biosensor

Abstract

A DNA sequence and a synthetic gene circuit (SGC) comprising the same for detecting a DNA or RNA nucleotide trigger sequence, associated detection systems, methods for detecting the DNA or RNA nucleotide trigger sequence as well as further proteins of interest and associated uses.

Description

[0001] BIOSENSOR

[0002] TECHNICAL FIELD OF THE INVENTION

[0003] The current invention relates to biological sensors for detecting targets of interest, associated detection systems and methods .

[0004] DESCRIPTION OF THE RELATED ART

[0005] The ability to accurately detect disease is fundamental to diagnostic and prognostic testing, and an essential part of modern healthcare pipelines . One challenge in the field is multiplexing i . e . the ability to detect multiple targets within a single sample, which can be used, e . g. , in situations where diseases tend to cluster ( co-morbidities ) . Current approaches for multiplexing rely heavily on parallelization, whereby individual samples are split and then analyzed individually, but in parallel, in separate reaction vessels . A simpler and more elegant approach is to multiplex within a single reaction ("one-pot" multiplexing) . Over the last 10 years, synthetic gene circuits (SGCs) have emerged as a tool for one-pot multiplexing. In a typical SGC, a synthetic strand of mRNA is programmed to encode for a signaling protein (e . g. , fluorescent protein, enzyme) upon interaction with a particular disease target (ON) . In the absence of the target, no expression is observed (OFF) . Though promising, current switches suffer from multiple drawbacks . For example, their signal-cascade mechanism is heavily reliant on hairpin RNA structures, which are prone to unwinding even in the absence of target, leading to nonspecific activation of the gene . This increases background signals, decreasing the sensitivity of any resulting assay and potentially leading to false positives . Moreover, this reliance on hairpin structures renders current switches unable to respond to single-nucleotide polymorphisms (SNPs) . SNPs are essential targets for many diseases, particularly cancers and drugresistant infections . To overcome these limitations, researchers typically perform nucleic acid amplification (e . g. , PCR, RPA) before using SGCs . This adds significantly to the costs and complexity .

[0006] SUMMARY OF THE INVENTION

[0007] It is a task of current invention to provide alternative, in particular improved, means and methods for detecting biological targets, in particular nucleic acid sequences .

[0008] This task is solved by a sequence with the features of claim 1, the gene circuit according to claim 6, the detection system according to claim 7, and the methods according to claims 10, 14 and 15. Further embodiments of sequence, gene circuit, detection system and methods are defined by the features of further claims .

[0009] In a first aspect, the present invention is directed to a DNA sequence for detecting a DNA or RNA nucleotide trigger sequence comprising :

[0010] (a) a double stranded DNA promoter sequence,

[0011] (b) a single stranded DNA sequence segment comprising or consisting of a single stranded DNA trigger binding sequence (TBS) ,

[0012] (c) a double stranded DNA sequence encoding a ribosome binding site (RBS ) , and

[0013] (d) a double stranded DNA sequence encoding a protein of interest (POI ) ,

[0014] wherein the TBS is positioned downstream of, optionally adj acent to, the promoter sequence,

[0015] the promoter sequence is operably linked to the double stranded DNA sequences encoding the RBS and the POI .

[0016] The DNA sequences according to the present invention are primarily made of double-stranded DNA and contain one or more single stranded "gaps" , i . e . one or more single stranded DNA sequence segments, wherein the "missing" strand makes up the "gap" . The DNA sequences deactivate transcription and are designed to be complementary to a single stranded or double stranded DNA or RNA nucleotide trigger sequence (e . g. DNA associated with a specific disease) . Upon interaction with the trigger sequence, the gap (i . e . the single stranded DNA sequence segment) is filled, transcription is activated, and a protein of interest is produced. This protein can be any protein suitable for detection, e . g. a fluorescent protein ( for direct detection) , a catalytic enzyme ( for colorimetric signaling) , or a peptide ( for LCMS / HPLC detection) .

[0017] The DNA or RNA nucleotide trigger sequence can be a single stranded DNA nucleotide trigger sequence, a double stranded DNA nucleotide trigger sequence, a single stranded RNA nucleotide trigger sequence, or a double stranded RNA nucleotide trigger sequence . Optionally the DNA or RNA nucleotide trigger sequence is a single stranded DNA or RNA nucleotide trigger sequence . For double stranded nucleotide trigger sequences, it was found that, e . g. , the trigger binding sequence displaces one of the strands of the double stranded trigger sequence .

[0018] It was surprisingly found that the DNA sequences according to the present invention essentially do not "leak" signal in the absence of target . This grants them unprecedently high signal-to-noise ratios compared to other detectors . This means that the DNA sequences according to the present invention can operate without the need for nucleic acid amplification of the trigger sequence . The DNA sequences according to the present invention can be easily programmed to react to different nucleic acid targets and express different proteins in response, and they can be designed to respond to single nucleotide polymorphisms (SNPs) in a trigger sequence, as described further herein. The DNA sequences described herein can activate in the presence of individual trigger sequences or multiple trigger sequences, and can differentiate targets by their outputs within a single tube e . g. , target 1 = express red fluorescent protein, target 2 = express green fluorescent protein. The DNA sequences can work orthogonally; thus, they can be used for disease multiplexing. The DNA sequence of the present invention can be a synthetic sequence and it (as well as the gene circuit disclosed herein) can be obtained by well-known means in the art . Exemplary means or methods for producing the DNA sequence and the gene circuit include, e . g. , solid-phase phosphoramidite chemistry-based synthesis, terminal deoxynucleotidyl transf erase-mediated synthesis, and template-dependent polymerase-mediated synthesis . For example, the DNA sequence and gene circuit disclosed herein can be produced such that the part of the sequence comprising the promoter and the single stranded TBS (and optionally a double stranded adapter DNA adj acent to the TBS) is installed onto known genes (or synthetic gene circuits) using DNA ligase (see, for example, Figure 7a and 7b) , wherein the part of the sequence comprising the promoter and the single stranded TBS (and optionally the adapter DNA) can be, for example, employed in excess and subsequently purified away using affinity chromatography .

[0019] In an exemplary embodiment, the present invention is directed to the manufacture of a DNA sequence or a synthetic gene circuit as described herein, optionally by one of the methods noted above, optionally by first a part of the DNA sequence comprising the promoter and the single stranded TBS and optionally a double stranded adapter DNA adj acent to the TBS, and subsequently combining this part with, i . e . installing this part into, known genes (or synthetic gene circuits) comprising a double-stranded DNA sequence encoding an RBS and a POT, optionally by using DNA ligase .

[0020] The double stranded promoter sequence (also referred to as "promoter" herein for reasons of simplicity) for use in the DNA sequence can be any promoter that can control the transcription of the DNA sequence encoding the POT of the DNA sequence once a trigger sequence has bound to the TBS . In other words, the promoter is suitable for recruiting and activating an RNA-polymerase which will, once the trigger has bound to the TBS, transcribe the RBS and the POI . Therefore, the promoter is operably linked to the double stranded DNA sequences encoding the RBS and the POI . In other words, this means that transcription of the double stranded DNA sequences encoding the RBS and the POI is under the control of the double stranded promoter sequence and binding of the trigger to the TBS .

[0021] Transcription of the RBS and POI will be initiated once the trigger has bound to the TBS; i . e . the transcription initiated by the promoter is subj ect to the binding of the trigger to the TBS - transcription is OFF in the absence of a trigger sequence and ON when a trigger sequence complementary to the TBS is bound to the TBS . As mentioned further below, the template strand sequence segment of the promoter sequence can, optionally, comprise a 5 ' -phosphorylation, in particular if the "gap" is located in the template strand of the DNA sequence . The RBS and the POI are positioned such that they allow for transcription when a trigger sequence has bound to the TBS . The RBS allows for translation of the POI after transcription, and suitable RBS sequences are well known to the skilled person and can be routinely chosen (see, e . g. , https : / / salislab .net / software / predict_rbs_calculator) . A nonlimiting example of an RBS is the T7 phage gene 10 leader RNA with the following sequence : TTTGTTTAACTTTAAGAAGGAGA (SEQ ID NO: 1 ) •

[0022] The single stranded DNA sequence segment comprising or consisting of a single stranded DNA trigger binding sequence (TBS) is configured such that the TBS is at least partially complementary to the trigger sequence which should be detected, and is suitable for hybridizing with (i . e . binding to based on base pairing, wherein the term "binding" is used interchangeably with "hybridizing" herein) the trigger sequence . The skilled person can routinely design and manufacture the TBS to be suitable for hybridization with the trigger sequence, e . g. with the means described above for DNA sequence manufacturing.

[0023] The term "hybridize" (and therefore also the term "binding" in the same context) means that two nucleotide sequences anneal to form a double stranded sequence (segment) under physiological conditions, and / or at least under the following conditions : 1 mM to 1000 mM NaCl, optionally 1 mM to 5 mM NaCl, 1 mM to 500 mM MgC12, optionally 1 mM to 5 mM MgC12, pH 5 to 9, 4 °C to 99°C, optionally 14 °C to 37 °C, optionally within about 2 hours .

[0024] The TBS is positioned downstream of the promoter sequence, wherein downstream is relative to the direction of transcription of the DNA sequence with an RNA-polymerase . Essentially, the TBS is positioned between the promoter and the RBS / POI . For example, there can be one or more sequences between the TBS and the promoter sequence as long as these sequences still allow for transcription to occur once a trigger sequence has hybridized with the TBS . Optionally, the TBS is positioned adj acent to the promoter sequence (also downstream) which means that the sequences are directly next to each other with no other sequence in between.

[0025] In an embodiment of the DNA sequence according to the present invention, which may be combined with any of the embodiments of the DNA sequence still to be addressed unless in contradiction, the DNA sequence is a two-part DNA sequence comprising a part A and a part B, wherein

[0026] part A comprises the double stranded DNA promoter sequence, and at least a part of the single stranded DNA sequence segment comprising or consisting of a first part of the single stranded DNA trigger binding sequence (TBS) ,

[0027] part B comprises at least a further part of the single stranded DNA sequence segment comprising or consisting of a second part of the single stranded DNA trigger binding sequence (TBS) , the double stranded DNA sequence encoding the ribosome binding site (RBS) , and the double stranded DNA sequence encoding the protein of interest (POI ) , wherein

[0028] part A and part B are configured such that the first and the second part of the single stranded DNA trigger binding sequence (TBS) can be functionally brought together upon their (joint) binding to a trigger sequence .

[0029] For example, part A and part B can be ligated together (after they are brought together by their binding to the trigger sequence) with the aid of a suitable ligase, which may be added to the DNA sequence of any embodiment disclosed herein, e . g. a ligase such as T4 ligase, Tag DNA ligase, T3 ligase, E . coli DNA ligase, or Hi-T4 ligase) .

[0030] It is noted that, without wishing to be bound by theory, it is not the ligation of parts A and B by the ligase which brings the parts spatially together and that it is believed that the parts are at least partially "held together" by the DNA or RNA trigger sequence that is at least partially complementary to the first and second part A and B of the TBS, while the ligation with a ligase may improve or increase stability and detection efficacy. In particular, the trigger binding sequence (TBS) may be "nicked" , meaning that there may be a point of rupture within the TBS, with the first part of the TBS being part of part A and the further (remaining) part of the TBS being part of part B . Both parts of the DNA sequence, especially the first and the second part of the TBS, are configured such that they form a functioning TBS when both are bound to the trigger . Visually speaking, part A and part B of the DNA sequence may be "glued together" upon their binding to the trigger and allow the gene of part B (encoding the POI ) to be expressed.

[0031] For example, the free ends of the first and the second part of the TBS do not have any residual groups which would sterically hinder them from being brought together by the trigger .

[0032] In an embodiment of the DNA sequence according to the present invention, which may be combined with any of the embodiments of the DNA sequence still to be addressed unless in contradiction, at least one of :

[0033] the single stranded DNA sequence segment and / or the TBS, optionally the first and the second part of the TBS together, is at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides or at least 20 nucleotides in length;

[0034] the TBS is positioned in the coding strand of the DNA sequence or positioned in the template strand of the DNA sequence; or

[0035] a combination thereof . As noted above, the single stranded DNA sequence is configured such that transcription of the RBS and POI is reduced or inhibited before a trigger sequence has bound to the TBS . In other words, the single stranded DNA sequence segment is of a length (number of nucleotides) which is suitable for reducing, suppressing or inhibiting transcription in the absence of a trigger sequence by at least 5%, optionally by at least 10%, 20%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.99% or more compared to when the trigger sequence is bound. For example, the single stranded DNA sequence segment may be up to 2 ' 000, 5 ' 000, 10 ' 000 or 100 ' 000 nucleotides in length. When the TBS is positioned in the coding strand of the DNA sequence, then the "gap" is positioned opposite the TBS in the template strand. If the TBS is positioned in the template strand of the DNA sequence, then the "gap" is positioned opposite the TBS in the coding strand. In an embodiment of the DNA sequence according to the present invention, which may be combined with any of the embodiments of the DNA sequence still to be addressed unless in contradiction, at least one of :

[0036] the RBS is positioned upstream of and optionally adj acent to the POI ;

[0037] the DNA sequence further comprises a double stranded DNA sequence encoding a translation enhancing sequence, optionally a GIO leader sequence, optionally positioned upstream of and / or adj acent to the RBS; or

[0038] a combination thereof .

[0039] For example, the RBS is positioned upstream of the POI, wherein upstream is relative to the direction of transcription of the DNA sequence with an RNA-polymerase . For example, there can be one or more sequences between the RBS and the POI as long as these sequences still allow for translation to occur (and, of course, for transcription once a trigger sequence has hybridized with the TBS) . Optionally, the RBS is positioned adj acent to the POI (also upstream) which means that the sequences are directly next to each other with no other sequence in between. The DNA sequence can, e . g. , further comprise a double stranded DNA sequence encoding a translation enhancing sequence, optionally positioned upstream of and / or adj acent to the RBS . Such translation enhancer sequences are known in the art and include, e . g. , a GIO leader sequence, as described above .

[0040] In an embodiment of the DNA sequence according to the present invention, which may be combined with any of the embodiments of the DNA sequence still to be addressed unless in contradiction, the TBS, optionally the first and the second part of the TBS, is positioned in the coding strand adj acent to a double stranded DNA sequence encoding a translation enhancing sequence that is positioned adj acent to the RBS that is positioned adj acent to the POI . Adj acent means that the sequences are directly next to each other with no other sequence in between.

[0041] In an embodiment of the DNA sequence according to the present invention, which may be combined with any of the embodiments of the DNA sequence still to be addressed unless in contradiction, at least one of :

[0042] a template strand sequence segment of the promoter sequence comprises a 5 ' -phosphorylation;

[0043] the promoter sequence is a constitutive promoter or an inducible promoter, optionally a promoter selected from the group consisting of a T7 promoter, a sigmaVO promoter, a lac operon, a arabinose-inducible promoter, a cold-inducible promoter, a tetracycline promoter, a rhamnose promoter, a cytomegalovirus promoter, a simian virus 40 promoter, an elongation Factor 1-alpha promoter, a ubiquitin promoter, a phosphoglycerate kinase promoter, and a human beta actin promoter;

[0044] the POI is a protein suitable for spectroscopic, spectrometric or interferometric detection, optionally a fluorescent protein or a protein catalyzing a colorimetric or chemiluminescent reaction, optionally a protein selected from the group consisting of GFP, mCerulean, mNeonGreen, mPapaya, mCherry, Sirius, mNeptune, luciferase, nanoluciferase, Renilla-lucif erin 2 -monooxygenase, streptavidin, betagalactosidase, glucose oxidase, hydrolases, polymerases, synthetic affinity protein, peptide, and metalloenzymes ; or a combination thereof .

[0045] For example, a template strand sequence segment of the promoter sequence can comprise a 5 ' -phosphorylation in particular if the "gap" is located in the template strand of the DNA sequence .

[0046] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a synthetic gene circuit (SGC) comprising at least one, optionally two to ten, DNA sequence (s) as described herein. Exemplary carriers and expression systems for the SGC include the PURExpress In Vitro Protein Synthesis Kit, the NEBExpress Cell-Free Protein Synthesis (CFPS) System, the PUREfrex Reconstituted Cell-Free Protein Synthesis Kit, E . coli extracts, wheat germ extracts, vibrio natriegens extracts, and rabbit reticulocyte lysate .

[0047] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a detection system comprising the DNA sequence as described herein or the SGC as described herein, and optionally at least one of : ( I ) a DNA or RNA trigger sequence, optionally a single stranded or double stranded DNA trigger sequence or a single stranded RNA trigger sequence, that is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS;

[0048] ( II ) a ligase suitable for ligating the trigger sequence bound to the TBS at least with the promoter sequence and optionally for ligating together parts A and B of the two- part DNA sequence;

[0049] ( III ) a protein detection system, optionally a colorimeter, a mass spectrometer, a fluorometer, a luminometer, an interferometer, a surface plasmon resonance spectrometer, a lateral flow device, a Raman spectrometer, an infrared spectrometer, a Fourier-transform infrared spectrometer, a UV-Vis spectrometer, a circular dichroism spectrometer or an NMR spectrometer;

[0050] or a combination thereof .

[0051] For example, the DNA sequence, the SGC and the detection system as described herein are configured to be functional under the conditions described for hybridization, e . g. physiological conditions, and / or 1 mM to 1000 mM NaCl, optionally 1 mM to 5 mM NaCl, 1 mM to 500 mM MgC12, optionally 1 mM to 5 mM MgC12, pH 5 to 9, 4 °C to 99°C, optionally 14 °C to 37 °C, optionally within about 2 hours, a concentration of DNA sequence or SGC of 10-18M to 1 M, a concentration of trigger sequence of 10-24M to 1 M, and / or a ratio of DNA sequence / SGC to trigger sequence of 1 : 1 to 1024: 1 .

[0052] The DNA or RNA nucleotide trigger sequence can be a single stranded DNA nucleotide trigger sequence, a double stranded DNA nucleotide trigger sequence, a single stranded RNA nucleotide trigger sequence, or a double stranded RNA nucleotide trigger sequence . Optionally the DNA or RNA nucleotide trigger sequence is a single stranded DNA or RNA nucleotide trigger sequence . The trigger sequence is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS, which means that the degree of complementarity is sufficient for binding of the trigger sequence to the TBS, in particular under the conditions described above, e . g. within not more than about 5 hours

[0053] The optional ligase for use herein is suitable for ligating the trigger sequence that has bound to the TBS at least with the promoter sequence and optionally for ligating together parts A and B of the two-part DNA sequence . Suitable ligases are known in the art and include, e . g. , T4 ligase, Tag DNA ligase, T3 ligase, E . coli DNA ligase, and Hi-T4 ligase .

[0054] For example, part A and part B can be ligated together (after they are brought together by their binding to the trigger sequence) with the aid of the ligase, which may be added to the DNA sequence of any embodiment disclosed herein. It is noted that, without wishing to be bound by theory, it is not the ligation of parts A and B by the ligase which brings the parts spatially together and that it is believed that the parts are at least partially "held together" by the DNA or RNA trigger sequence that is at least partially complementary to the first and second part A and B of the TBS, while the ligation with a ligase may improve or increase stability and detection efficacy. In an embodiment of the detection system according to the present invention, which may be combined with any of the embodiments of the detection system still to be addressed unless in contradiction, the DNA or RNA trigger sequence comprises less, the same amount, or more nucleotides than the TBS, optionally the first and the second part of the TBS . The DNA or RNA trigger sequence may have the same length as the TBS, in particular the first and the second part of the TBS together, it may be shorter, or longer .

[0055] In particular, in an embodiment in which the DNA sequence is a two-part DNA sequence with a first and a second part of the TBS being arranged in different parts of the DNA sequence (part A and part B) , the trigger sequence or the target may be longer than the TBS or the gap and still provide a working system.

[0056] In an embodiment of the detection system according to the present invention, which may be combined with any of the embodiments of the detection system still to be addressed unless in contradiction, the DNA or RNA trigger sequence is a native or synthetically modified DNA or RNA sequence of a bacterium, a virus, a fungus, or an amoeba .

[0057] For example, with the DNA or RNA trigger sequence derived from a microorganism such as a bacterium, a virus, a fungus, or an amoeba, it is possible to detect the presence of said microorganism within the detection system. In an example, in which the TBS is complementary to the trigger sequence of a predefined microorganism, the expression of the gene encoding for the protein of interest (POI ) serves as proof that the trigger sequence, especially the microorganism, is present .

[0058] In an embodiment of the detection system according to the present invention, which may be combined with any of the embodiments of the detection system still to be addressed unless in contradiction, the detection system is for the detection of a single nucleotide polymorphism (SNR) in a DNA or RNA trigger sequence, optionally in a single stranded or double stranded DNA trigger sequence or in a single stranded RNA trigger sequence, wherein the DNA sequence as described herein, in particular the single stranded DNA trigger binding sequence (TBS) or the first and the second part of the single stranded DNA trigger binding sequence (TBS) , is optionally configured such that a SNP-nucleotide in the DNA or RNA trigger sequence, optionally in the single stranded or double stranded DNA trigger sequence or in the single stranded RNA trigger sequence, is positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS .

[0059] A SNR can be detected with the detection system described herein based on the one nucleotide that is substituted in a trigger sequence . The TBS is designed accordingly such that the SNP in the trigger sequence will, e . g. preclude ligation of the promoter with the trigger sequence, or preclude hybridization of the trigger sequence with the TBS or such that only the trigger sequence including the SNP can allow ligation of the promoter with the trigger sequence and / or hybridize with the TBS . For example, the TBS for use in the present invention can be designed such that the SNP-nucleotide (i . e . the nucleotide that is substituted) in the DNA or RNA trigger sequence will be -according to the sequence complementarity of the trigger sequence and the TBS - positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS . This can increase the sensitivity towards the detection of an SNP in a given sequence .

[0060] In an embodiment of the detection system according to the present invention, which may be combined with any of the embodiments of the detection system still to be addressed unless in contradiction, the detection system further comprises :

[0061] ( IV) a detection antibody, functional fragment or derivative thereof, configured to bind to a further protein of interest (FPOI ) , optionally an FPOI bound to an optional capture antibody, functional fragment or derivative thereof, or bound to an optional synthetic affinity protein, wherein the detection antibody, functional fragment or derivative thereof, is further bound, optionally by a disulfide bond, to the DNA or RNA trigger sequence ;

[0062] (V) optionally means for cleaving the bond between the detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence; and

[0063] (VI ) optionally a capture antibody, functional fragment or derivative thereof, or a synthetic affinity protein, configured to bind the further protein of interest (FPOI ) , wherein the capture antibody, functional fragment or derivative thereof, or synthetic affinity protein is optionally attached to a surface .

[0064] For reasons of easier legibility, the term "antibody" is used herein without the "functional fragment or derivative thereof" but is meant to optionally include these .

[0065] The detection system described herein can be used to detect a further protein of interest (FPOI ) . A detection antibody that specifically binds to the FPOI can be used in the detection system, wherein the detection antibody is further bound, optionally by a disulfide bond, to the DNA or RNA trigger sequence, which in turn is used to indirectly detect the FPOI by means of POI expression by the DNA sequence described herein or the SGC described herein. For example, the detection antibody bound to an FPOI can be separated from non-bound antibodies and subsequently, POI expression can be initiated based on the trigger sequence bound to the antibody bound to the FPOI .

[0066] Separation can be done by any suitable means including chromatography. Alternatively, separation can be done using a capture antibody or synthetic affinity protein which detects and captures (e . g. concentrates or immobilizes by being bound to a surface) the further protein of interest (FPOI ) , for which the detection antibody is specific . Once the capture antibody has bound the FPOI, non-bound components can be removed and the detection antibody can be used (e . g. added) to bind to the FPOI bound to the capture antibody and detect the FPOI via the trigger sequence bound to the detection antibody. For example, after binding of the detection antibody to the (immobilized) FPOI, the trigger sequence can be cleaved from the detection antibody and then be detected by the detection system according to the present invention. The means for cleaving include, e . g. , reducing agents, photochemical, enzymatic hydrolysis, acid / base catalyzed hydrolysis, and temperature aided hydrolysis .

[0067] In an alternative embodiment, the capture antibody or synthetic affinity protein can be, e . g. , bound, optionally by a disulfide bond, to the DNA or RNA trigger sequence, in particular if no detection antibody is used (if a detection antibody is also used, the capture antibody or synthetic affinity protein is, for example, not bound to the DNA or RNA trigger sequence) . In this alternative embodiment, detection of the FPOI can be done by using only the capture antibody or synthetic affinity protein which binds to the FPOI and is separated from non-bound capture antibodies or affinity proteins by any suitable means before detection is performed by the detection system according to the present invention.

[0068] The detection system according to the present invention can be a kit of parts, wherein some or all of the individual components ( I ) to (VI ) are separate parts, and the kit optionally further includes instructions for use .

[0069] Exemplary capture and detection antibodies include IgG, IgM, IgA, IgE, IgD, Fab fragment, Fab2 fragment, Fab ' fragment, ScFv fragment, Diabody, Variable New Antigen Receptor fragments, Nanobodies, Exemplary synthetic affinity proteins include Affibodies, DARPins, ADAPTS, Monobodies, Centyrins, and Knottins .

[0070] The term "functional derivative" of an antibody for use in the present invention is meant to include any antibody or fragment thereof that has been chemically or genetically modified in its amino acid sequence, e . g. by addition, substitution and / or deletion of amino acid residue (s) and / or has been chemically modified in at least one of its atoms and / or functional chemical groups, e . g. by additions, deletions, rearrangement, oxidation, reduction, etc . as long as the derivative still has at least some FPOI ( further protein of interest) binding activity to a measurable extent, e . g. of at least about 1 to 10 % FPOI binding activity of the original unmodified polypeptide for use in the invention. Functional derivatives of an antibody for use in the present invention include non-natural polypeptides and glycosylated, phosphorylated, PEGylated, etc . derivatives .

[0071] In this context a "functional fragment" of an antibody for use in the invention is one that forms part of an antibody or derivative for use in the invention and still has at least some FPOI binding activity to a measurable extent, e . g. of at least about 1 to 10 % FPOI binding activity of the original unmodified polypeptide for use in the invention.

[0072] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a method for the detection of a DNA or RNA sequence, optionally a single stranded or double stranded DNA trigger sequence or a single stranded RNA trigger sequence, the method comprising the following steps :

[0073] (i) providing the DNA sequence as described herein or the SGC as described herein; (ii) adding a sample of interest under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, and optionally adding a ligase;

[0074] (iii) measuring the presence or absence, optionally quantifying the presence, of the POI encoded by the DNA sequence; and (iv) determining and optionally quantifying the presence of a DNA or RNA trigger sequence, optionally of a single stranded or double stranded DNA trigger sequence or of a single stranded RNA trigger sequence, wherein the trigger sequence is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS, optionally to the first and the second part of the TBS, based on the measurement of step (iii) •

[0075] Optionally, the steps of all methods described herein are performed in the sequence they are written. For example, all methods disclosed herein can be in vitro or ex vivo methods .

[0076] The sample of interest can be any sample that is known or suspected to comprise the DNA or RNA sequence that should be detected, i . e . that is the trigger sequence, or a sample of which it is not known if the trigger sequence is present, e . g. for screening purposes . The DNA or RNA nucleotide trigger sequence can be a single stranded DNA nucleotide trigger sequence, a double stranded DNA nucleotide trigger sequence, a single stranded RNA nucleotide trigger sequence, or a double stranded RNA nucleotide trigger sequence . Optionally the DNA or RNA nucleotide trigger sequence is a single stranded DNA or RNA nucleotide trigger sequence .

[0077] Suitable conditions for performing the method, in particular steps (ii) and (iii) , in particular conditions suitable for hybridization, are known to the skilled person and include, e . g. , physiological conditions, 1 mM to 1000 mM NaCl, optionally 1 mM to 5 mM NaCl, 1 mM to 500 mM MgC12, optionally 1 mM to 5 mM MgC12, pH 5 to 9, 4 °C to 99°C, optionally 14 °C to 37 °C, optionally within about 2 hours, a concentration of DNA sequence or SGC of 10-18M to 1 M, a concentration of trigger sequence of 10-24M to 1 M, and / or a ratio of DNA sequence / SGC to trigger sequence of 1 : 1 to 1024: l . The skilled person further knows which components are required for transcription and translation / protein expression and can routinely add the necessary components, including, e . g. , RNA-polymerase, ribosomes, reducing agents, transcription factors, cofactors, amino acids, tRNAs, NaCl, MgC12, buffer salts . The skilled person can also routinely rely on existing kits such as the PURExpress In Vitro Protein Synthesis Kit, the NEBExpress Cell-Free Protein Synthesis (CEPS) System, and the PUREfrex Reconstituted Cell-Free Protein Synthesis Kit .

[0078] The optional ligase for use herein is, as mentioned above, suitable for ligating the trigger sequence that has bound to the TBS at least with the promoter sequence and optionally for ligating together parts A and B of the two-part DNA sequence . Suitable ligases are those mentioned above .

[0079] The step (iii) of measuring the presence or absence, optionally quantifying the presence, of the PCI can be done according to the type of PCI that is chosen (e . g. based on whether the FPOI is suitable for identification by mass spectrometry or is a fluorescent protein, or a protein catalyzing a colorimetric or chemiluminescent reaction) , e . g. with a colorimeter, a mass spectrometer, a fluorometer, a luminometer, an interferometer, a surface plasmon resonance spectrometer, a lateral flow device, a Raman spectrometer, an infrared spectrometer, a Fourier-transform infrared spectrometer, a UV-Vis spectrometer, a circular dichroism spectrometer or an NMR spectrometer . Step (iv) is performed based on the measurement data obtained in step (iii) , e . g. by suitable quantification software .

[0080] In an embodiment of the method for the detection of a DNA or RNA sequence according to the present invention, which may be combined with any of the embodiments of the method still to be addressed unless in contradiction, the method further comprises, before step (i) , the steps of :

[0081] (ia) defining a DNA or RNA trigger sequence of interest, optionally a single stranded or double stranded DNA trigger sequence or a single stranded RNA trigger sequence;

[0082] (ib) designing the TBS of the DNA sequence, optionally the first and the second part of the TBS, to be at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the DNA or RNA trigger sequence of interest .

[0083] A DNA or RNA trigger sequence is defined in step (ia) as the sequence that should be detected. The DNA sequences according to the present invention is then designed and manufactured to be suitable for hybridization with the trigger sequence that should be detected, e . g. with the means described above for DNA sequence manufacturing.

[0084] In an embodiment of the method for the detection of a DNA or RNA sequence according to the present invention, which may be combined with any of the embodiments of the method still to be addressed unless in contradiction, the method is for the detection of a single nucleotide polymorphism (SNR) in a DNA or RNA trigger sequence, optionally in a single stranded or double stranded DNA trigger sequence or in a single stranded RNA trigger sequence, and wherein the DNA sequence of step (i) , in particular the single stranded DNA trigger binding sequence (TBS) , is configured such that a SNP-nucleotide in the DNA or RNA trigger sequence of the sample of interest is positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS in step (ii) .

[0085] The TBS for use in the present method can, e . g. , be designed such that the SNR in the trigger sequence will either preclude ligation of the promoter with the trigger sequence, or preclude hybridization of the trigger sequence with the TBS or such that only the trigger sequence including the SNP can allow ligation of the promoter with the trigger sequence and / or hybridize with the TBS, as described above .

[0086] In an embodiment of the method for the detection of a DNA or RNA sequence according to the present invention, which may be combined with any of the embodiments of the method still to be addressed unless in contradiction, the method further comprises, before step (i) , the steps of :

[0087] (iaa) defining a DNA or RNA trigger sequence of interest comprising an SNP, optionally a single stranded or double stranded DNA trigger sequence or a single stranded RNA trigger sequence comprising an SNP;

[0088] (ibb) designing the TBS of the DNA sequence, optionally the first and the second part of the TBS, to be at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the DNA or RNA trigger sequence of interest, and optionally designing the DNA sequence of step (i) , in particular the single stranded DNA trigger binding sequence (TBS) , optionally the first and the second part of the TBS, such that the SNP- nucleotide in the DNA or RNA trigger sequence of the sample of interest is positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS in step (ii) . In an embodiment of the method for the detection of a DNA or RNA sequence according to the present invention, which may be combined with any of the embodiments of the method still to be addressed unless in contradiction, the method further comprises, after step (ii) , in particular before step (iii) and (iv) , the step of :

[0089] (iiia) amplifying the DNA or RNA trigger sequence, optionally by the means of recombinase polymerase amplification (RPA) or polymerase chain reaction (PCR) .

[0090] For example, the DNA or RNA trigger sequence may be a DNA or RNA sequence of a microorganism, such as a bacterium or a pathogen. The amplification step is particularly advantageous in the context of the methods disclosed herein, and their use for determining the presence or the absence of the bacterium.

[0091] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a method for the detection of a further protein of interest (FPOI ) , wherein the method comprises the following steps :

[0092] (A) providing a detection antibody, functional fragment or derivative thereof, configured to bind to a further protein of interest (FPOI ) , wherein the detection antibody, functional fragment or derivative thereof, is further bound, optionally by a disulfide bond, to a DNA or RNA trigger sequence, optionally to a single stranded or double stranded DNA trigger sequence or to a single stranded RNA trigger sequence, and wherein the detection antibody, functional fragment or derivative thereof, exhibits a different property when bound to the FPOI compared to when not bound to the FPOI ;

[0093] (B) adding a sample of interest; followed by (Cl ) separating a FPOI-bound detection antibody, functional fragment or derivative thereof, from a non-FPOI-bound antibody, optionally cleaving the bond between the detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence; or

[0094] (C2 ) selectively cleaving the bond between the FPOI-bound detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence; followed by (D) adding the DNA sequence as described herein or the SGC as described herein under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, wherein the DNA or RNA trigger sequence, optionally the first and the second part of the TBS, is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS of the DNA sequence or the SGC; (E) measuring the presence or absence, optionally quantifying the presence, of the PCI encoded by the DNA sequence; and (F) determining and optionally quantifying the presence of the FPOI based on the measurement of step (E) .

[0095] The different property of the detection antibody, functional fragment or derivative thereof, when bound to the FPOI compared to when not bound to the FPOI, can be any property that allows for separating a detection antibody bound to the FPOI from a detection antibody not bound to the FPOI, such as solubility, size, etc .

[0096] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a method for the detection of a further protein of interest (FPOI ) , wherein the method comprises the following steps : (AA) providing a capture antibody, functional fragment or derivative thereof, or a synthetic affinity protein, configured to bind a further protein of interest (FPOI ) , wherein the capture antibody, functional fragment or derivative thereof or synthetic affinity protein is optionally attached to a surface;

[0097] (B) adding a sample of interest;

[0098] (Bl ) optionally washing off components not bound to the capture antibody, functional fragment or derivative thereof, or synthetic affinity protein;

[0099] (A2 ) adding a detection antibody, functional fragment or derivative thereof, configured to bind to the further protein of interest (FPOI ) bound to the capture antibody, functional fragment or derivative thereof, or to the synthetic affinity protein, wherein the detection antibody, functional fragment or derivative thereof, is further bound, optionally by a disulfide bond, to a DNA or RNA trigger sequence, optionally to a single stranded or double stranded DNA trigger sequence or to a single stranded RNA trigger sequence;

[0100] (C) optionally cleaving the bond between the detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence;

[0101] (D) adding the DNA sequence as described herein or the SGC as described herein under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, wherein the DNA or RNA trigger sequence, optionally the first and the second part of the TBS, is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS of the DNA sequence or the SGC; (E) measuring the presence or absence, optionally quantifying the presence, of the POI encoded by the DNA sequence; and (F) determining and optionally quantifying the presence of the FPOI based on the measurement of step (E) .

[0102] The step (Cl ) of separating a FPOI-bound detection antibody, functional fragment or derivative thereof, from a non-FPOI-bound antibody, can be any suitable separation step including (plate) washing, chromatography, separation by the use of further antibodies or by magnetic bead separation. The step (C2 ) can be optional . The sample of interest is a sample as detailed above . All definitions provided above for the antibodies also apply to the antibodies for use in the present methods . The conditions suitable for hybridization of complementary nucleotide sequences and for protein expression include those detailed above . The steps of measuring and determining include those mentioned above in the context of the other method aspects .

[0103] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a use of any of the embodiments of the DNA sequence, the SGC, the detection system, or the method, for detecting a microorganism, in particular a pathogen such as a virus, a bacterium, a fungus, or an amoeba .

[0104] In another aspect which may be combined with any of the embodiments or aspects preaddressed or still to be addressed unless in contradiction, the present invention is directed to a method for detecting a microorganism, in particular a pathogen such as a virus, a bacterium, a fungus, or an amoeba, comprising the steps of :

[0105] (i) providing the DNA sequence as disclosed herein; (ii) adding a sample of interest under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, and optionally adding a ligase;

[0106] (iii) measuring the presence or absence, optionally quantifying the presence, of the POI encoded by the DNA sequence; and (iv) determining and optionally quantifying the presence of a DNA or RNA trigger sequence that is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS, optionally to the first and the second part of the TBS, based on the measurement of step (iii) ,

[0107] (v) determining the presence of a microorganism, in particular a pathogen such as a virus, a bacterium, a fungus, or an amoeba, based on the result of step (iv) .

[0108] BRIEF DESCRIPTION OF THE DRAWINGS

[0109] Embodiments of the current invention are described in more detail in the following with reference to the figures . These are for illustrative purposes only and are not to be construed as limiting. It is shown in

[0110] Fig. 1 an exemplary DNA sequence according to the present invention;

[0111] Fig. 2 a fluorescence-based readout of protein expression; Fig. 3 fluorescence-based readout of 3 different protein expression levels in the same assay;

[0112] Fig. 4 concentration-dependent protein expression;

[0113] Fig. 5 the concept of orthogonality in the present

[0114] invention; Fig. 6 the relative expression of mNeonGreen from different trigger and DNA sequence combinations;

[0115] Fig. 7a and 7b exemplary synthetic schemes;

[0116] Fig. 8 SNR detection according to the present invention; Fig. 9 an exemplary two-part DNA sequence according to the present invention; and

[0117] Fig. 10 a luminescence-based readout of protein expression for an exemplary two-part DNA sequence according to the present invention.

[0118] DETAILED DESCRIPTION OF THE DRAWINGS AND EXAMPLES

[0119] Figure 1 shows an exemplary DNA sequence according to the present invention. The figure shows a T7 promoter, but any promoter can be used, as described above . The TBS is a singlestranded sequence and creates a "gap" in the double stranded DNA sequence, which can be designed such that it is filled by the DNA or RNA nucleotide trigger sequence ("target" in the figure, optionally a single stranded or double stranded DNA trigger sequence or a single stranded RNA trigger sequence) which hybridizes with the TBS ("binding" in the figure) . An optional ligase (e . g. a T4 ligase) can be added to ligate the hybridized trigger sequence with the promoter sequence upon hybridization of the trigger sequence with the TBS . Subsequently, the RBS and Gene are transcribed and translated into a protein which can be used to determine and / or quantify the presence or absence of the trigger sequence ("target" ) .

[0120] Figure 2 shows a fluorescence readout (in relative fluorescence units, RFU) comparison for systems comprising no DNA sequence according to the present invention ("no circuit" ) , comprising only the DNA sequence according to the present invention but no single or double stranded DNA or RNA nucleotide trigger sequence which can bind / hybridize to the TBS of the DNA sequence ("Circuit" ) , and comprising the DNA sequence according to the present invention and a (e . g. single stranded) DNA or RNA nucleotide trigger sequence which can bind / hybridize to the TBS of the DNA sequence ("Circuit + target" ) . The negative controls ("no circuit" and "circuit" ) do not show any fluorescence (i . e . protein expression) over at least 250 min, whereas the DNA sequence according to the present that detects a trigger sequence generates a clear fluorescent signal (i . e . protein expression) . This demonstrates the very high specificity and very low leakage of the DNA sequence according to the present invention. The conditions for the data shown in Figure 2 are provided in Example 1 .

[0121] Figure 3 shows how different proteins can be expressed by orthogonal DNA sequences, even when mixed in one reaction vessel . The conditions for the data shown in Figure 3 are provided in Example 5.

[0122] Figure 4 shows a fluorescence readout (in relative fluorescence units, RFU) comparison for different trigger sequence concentrations . Concentrations of only 0.14 nM already provide a clearly detectable readout, while high trigger sequence concentrations also lead to measurable and quantifiable results . The conditions for the data shown in Figure 4 are provided in Example 2 .

[0123] Figure 5 illustrates the orthogonality of a combination of different DNA sequences according to the present invention (e . g. of a synthetic gene circuit comprising multiple, e . g. 5, different DNA sequences according to the present invention, or of 5 synthetic gene circuits each comprising a different DNA sequence according to the present invention) . For example, different DNA sequences encoding different proteins can be used and / or installed on gene circuits . The DNA sequences will only activate in the presence of their designated trigger sequences . The different DNA sequences are designed to code for different proteins (e . g. red, blue, green, etc . fluorescent proteins) in a single reaction vessel . The readout of the overall fluorescence can determine which DNA sequences were activated to which extent and, thus, allows for the detection and / or quantification of different trigger sequences at the same time, while being fully orthogonal . The readout is shown in Figure 6.

[0124] Figure 6 shows a matrix detailing the relative expression of mNeonGreen from different trigger and DNA sequence combinations . The conditions for the data shown in Figure 6 are provided in Example 3.

[0125] Figure 7a and 7b show exemplary synthetic strategies for the production of a DNA sequence (or an SGC) of the present invention. A sequence comprising an RBS and a gene (e . g. encoding a POI ) is combined with a sequence fragment comprising a promoter and a TBS (Figure 7a) , wherein this sequence fragment can optionally include a double stranded adapter DNA adj acent to the TBS (on the right side of the TBS in Figure 7b) . The optional adapter sequence can be any double stranded nucleotide sequence and the skilled person can routinely choose such a sequence for the purpose of accelerating the ligation of the fragments . For example, the adapter sequence could also be part of the RBS sequence . A ligase can be used to combine the sequence fragment with the sequence comprising the RBS and gene . Exemplary conditions for the protocol shown in Figure 7a and 7b are provided in Example 6.

[0126] Figure 8 demonstrates how single nucleotide polymorphisms (SNPs) can be detected by the DNA sequence according to the present invention. Each graph represents the relative expression of mNeonGreen. The x axes show the nucleotide at 3 ' end of the target (i . e . the trigger) , and the graph title shows the corresponding sequence in the TBS . The conditions for the data shown in Figure 8 are provided in Example 4 .

[0127] Figure 9 shows an exemplary two-part DNA sequence according to the present invention. The figure shows a T7 promoter, but any promoter can be used, as described above . The TBS is a nicked single-stranded sequence and creates a "gap" in the double stranded DNA sequence, which can be designed such that it is filled by the DNA or RNA nucleotide trigger sequence ("target" in the figure, optionally a single stranded or double stranded DNA trigger sequence or a single stranded RNA trigger sequence) which hybridizes with the TBS ("binding" in the figure) . A ligase (e . g. a T4 ligase, as depicted) can be added to ligate the hybridized trigger sequence with the promoter sequence upon hybridization of the trigger sequence with the nicked TBS .

[0128] Subsequently, the RBS and Gene are transcribed and translated into a protein which can be used to determine and / or quantify the presence or absence of the trigger sequence ("target" ) . In the depicted figure, the target is longer than the gap and optionally comprises more nucleotides than the first and the second part of the TBS together .

[0129] Figure 10 shows a change of luminescence readout (in relative luminescence units, RLU) per time for an exemplary two-part DNA sequence according to the present invention. The measurement data shown on the left side were obtained in the presence of a target (i . e . a trigger) . In the absence of a target (measurement data on the right side) , essentially no luminescence was measured .

[0130] In the following examples, the term "Base Gap switch" is used for the sequence segment of the DNA sequence or SGC that comprises the promoter and the TBS . The term "gene" is used to describe the part which encodes a POI (and optionally RBS) . The term "target" is used to describe the trigger sequence .

[0131] Example 1 : To a mixture of SGC A (3.5 pL, 35 nM, in QuickLigase buffer) and T4 DNA Ligase (2000 units) , target A was added (3.5 pL, 350 nM) , in triplicate . To this solution, NEB PURExpress was added ( 17.5 pL) . As a control, the same experiment was set up without the target, and instead the SGC was mixed with d. d. H2O (3.5 pL) . The reactions were heated at 37 °C for 240 minutes, with the fluorescence monitored over time . SGC A comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCATTCCGTGTTCGTCGCCGATCAAGGGGGGTCCTTATGT CGCGCCATGGAT- ' 3 (SEQ ID NO: 2 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS . Target A was 5 ' -ATCCATGGCGCGACATAAGGACCCCCCTTGATCGGCGACGAACACGGAAT-3 ' (SEQ ID NO: 16) .

[0132] Example 2 : To a mixture of the SGC A (2.0 pL, 35 nM, in QuickLigase buffer) and T4 DNA Ligase (2000 units) , target A was added (2.0 pL, 233.33 - 0.96 nM) . After this, 1 pL of each SGC and target solution was added to NEB PURExpress (2.5 pL) , in triplicate . The reactions were heated at 37 °C for 240 minutes, with the fluorescence monitored over time . SGC A comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCATTCCGTGTTCGTCGCCGATCAAGGGGGGTCCTTATGT CGCGCCATGGAT- ' 3 (SEQ ID NO: 2 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS . Target A was 5 ' -ATCCATGGCGCGACATAAGGACCCCCCTTGATCGGCGACGAACACGGAAT- ' 3 (SEQ ID NO: 16) Example 3 : To separate mixtures of SGC 1-7 (2.0 pL, 35 nM, in QuickLigase buffer) and T4 DNA Ligase (2000 units) , targets 1-7 were added (2.0 pL, 350 nM) . After this, 1 pL of each SGC and target solution was added to NEB PURExpress (2.5 pL) , in triplicate . The reactions were heated at 37 °C for 240 minutes, with the fluorescence monitored over time .

[0133] SGC 1 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCTGGACTTCTTATTCACAGTCGGTCACATTGGGCTACTC CTTGGGTCTTCC- ' 3 (SEQ ID NO: 4 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS

[0134] SGC 2 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCCTTCAAGAATTGGAAGAGTATCCTGCACTTGAATAAGT GATAACCTCGTA- ' 3 (SEQ ID NO: 5) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS

[0135] SGC 3 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCTGCAGTTCTTATTCACAGTCGGTCACATTGGGCTAGTC GTTGGGTCTTCG- ' 3 (SEQ ID NO: 6) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS

[0136] SGC4 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCAACGGGGTTCAACAAATACGGCCTAACGGACGGTAAAG CCTGAGGGTGCT- ' 3 (SEQ ID NO: 7 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS SGC5 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCGCTTTACTGACCTCGGGAGCTGTGTATTATATGTGTTG GTCGGGTATGGG- ' 3 (SEQ ID NO: 8 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS

[0137] SGC6 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCGGAGGTCCTGGCATTGGGAATATCAAACCCTAAACCCA ATGTATGCCGTA- ' 3 (SEQ ID NO: 9) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS

[0138] SGC7 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCATTCCGTGTTCGTCGCCGATCAAGGGGGGTCCTTATGT CGCGCCATGGAT- ' 3 (SEQ ID NO: 2 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeonGreen (GenBank: KC295282.1 ) , under the control of the glO leader RBS

[0139] Target 1 was 5 ' -GGAAGACCCAAGGAGTAGCCCAATGTGACCGACTGTGAATAAGAAGTCCA- ' 3 (SEQ ID NO : 10)

[0140] Target 2 was 5 ' -TACGAGGTTATCACTTATTCAAGTGCAGGATACTCTTCCAATTCTTGAAG- ' 3 (SEQ ID NO : 11 )

[0141] Target 3 was 5 ' -CGAAGACCCAACGACTAGCCCAATGTGACCGACTGTGAATAAGAACTGCA- ' 3 (SEQ ID NO: 12 )

[0142] Target 4 was 5 ' - AGCACCCTCAGGCTTTACCGTCCGTTAGGCCGTATTTGTTGAACCCCGTT- ' 3 (SEQ ID NO: 13) Target 5 was 5 ' - CCCATACCCGACCAACACATATAATACACAGCTCCCGAGGTCAGTAAAGC - ' 3 ( SEQ ID NO : 14 )

[0143] Target 6 was 5 ' -TACGGCATACATTGGGTTTAGGGTTTGATATTCCCAATGCCAGGACCTCC- ' 3 ( SEQ ID NO : 15 )

[0144] Target 7 was 5 ' -ATCCATGGCGCGACATAAGGACCCCCCTTGATCGGCGACGAACACGGAAT- ' 3 ( SEQ ID NO : 1 6 )

[0145] Example 4 : To separate mixtures o f SGC 8- 11 ( 2 . 0 pL , 35 nM, in QuickLigase buf fer ) and Hi Fi Tag Ligase ( 12 nM) , targets 8- 11 were added ( 2 . 0 pL , 350 nM) . After thi s , 1 pL o f each SGC and target solution was added to NEB PURExpres s ( 2 . 5 pL ) , in tripl icate . The reactions were heated at 37 ° C for 240 minutes , with the f luorescence monitored over time .

[0146] SGC 8 compri sed a Base Gap switch with a coding strand : 5 ' -ACCTTAATACGACTCACTATAGGGCCCTTCAAGAATTGGAAGAGTATCCTGCACTTGAATAAGT GATAACCTCGTA- ' 3 ( SEQ ID NO : 5 ) and template strand 5 ' phosphate-CTATAGTGAGTCGTATTAAGGT- ' 3 ( SEQ ID NO : 17 ) . The Base Gap switch was attached to a gene encoding for mNeonGreen ( GenBank :

[0147] KC295282 . 1 ) , under the control o f the gl O leader RBS

[0148] SGC 9 compri sed a Base Gap switch with a coding strand : 5 ' - AC C T T AAT AC GAC T C AC TATAGCGCCCTT C AAGAAT T G GAAGAG T AT C C T G C AC T T GAAT AAG T GATAACCTCGTA- ' 3 ( SEQ ID NO : 18 ) and template strand 5 ' phosphate-CTATAGTGAGTCGTATTAAGGT- ' 3 ( SEQ ID NO : 17 ) . The Base Gap switch was attached to a gene encoding for mNeonGreen ( GenBank :

[0149] KC295282 . 1 ) , under the control o f the gl O leader RBS

[0150] SGC 10 compri sed a Base Gap switch with a coding strand : 5 ' - AC C T T AAT AC GAC T C AC T AT AGAG C C C T T C AAGAAT T G GAAGAG T AT C C T G C AC T T GAAT AAG T GATAACCTCGTA- ' 3 ( SEQ ID NO : 19 ) and template strand 5 ' phosphate-CTATAGTGAGTCGTATTAAGGT- ' 3 ( SEQ ID NO : 17 ) . The Base Gap switch was attached to a gene encoding for mNeonGreen ( GenBank :

[0151] KC295282 . 1 ) , under the control o f the gl O leader RBS

[0152] SGC 11 compri sed a Base Gap switch with a coding strand : 5 ' -AC C T T AAT AC GAG T GAG TATAGTGCCCTT C AAGAAT T G GAAGAG T AT C C T G GAG T T GAAT AAG T GATAACCTCGTA- ' 3 ( SEQ ID NO : 20 ) and template strand 5 ' phosphate-CTATAGTGAGTCGTATTAAGGT- ' 3 ( SEQ ID NO : 17 ) . The Base Gap switch was attached to a gene encoding for mNeonGreen ( GenBank :

[0153] KC295282 . 1 ) , under the control o f the gl O leader RBS

[0154] Target 8 was 5 ' -TACGAGGTTATCACTTATTCAAGTGCAGGATACTCTTCCAATTCTTGAAGGGCC- ' 3 ( SEQ ID NO : 21 )

[0155] Target 9 was 5 ' -TACGAGGTTATCACTTATTCAAGTGCAGGATACTCTTCCAATTCTTGAAGGGCG- ' 3

[0156] ( SEQ ID NO : 22 )

[0157] Target 10 was 5 ' -TACGAGGTTATCACTTATTCAAGTGCAGGATACTCTTCCAATTCTTGAAGGGCT- ' 3

[0158] ( SEQ ID NO : 23 )

[0159] Target 11 was 5 ' -TACGAGGTTATCACTTATTCAAGTGCAGGATACTCTTCCAATTCTTGAAGGGCA- ' 3

[0160] ( SEQ ID NO : 24 )

[0161] Example 5 : To tubes containing a mixture o f SGCs 12 - 14 ( 40 nM, in QuickLigase buf fer ) and QuickLigase ( 2000 units ) , di f ferent combinations o f targets 12- 14 were added ( 2 . 0 pL , 350 nM) . After thi s , 1 pL o f each SGC and target solution was added to NEB PURExpres s ( 2 . 5 pL ) , in tripl icate . The reactions were heated at 37 ° C for 240 minutes , with the f luorescence monitored over time .

[0162] SGC 12 compri sed a Base Gap switch with a coding strand : 5 ' -ACCTTAATACGACTCACTATAGGGCCGCTTTACTGACCTCGGGAGCTGTGTATTATATGTGTTG GTCGGGTATGGG- ' 3 (SEQ ID NO: 8 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mPapaya (GenBank: AGX93076.1 ) , under the control of the glO leader RBS .

[0163] SGC 13 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCGGAGGTCCTGGCATTGGGAATATCAAACCCTAAACCCA ATGTATGCCGTA- ' 3 (SEQ ID NO: 9) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for mNeptune (GenBank: ACZ95825.1 ) , under the control of the glO leader RBS .

[0164] SGC 14 comprised a Base Gap switch with a coding strand: 5 ' -ACCTTAATACGACTCACTATAGGGCCATTCCGTGTTCGTCGCCGATCAAGGGGGGTCCTTATGT CGCGCCATGGAT- ' 3 (SEQ ID NO: 2 ) and template strand 5 ' phosphate-GGCCCTATAGTGAGTCGTATTAAGGT- ' 3 (SEQ ID NO: 3) . The Base Gap switch was attached to a gene encoding for Sirius (GenBank:

[0165] AB444952.1 ) , under the control of the glO leader RBS .

[0166] Target 12 was 5 ' -CCCATACCCGACCAACACATATAATACACAGCTCCCGAGGTCAGTAAAGC- ' 3 (SEQ ID NO: 14 )

[0167] Target 13 was 5 ' -TACGGCATACATTGGGTTTAGGGTTTGATATTCCCAATGCCAGGACCTCC- ' 3 (SEQ ID NO: 15)

[0168] Target 14 was 5 ' - ATCCATGGCGCGACATAAGGACCCCCCTTGATCGGCGACGAACACGGAAT- ' 3 (SEQ ID NO : 16)

[0169] Example 6 : The DNA sequences and SGCs disclosed herein could be obtained according to the following exemplary protocol : To QuickLigase buffer ( 13 L, 2X, New England Biolabs) , a solution of the encoder gene (the RBS sequence and the sequence encoding a POI, 8 L, 0.25 pM in Tris .HCl, 5 mM, pH = 7. 6) , the Base Gap switch (the promoter sequence and TBS, 3.2 L, 100 M in RNAse free d. d H2O, 160 eq. ) and optionally an adapter DNA (double stranded sequence shown in Fig. 7b to the right of the TBS sequence, 2.0 L, 400 M in RNAse free d. d H2O, 400 eq. ) were added. The optional adapter DNA is a short piece of DNA that can hybridize to the 3 ' end of the coding strand region to accelerate ligation between double-stranded DNA. The skilled person can routinely choose a suitable sequence . The reaction mixture was incubated at 4 °C for 30 minutes, after which, T4 Ligase ( 1000 units, cooled to 4 °C) was added. The reaction was incubated at 4 °C overnight . In the morning, the reaction mixture was diluted to a total volume of 100 L with RNAse free d. d H2O and purified using affinity chromatography.

Claims

39CLAIMS1 . A DNA sequence for detecting a DNA or RNA nucleotide trigger sequence comprising:(a) a double stranded DNA promoter sequence,(b) a single stranded DNA sequence segment comprising or consisting of a single stranded DNA trigger binding sequence ( TBS ) ,(c) a double stranded DNA sequence encoding a ribosome binding site (RBS) , and(d) a double stranded DNA sequence encoding a protein of interest ( POI ) ,whereinthe TBS is positioned downstream of, optionally adj acent to, the promoter sequence, andthe promoter sequence is operably linked to the double stranded DNA sequences encoding the RBS and the POI .

2. The DNA sequence according to claim 1, wherein the DNA sequence is a two-part DNA sequence comprising a part A and a part B, whereinpart A comprises the double stranded DNA promoter sequence, and at least a part of the single stranded DNA sequence segment comprising or consisting of a first part of the single stranded DNA trigger binding sequence (TBS) ,part B comprises at least a further part of the single stranded DNA sequence segment comprising or consisting of a second part of the single stranded DNA trigger binding sequence (TBS) , the double stranded DNA sequence encoding the40ribosome binding site (RBS) , and the double stranded DNA sequence encoding the protein of interest (POI ) , wherein part A and part B are configured such that the first and the second part of the single stranded DNA trigger binding sequence (TBS) can be functionally brought together upon binding to a trigger sequence .

3. The DNA sequence according to claim 1 or 2, wherein at least one of :the single stranded DNA sequence segment and / or the TBS, optionally the first and the second part of the TBS together, is at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides or at least 20 nucleotides in length;the TBS is positioned in the coding strand of the DNA sequence or positioned in the template strand of the DNA sequence; ora combination thereof .

4. The DNA sequence according to any of claims 1 to 3, wherein at least one of :the RBS is positioned upstream of and optionally adj acent to the POI ;the DNA sequence further comprises a double stranded DNA sequence encoding a translation enhancing sequence, optionally a GIO leader sequence, optionally positioned upstream of and / or adj acent to the RBS; ora combination thereof .

415. The DNA sequence according to any of claims 1 to 4, wherein the TBS, optionally the first and the second part of the TBS, is positioned in the coding strand adj acent to a double stranded DNA sequence encoding a translation enhancing sequence that is positioned adj acent to the RBS that is positioned adj acent to the POI .

6. The DNA sequence according to any of claims 1 to 5, wherein at least one of :a template strand sequence segment of the promoter sequence comprises a 5 ' -phosphorylation;the promoter sequence is a constitutive promoter or an inducible promoter;the POI is a protein suitable for spectroscopic, spectrometric or interferometric detection, optionally a fluorescent protein or a protein catalyzing a colorimetric or chemiluminescent reaction; ora combination thereof .

7. A synthetic gene circuit (SGC) comprising at least one, optionally two to ten, DNA sequence (s) according to any of claims 1 to 6 .

8. A detection system comprising the DNA sequence according to any of claims 1 to 6 or the SGC according to claim 7, and optionally at least one of :( I ) a DNA or RNA trigger sequence that is at least partially complementary, optionally complementary inall but one nucleotide, or entirely complementary to the TBS;( IT ) a ligase suitable for ligating the trigger sequence bound to the TBS at least with the promoter sequence and optionally for ligating together parts A and B of the two-part DNA sequence;( ITT ) a protein detection system, optionally a colorimeter, a mass spectrometer, a fluorometer, a luminometer, an interferometer, a surface plasmon resonance spectrometer, a lateral flow device, a Raman spectrometer, an infrared spectrometer, a Fourier- transform infrared spectrometer, a UV-Vis spectrometer, a circular dichroism spectrometer or an NMR spectrometer;or a combination thereof .

9. The detection system according to claim 8, wherein the DNA or RNA trigger sequence comprises less, the same amount, or more nucleotides than the TBS, optionally the first and the second part of the TBS .

10. The detection system according to claim 8 or 9, wherein the DNA or RNA trigger sequence is a native or synthetically modified DNA or RNA sequence of a bacterium, a virus, a fungus, or an amoeba .

11. The detection system according to any of claims 8 to 10, wherein the detection system is for the detection of a single nucleotide polymorphism (SNR) in a DNA or RNA trigger sequence, wherein the DNA sequence according to any of claims1 to 6, in particular the single stranded DNA trigger binding sequence (TBS) or the first and the second part of the single stranded DNA trigger binding sequence (TBS) , is optionally configured such that a SNP-nucleotide in the DNA or RNA trigger sequence is positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS .

12. The detection system according to any of claims 8 to 11, wherein the detection system further comprises :( IV) a detection antibody, functional fragment or derivative thereof, configured to bind to a further protein of interest (FPOI ) , optionally an FPOI bound to an optional capture antibody, functional fragment or derivative thereof, or bound to an optional synthetic affinity protein, wherein the detection antibody, functional fragment or derivative thereof, is further bound, optionally by a disulfide bond, to the DNA or RNA trigger sequence;(V) optionally means for cleaving the bond between the detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence; and (VI ) optionally a capture antibody, functional fragment or derivative thereof, or a synthetic affinity protein, configured to bind the further protein of interest (FPOI ) , wherein the capture antibody, functional fragment or derivative thereof, or synthetic affinity protein is optionally attached to a surface .4413. A method for the detection of a DNA or RNA sequence, the method comprising the following steps :(i) providing the DNA sequence according to any of claims 1 to 6 or the SGC according to claim 7 ;(ii) adding a sample of interest under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, and optionally adding a ligase ;(iii) measuring the presence or absence, optionally quantifying the presence, of the POI encoded by the DNA sequence; and(iv) determining and optionally quantifying the presence of a DNA or RNA trigger sequence that is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS, optionally to the first and the second part of the TBS, based on the measurement of step (iii) .

14. The method according to claim 13, wherein before step (i) , the method further comprises the steps of :(ia) defining a DNA or RNA trigger sequence of interest; (ib) designing the TBS of the DNA sequence, optionally the first and the second part of the TBS, to be at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the DNA or RNA trigger sequence of interest .

15. The method according to claim 13 or 14, wherein the method is for the detection of a single nucleotide polymorphism (SNR)45in a DNA or RNA trigger sequence, and wherein the DNA sequence of step (i) , in particular the single stranded DNA trigger binding sequence (TBS) , is configured such that a SNP-nucleotide in the DNA or RNA trigger sequence of the sample of interest is positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS in step (ii) .

16. The method according to claim 15, wherein before step (i) , the method further comprises the steps of :(iaa) defining a DNA or RNA trigger sequence of interest comprising an SNP;(ibb) designing the TBS of the DNA sequence, optionally the first and the second part of the TBS, to be at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the DNA or RNA trigger sequence of interest, and optionally designing the DNA sequence of step (i) , in particular the single stranded DNA trigger binding sequence (TBS) , optionally the first and the second part of the TBS, such that the SNP-nucleotide in the DNA or RNA trigger sequence of the sample of interest is positioned adj acent to the promoter sequence upon hybridization of the DNA or RNA trigger sequence with the TBS in step (ii) .

17. The method according to any of claims 13 to 16, wherein after step (ii) , in particular before step (iii) and (iv) , the method further comprises the step of :46(iiia) amplifying the DNA or RNA trigger sequence, optionally by the means of recombinase polymerase amplification (RPA) or polymerase chain reaction (PCR) .

18. A method for the detection of a further protein of interest (FPOI ) , wherein the method comprises the following steps : (A) providing a detection antibody, functional fragment or derivative thereof, configured to bind to a further protein of interest (FPOI ) , wherein the detection antibody, functional fragment or derivative thereof, is further bound, optionally by a disulfide bond, to a DNA or RNA trigger sequence, and wherein the detection antibody, functional fragment or derivative thereof, exhibits a different property when bound to the FPOI compared to when not bound to the FPOI ;(B) adding a sample of interest; followed by(01 ) separating a FPOI-bound detection antibody, functional fragment or derivative thereof, from a non-FPOI-bound antibody, optionally cleaving the bond between the detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence; or (02 ) selectively cleaving the bond between the FPOI-bound detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence; followed by(D) adding the DNA sequence according to any of claims 1 to 6 or the SGC according to claim 7 under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, wherein the DNA or RNA trigger sequence is at least partially47complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS of the DNA sequence, optionally the first and the second part of the TBS, or the SGC;(E) measuring the presence or absence, optionally quantifying the presence, of the POI encoded by the DNA sequence; and(F) determining and optionally quantifying the presence of the FPOI based on the measurement of step (E) .

19. A method for the detection of a further protein of interest (FPOI ) , wherein the method comprises the following steps : (AA) providing a capture antibody, functional fragment or derivative thereof, or a synthetic affinity protein, configured to bind a further protein of interest (FPOI ) , wherein the capture antibody, functional fragment or derivative thereof or synthetic affinity protein is optionally attached to a surface;(B) adding a sample of interest;(Bl ) optionally washing off components not bound to the capture antibody, functional fragment or derivative thereof, or synthetic affinity protein;(A2 ) adding a detection antibody, functional fragment or derivative thereof, configured to bind to the further protein of interest (FPOI ) bound to the capture antibody, functional fragment or derivative thereof, or to the synthetic affinity protein, wherein the detection antibody, functional fragment or derivative thereof, is further bound, optionally by a disulfide bond, to a DNA or RNA trigger sequence;48(C) optionally cleaving the bond between the detection antibody, functional fragment or derivative thereof, and the DNA or RNA trigger sequence;(D) adding the DNA sequence according to any of claims 1 to 6 or the SGC according to claim 7 under conditions suitable for hybridization of complementary nucleotide sequences and for protein expression, wherein the DNA or RNA trigger sequence, optionally the first and the second part of the TBS, is at least partially complementary, optionally complementary in all but one nucleotide, or entirely complementary to the TBS of the DNA sequence or the SGC;(E) measuring the presence or absence, optionally quantifying the presence, of the POT encoded by the DNA sequence; and(F) determining and optionally quantifying the presence of the FPOI based on the measurement of step (E) .

20. A use of the DNA sequence according to any of claims 1 to 6, the SGC according to claim 7, the detection system according to any of claims 8 to 12, or the method according to any of claims 13 to 19, for determining the presence or the absence of a microorganism, in particular a pathogen, further in particular a virus, a bacterium, a fungus, or an amoeba .

Images