Composition, kit and methods for target sequence detection in double-stranded DNA

Abstract

The present invention is directed to a composition for a target sequence detection in double- stranded DNA, wherein the composition comprises i) a first oligonucleotide and a second oligonucleotide for a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides are capable of forming substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in double-stranded DNA, ii) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double- stranded DNA leaving said target sequence single-stranded and thus free for said target- binding arms of said MNAzyme to bind, and iii) a substrate oligonucleotide comprising a sequence complementary to the sequence of said substrate binding arms, wherein said substrate binding arms of said MNAzyme engage said substrate oligonucleotide so that said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide when said target-binding arms of said MNAzyme bind or are bound to said target sequence in the presence of a cofactor. The present invention is also directed to a kit comprising said composition and to methods of using said composition.

Description

Composition, kit and methods for target sequence detection in double-stranded DNA FIELD

[0001] The present invention relates to multicomponent catalytic nucleic acids, peptide nucleic acids and methods for their use. More particularly, the invention relates to compositions comprising self-assembling multicomponent nucleic acid enzymes including multicomponent nucleic acid enzymes (MNAzymes) having endonuclease activity and interacting with peptide nucleic acid (PNA) and labeled oligonucleotide substrates. The present invention also provides methods for using such compositions, including for detecting, identifying and / or quantifying target sequences in double-stranded DNA (dsDNA).BACKGROUND

[0002] DNA nanotechnology involves the design and fabrication of nucleic acid structures, enabling the creation of intricate molecular architectures and devices. Recently, combining DNA with other DNA analogs has emerged as an important tool to diversify the systems(7, 2). DNA analogs follow the base-pairing principle and possess unique functionalities absent in DNA, significantly expanding the innovation and development of DNA nanotechnology. For example, y-peptide nucleic acid (yPNA) replaces the phosphate backbone with uncharged A-(2-aminoethyl) glycine units, exhibiting a higher binding affinity to DNA than DNA-DNA interactions^). Combining yPNA with functional DNA sequences has led to novel dynamic DNA modifications. For example, yPNA can eliminate mRNA secondary structure / - / ) for better target sequence access, or invade dsDNA, exposing ssDNA for further gene cleavage(5-7) or other potential evaluations. However, the fundamental dynamic binding reactions between yPNA and DNA are rarely explored.

[0003] The multicomponent DNA deoxyribozyme (M'NAzyme) system / ) composed of pure DNA has complementary functions to yPNA and is an ideal DNA model for exploring such kind of binding mechanisms with yPNA. Specifically, MNAzyme was first reported in 2007(9, 70) and has been extensively studied for over 15 years for the ssDNA detection (77-14). Despite the significant progress, the activity of MNAzymes against dsDNA remained unreported. MNAzymes can be used for sequence detection only by unwinding the target dsDNA sequence into ssDNA.

[0004] US8394946 discloses MNAzymes comprising two or more oligonucleotide components which self-assemble in the presence of one or more MNAzyme assembly facilitatormolecules to form a catalytically active structure. Compositions for making MNAzymes, and collections of MNAzymes were disclosed. Also disclosed were methods for using MNAzymes for the detection, identification and / or quantification of one or more targets.

[0005] US20230049215 discloses systems and methods for genetic engineering. The systems disclosed include one or more catalytic nucleic acids (e.g., one or more DNAzymes or ribozymes) and one or more catalytic nucleic acid-assisting reagents. In some embodiments, the disclosed systems included PNA-Assisted double-stranded DNA nicking by DNAzymes. In the examples, the one or more catalytic nucleic acid-assisting reagents include a sequence that specifically binds a sequence that is complementary to and / or identical to a sequence flanking the target site and / or within the target site.SUMMARY

[0006] The invention is defined by the features of the independent claims. Some specific embodiments are defined in the dependent claims.

[0007] The present invention provides PNA / MNAzyme based system enabling rapid dsDNA detection without protein-based enzymes or complex machinery. Further, compared with advanced CRISPR-based dsDNA detection systems (Cas9 or Casl2), the PNA / MNAzyme system also offers significant advantages. First, the detection needs both PNA and MNAzyme to specifically target to each of the ssDNA sequence inside a dsDNA, which improves the detection accuracy. Second, the MNAzyme system does not require specific morphology of the target dsDNA.

[0008] According to a first aspect of the present invention, there is provided a composition for detecting a target sequence in double-stranded DNA, the composition comprising i) a first oligonucleotide and a second oligonucleotide for a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides are capable of forming substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in double-stranded DNA, ii) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA leaving said target sequence single-stranded and thus free for said target-binding arms of said MNAzyme to bind, and iii) a substrateoligonucleotide comprising a sequence complementary to the sequence of said substrate binding arms, wherein said substrate binding arms of said MNAzyme engage said substrate oligonucleotide so that said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide when said target-binding arms of said MNAzyme bind or are bound to said target sequence in the presence of a cofactor.

[0009] The inventors discovered that the PNA detaches from an MNAzyme / PNA combination by a new strand displacement mechanism, wherein the PNA bound to two half-DNA chains of the MNAzyme (i.e. target-binding arms) can be replaced by a full DNA chain of a dsDNA target, when the two half chains share the same sequence with the full chain without any gap or toehold. This explains the mechanism described in Figure If, how PNA can be released from the target-binding arms (two half chains) of the MNAzyme in order to invade the dsDNA and bind to the complementary DNA chain (full chain) within the dsDNA and thus opening the dsDNA target site to a single-stranded sequence for the MNAzyme target-binding arms to bind.

[0010] According to a second aspect of the present invention, there is thus provided a method for detecting the presence of a target sequence in a double-stranded DNA in a sample, preferably an environmental or clinical sample, the method comprising the steps of:a) contacting a first oligonucleotide and a second oligonucleotide forming a multi-component deoxyribozyme (MNAzyme) with i) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, and ii) a substrate oligonucleotide, in any order or simultaneously in a suitable buffer, wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme; said target-binding arms being complementary to said target sequence in double-stranded DNA, and said substrate binding arms being complementary to said substrate oligonucleotide, wherein said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide and the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect;b) incubating said first oligonucleotide and said second oligonucleotide with said PNA and said substrate oligonucleotide in order to let said PNA bind to said target-binding arms of said first oligonucleotide and said second oligonucleotide and in order to let said substrate oligonucleotide to bind said substrate binding arms of said MNAzyme to obtain a combination of said PNA, said substrate oligonucleotide and said MNAzyme;c) contacting the combination of said PNA, said substrate oligonucleotide and said MNAzyme obtained in step b) with said sample or nucleic acids isolated from said sample, wherein in the presence of the target sequence in said double-stranded DNA in said sample, the PNA detaches from the combination, invades the double-stranded DNA at the site of said target sequence by binding to the sequence that is complementary to said target sequence in said double-stranded DNA providing said target sequence in a single-stranded form for the MNAzyme to bind, wherein said catalytic core of said MNAzyme modifies said substrate oligonucleotide when said MNAzyme binds or is bound to said target sequence in doublestranded DNA in the presence of a cofactor; andd) detecting a signal from said detectable effect originating from the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme, wherein the presence of said signal confirms the presence of said target sequence in said sample.

[0011] According to a third aspect of the present invention, there is provided a method for detecting the presence of a target sequence in a double-stranded DNA in a sample, preferably an environmental or clinical sample, the method comprising the steps ofa) contacting a first oligonucleotide and a second oligonucleotide capable of forming a multicomponent deoxyribozyme (MNAzyme) with a substrate oligonucleotide, wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme; said target-binding arms being complementary to said target sequence in double-stranded DNA, and said substrate binding arms being complementary to said substrate oligonucleotide, wherein said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide and the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect;b) incubating said first oligonucleotide and said second oligonucleotide with said substrate oligonucleotide in order to let said substrate oligonucleotide to bind said substrate binding arms of said MNAzyme to obtain a combination of said substrate oligonucleotide and said MNAzyme;c) contacting a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said doublestranded DNA, with said sample or nucleic acids isolated from said sample, wherein in the presence of the target sequence in said double-stranded DNA in said sample, the PNA invades the double-stranded DNA at the site of said target sequence by binding to the sequence that is complementary to said target sequence in said double-stranded DNA providing said target sequence in a single-stranded form;d) adding the combination of said substrate oligonucleotide and said MNAzyme obtained in step b) to the mixture of said PNA and the sample obtained in step c), wherein said catalytic core of said MNAzyme modifies said substrate oligonucleotide when said MNAzyme binds or is bound to said target sequence in the presence of a cofactor; ande) detecting a signal from said detectable effect originating from the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme, wherein the presence of said signal confirms the presence of said target sequence in said sample.

[0012] According to a fourth aspect of the present invention, there is provided a kit for detecting the presence of a target sequence in double-stranded DNA in a sample, wherein said kit comprises a) one or more containers comprising i) a first oligonucleotide and a second oligonucleotide capable of forming a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and targetbinding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in said double-stranded DNA, ii) a substrate oligonucleotide, and iii) a PNA, wherein said PNA comprises a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, and b) instructions for use of the kit for the detection.BRIEF DESCRIPTION OF THE DRAWINGS

[0013] FIGURE 1. Multicomponent deoxyribozyme (MNAzyme) illustration and primary mechanisms regarding yPNA-assisted MNAzyme for dsDNA detection, (a) The structural components and detection mechanism of MNAzyme. (b) The sequence in dsDNA that is completely complementary to yPNA is named as ssDNAfc, and the corresponding sequence to be detected is named as ssDNAd. yPNA can invade dsDNA and bind to ssDNAfc. Excess yPNA shares the same sequence with the target ssDNAd. (c) dsDNA correct detection using yPNA / MNAzyme. (d) yPNA deactivate MNAzyme through “V” shape binding structure and could not mediate false signals, (e) After yPNA and biomarker-binding arms (BBAs) binding, a yPNA / MNAzyme complex structure is formed, (f) After encountering ssDNAfc, ssDNAfcwill replace the yPNA bound to BBAs and release MNAzymes for the detection of ssDNAd. This process is named as one-step dsDNA sequence detection.

[0014] FIGURE 2. Experimental verification of the yPNA / MNAzyme function, (a) MNAzyme for ssDNAddetection, (b) Hypothesis that yPNA cannot activate MNAzyme. (c) Processes for two-step dsDNA sequence detection, (d) Macroscopic validation of the ability of yPNA to assist MNAzyme in dsDNA detection, (e) Molecular validation of MNAzyme cleavage activity, (f) After incubating yPNA with a plasmid for 2 h, MNAzyme and substrate strand were added, and the reactions were recorded at different times, (g) yPNA, MNAzyme, and substrate were mixed (without plasmid), and the reactions at different times were recorded, (h) Kinetic analysis of substrate strand cleavage by MNAzyme in (f) and (g) was conducted. Data points represent the percentage of substrate cleavage, with error bars indicating ± standard deviation for three independent replicates. The band meanings were labeled on the right side of the gel. M, MNAzyme; S, full-length substrate; P, cleavage product. Molecular weight markers were indicated to the left of the gel. The concentrations of yPNA, plasmid, MNAzyme, and substrate in (d, e, f, g, and h) were as follows: yPNA = 2 pM, Plasmid = 100 nM, MNAzyme = 100 pM, Substrate = 100 pM.

[0015] FIGURE 3. Validation of the none-toehold-dependent strand displacement reaction, (a) Two strands were prepared, including the full chain and the two half chains, the full chain and two half chains have identical same sequence, (b) Both full chain and two half chains are fully complementarily with the yPNA. (c) The yPNA was pre-bound to the two halfchains to form double strands. Subsequently, the full chain was added, and it was observed to bound to the yPNA through competition, replacing and releasing the two half chains, (d)Polyacrylamide gel electrophoresis (PAGE) validates the process of the new strand displacement. The concentrations of the yPNA, full chain, and two half chains were 1 nM, and the reaction conditions were RNase-free. The experiment was independently repeated thrice, yielding similar results.

[0016] FIGURE 4. Under the conditions of lOnM plasmid, 20nM yPNA, 40nM MNAzyme, and 200nM substrate, the cleavage of the substrate at different reaction times were investigated. The substrate was labeled with FAM.

[0017] FIGURE 5 shows an example of the MNAzyme which can be used in the present invention. The MNAzyme is composed of two oligonucleotides, i.e. right (1.) and left (2.) partzymes (SEQ ID NOS: 1 and 2, respectively), each of which comprises a substrate binding arm, a target binding arm and between said arms a sequence forming a catalytic core. The substrate oligonucleotide (3.) (SEQ ID NO:3) and the target sequence or PNA (4.) (SEQ ID NOs:4 and 5, respectively) have sequences which are complementary to the substrate binding arms and target binding arms of said MNAzyme, respectively. Further details of the MNAzyme and the reactions with the MNAzyme are given in the EXAMPLE below.

[0018] FIGURE 6 shows results from the EXAMPLE disclosed below. The amount of plasmid target in the gel decreases when the PNA concentration is increased in the reaction. M+S, the combination of the MNAzyme and FAM-labelled substrate; P, target plasmid.EMBODIMENTS

[0019] DEFINITIONS

[0020] The term “peptide nucleic acid” (PNA) refers herein to an artificially synthesized polymer, similar to DNA or RNA, with natural nitrogenous bases (such as A, T, C, G, or U) or unnatural nitrogenous bases. PNA monomers can be linked through amide (- (O)-NH-) linkages. In some examples, a PNA backbone can be composed of repeating N-(2- aminoethyl)-glycine units linked by amides. Purine and pyrimidine bases can be linked to the backbone by a methylene bridge (-CEE-) and a carbonyl group (-(O)-). In examples, PNAs can invade dsDNA, such as to form a triplex. Examples of PNAs include bis-PNA, pseudo-complementary PNA (pc-PNA), tail-clamp PNA (tc-PNA), and / or y-PNA. Analogs of PNAs are included, such as polyacrylate nucleic acid analogs and / or nucleobase-containing polymers with polyester, polyvinyl, or polyamide backbones.

[0021] The term “single-stranded nucleic acid” refers herein to a nucleic acid that only includes a single polymer strand (e.g., the nucleic acid polymer strand does not form non-covalent bonds with another nucleic acid polymer), such as single-stranded DNA (ssDNA). The nucleic acid molecule can be single-stranded in full or in part (e.g., a ssDNA region formed through a PNA-binding to a double-stranded DNA).

[0022] The term “multi-component deoxyribozyme” or “MNAzyme” refers herein to two (or more) oligonucleotide sequences (i.e. partzymes) which form an active nucleic acid enzyme that is capable of catalytically modifying a substrate, i.e. a catalytic core, said two or more oligonucleotides also forming substrate binding arms and target-binding arms of said MNAzyme (see Fig. la) so that each oligonucleotide forming said MNAzyme preferably comprises a part (preferably a half or about half) of said substrate binding arms and target binding arms. The substrate binding arms of the MNAzyme engage the reporter substrate oligonucleotide, the cleavage of which is catalyzed by the catalytic core of the MNAzyme. For self-assembly and catalytic activity, the MNAzyme requires i) an assembly facilitator, which in the present invention is the target sequence to which said target-binding arms bind, and ii) a metal ion as a cofactor. In the present invention, self-assembly of the MNAzyme can be initiated by the presence of a PNA comprising a sequence identical to said target sequence. In an embodiment, the MNAzyme cleaves the substrate between a fluorophore and a quencher dye pair attached to said reporter substrate oligonucleotide, thus generating signal. MNAzymes have been disclosed in the prior art, e.g., in W02008122084.

[0023] yPNA can mediate MNAzyme detection of a target sequence in dsDNA

[0024] In this invention, we utilized molecular dynamics (MD) simulation technology to study the differences between yPNA-MNAzyme and DNA-MNAzyme binding mechanisms. MNAzyme comprises a catalytic core sequence flanked by two biomarker-binding arms (BBAs) and two substrate recognition arms (Figure la). With lower persistence length (p) and stronger 7t-7t stacking interactions with MNAzyme BBAs, yPNA showed a "V" shape instead of linear structure under MD simulation, which resulted in deactivation of the MNAzyme catalytical activity, even when it had the correct sequence (Figure Id, e). Besides, proofed by northern blot analysis, yPNA has higher affinity to "full chain (ssDNAfc) than two half chains (BBAs) that sharing the exactly same sequence, thus could recognize and unwind dsDNA even when it was already associated to the two BBAs of MNAzyme. Those unique mechanisms are fundamental for one-step detection of dsDNA with yPNA / MNAzyme complex (Figure le, f).Finally, we validated the single-base mutation detection accuracy of the yPNA / MNAzyme system and applied it to rapid plasmid / cell fragment gene sequencing. The two unique binding mechanisms discovered between yPNA, and DNA is universal, which greatly enriches the future design concepts of DNA nanotechnology, providing support for advancing more biotechnologies.

[0025] To validate the accuracy of the aforementioned simulation results, we conducted two experiments. First, we verified that pre-incubation of yPNA could invade dsDNA, mediating MNAzyme substrate cleavage (Fig. 2a). Second, we focused on whether yPNA alone mediates MNAzyme cleavage of its substrate, causing false signals (Fig. 2b). FAM-BHQ1 fluorescence probes as the Forster resonance energy transfer pair, were modified on the substrate sequence. Ca2+was used as the metal cofactor for MNAzymes. Plasmids containing the target sequence were used as the dsDNA (Fig. 2c). For the original dsDNA detection process, yPNA was first incubated with plasmids for 2 h, followed by the addition of the MNAzyme system containing fluorescent substrates.

[0026] The macroscopic results (after overnight reaction) revealed that Groups 3 and 4, which contained the plasmid and yPNA (with different Ca2+ concentrations), exhibited strong detection signals (Fig. 2d). This suggests that yPNA hybridized with the plasmid, exposing ssDNAd and facilitating MNAzyme-mediated cleavage of the fluorescent substrate. In contrast, Group 5, lacking the plasmid, produced no signals, indicating that yPNA alone could not activate MNAzyme.

[0027] Similarly, we investigated the ability of yPNA to facilitate MNAzyme detection of dsDNA from a molecular perspective using PAGE (Fig. 2e). As anticipated, the group with yPNA and plasmid (Group 4) facilitated MNAzyme cleavage of the substrate after an overnight reaction. Moreover, yPNA mediated MNAzyme for substrate cleavage, however, with low efficiency (Group 6). This phenomenon is crucial for determining whether yPNA can be used for MNAzyme-mediated dsDNA detection. Therefore, we compared the abilities of ssDNAd and yPNA to catalyze the MNAzyme cleavage of the substrate (Fig. 2f, g). The results showed that within 2 h of reaction, ssDNAd mediated nearly 100% substrate cleavage, with detectable cleaved substrate signals within 30 min. In contrast, yPNA only mediated less than 5% substrate cleavage within 2 h (Fig. 2h). Comparing the pseudo first-order rate constant (kobs), we found that ssDNAd-mediated catalysis occurred 4,400 times faster than that of yPNA (Fig. 2h). Hence, for a 30 min to 2 h reaction period, yPNA aids MNAzyme in dsDNA detection withoutgenerating false signals. Therefore, the phenomena observed in the MD simulations results are partially correct. Within a 2-hour incubation period (sufficient for conducting the test), yPNA does not activate MNAzyme.

[0028] Accordingly, the present invention is providing a composition for detecting a target sequence in double-stranded DNA, the composition comprising i) a first oligonucleotide and a second oligonucleotide for a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides are capable of forming substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in double-stranded DNA, ii) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the doublestranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA leaving said target sequence single-stranded and thus free for said targetbinding arms of said MNAzyme to bind, and iii) a substrate oligonucleotide comprising a sequence complementary to the sequence of said substrate binding arms, wherein said substrate binding arms of said MNAzyme engage said substrate oligonucleotide so that said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide when said targetbinding arms of said MNAzyme bind or are bound to said target sequence.

[0029] In a preferred embodiment, said composition comprises i) said multi-component deoxyribozyme (MNAzyme), ii) said PNA that is in a free form or in a form that is bound to said target-binding arms of said MNAzyme, and iii) said substrate oligonucleotide bound to said substrate binding arms of said MNAzyme.

[0030] In another preferred embodiment, said PNA comprises bis-PNA, pseudo-complementary PNA (pc-PNA), tail-clamp PNA (tc-PNA), y-PNA and / or y-modified bis-PNA, pc-PNA, or tc-PNA. More preferably, said PNA is y-PNA.

[0031] In another preferred embodiment, the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect.

[0032] In another preferred embodiment, said detectable effect is produced by a label that can be engaged to said substrate oligonucleotide and is detectable by an imaging instrument or by naked eye.

[0033] In another preferred embodiment, said label is a fluorescent label and is preferably detected by fluorescence spectroscopy.

[0034] In another preferred embodiment, said modification of said substrate oligonucleotide is a cleavage of said substrate oligonucleotide.

[0035] In another preferred embodiment, said substrate oligonucleotide comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said catalytic core of said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.

[0036] In an embodiment, the present invention is providing a method for detecting the presence of a target sequence in a double-stranded DNA in a sample, preferably an environmental or clinical sample, the method comprising the steps of:a) contacting a first oligonucleotide and a second oligonucleotide forming a multi-component deoxyribozyme (MNAzyme) with i) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, and ii) a substrate oligonucleotide, in any order or simultaneously in a suitable buffer, wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme; said target-binding arms being complementary to said target sequence in double-stranded DNA, and said substrate binding arms being complementary to said substrate oligonucleotide, wherein said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide and the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect;b) incubating said first oligonucleotide and said second oligonucleotide with said PNA and said substrate oligonucleotide in order to let said PNA bind to said target-binding arms of said first oligonucleotide and said second oligonucleotide and in order to let said substrate oligonucleotide to bind said substrate binding arms of said MNAzyme to obtain a combination of said PNA, said substrate oligonucleotide and said MNAzyme;c) contacting the combination of said PNA, said substrate oligonucleotide and said MNAzyme obtained in step b) with said sample or nucleic acids isolated from said sample, wherein in the presence of the target sequence in said double-stranded DNA in said sample, the PNA detaches from the combination, invades the double-stranded DNA at the site of said target sequence by binding to the sequence that is complementary to said target sequence in said double-stranded DNA providing said target sequence in a single-stranded form for the MNAzyme to bind, wherein said catalytic core of said MNAzyme modifies said substrate oligonucleotide when said MNAzyme binds or is bound to said target sequence in doublestranded DNA in the presence of a cofactor; andd) detecting a signal from said detectable effect originating from the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme, wherein the presence of said signal confirms the presence of said target sequence in said sample.

[0037] In an embodiment, the present invention is providing a method for detecting the presence of a target sequence in a double-stranded DNA in a sample, preferably an environmental or clinical sample, the method comprising the steps of:a) contacting a first oligonucleotide and a second oligonucleotide capable of forming a multicomponent deoxyribozyme (MNAzyme) with a substrate oligonucleotide, wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme; said target-binding arms being complementary to said target sequence in double-stranded DNA, and said substrate binding arms being complementary to said substrate oligonucleotide, wherein said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide and the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect;b) incubating said first oligonucleotide and said second oligonucleotide with said substrate oligonucleotide in order to let said substrate oligonucleotide to bind said substrate binding arms of said MNAzyme to obtain a combination of said substrate oligonucleotide and said MNAzyme;c) contacting a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, with said sample or nucleic acids isolated from said sample, wherein in the presence of the target sequence in said double-stranded DNA in said sample, the PNA invades the double-stranded DNA at the site of said target sequence by binding to the sequence that is complementary to said target sequence in said double-stranded DNA providing said target sequence in a single-stranded form;d) adding the combination of said substrate oligonucleotide and said MNAzyme obtained in step b) to the mixture of said PNA and the sample obtained in step c), wherein said catalytic core of said MNAzyme modifies said substrate oligonucleotide when said MNAzyme binds or is bound to said target sequence in the presence of a cofactor; ande) detecting a signal from said detectable effect originating from the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme, wherein the presence of said signal confirms the presence of said target sequence in said sample.

[0038] In a preferred embodiment, said cofactor is a metal ion, such as Ca2+.

[0039] In an embodiment, the present invention is providing a kit for detecting the presence of a target sequence in double-stranded DNA in a sample, wherein said kit comprises a) one or more containers comprising i) a first oligonucleotide and a second oligonucleotide capable of forming a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in said double-stranded DNA, ii) a substrate oligonucleotide, and iii) a PNA, wherein said PNA comprises a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, and b) instructions for use of the kit for the detection.

[0040] In a preferred embodiment, said substrate oligonucleotide in the kit is bound to said substrate binding arms of said MNAzyme.

[0041] In another preferred embodiment, said PNA in the kit is bound to said targetbinding arms of said MNAzyme.

[0042] In another preferred embodiment, said PNA in the kit comprises bis-PNA, pseudo-complementary PNA (pc-PNA), tail-clamp PNA (tc-PNA), y-PNA and / or y-modified bis-PNA, pc-PNA, or tc-PNA. More preferably said PNA is y-PNA.

[0043] It is to be understood that the embodiments of the invention disclosed are not limited to the particular structures, process steps, or materials disclosed herein, but are extended to equivalents thereof as would be recognized by those ordinarily skilled in the relevant arts. It should also be understood that terminology employed herein is used for the purpose of describing particular embodiments only and is not intended to be limiting.

[0044] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment.

[0045] As used herein, a plurality of items, structural elements, compositional elements, and / or materials may be presented in a common list for convenience. However, these lists should be construed as though each member of the list is individually identified as a separate and unique member. Thus, no individual member of such list should be construed as a de facto equivalent of any other member of the same list solely based on their presentation in a common group without indications to the contrary. In addition, various embodiments and example of the present invention may be referred to herein along with alternatives for the various components thereof. It is understood that such embodiments, examples, and alternatives are not to be construed as de facto equivalents of one another, but are to be considered as separate and autonomous representations of the present invention.

[0046] Furthermore, the described features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. In the following description, numerous specific details are provided, such as examples of lengths, widths, shapes, etc., to provide a thorough understanding of embodiments of the invention. One skilled in the relevant art will recognize, however, that the invention can be practiced without one or more of the specific details, or with other methods, components, materials, etc. In other instances, well-known structures, materials, or operations are not shown or described in detail to avoid obscuring aspects of the invention.

[0047] While the forgoing examples are illustrative of the principles of the presentinvention in one or more particular applications, it will be apparent to those of ordinary skill in the art that numerous modifications in form, usage and details of implementation can be made without the exercise of inventive faculty, and without departing from the principles and concepts of the invention. Accordingly, it is not intended that the invention be limited, except as by the claims set forth below.

[0048] The verbs “to comprise” and “to include” are used in this document as open limitations that neither exclude nor require the existence of also un-recited features. The features recited in depending claims are mutually freely combinable unless otherwise explicitly stated. Furthermore, it is to be understood that the use of "a" or "an", i.e. a singular form, throughout this document does not exclude a plurality.EXAMPLEEXAMPLE 1. MNAzyme-mediated substrate cleavage in the presence of PNA and 10 nM plasmid target.First, PNA, MNAzyme, and a fluorescent substrate were each diluted to 1 mM stock solutions using nuclease-free water at room temperature. The y-PNA was purchased from PANAGENE, and the MNAzyme and nucleic acid substrates were obtained from Eurofins without further modification. The PNA sequence for dsDNA invasion was as follows: N-term - cca ca*a gt*t ca*g cg*t gt*c eg*- C-term (SEQ ID NO:5) (* represents y-Lys). The MNAzyme contained two branch sequences: (Right Partzyme) CACGTCCATCTCTTCTCTCAGCGAACTTGTGG (SEQ ID NO: 1) and (Left Partzyme) CGGACACGCTGAGACGAAATAGTGAGT (SEQ ID NO:2). The fluorescence substrate sequence was FAM-ACTCACTAT / rA / / rG / GAAGAGATGGACGTG-BHQ1 (SEQ ID NO:3), where "r" denotes ribonucleotide. The target gene sequence within a plasmid was CCACAAGTTCAGCGTGTCCG (SEQ ID NO:4). The plasmid pcDNA3.1(+) containing eGFP was designed and purchased from Sangon Biotech Co. For the 10 nM plasmid sample testing, the effects of 10, 20, 30, 40, and 50 nM PNA were compared on MNAzyme-mediated substrate cleavage. The substrate was labeled with FAM alone. The MNAzyme concentration was 100 nM, and that of the substrate was 100 nM in a reaction system of 10 pL nuclease-free water containing 5 mM calcium ion cofactor. After a subsequent 2h reaction, fluorescence imaging was conducted. For fluorescence imaging in PCR tubes, the fluorescent substrate was labeled with FAM-BHQ1, and imaging was performed using the Invitrogen iBright imaging system from Thermo Fisher. The results of this experiment are shown in Figure 6.ACRONYMS LISTPNA peptide nucleic acidMNAzyme multi-component deoxyribozymedsDNA double strand DNAssDNA single strand DNACITATION LISTPatent LiteratureUS8394946US20230049215Non-Patent Literature1. G. C. Gavins et al., Live cell PNA labelling enables erasable fluorescence imaging of membrane proteins. Nature Chemistry 13, 15-23 (2021).2. I. Hirao et al., An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA. Nature Methods 3, 729-735 (2006).3. Y. Ura, J. M. Beierle, L. J. Leman, L. E. Orgel, M. R. Ghadiri, Self-assembling sequence-adaptive peptide nucleic acids. Science 325, 73-77 (2009).4. J. E. Kim, S. Yoon, H. Mok, W. Jung, D.-E. Kim, Site-specific cleavage of mutant ABL mRNA by DNAzyme is facilitated by peptide nucleic acid binding to RNA substrate. FEBS Letters 586, 3865-3869 (2012).5. M. Lyu et al., PNA-assisted DNAzymes to cleave double-stranded DNA for genetic engineering with high sequence fidelity. Journal of the American Chemical Society 143, 9724-9728 (2021).6. T. Marsic et al., Programmable site-specific DNA double-strand breaks via PNA- assisted prokaryotic Argonautes. Nucleic Acids Research 51, 9491-9506 (2023).7. R. Aman et al., Peptide nucleic acid-assisted generation of targeted double-stranded DNA breaks with T7 endonuclease I. Nucleic Acids Research 52, 3469-3482 (2024).8. J. Yan et al. , Development of Aptamer-DNAzyme based metal-nucleic acid frameworks for gastric cancer therapy. Nature Communications 15, 3684 (2024).9. E. Mokany, The development of multi-component nucleic acid enzymes(MNAzymes)for the detection of analytes. University of New South Wales 80, 98-104 (2007).10. E. Mokany, S. M. Bone, P. E. Young, T. B. Doan, A. V. Todd, MNAzymes, a versatile new class of nucleicacid enzymes that can function as biosensors and molecular switches. Journal of the American Chemical Society 132, 1051-1059 (2010).11. J. Yan, M. Ran, X. Shen, H. Zhang, Therapeutic DNAzymes: from structure design to clinical applications. Advanced Materials 35, 2300374 (2023).O. Hanpanich et al.. Label-free detection of HPV mRNA with an artificial chaperone-enhanced MNAzyme (ACEzyme)-based electrochemical sensor. Biosensors and Bioelectronics 221, 114352 (2023).M. A. Abdou Mohamed et al., Diagnosing antibiotic resistance using nucleic acid enzymes and gold nanoparticles. ACS Nano 15, 9379-9390 (2021).O. Hu et al, A multicomponent nucleic acid enzyme-cleavable quantum dot nanobeacon for highly sensitive diagnosis of tuberculosis with the naked eye. ACS Sensors 8, 254-262 (2023).

Claims

CLAIMS1. A composition for detecting a target sequence in double-stranded DNA, the composition comprising i) a first oligonucleotide and a second oligonucleotide for a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides are capable of forming substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in double-stranded DNA, ii) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA leaving said target sequence single-stranded and thus free for said target-binding arms of said MNAzyme to bind, and iii) a substrate oligonucleotide comprising a sequence complementary to the sequence of said substrate binding arms, wherein said substrate binding arms of said MNAzyme engage said substrate oligonucleotide so that said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide when said target-binding arms of said MNAzyme bind or are bound to said target sequence in the presence of a cofactor.

2. The composition according to claim 1, wherein said composition comprises i) said multicomponent deoxyribozyme (MNAzyme), ii) said PNA that is in a free form or in a form that is bound to said target-binding arms of said MNAzyme, and iii) said substrate oligonucleotide bound to said substrate binding arms of said MNAzyme.

3. The composition according to claim 1 or 2, wherein said PNA comprises bis-PNA, pseudo-complementary PNA (pc-PNA), tail -clamp PNA (tc-PNA), y-PNA and / or y-modified bis-PNA, pc-PNA, or tc-PNA.

4. The composition according to claim 3, wherein said PNA is y-PNA.

5. The composition according to any one of claims 1-4, wherein the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect.

6. The composition according to claim 5, wherein said detectable effect is produced by a label that can be engaged to said substrate oligonucleotide and is detectable by an imaging instrument or by naked eye.

7. The composition according to claim 6, wherein said label is a fluorescent label and is preferably detected by fluorescence spectroscopy.

8. The composition according to any one of claims 5-7, wherein said modification of said substrate oligonucleotide is a cleavage of said substrate oligonucleotide.

9. The composition according to any one of claims 5-8, wherein said substrate oligonucleotide comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said catalytic core of said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.

10. A method for detecting the presence of a target sequence in a double-stranded DNA in a sample, preferably an environmental or clinical sample, the method comprising the steps of: a) contacting a first oligonucleotide and a second oligonucleotide forming a multi-component deoxyribozyme (MNAzyme) with i) a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, and ii) a substrate oligonucleotide, in any order or simultaneously in a suitable buffer, wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme; said target-binding arms being complementary to said target sequence in double-stranded DNA, and said substrate binding arms being complementary to said substrate oligonucleotide, wherein said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide and the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect;b) incubating said first oligonucleotide and said second oligonucleotide with said PNA and said substrate oligonucleotide in order to let said PNA bind to said target-binding arms of said first oligonucleotide and said second oligonucleotide and in order to let said substrate oligonucleotide to bind said substrate binding arms of said MNAzyme to obtain a combination of said PNA, said substrate oligonucleotide and said MNAzyme;c) contacting the combination of said PNA, said substrate oligonucleotide and said MNAzyme obtained in step b) with said sample or nucleic acids isolated from said sample,wherein in the presence of the target sequence in said double-stranded DNA in said sample, the PNA detaches from the combination, invades the double-stranded DNA at the site of said target sequence by binding to the sequence that is complementary to said target sequence in said double-stranded DNA providing said target sequence in a single-stranded form for the MNAzyme to bind, wherein said catalytic core of said MNAzyme modifies said substrate oligonucleotide when said MNAzyme binds or is bound to said target sequence in doublestranded DNA in the presence of a cofactor; andd) detecting a signal from said detectable effect originating from the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme, wherein the presence of said signal confirms the presence of said target sequence in said sample.

11. A method for detecting the presence of a target sequence in a double-stranded DNA in a sample, preferably an environmental or clinical sample, the method comprising the steps of: a) contacting a first oligonucleotide and a second oligonucleotide capable of forming a multicomponent deoxyribozyme (MNAzyme) with a substrate oligonucleotide, wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme; said target-binding arms being complementary to said target sequence in double-stranded DNA, and said substrate binding arms being complementary to said substrate oligonucleotide, wherein said catalytic core of said MNAzyme is capable of modifying said substrate oligonucleotide and the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme provides a detectable effect;b) incubating said first oligonucleotide and said second oligonucleotide with said substrate oligonucleotide in order to let said substrate oligonucleotide to bind said substrate binding arms of said MNAzyme to obtain a combination of said substrate oligonucleotide and said MNAzyme;c) contacting a peptide nucleic acid (PNA) comprising a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said doublestranded DNA, with said sample or nucleic acids isolated from said sample, wherein in the presence of the target sequence in said double-stranded DNA in said sample, the PNA invades the double-stranded DNA at the site of said target sequence by binding to the sequence that iscomplementary to said target sequence in said double-stranded DNA providing said target sequence in a single-stranded form;d) adding the combination of said substrate oligonucleotide and said MNAzyme obtained in step b) to the mixture of said PNA and the sample obtained in step c), wherein said catalytic core of said MNAzyme modifies said substrate oligonucleotide when said MNAzyme binds or is bound to said target sequence in the presence of a cofactor; ande) detecting a signal from said detectable effect originating from the modification of said substrate oligonucleotide by said catalytic core of said MNAzyme, wherein the presence of said signal confirms the presence of said target sequence in said sample.

12. The method according to claim 10 or 11, wherein said PNA comprises bis-PNA, pseudo-complementary PNA (pc-PNA), tail -clamp PNA (tc-PNA), y-PNA and / or y-modified bis-PNA, pc-PNA, or tc-PNA.

13. The method according to claim 12, wherein said PNA is y-PNA.

14. The method according to any one of claims 10-13, wherein said detectable effect is produced by a label that can be engaged to said substrate oligonucleotide and is detectable by an imaging instrument or by naked eye.

15. The method according to claim 14, wherein said label is a fluorescent label and is preferably detected by fluorescence spectroscopy.

16. The method according to any one of claims 10-15, wherein said modification of said substrate oligonucleotide is a cleavage of said substrate oligonucleotide.

17. The method according to any one of claims 10-16, wherein said substrate oligonucleotide comprises a detectable portion and a quencher portion, wherein upon modification of said substrate by said catalytic core of said MNAzyme, a detectable effect provided by said detectable portion is increased or decreased.

18. A kit for detecting the presence of a target sequence in double-stranded DNA in a sample, wherein said kit comprises a) one or more containers comprising i) a first oligonucleotide and a second oligonucleotide capable of forming a multi-component deoxyribozyme (MNAzyme), wherein said first and second oligonucleotides form substrate binding arms, a catalytic core, and target-binding arms of said MNAzyme, said target-binding arms being complementary to said target sequence in said double-stranded DNA, ii) a substrate oligonucleotide, and iii) aPNA, wherein said PNA comprises a sequence identical to said target sequence, wherein said PNA is capable of binding to a sequence that is complementary to said target sequence in said double-stranded DNA, and wherein said PNA is capable of invading the double-stranded DNA at the site of said target sequence and opening the double-stranded DNA by binding to the sequence complementary to said target sequence in said double-stranded DNA, and b) instructions for use of the kit for the detection.

19. The kit according to claim 18, wherein said substrate oligonucleotide is bound to said substrate binding arms of said MNAzyme.

20. The kit according to claim 18 or 19, wherein said PNA is bound to said target-binding arms of said MNAzyme.

21. The kit according to any one of claimsl8-20, wherein said PNA comprises bis-PNA, pseudo-complementary PNA (pc-PNA), tail-clamp PNA (tc-PNA), y-PNA and / or y-modified bis-PNA, pc-PNA, or tc-PNA.

22. The kit according to claim 21, wherein said PNA is y-PNA.

Images