17, 19, 20, and 21; and / or (iv) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

16. The dsRNA of any one of claims 9-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) SCP modification located at position 1; (ii) (counting from the 5' end) 2'-fluorinated modifications at positions 2, 5, 7, 12 and 14; (iii) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or (iv) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

17. The dsRNA of any one of claims 9-12, wherein the antisense strand has a length of 21 nucleotides and has (i) (counting from the 5' end) 2'-deoxygenation modifications at positions 2, 5, 7 and 12; (ii) (Counting from the 5' end) SCP modification located at position 1; (iii) (Counting from the 5' end) 2'-fluorinated modification at position 14; (iv) (counting from the 5' end) 2'-O-methyl modifications at positions 3, 4, 6, 8, 9, 10, 11, 13, 15, 16, 17, 18, 19, 20, and 21; and / or (v) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

18. The dsRNA of any one of claims 9-17, wherein the sense strand has a length of 19 nucleotides and has: (i) (counting from the 5' end) nucleotides with 2'-O-methyl modification at positions 1 to 6 and 10 to 19, and nucleotides with 2'-fluoro modification at positions 7 to 9; (ii) Optional IB modifications located at the 5' end and / or the 3' end; and / or (iii) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

19. The dsRNA of any one of claims 9-17, wherein the sense strand has a length of 21 nucleotides and has: (i) (counting from the 5' end) nucleotides with 2'-O-methyl modification at positions 1 to 8 and 12 to 21, and nucleotides with 2'-fluoro modification at positions 9 to 11; and / or (ii) Optional IB modifications located at the 5' end and / or the 3' end; and / or (iii) Bonding between 1-2 thiophosphate nucleotides located in the 5' and 3' end regions.

20. The dsRNA of any one of claims 1-19, comprising any one of the modified antisense strands shown in Table 5 of the specification, and / or any one of the modified sense strands shown in Table 4 of the specification.

21. The dsRNA of claim 20, wherein the dsRNA comprises a pair of modified sense strands and modified antisense strands as shown below, or comprises a pair of modified sense strands and modified antisense strands as shown in Tables 4 and 5 of the specification, preferably the dsRNA comprises a pair of modified sense strands and modified antisense strands as shown below: (1) The chain of justice includes GmCmUmGmGmUmAfUfCfUmGmAmAmUmAmUmCmAmAm(SEQ ID NO:1254), and the antisense chain contains (SCPUm)sUfsGmAmUfAmUfUmCmAmGmAfUmAfCmCmAmGmCmsCmsAm (SEQ ID NO: 1255); (2) The justice chain includes CmUmGmUmGmAmAfGfCfAmUmGmAmUmUmCmAmAmAm(SEQ ID NO:1256), and the antisense chain contains (SCPUm)sUfsUmGmAfAmUfCmAmUmGmCfUmUfCmAmCmAmGmsCmsCm (SEQ ID NO: 1257); (3) The justice chain includes AmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAm(SEQ ID NO:1258), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO: 1259); (4) The justice chain includes UmGmCmUmAmUmUfGfCfUmCmAmUmCmGmAmGmAmAm(SEQ ID NO:1260), and the antisense chain contains (SCPUm)sUfsCmUmCfGmAfUmGmAmGmCfAmAfUmAmGmCmAmsGmsGm (SEQ ID NO: 1261); (5) The justice chain includes CmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAm(SEQ ID NO:1262), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1263); (6) The justice chain includes CmCmUmAmAmCmUfGfCfUmCmUmUmCmGmUmAmUmAm(SEQ ID NO:1264), and the antisense chain contains (SCPUm)sAfsUmAmCfGmAfAmGmAmGmCfAmGfUmUmAmGmGmsCmsGm (SEQ ID NO: 1265); (7) The justice chain includes GmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAm(SEQ ID NO:1266), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1267); (8) The justice chain includes GmAmUmGmAmUmAfCfAfAmUmGmAmAmUmGmUmGmUmGmAm(SEQ ID NO:1268), and the antisense chain contains (SCPUm)sCfsAmCmAfUmUfCmAmUmUmGfUmAfUmCmAmUmCmsAmsAm (SEQ ID NO: 1269); (9) The chain of justice includes GmCmUmCmUmUmCfGfUfAmUmUmAmAmGmAmAmGmAm(SEQ ID NO:1270), and the antisense chain contains (SCPUm)sCfsUmUmCfUmUfAmAmUmAmCfGmAfAmGmAmGmCmsAmsGm (SEQ ID NO: 1271); (10) The justice chain includes AmAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAm(SEQ ID NO:1272), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm (SEQ ID NO: 1273); (11) The chain of justice includes GmGmAmGmUmAmCmCmAfAfUfUmGmCmCmUmUmAmUmUmAm(SEQ ID NO:1274), and the antisense chain contains (SCPUm)sAfsAmUmAfAmGfGmCmAmAmUfUmGfGmUmAmCmUmsCmsCm (SEQ ID NO: 1275); (12) The justice chain includes AmUmGmGmGmCmAmGmGfAfGfUmUmGmAmCmUmUmCmAmAm(SEQ ID NO:1276), and the antisense chain contains (SCPUm)sUfsGmAmAfGmUfCmAmAmCmUfCmCfUmGmCmCmCmsAmsUm (SEQ ID NO: 1277); (13) The justice chain includes CmCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAm(SEQ ID NO:1278), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm (SEQ ID NO: 1279); (14) The chain of justice includes AmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmUmAmGmAm(SEQ ID NO:1280), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1281); (15) The chain of justice includes AmGmGmAmGmUmUfGfAfCmUmUmCmAmUmCmCmAmAm(SEQ ID NO:1282), and the antisense chain contains (SCPUm)sUfsGmGmAfUmGfAmAmGmUmCfAmAfCmUmCmCmUmsGmsCm (SEQ ID NO: 1283); (16) The chain of justice includes CmAmAmAmAmGmUfAfUfAmAmAmAmUmAmAmGmCmAm(SEQ ID NO:1284), and the antisense chain contains (SCPUm)sGfsCmUmUfAmUfUmUmUmAmUfAmCfUmUmUmGmsUmsAm (SEQ ID NO: 1285); (17) The chain of justice includes AmGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAm(SEQ ID NO:1286), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm (SEQ ID NO: 1287); (18) The chain of justice includes AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAm(SEQ ID NO:1288), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO: 1259); (19) The chain of justice includes CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAm(SEQ ID NO:1289), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1263); (20) The chain of justice includes GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAm(SEQ ID NO:1290), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1267); (21) The chain of justice includes AmsAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAm(SEQ ID NO:1291), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm (SEQ ID NO: 1273); (22) The justice chain includes CmsCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAm(SEQ ID NO:1292), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm (SEQ ID NO: 1279); (23) The justice chain includes CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAm(SEQ ID NO:1289), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1263); (24) The chain of justice includes GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAm(SEQ ID NO:1290), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1267); (25) The justice chain includes AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmUmAmGmAm(SEQ ID NO:1293), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1281); (26) The justice chain includes AmsGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAm(SEQ ID NO:1294), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm (SEQ ID NO: 1287); (27) The justice chain includes AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1296); (28) The chain of justice includes AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)CfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1297); (29) The chain of justice includes AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1281); (30) The justice chain includes AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAm(SEQ ID NO:1295), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1296); (31) The chain of justice includes AmsAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAm(SEQ ID NO:1298), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1296); (32) The justice chain includes UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAm(SEQ ID NO:1299), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1296); (33) The justice chain includes UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAm(SEQ ID NO:1299), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1281); (34) The justice chain includes AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAm(SEQ ID NO:1300), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO: 1259); (35) The justice chain includes AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAm(SEQ ID NO:1300), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO: 1301); (36) The justice chain includes AmsAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAm(SEQ ID NO:1302), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO: 1301); (37) The justice chain includes AmUmAmAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAm(SEQ ID NO:1303), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO: 1301); (38) The justice chain includes CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmsAm(SEQ ID NO:1304), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1263); (39) The chain of justice includes GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmsAm(SEQ ID NO:1305), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1267); (40) The chain of justice includes GmsCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAm(SEQ ID NO:1306), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1267); or (41) The chain of justice includes CmCmGmCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAm(SEQ ID NO:1307), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1267).

22. The dsRNA of any one of claims 1-21, wherein the dsRNA is further conjugated to a ligand portion, preferably conjugated to a ligand portion targeting adipocytes, preferably the sense strand is conjugated to the ligand portion, more preferably the 5' end and 3' end of the sense strand are conjugated to the ligand portion via a phosphate ester or a thiophosphate ester, respectively.

23. The dsRNA of claim 22, wherein the 5' end of the sense strand is conjugated to S' via a phosphate ester or thiophosphate ester, and the 3' end of the sense strand is conjugated to S via a phosphate ester or thiophosphate ester, wherein S' is selected from DL0359-NHC6s-IB, DL0363-NHC6s-IB, DL0370-NHC6, DL0370-NHC6s-IB, and DL0456, and S is selected from IB-C6NH-DL0359, IB-C6NH-DL0363, DL0426, and DL0455. Preferably, S' and S are selected from the following combinations (1)-(5): (1) S' is DL0359-NHC6s-IB, and S is IB-C6NH-DL0359; (2) S' is DL0363-NHC6s-IB, and S is IB-C6NH-DL0363; (3) S' is DL0370-NHC6, and S is DL0426; (4) S' is DL0370-NHC6s-IB, and S is DL0426; and (5) S' is DL0456, and S is DL0455.

24. The dsRNA of any one of claims 1-23, comprising a sense strand and an antisense strand as shown below, or comprising a sense strand or antisense strand as shown in Table 6: (1) The justice chain contains DL0359-NHC6s-IBs- GmCmUmGmGmUmAfUfCfUmGmAmAmUmAmUmCmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1193), and the antisense chain contains (SCPUm)sUfsGmAmUfAmUfUmCmAmGmAfUmAfCmCmAmGmCmsCmsAm (SEQ ID NO: 1194); (2) The justice chain contains DL0359-NHC6s-IBs- CmUmGmUmGmAmAfGfCfAmUmGmAmUmUmCmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1195), and the antisense chain contains (SCPUm)sUfsUmGmAfAmUfCmAmUmGmCfUmUfCmAmCmAmGmsCmsCm (SEQ ID NO: 1196); (3) The justice chain contains DL0359-NHC6s-IBs- AmAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1197), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO: 1198); (4) The justice chain contains DL0359-NHC6s-IBs- UmGmCmUmAmUmUfGfCfUmCmAmUmCmGmAmGmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1199), and the antisense chain contains (SCPUm)sUfsCmUmCfGmAfUmGmAmGmCfAmAfUmAmGmCmAmsGmsGm (SEQ ID NO: 1200); (5) The sense chain contains DL0359-NHC6s-IBs-CmAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1201), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1202); (6) The sense chain contains DL0359-NHC6s-IBs-CmCmUmAmAmCmUfGfCfUmCmUmUmCmGmUmAmUmAms-IB-C6NH-DL0359 (SEQ ID NO:1203), and the antisense chain contains (SCPUm)sAfsUmAmCfGmAfAmGmAmGmCfAmGfUmUmAmGmGmsCmsGm (SEQ ID NO: 1204); (7) The sense chain contains DL0359-NHC6s-IBs-GmCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1205), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1206); (8) The sense chain contains DL0359-NHC6s-IBs-GmAmUmGmAmUmAfCfAfAmUmGmAmAmUmGmUmGmUmGmAms-IB-C6NH-DL0359 (SEQ ID NO:1207), and the antisense chain contains (SCPUm)sCfsAmCmAfUmUfCmAmUmUmGfUmAfUmCmAmUmCmsAmsAm (SEQ ID NO: 1208); (9) The sense chain contains DL0359-NHC6s-IBs-GmCmUmCmUmUmCfGfUfAmUmUmAmAmGmAmAmGmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1209), and the antisense chain contains (SCPUm)sCfsUmUmCfUmUfAmAmUmAmCfGmAfAmGmAmGmCmsAmsGm (SEQ ID NO: 1210); (10) The sense chain contains DL0359-NHC6s-IBs-AmAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAmS-IB-C6NH-DL0359 (SEQ ID NO:1211), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm (SEQ ID NO: 1212); (11) The sense chain contains DL0363-NHC6s-IBs-GmGmAmGmUmAmCmCmAfAfUfUmGmCmCmUmUmAmUmUmAms-IB-C6NH-DL0363 (SEQ ID NO:1213), and the antisense chain contains (SCPUm)sAfsAmUmAfAmGfGmCmAmAmUfUmGfGmUmAmCmUmsCmsCm (SEQ ID NO: 1214); (12) The sense chain contains DL0363-NHC6s-IBs-AmUmGmGmGmCmAmGmGfAfGfUmUmGmAmCmUmUmCmAmAmAms-IB-C6NH-DL0363 (SEQ ID NO:1215), and the antisense chain contains (SCPUm)sUfsGmAmAfGmUfCmAmAmCmUfCmCfUmGmCmCmCmsAmsUm (SEQ ID NO: 1216); (13) The sense chain contains DL0359-NHC6s-IBs-CmCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAms-IB-C6NH-DL0359 (SEQ ID NO:1217), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm (SEQ ID NO: 1218); (14) The sense chain contains DL0359-NHC6s-IBs-AmAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmGmAms-IB-C6NH-DL0359 (SEQ ID NO:1219), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1220); (15) The sense chain contains DL0359-NHC6s-IBs-AmGmGmAmGmUmUfGfAfCmUmUmCmAmUmCmCmAmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1221), and the antisense chain contains (SCPUm)sUfsGmGmAfUmGfAmAmGmUmCfAmAfCmUmCmCmUmsGmsCm (SEQ ID NO: 1222); (16) The sense chain contains DL0359-NHC6s-IBs-CmAmAmAmAmGmUfAfUfAmAmAmAmUmAmAmGmCmAms-IB-C6NH-DL0359 (SEQ ID NO:1223), and the antisense chain contains (SCPUm)sGfsCmUmUfAmUfUmUmUmAmUfAmCfUmUmUmGmsUmsAm (SEQ ID NO: 1224); (17) The sense chain contains DL0359-NHC6s-IBs-AmGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAmAms-IB-C6NH-DL0359 (SEQ ID NO:1225), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm (SEQ ID NO: 1226); (18) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmAmAms-DL0426 (SEQ ID NO:1227), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO: 1198); (19) The justice chain contains DL0370-NHC6s-CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-DL0426 (SEQ ID NO:1228), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1202); (20) The sense chain contains DL0370-NHC6s-GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0426 (SEQ ID NO:1229), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1206); (21) The justice chain contains DL0370-NHC6s-AmsAmGmAmUmAmAfGfAfCmAmGmUmAmCmAmGmUmAmS-DL0426 (SEQ ID NO:1230), and the antisense chain contains (SCPUm)sAfsCmUmGfUmAfCmUmGmUmCfUmUfAmUmCmUmUmsUmsGm (SEQ ID NO: 1212); (22) The sense chain contains DL0370-NHC6s-CmsCmUmAmAmUmGfAfUfGmAmUmAmAmUmUmAmUmAms-DL0426 (SEQ ID NO:1231), and the antisense chain contains (SCPUm)sAfsUmAmAfUmUfAmUmCmAmUfCmAfUmUmAmGmGmsCmsUm (SEQ ID NO: 1218); (23) The justice chain contains DL0456s-CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmAms-DL0455 (SEQ ID NO:1232), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1202); (24) The justice chain contains DL0456s-GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmAms-DL0455 (SEQ ID NO:1233), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1206); (25) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmAmS-DL0426 (SEQ ID NO:1234), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1220); (26) The sense chain contains DL0370-NHC6s-AmsGmUmUmAmGmCfAfGfGmAmCmUmUmUmUmUmAmAmAms-DL0426 (SEQ ID NO:1235), and the antisense chain contains (SCPUm)sUfsAmAmAfAmAfGmUmCmCmUfGmCfUmAmAmCmUmsUmsAm (SEQ ID NO: 1226); (27) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1236), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1251); (28) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1237), and the antisense chain contains (SCPUm)CfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1252); (29) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1238), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1220); (30) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAfGfAmCmAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1239), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1251); (31) The justice chain contains DL0370-NHC6s-AmsAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1240), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1251); (32) The justice chain contains DL0370-NHC6s-IBs-UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1241), and the antisense chain contains (SCPUm)sCfsUmGmUmAmCfUmGmUmCmUfUmAfUmCfUmUmUmsGmsAm (SEQ ID NO: 1251); (33) The justice chain contains DL0370-NHC6s-IBs-UmCmAmAmAmGmAmUmAfAmGfAmCfAmGmUmAmCmAmGmsAms-DL0426 (SEQ ID NO:1242), and the antisense chain contains (SCPUm)sCfsUmGmUfAmCfUmGmUmCmUfUmAfUmCmUmUmUmsGmsAm (SEQ ID NO: 1220); (34) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1243), and the antisense chain contains (SCPUm)sUfsAmAmAfUmAfCmUmGmUmAfCmUfGmUmCmUmUmsAmsUm (SEQ ID NO: 1198); (35) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUfAfCmAmGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1244), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO: 1253); (36) The justice chain contains DL0370-NHC6s-AmsAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1245), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO: 1253); (37) The justice chain contains DL0370-NHC6s-IBs-AmUmAmAmGmAmCmAmGfUmAfCmAfGmUmAmUmUmUmAmsAms-DL0426 (SEQ ID NO:1246), and the antisense chain contains (SCPUm)sUfsAmAmAmUmAfCmUmGmUmAfCmUfGmUfCmUmUmsAmsUm (SEQ ID NO: 1253); (38) The justice chain contains DL0370-NHC6s-CmsAmGmUmGmGmCfAfAfAmGmUmUmGmUmGmAmAmsAms-DL0426 (SEQ ID NO:1247), and the antisense chain contains (SCPUm)sUfsUmCmAfCmAfAmCmUmUmUfGmCfCmAmCmUmGmsGmsUm (SEQ ID NO: 1202); (39) The sense chain contains DL0370-NHC6s-GmsCmCmUmAmAmCfUfGfCmUmCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:1248), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1206); (40) The sense chain contains DL0370-NHC6s-GmsCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:1249), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1206); or (41) The justice chain contains DL0370-NHC6s-IBs-CmCmGmCmCmUmAmAmCfUmGfCmUfCmUmUmCmGmUmAmsAms-DL0426 (SEQ ID NO:1250), and the antisense chain contains (SCPUm)sUfsAmCmGmAmAfGmAmGmCmAfGmUfUmAfGmGmCmsGmsGm (SEQ ID NO: 1206).

25. A cell containing dsRNA as described in any one of claims 1-24.

26. A pharmaceutical composition comprising dsRNA as described in any one of claims 1-24, or cells as described in claim 25, and optionally a pharmaceutically acceptable carrier or excipient.

27. A kit comprising dsRNA as described in any one of claims 1-24, cells as described in claim 25, or a pharmaceutical composition as described in claim 26.

28. A method for inhibiting ALK7 gene expression in cells, the method comprising contacting the cells with dsRNA as described in any one of claims 1-24 or a pharmaceutical composition as described in claim 26.

29. A method for inhibiting ALK7 gene expression in cells of a subject, the method comprising administering to the subject dsRNA as described in any one of claims 1-24, cells as described in claim 25, or a pharmaceutical composition as described in claim 26.

30. A method for treating a subject for a disease or condition in which reduced ALK7 gene expression benefits, the method comprising administering to the subject the dsRNA of any one of claims 1-24, the cell of claim 25, or the pharmaceutical composition of claim 26.

31. A method for preventing at least one symptom in a subject suffering from a disease or condition that benefits from reduced ALK7 gene expression, the method comprising administering to the subject the dsRNA of any one of claims 1-24, the cell of claim 25, or the pharmaceutical composition of claim 26.

32. A method for preventing the progression of a disease or condition in a subject that benefits from reduced ALK7 gene expression, the method comprising administering to the subject the dsRNA of any one of claims 1-24, the cell of claim 25, or the pharmaceutical composition of claim 26.

33. The method of any one of claims 29-32, wherein the disease or condition that benefits from reduced ALK7 gene expression is an ALK7-related disease, such as a disease associated with ALK7 overexpression.

34. The method of claim 33, wherein the ALK7-related disease is selected from the group consisting of: metabolic syndrome, cardiovascular disease, hypertension, type II diabetes, obesity, elevated triglyceride levels, lipid metabolism disorders, liver inflammation, fatty liver disease, liver enzyme-related diseases, non-alcoholic cirrhosis, cardiomyopathy, heart failure, and kidney disease.

35. The method of any one of claims 29-34, wherein the dsRNA, cell, or pharmaceutical composition is administered subcutaneously or intravenously.

36. The method of any one of claims 29-35, wherein the subject is a human.

Images