Recombinant adeno-associated virus 8 human solute carrier family 4 member 11 (AAV8-HSLC4a11) for congenital hereditary endothelial dystrophy (CHED)
The AAV8-hSLC4A11 vector addresses the lack of effective treatments for CHED by restoring SLC4A11 function in corneal endothelial cells, reducing edema and improving vision, providing a safer and more accessible alternative to transplantation.
Patent Information
- Application Number
- PCT/US2025/055084
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-13
- Filing Date
- 2025-11-12
- Publication Date
- 2026-05-21
AI Technical Summary
There is no effective pharmaceutical treatment available for Congenital Hereditary Endothelial Dystrophy (CHED) caused by SLC4A11 gene mutations, leading to corneal edema and visual impairment, with current treatments like corneal transplantation associated with complications and limited accessibility in resource-limited settings.
A recombinant adeno-associated virus 8 (AAV8) vector encoding human solute carrier family 4 member 11 (SLC4A11) polypeptide is used to transduce corneal endothelial cells via intrastromal injection, aiming to restore SLC4A11 function and improve corneal clarity.
The AAV8-hSLC4A11 vector effectively reduces corneal edema and improves visual function in preclinical models, offering a potentially long-term solution with fewer complications compared to transplantation.
Smart Images

Figure US2025055084_21052026_PF_FP_ABST
Abstract
Description
[0001] RECOMBINANT ADENO-ASSOCIATED VIRUS 8 HUMAN SOLUTE CARRIER FAMILY 4 MEMBER 11 (AAV8-HSLC4A11) FOR CONGENITAL HEREDITARY ENDOTHELIAL DYSTROPHY (CHED)
[0002] CROSS REFERENCE TO RELATED APPLICATIONS
[0003] This application claims the benefit under 35 U.S.C. Section 119(e) of copending and commonly-assigned U.S. Provisional Patent Application No. 63 / 720,061, filed November 13, 2024, entitled “RECOMBINANT ADENO-ASSOCIATED VIRUS 8 HUMAN SOLUTE CARRIER FAMILY 4 MEMBER 11 (AAV8-HSLC4A11) FOR CONGENITAL HEREDITARY ENDOTHELIAL DYSTROPHY (CHED)”, the contents of which is incorporated by reference herein.
[0004] TECHNICAL FIELD
[0005] Embodiments of the disclosure concern at least the fields of medicine and molecular biology.
[0006] BACKGROUND OF THE INVENTION
[0007] Congenital hereditary endothelial dystrophy (CHED) is an autosomal recessive condition affecting the corneal endothelial cells, which function to maintain corneal clarity. CHED is characterized by bilateral corneal edema and opacification presenting at birth or in the first decade of life. Symptoms consist of bilateral visual impairment, which is typically significant, and secondary deprivation amblyopia and nystagmus. The diffuse corneal edema may be associated with increased corneal thickness up to twice normal, although the remainder of the ocular structures typically develop normally.
[0008] Approximately 80% of individuals with CHED screened to date demonstrate biallelic coding region mutations in the solute carrier family 4 member 11 gene (S C4AI I). To date, more than 90 distinct mutations throughout exons 2 to 19 of SLC4A11 have been identified in individuals with CHED, including missense and nonsense point mutations, insertion or deletion-associated frameshift mutations, as well as canonical splice-site mutations.
[0009] CHED is a rare disease in the United States, where neither the birth incidence nor the population prevalence has been reported, and is an uncommon domestic indication for corneal transplantation. However, CHED is one of the most frequently encountered corneal dystrophies in countries where consanguineous marriages are more common (Middle East, South Asia and Southeast Asia), and is a well-recognized cause of congenital corneal opacification (CCO) due to the presence of corneal edema at birth. The incidence of CCO in the United States is estimated to be approximately 2.2 per 100,000 live births. A determination of the percentage of the cases of CCO that are due to CHED can be performed by reviewing the published series of the causes of CCO in the US. The largest series include between 14 and 56 infants. In none of these series was CHED identified as the case of CCO in an infant. However, the percentage of eyes in each of these series in which the cause of the CCO was idiopathic (0%, 4%, 10%) or was not specified (33%) was provided. Therefore, if one assumes that all of the infants with idiopathic CCO or in whom the cause was not specified had CHED, the birth incidence can be conservatively calculated by multiplying the incidence of CCO per live births in the US by the lowest and highest percentages of cases of CCO in these series by the US population in the 2020 census: (2.2 / 100,000) x 0.04 x 331,449,281 to (2.2 / 100,000) x 0.33 x 331,449,281 = 292 to 2406. Given an average life expectancy of 76.4 years for both sexes in the US, the estimated number of individuals with CHED in the US would then be 22,309 - 183,843.
[0010] Currently there is no highly efficacious treatment available for CHED caused by SLC4A11 gene mutations. There is a need in the art for materials and methods useful to treat CHED. SUMMARY OF THE INVENTION
[0011] The invention disclosed herein has a number of embodiments. For example, embodiments of the invention include compositions of matter comprising a mammalian expression vector, wherein a polynucleotide disposed in the vector encodes a human solute carrier family 4 member 11 polypeptide (e.g., as shown in SEQ ID NO: 2). In embodiments of the invention, the composition can further comprise one or more agents such as pharmaceutical excipients. In certain embodiments of the invention, the vector comprises a AAV promoter and an AAV inverted terminal repeat of SEQ ID NO: 1. Typically, the vector comprises an adeno-associated viral (AAV) vector, for example, an AAV8 viral vector. In certain embodiments of the invention the vector comprises a codon optimized human solute carrier family 4 member 11 polynucleotide sequence. Working embodiments of the invention include rAAV8-EFla-hSLC4Al 1 (SEQ ID NO: 1), a non-replicating, rep / cap-deleted, rAAV vector containing wild type human single stranded cDNA encoding Solute Carrier Family 4 Member 11 (SLC4A11') variant B protein. In certain embodiments of the invention, the vector is disposed in a corneal endothelial cell, for example one exhibiting a mutation found in an individual suffering from a congenital hereditary endothelial dystrophy.
[0012] Embodiments of the invention further include methods of transducing a human corneal endothelial cell, the method comprising combining a vector comprising SEQ ID NO: 1 with the corneal endothelial cell under conditions selected to allow the vector to deliver the polynucleotide into the corneal endothelial cell such that the corneal endothelial cell is transduced with the vector and expresses human solute carrier family 4 member 11 polypeptide. In some embodiments of these methods, the corneal endothelial cell is transduced in vitro. In other embodiments of these methods, the corneal endothelial cell is transduced in vivo. Typically, the corneal endothelial cell is selected to exhibit a mutation found in an individual suffering from a congenital hereditary endothelial dystrophy. In certain embodiments of such methods, the individual is administered the vector via intrastromal injection into a cornea.
[0013] Embodiments of the invention also include methods of making a mammalian expression vector comprising a polynucleotide encoding a human solute carrier family 4 member, the method comprising disposing a polynucleotide comprising SEQ ID NO: 2 into an adeno-associated viral (AAV) vector such that the mammalian expression vector is made. In certain embodiments of these methods, the adeno-associated viral (AAV) vector comprises an AAV8 viral vector. Typically in these methods, the adeno-associated viral (AAV) vector comprises an AAV promoter and an AAV inverted terminal repeat shown in SEQ ID NO: 1. Optionally, the adeno-associated viral (AAV) vector comprises SEQ ID NO: 1.
[0014] Other objects, features and advantages of the present invention will become apparent to those skilled in the art from the following detailed description. It is to be understood, however, that the detailed description and specific examples, while indicating some embodiments of the present invention, are given by way of illustration and not limitation. Many changes and modifications within the scope of the present invention may be made without departing from the spirit thereof, and the invention includes all such modifications.
[0015] FIGURES
[0016] Figure 1. Clinical presentation of Congenital hereditary endothelial dystrophy (CHED). Slit-lamp images of 16-y ear-old-boy with CHED associated with compound heterozygous SLC4A11 mutations, demonstrating diffuse corneal stromal edema seen on direct and slit illumination.
[0017] Figure 2. Natural History of CHED. A. Scatter plot of visual acuity (VA) in logMAR unit against age in individuals with CHED. Fitted second order polynomial curve (solid line) with 95% CI (dotted lines) of predicted VA against age were also plotted. Reference lines and shaded areas indicate 20 / 20 vision, VA range for low vision / moderate visual impairment (light grey) and VA range for legal blindness (dark grey). B. Slope graph of Snellen chart VA in 33 eyes of individuals with CHED measured with correction (CC) and laser interferometry (LI). ****, p<0.0001. C. Slope graph of Snellen chart VA in 14 eyes of individuals with CHED measured with correction (CC) and with pinhole. ****, p<0.0001. D. Scatter plot of CCT against age in individuals with CHED. Fitted one phase association curve (solid line) with 95% CI (dotted lines) of predicted CCT against age were also plotted. E Zoomed-in figure of scatter plot £>, showing CCT plotted against age within first 6 years of life in individuals with CHED. F. Scatter plot showing corneal endothelial cell density (CD) plotted against CCT in children 6 - 13 years of age with CHED. G. Histogram of CDS (in grayscale units (GSU)) in 55 eyes of children with CHED (GSU 10 indicates a relatively transparent cornea and 70 indicates a relatively opaque cornea). H. Scatter plot showing age at time of initial keratoplasty in individuals with CHED. Median with 95% CI was plotted as line with error bars.
[0018] Figure 3. Schematic of the plasmid vector used to produce single stranded AAV-hSLC4All. ITR2 = inverted terminal repeat serotype 2, EFl a = eukaryotic translation elongation factor 1 a promoter, hSLC4Al 1 = human solute carrier family 4 member 11, bGH pA = bovine growth hormone polyadenylation signal.
[0019] Figure 4. Organization of the AAV8-hSLC4All vector. ITR2 = inverted terminal repeat serotype 2, EFla = eukaryotic translation elongation factor 1 a promoter, hSLC4Al 1 = human solute carrier family 4 member 11, bGH pA = bovine growth hormone polyadenylation signal.
[0020] Figure 5. Intrastromal injection of AAV8-GFP in ex vivo donor human corneas transduces the corneal endothelium. A. Photographs of human cornea mounted on artificial anterior chamber prior to and after central deep stromal injection. Air in the anterior chamber facilitates visualization of folds in the Descemet membrane (DM) observed when the needle tip was advanced very close to the DM. B. Representative immunofluorescence staining images of peeled DM from AAV8-GFP or BSS injected human corneas labeled with anti-GFP and anti-ZOl antibodies with DAPI nuclear staining. C. Scatter plot of the estimated percentage of transduced comeal endothelial cells in AAV8-GFP or BSS injected corneas in four testing conditions with varying injection depth and volume but constant 5el0 vg viral genome dosage.
[0021] Figure 6. AAV8-hSLC4All transduction produces mature SLC4A11 protein. Western Blot results of HEK293 cell lysates after transduction of AAV8-hSLC4Al 1 blotted for SLC4A11 and a-tubulin proteins.
[0022] Figure 7. SLC4A11 mediated NH3 / NH4+ and H+ conductance is a sensitive measure of mature SLC4A11 function. A. Scatter plot of SLC4A11 / Slc4all mRNA transcript abundance from RNAseq data of corneal endothelial cells from various sources. RPKM, reads per kilobase of transcript, per million mapped reads; evHCEnC, ex vivo human comeal endothelial cells. RPKM less than 1 was considered no expression (region shaded grey). B. Scatter plot of NH4CI (10 mM) induced membrane potential changes measured by single-cell current-clamp recordings of corneal endothelial cells from various sources. C. Scatter plot of NH4CI (10 mM) induced membrane potential changes of CRISPR SLC4A11'1' HCEnC-21T transduced with lentiviral (LV) vectors driving expressing of SLC4AllvB wild type, R125H, R605X or R755W mutant, respectively. Mean ± SEM were plotted; *, / ? <0.05; ****, / ? <0.0001.
[0023] Figure 8. LV-hSLC4All transduction reinstated membrane NHs / NELF and H+conductance, as well as cellular resistance to oxidative stress stimuli in SLC4All-deficient HCEnC. A. Representative traces of membrane potential changes induced by 10 mM NH4C1 in CRISPR SLC4AH'1' hCEnC transduced with empty vector, LV-hSLC4Al lvBWTor LV-hSLC4Al lvCWT. B. Bar graph shows the fraction of viable cells after induction of acute oxidative stress by escalating concentrations of tBH. Stable transductions of CRISPR SLC4A11’1’ hCEnC-21T with LV-hSLC4Al 1VBWTor LV-hSLC4Al lvCWTexhibit increases in hCEnC viability during tBH-induced oxidative stress compared to empty vector. LV = Lentivirus; hCEnC = human comeal endothelial cells; tBH = tert-butylhydroperoxide; vB = SLC4A11 variant B; vC = SLC4A11 variant C. Figure 9. Corneal edema is reduced with AAV9-mSlc4all. A.
[0024] Representative OCT images of noninjected and AAV9-HA-57c a77 injected eyes from 5-week-old S!c4al 1~~ mice. B. Quantification of data from A. Mean ± SD. ns = not significant. OD = right eye; OS = left eye.
[0025] Figure 10. Intrastromal AAV8-hSLC4All injection rescues corneal edema in Slc4all knock out mice. Anterior segment ocular coherence tomography (OCT) images of a Slc4all -deficient mouse 14 weeks after corneal intrastromal injection of rAAV8-EFla-hSLC4Al 1 vector (1 x 109vg / eye) in one eye (AAV eye). A significant difference in corneal thickness is seen when compared with the untreated eye (CTRL eye).
[0026] Figure 11. Intrastromal AAV8-hSLC4All injection rescues corneal edema in Slc4all knock out mice. Central corneal thickness (CCT) measurements in Slc4all~~ mice following AAV8-hSLC4Al 1 corneal intrastromal injection of four dosages of AAV8-hSLC4Al 1 vector in one eye (AAV eye) (1 x 109(n = 14 mice), 3.3 x 108(n = 10 mice), 1 x 108(n = 10 mice), 1 x 107(n = 11 mice), and 1 x 106(n = 11 mice) vg / eye) and in the contralateral untreated eye (CTRL eye). Vg = viral genomes. Shaded area indicates CCT in Slc4all wild type mice.
[0027] DETAILED DESCRIPTION OF THE INVENTION
[0028] In the description of embodiments, reference may be made to the accompanying figures which form a part hereof, and in which is shown by way of illustration a specific embodiment in which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural changes may be made without departing from the scope of the present invention. Many of the techniques and procedures described or referenced herein are well understood and commonly employed by those skilled in the art. Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.
[0029] Congenital Hereditary Endothelial Dystrophy (CHED, OMIM# 217700, ORPHAcode 293603) is an autosomal recessive condition affecting the corneal endothelial cells, which function to maintain corneal clarity. CHED is characterized by bilateral corneal edema and opacification presenting at birth or in the first decade of life (Figure 1). Symptoms consist of bilateral visual impairment, which is typically significant, with affected individuals commonly developing secondary deprivation amblyopia and nystagmus. The diffuse corneal edema is typically severe at the time of diagnosis and may result in an increased corneal thickness up to twice normal, although the remainder of the ocular structures typically develop normally.2A subset of affected individuals will develop a slowly progressive sensorineural hearing loss (Harboyan syndrome, OMIM# 217400) that typically presents in the first two decades of life.3'5At present, there is no effective pharmaceutical treatment for CHED and thus corneal transplantation is the only treatment option for restoration of vision in infants and children with CHED.
[0030] CHED is associated with mutations in the solute carrier family 4 member 11 gene (SLC4AU). To date, more than 90 distinct mutations throughout exons 2 to 19 of SLC4A11 have been identified in individuals with CHED, including missense and nonsense point mutations, insertion or deletion-associated frameshift mutations, as well as canonical splice-site mutations.3’6'19Approximately 80% of individuals with CHED screened to date demonstrate biallelic coding region mutations in SLC4A11. In CHED cases without SLC4A11 coding region mutations, an intronic SLC4A11 mutation was reported to result in aberrant pre-mRNA splicing and functionally null allele, whereas no pathogenic variants have been identified in the SLC4A11 promoter region thus far.12,15,20
[0031] Pathophysiology SLC4A11 is one of the highly expressed differentiation markers for corneal endothelium and is essential in facilitating energy producing glutaminolysis by maintaining ammonia homeostasis, reducing glutaminolysis-associated oxidative stress, maintaining antioxidant signaling and preventing apoptosis in the corneal endothelium.21'28The progressive corneal stromal edema observed in CHED is evidence of corneal endothelial dysfunction, either from cell loss or dysfunction of the corneal endothelial “pump-leak” system.29'31The endothelial pump activity is driven by an ionic electrical -chemi cal gradient set up by the highly expressed Na+ / K+-ATPase.32As such, corneal endothelial cells have the second highest density of mitochondria among any cell types in the body (second to photoreceptors), necessary to generate sufficient ATP to fuel the Na+ / K+-ATPase driven endothelial pump.33Glucose and glutamine each contribute about half of the energy needed to fuel the corneal endothelial “pump” activity.34Multiple lines of evidence support dysfunction of the corneal endothelial “pump” activity secondary to loss of SLC4A11 function as the direct cause of corneal edema in CHED.20,33’35'39
[0032] To determine the natural history of CHED, we collected demographic and clinical data on 166 individuals (age range: 4 months - 60 years old) with CHED, including 62 published cases (42 male, 20 female) and 104 unpublished cases (57 male, 47 female).15,35’40'47Visual acuity was measured on Snellen visual acuity chart or age-appropriate Cardiff chart for young children. If preoperative VA of both eyes was available at a given age, only the VA of the better-seeing eye was included.
[0033] Progressive corneal edema (measured by an increase in CCT) and loss of vision (measured by a decrease in visual acuity) with increasing age were evident in individuals with CHED (Figure 2A, D). In 180 eyes with available preoperative corrected visual acuity (VA), the median VA was 20 / 400 (1.30 logMAR) (95% confidence interval (95% CI) of 20 / 317 - 20 / 604 (1.2 - 1.48 logMAR)), with 73.3% eyes reaching the threshold of legal blindness (Figure 2A). Preoperative laser interferometer (LI) visual acuity testing performed to assess the visual acuity potential after optical correction and vision therapy demonstrated the potential for visual recovery in 31 of 33 eyes with a mean potential VA improvement of 0.80 logMAR unit (paired t test, p < 0.0001) (Figure 2B). Similarly, preoperative pin hole visual acuity testing performed to assess visual acuity potential after optical correction revealed the potential for visual recovery in 13 of 14 eyes with a mean potential VA improvement of 0.26 logMAR unit (paired t test, p < 0.0001) (Figure 2C). These data suggest that individuals with CHED have the potential for significant recovery of vision if corneal edema is corrected with or without subsequent vision therapy for amblyopia.
[0034] CCT in individuals with CHED can be fit against age with a one-phase association curve, if it is assumed that corneas in CHED will reach maximum thickness with zero swelling pressure beyond a certain age (Figure 2D, E). Our data of 301 eyes in individuals with CHED with preoperative CCT data demonstrate an increase in CCT between birth and 3 years of age, with a stabilization of CCT after 3 years of age (Figure 2E). In addition to increased CCT, the corneas from children affected with CHED demonstrate decreased endothelial cell density (Figure 2F) and exhibit significantly increased mean corneal densitometry (37.2 + 1.5 grayscale units (GSU)) compared with controls (15.0 + 1.9 GSU, p < 0.0001) (Figure 2G).
[0035] The chronic corneal stromal edema in CHED leads to irreversible stromal architectural changes that limit the degree of corneal clarity following surgical intervention to replace the dysfunctional host endothelium with healthy donor endothelium (endothelial keratoplasty). Therefore, the decision of whether to perform a full thickness replacement of the cornea (penetrating keratoplasty) or endothelial keratoplasty is dependent on the severity and chronicity of the corneal edema and the presence of stromal scarring.48In published case series of CHED, the mean age at the time of keratoplasty is reported to be between 8.1 - 13.5 years of age (excluding two case series reporting 42.7 and 3.3 years of age as the mean age at the time of keratoplasty).49'55The first of the two series was published in 1969 and described early experiences of keratoplasty in individuals with CHED, while the second was a case series that specifically described keratoplasty outcomes in young children.54’55 Our unpublished data from 157 eyes that underwent corneal transplantation showed a median age at the time of initial keratoplasty of 9.5 years of age (95% CI, 8.3 - 10.6), similar to published series (Figure 2H).
[0036] The typical indication for embodiments of the invention is for the treatment of Congenital hereditary endothelial dystrophy (CHED). We disclose the use of recombinant Adeno-Associated Virus 8 Human Solute Carrier Family 4 Member 11 (AAV8-hSLC4All) useful as a drug product for treatment of infants and children with Congenital hereditary endothelial dystrophy (CHED) associated with biallelic mutations in SLC4A11. Missense mutations in SLC4A11 lead to loss of function of the encoded protein, with secondary dysfunction of the corneal endothelial “pump” activity and development of the progressive corneal edema that characterizes CHED. A single injection of AAV8-hSLC4Al 1 into the posterior corneal stroma will be performed to transduce the corneal endothelial cells with the intended result as longterm expression of SLC4A11 in the endothelial cells. Studies in Slc4a 11 -deficient mice have shown that recombinant adeno-associated virus (rAAV) gene therapy vectors expressing wild type Slc4all can provide significant restoration of corneal endothelial function and reversal of corneal edema, supporting the feasibility and potential benefit of corneal intrastromal delivery of a rAAV8 vector expressing human SLC4A11 to improve visual function in individuals with CHED.56Inclusion criteria for treatment would be: an infant or child with CHED associated with biallelic mutations in SLC4A11; and a corneal densitometry score (CDS) less than 40 grey scale unit (GSU) and endothelial cell density greater than 500 cells per square millimeter (optimal profile) or a CDS less than 45 GSU and an undocumented endothelial cell density (threshold profile).
[0037] Pediatric corneal transplantation, which is the only available treatment for CHED, is associated with an increased risk of intraoperative and postoperative complications, including higher rates of transplant rejection and failure. Long term topical ocular corticosteroid uses to decrease the risk of corneal graft rejection is associated with potentiation of infection and an increased risk of secondary cataract and glaucoma. As the mean comeal transplant survival for CHED is approximately 10 years, multiple comeal transplants will be needed to maintain vision for individuals with CHED, with increasing rates of complications and decreasing duration of survival with each subsequent comeal transplant.57
[0038] The long-term postoperative care after pediatric comeal transplantation requires dedication from caregivers to instill corticosteroid eye drops at least daily for months or years after surgery and to return for frequent office visits with a cornea specialist, pediatric ophthalmologist, and frequently, a glaucoma specialist. Thus, the prolonged visual rehabilitation following even a successful comeal transplant means that amblyopia and nystagmus still commonly develop.
[0039] Additionally, while CHED is an uncommon domestic indication for comeal transplantation, it is one of the most frequently encountered corneal dystrophies in countries where consanguineous marriages are more common (Middle East, South Asia and Southeast Asia), and is a well-recognized cause of congenital corneal edema. However, the vast majority of children affected with CHED in these regions do not have access to a trained comeal transplant surgeon or to donor comeal tissue due to limited supply and their families are unable to afford imported corneal tissue. Thus, for most infants and children with CHED living in resource-limited settings, there is no accessible treatment at present.
[0040] EXAMPLES
[0041] EXAMPLE 1: RECOMBINANT ADENO-ASSOCIATED VIRUS 8 HUMAN SOLUTE CARRIER FAMILY 4 MEMBER 11 (AAV8-HSLC4A11)
[0042] Drug Product Physical, Chemical, and Pharmaceutical Properties
[0043] AAV8-hSLC4Al 1 is a non-replicating, rep / cap-deleted, rAAV vector containing single stranded cDNA encoding wild type human SLC4A11 protein. The vector contains AAV serotype 2 ITRs and an expression cassette consisting of a eukaryotic translation elongation factor la promoter (EFla), a Kozak sequence, the wild type human SLC4A11 variant B (NM_032034) cDNA and bovine growth hormone polyadenylation sequence and is packaged in wild type AAV8 capsid (Figure 3). The non-viral EFla promoter was selected because of the ubiquitous expression of SLC4A11 in human cornea as well as other organs and tissues. SLC4A11 variant B (NM_032034) was selected as the transgene variant as it is the most abundantly expressed transcript variant at the mRNA level in the human cornea.58A single-stranded design was used given the 3089 bp size of human SLC4A11 variant B (NM_032034) cDNA (Figure 4). The complete nucleotide sequence of AAV8-hSLC4Al 1 is included as Table 1.
[0044] Drug Product Description, Mechanism of Action and Route of Administration AAV8-hSLC4Al 1 is a biologic modality for introducing SLC4A11 cDNA into the corneal endothelium in individuals with CHED. The formulation relies on the AAV8 capsid, which has been reported for efficient corneal gene delivery in many species including human corneas ex vivo.59,60The route of administration is a single corneal intrastromal injection of a volume of 100 pL, which is consistent with the 50 -100 pL volume of voriconazole and amphotericin B injected into the cornea when treating fungal keratitis, and thus is an appropriate and clinically utilized volume for injection into the human cornea.61'63The drug formulation will rely on Andelyn Biosciences’ proprietary buffer composition. Vector dosing will be based on ongoing in vivo dose-response studies and planned safety, toxicology and biodistribution studies.
[0045] The cellular target of AAV8-hSLC4Al 1 is the corneal endothelium, which consists of a monolayer of non-dividing endothelial cells, representing a suitable target for a primarily episomal AAV vector. SLC4A11, one of the highly expressed differentiation markers for corneal endothelium, is essential in facilitating energy producing glutaminolysis in the corneal endothelium by maintaining ammonia homeostasis, reducing glutaminolysis-associated oxidative stress, maintaining antioxidant signaling and preventing apoptosis.21'25,27’28’34Therefore, the restoration of SLC4A11 in the comeal endothelium via intrastromal delivery of AAV8-hSLC4Al 1 is expected to restore corneal endothelial cell function and improve comeal clarity
[0046] Scientific Rationale for the Use of AAV8-hSLC4All in the Rare Disease or Condition
[0047] A single injection of recombinant adeno-associated vims (rAAV) gene therapy vectors expressing wild type Slc4all in the anterior chambers of Slc4al 1 -deficient mice has been shown to provide significant restoration of comeal endothelial function and reversal of corneal edema. Our pre-clinical results of rAAV8 vector comeal intrastromal administration in large animal models, including rabbit59, canine60and feline (unpublished), showed excellent safety profiles with limited to no ocular and non-ocular immunologic response, no vector-mediated transgene expression in non-comeal ocular tissues or in non-ocular tissues (liver, kidney, spleen, heart, and contralateral non-injected cornea) and no detectable neutralizing antibodies to the rAAV8 capsid in the aqueous, vitreous humor or serum. Additionally, our unpublished studies in human donor corneas demonstrated that a single deep intrastromal injection of rAAV8-GFP achieved expression of GFP protein in more than 37% of corneal endothelial cells after 15 days, indicating the ability to deliver SLC4A11 protein from the stroma to the comeal endothelial cells that are affected in patients with CHED. These studies support the feasibility and safety of corneal intrastromal delivery of a rAAV8 vector expressing human SLC4A11 (AAV8-hSLC4All) in infants and children with CHED. Further, our unpublished preclinical studies of bilateral sequential corneal intrastromal injection of rAAV8 at a 6 week interval support the feasibility of sequential treatment of both eyes using the same AAV8 vector, offering the possibility of treating both eyes of individuals with CHED using the same AAV8-hSLC4Al 1.
[0048] Nonclinical Efficacy of AA V8-hSLC4All
[0049] Vector targeting Intrastromal injection of AAV8-GFP transduces ex vivo human corneal endothelium
[0050] Intrastromal injection of rAAV8-CMV-GFP in donor human corneas at a dosage of 5 x IO10vg per cornea showed the transduction efficiency in corneal endothelium is dependent on the depth and volume of the injection, independent of viral dosage (Figure 5). Viral vectors were diluted in Balanced Salt Solution sterile irrigating solution (BSS™, Alcon) to achieve the desired concentrations; BSS alone was used as the negative control. A single intrastromal injection was performed in each cornea using a 33G needle (Figure 5A). The following injection conditions were tested: 1) central mid-stromal injection of 50 pL rAAV8-GFP or 50 pL BSS; 2) central posterior stromal injection of 50 pL rAAV8-GFP or 50 pL BSS; 3) central posterior stromal injection of 100 pL rAAV8-GFP or 100 pL BSS; and 4) central deep stromal injection of 100 pL rAAV8-GFP or 100 pL BSS. Following injection, the corneas were replaced in OptiSol-GS corneal storage medium (Bausch & Lomb) at 37°C with 5% CO2 until processed for immunostaining. The Descemet membrane was peeled from the corneas immediately before immunostaining, en face visualization and quantification of GFP+ cells to estimate the transduction efficiency (GFP+ / total cells). In the cornea in which a central deep stromal injection of 100 pL rAAV8-GFP was performed, 37% of corneal endothelial cells were GFP+ (6640 GFP+ cells / 17886 DAPI+ nuclei) on post-injection day 15 (Figure 5B, C). The percentage of terminal deoxynucleotidyl transferase (dUTP) nick-end labeling (TUNEL) positive cells, indicative of apoptotic cells, was between 1 -2 % and was not significantly different between the rAAV8-GFP injected and BSS injected corneas.
[0051] Efficacy
[0052] Therapeutic candidate rAAV8- EFla-hSLC4Al 1 produces mature SLC4A11 protein
[0053] The transduction efficiency of rAAV8-EFla-GFP in an SLC4A1 ~ human corneal endothelial cell line was only 0.2% - 1%, consistent with the recognized low transduction efficiency of AAV8 in immortalized cell lines,64and making SI.C4A11~~ HCEnC-21T an unsuitable model for testing the efficacy of our therapeutic candidate rAAV8-EFla-hSLC4Al 1. Therefore, we transduced HEK293 cells with rAAV8-EFla -hSLC4All following cell transfection with plasmid containing the adenovirus gene E4ORF6, which increases AAV8 transduction in HEK293 cells by ~ 100-fold as shown previously.65
[0054] Mature SLC4A11 protein is dimerized and glycosylated when expressed on the plasma membrane.39,66The SLC4A11 monomer is 100 kDa in size and the glycosylated SLC4A11 monomer is -130 kDa. rAAV8-EFla -hSLC4All transduction of HEK293 cells resulted in the production of dimerized and glycosylated SLC4A11, as evidenced by Western Blot showing bands at 200 kDa and -260 kDa when using an anti-SLC4All antibody (Invitrogen, PA5-101889, Figure 6). The pAAV-hSLC4Al 1 plasmid used to produce the AAV8-hSLC4Al 1 viral vector was transfected in HEK293 cells as a positive control and showed significant over-expression of mature SLC4A11 protein. SLC4Ai '~ HCEnC-21T cells stably transduced with LV-hSLC4Al IvBWT was also included as positive control.
[0055]
[0056] Central corneal thickness is the functional measure of corneal endothelial “pump” activity in vivo. The corneal endothelium in vivo expresses SLC4A11 at a high level as evidenced by multiple publications67'70and our RNAseq data of ex vivo human cornea endothelial cells (evHCEnC) and ex vivo mouse corneal endothelial cells freshly dissected from
[0057]
[0058] and S!c4all~~ (exon 9-13 del) mice (Slc4all+ / +evMCEnC and Slc4all / ' (exon 9-13 del) evMCEnC)71For corneal endothelial cells in vitro, SLC4A11 -mediated plasma membrane NH3 / NH4+and H+conductance measured by single-cell patch-clamp (voltage-clamp or current-clamp) recordings is a direct, sensitive and physiologically relevant parameter to evaluate mature SLC4A11 protein function. We observed consistent NFUCl-induced membrane depolarization with current-clamp in corneal endothelial cell lines expressing wild type human SLC4A11 or murine Slc4all: primary human corneal endothelial cells (pHCEnC), immortalized human corneal endothelial cell lines (HCEnC-21T) and immortalized mouse corneal endothelial cell lines (S!c4al 1 immorto-MCEnC) (Figure 7B). In contrast, SLC4A11 knock-out (SLC4A11 KO) resulted in diminished NEUCl-induced membrane depolarization in human and mouse corneal endothelial cell-based models of CHED, including CRISPR mediated SLC4A11 knock-out in HCEnC-21T (CRISPR SLC4A11’1’ HCEnC-21T) and Slc4alT ' (exon 9-13 del) evMCEnC (Figure 7B). Additionally, transducing CRISPR SLC4A11~I~ HCEnC-21T with lentiviral (LV) vector driving expression of wild-type SLC4A11 variant B or C (LV-SLC4A1 lvarBWTor LV-SLC4A1 lvarCWT) reinstated the SLC4A11 -mediated plasma membrane NEE / NEU* and H+conductance, while transduction with lentiviral vector driving expression of SLC4A11 mutants showed a variable decrease in the amplitude of depolarization (Figure 7C).
[0059]
[0060] human endothelial cells
[0061] Stable transduction of an immortalized human corneal endothelial cell line in which SLC4A11 expression was knocked out by CRISPR-Cas9 (CRISPR SIX14A11~~ HCEnC-21T) using LV vectors with the CMV promoter driving expression of wild type human SLC4A11 variant B (LV-CMV-hSLC4Al 1VBWT) or variant C (LV- CMV-hSLC4Al lvCWT) restored both plasma membrane NH3 / NHZ and H+conductance and antioxidative stress response with no significant difference observed between cells transduced with LV-hSLC4Al 1VBWTand LV-hSLC4Al lvCWT(Figure 8)
[0062] Overexpression of human SLC4A11 in an immortalized human corneal endothelial cell line (HCEnC-21T) to -3000 times its endogenous level, as measured by SLC4A11 mRNA transcript abundance, does not result in evidence of toxicity, and offers a protective effect against an oxidative stress insult (Figure 8B). Additionally, overexpression of human SLC4A11 does not over-correct SLC4A11 protein-mediated NH3 / NH4 and H+conductance, as the amplitude of NIH Cl-induced membrane depolarization following SLC4A11 overexpression in SLC4A11 knock-out HCEnC-21T is similar to that in HCEnC-21T expressing endogenous SLC4A11 (Figure 8B), possibly due to the role of ER-mediated SLC4A11 protein turnover,39and the roles of other ion transporters and channels in regulating corneal endothelial membrane potential.72
[0063] Intracameral AAV9-mSlc4al 1 rescues corneal edema in Slc4air~ mice
[0064] A Slc4ai '' mouse model has been developed that demonstrates the progressive congenital corneal edema that characterizes CHED. This mouse model was generated in a mixed Bruce4 / C57BL / 6 background with a targeted deletion of exons 9-13 of the murine Slc4all gene, in which the altered Slc4all mRNA transcript, lacking the sequences of the transmembrane helices of the wild type protein, was a target for degradation by nonsense-mediated decay.73,74The initial in-depth characterization of this mouse model and subsequent observations from multiple laboratories have indicated that this C57BL / 6 Slc4allemn9~13delvae, accurately recapitulates the CHED disease phenotype, with corneal edema documented immediately after weaning at 3 weeks of age, and presumably present since birth, as noted in affected human newborns73'77
[0065] The efficacy of rAAV vectors expressing wild type murine Slc4all was demonstrated in S!c4al 1~~ mice with an exon 9-13 deletion.71The estimated corneal endothelial cell transduction efficiency following intracameral injection of rAAV9-CAG-HA-mSlc4Al 1 in mice was 25% ± 12%.71A single intracameral injection of rAAV9 with chicken P-actin (CAG) promoter driving expression of murine Slc4all with a N-terminal HA-tag (rAAV9-CAG-HA-mSlc4Al 1) at the dosage range of Sxio11> 8xlOnvg in 5 and 11-week-old S!c4al 1~~ mice demonstrated reversal or halting the progression of corneal edema. Gene therapy in 5-week-old Slc4al 1~~ mice was able to reduce corneal edema in the rAAV9-mSlc4al 1 injected eye compared to the non-injected contralateral eye (Figure 9), whereas in 11 -week-old Slcdall'1' mice, rAAV-mSlc4al 1 injection prevented further increase in corneal thickness, which was observed in the noninjected eye. rAAV9-mSlc4al 1 injection also resulted in less endothelial cell loss in the treated eye compared with the non-injected contralateral eye in both 5 and 11 -week-old S!c4al 1~~ mice.71
[0066] No significant change in intraocular pressure and no ocular immune response was observed following intracameral injection of rAAV9-GFP or rAAV9-C AG-null in S!c4al 1 mice and rAAV9-CAG-HA-mSlc4Al 1 in Slc4air^ mice.71
[0067] Intrastromal AAV8-mediated hSLC4All delivery rescues corneal edema in Slc4all / ' mice
[0068] To evaluate the in vivo efficacy of corneal intrastromal delivery of a recombinant AAV8 vector encoding human SLC4A11 cDNA, we performed a single corneal intrastromal injection of 3 pL rAAV8-EFla-hSLC4Al 1 vector in one eye of Slc4ai '' mice at 4 weeks of age. Five dosages were tested: 1 x 109, 3.3 * 108, 1 x 108, 1 x 107and 1 x 106vg / eye. For each mouse, the eye receiving the AAV injection was randomized, and the contralateral eye served as the control. AAV-injected eyes showed a sustained reduction / stabilization of central corneal thickness (CCT) from baseline in a dose-dependent manner, whereas untreated contralateral eyes showed a progressive increase in CCT (Figures 10 and 11) A significant difference in the CCT of the treated eye compared with the control eye was observed at week 6 following the injection at each of the dosages tested, with the effect observed through the most recent assessment 26 weeks after the injection. These studies show that intrastromal AAV8-hSLC4Al 1 Injection Rescues Corneal Edema in Slc4all Knock Out Mice. In these studies, mixed-effect analysis of central corneal thickness measurements Week 2 (W2) - Week 26 (W26) after corneal intrastromal injection of four dosages of AAV8-hSLC4Al 1 vector in one eye (AAV eye) (1 x 109(n = 14 mice), 3.3 x 108(n = 10 mice), 1 x 108(n = 10 mice), 1 x 107(n = 11 mice), and 1 x 106(n = 11 mice) vg / eye) and in the contralateral untreated eye (CTRL eye) were examined. These nonclinical studies that demonstrate the ability of AAV8 to transduce ex vivo human corneal endothelium, the ability of AAV8-hSLC4Al 1 to produce a mature SLC4A11 protein, the restoration of NH3 / NH4 and H+conductance, as well as cellular resistance to oxidative stress stimuli, in SLC4A11~I~ human endothelial cells following LV-hSLC4Al 1 transduction and the reduction of corneal edema in Slc4all~ / _mice following intracameral and intrastromal injection of AAV9-mSlc4al 1 AAV8-hSLC4Al 1 highlight the potential of AAV8-hSLC4Al 1 to effectively restore corneal endothelial cell function and prevent progressive corneal edema and loss of vision in infants and children affected with CHED.
[0069] Table 1A: Sequence of the human SLC4A11 polynucleotide.
[0070] ATGAGCCAGGTCGGGGGGCGGGGAGACAGGTGCACACAGGAGGTCCAGG GCTTGGTCCATGGGGCTGGTGACCTTTCTGCTTCCCTTGCAGAAAACTCTC CCACCATGTCGCAGAATGGATACTTCGAGGATTCAAGCTACTACAAGTGT GACACAGATGACACCTTCGAAGCCCGAGAGGAGATCCTGGGGGATGAGG CCTTCGACACTGCCAACTCCTCCATCGTGTCTGGCGAGAGTATCCGTTTTT TTGTCAATGTCAACCTTGAGATGCAGGCCACCAACACTGAGAATGAAGCG ACTTCCGGTGGCTGTGTGCTCCTGCACACCTCCCGAAAGTACCTGAAGTTA AAGAACTTCAAGGAAGAGATCCGTGCGCACCGCGACCTAGATGGCTTCCT GGCGCAGGCCAGCATCGTCCTGAACGAGACGGCCACCTCCCTGGATAACG TGCTGCGGACCATGCTTCGCCGCTTCGCCAGGGACCCTGACAACAATGAG CCCAACTGCAACCTGGACCTGCTCATGGCCATGCTCTTCACCGATGCCGGG GCACCCATGCGGGGTAAAGTCCACCTGCTGTCAGATACCATCCAAGGGGT CACCGCCACAGTGACAGGGGTGCGGTACCAGCAGTCGTGGCTCTGCATCA TCTGTACCATGAAGGCCCTACAGAAGCGGCACGTGTGCATCAGCCGCCTG GTTCGCCCACAGAACTGGGGGGAGAATTCCTGTGAGGTTCGGTTCGTCAT CCTGGTGCTGGCCCCACCCAAGATGAAAAGCACTAAGACTGCGATGGAGG TGGCGCGCACGTTTGCCACCATGTTCTCGGATATCGCCTTCCGCCAGAAGC TCCTGGAGACCCGCACAGAGGAGGAATTCAAGGAGGCCTTGGTGCATCAG AGACAGCTGCTCACCATGGTGAGCCACGGTCCAGTGGCGCCGAGAACGAA GGAACGCAGCACAGTCTCCCTCCCTGCCCACAGACACCCAGAGCCCCCAA AGTGCAAGGACTTTGTCCCTTTTGGGAAGGGCATCCGGGAGGACATCGCA CGCAGGTTCCCCTTGTACCCCTTGGACTTCACTGATGGCATTATTGGGAAA AACAAGGCTGTGGGCAAATACATCACCACCACCCTGTTCCTCTACTTCGCC TGCCTCCTGCCCACCATCGCTTTCGGGTCTCTCAATGACGAGAACACAGAC GGGGCCATCGACGTGCAGAAGACCATAGCCGGGCAGAGCATCGGGGGCC TGCTCTACGCGCTCTTCTCTGGGCAGCCATTGGTGATTCTGCTGACCACCG CGCCCCTGGCGCTCTACATCCAGGTGATTCGTGTCATCTGTGATGACTATG ACCTGGACTTCAACTCCTTCTACGCATGGACGGGCCTGTGGAATAGTTTCT TCCTTGCGCTTTATGCCTTTTTCAACCTCAGCCTGGTCATGAGTCTCTTCAA GAGGTCGACGGAGGAGATCATCGCCCTCTTCATTTCCATCACGTTTGTGCT GGATGCCGTCAAGGGCACGGTTAAAATCTTCTGGAAGTACTACTATGGGC ATTACTTGGACGACTATCACACAAAAAGGACTTCATCCCTTGTCAGCCTGT CAGGCCTCGGCGCCAGCCTCAACGCCAGCCTCCACACTGCCCTCAACGCC AGCTTCCTCGCCAGCCCCACGGAGCTGCCCTCGGCCACACACTCAGGCCA GGCGACCGCCGTGCTCAGCCTCCTCATCATGCTGGGCACGCTCTGGCTGG GCTACACCCTCTACCAATTCAAGAAGAGCCCCTACCTGCACCCCTGCGTGC GAGAGATCCTGTCCGACTGCGCCCTGCCCATCGCGGTGCTCGCCTTCTCCC TCATCAGCTCCCATGGCTTCCGGGAAATCGAGATGAGCAAGTTCCGCTAC AACCCCAGCGAGAGCCCCTTTGCGATGGCGCAGATCCAGTCGCTGTCCCT GAGGGCCGTCAGCGGTGCCATGGGCCTCGGCTTCCTGCTGTCCATGCTCTT CTTCATCGAGCAGAACTTGGTGGCCGCCTTGGTGAATGCACCGGAGAACA GGCTGGTGAAGGGCACTGCCTACCACTGGGACCTCCTGCTCCTCGCCATC ATCAACACAGGGCTGTCTCTGTTTGGGCTGCCTTGGATCCATGCCGCCTAC CCCCACTCCCCGCTGCACGTGCGAGCCCTGGCCTTAGTGGAGGAGCGTGT GGAGAACGGACACATCTATGACACGATTGTGAACGTGAAGGAGACGCGG CTGACCTCGCTGGGCGCCAGCGTCCTGGTGGGCCTGTCCCTGTTGCTGCTG CCGGTCCCGCTTCAGTGGATCCCCAAGCCCGTGCTCTATGGCCTCTTCCTC TACATCGCGCTCACCTCCCTCGATGGCAACCAGCTCGTCCAGCGCGTGGCC CTGCTGCTCAAGGAGCAGACTGCGTACCCCCCGACACACTACATCCGGAG GGTGCCCCAGAGGAAGATCCACTACTTCACGGGCCTGCAGGTGCTTCAGC TGCTGCTGCTGTGTGCCTTCGGCATGAGCTCCCTGCCCTACATGAAGATGA TCTTTCCCCTCATCATGATCGCCATGATCCCCATCCGCTATATCCTGCTGCC CCGAATCATTGAAGCCAAGTACTTGGATGTCATGGACGCTGAGCACAGGC CTTGAACCCAGCTTTCTTGTACAAAGTGGGAATTCCTAGAGCTCGCTGATC AGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCC GTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAA AATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGG GGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCA GGCATGCTGGGGAGGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTC CCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCC CGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG CTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGG TATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGG CGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACAC TTGCCAGCGCCTTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGC CACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGG GTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGG TGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTT GACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAAC AACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCC GATTTCGGTCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGC GAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTAC AATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACAC CCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGAC AAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCAT CACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAG GTTAATGTCATGATAATAATGGTTTCTTAGACGTCCTGGCCCGTGTCTCAA AATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAAT AAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATA TTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGAT TTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGAC AATCTATCGCTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAAC ATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTA AACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGT ACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACAGC ATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGC GCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCT TTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAAT AACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCC TGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGG ATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGA GGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACC GATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTT CATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGA ATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGAATTGG TTAATTGGTTGTAACACTGGCAGAGCATTACGCTGACTTGACGGGACGGC GCAAGCTCATGACCAAAATCCCTTAACGTGAGTTACGCGTGAAGATCCTT TTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGA GCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTT CTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGT GGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGG CTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTT AGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCT AATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGG GTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAA CGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAA CTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAG CGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGT CGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGG GGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCC TGGCCTTTTGCTGGCCTTTTGCTCACATGT (SEQ ID NO: 2)
[0071] Table IB: Complete sequence of AAV8-hSLC4All vector, including the human SLC4A11 gene (in bold) and selected AAV8 cassette elements including the ITRs and promoter sequences.
[0072] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAG CCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTCTAGACAA CTTTGTATAGAAAAGTTGGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCAC ATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCG GTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTAC TGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGT AGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCC TTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCC CGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAG GAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGC CGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGAT AAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCT GGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCG GTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATG TTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGG TAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGTCTCGCGCCGCCGTGT ATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTG AGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGA GGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAA AAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCG GGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTC TTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGT GGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTG GAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACA GTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGACAAGTTTGTACA AAAAAGCAGGCTGCCACCATGAGCCAGGTCGGGGGGCGGGGAGACAG GTGCACACAGGAGGTCCAGGGCTTGGTCCATGGGGCTGGTGACCTTT CTGCTTCCCTTGCAGAAAACTCTCCCACCATGTCGCAGAATGGATACT TCGAGGATTCAAGCTACTACAAGTGTGACACAGATGACACCTTCGAA GCCCGAGAGGAGATCCTGGGGGATGAGGCCTTCGACACTGCCAACTC CTCCATCGTGTCTGGCGAGAGTATCCGTTTTTTTGTCAATGTCAACCT TGAGATGCAGGCCACCAACACTGAGAATGAAGCGACTTCCGGTGGCT GTGTGCTCCTGCACACCTCCCGAAAGTACCTGAAGTTAAAGAACTTCA AGGAAGAGATCCGTGCGCACCGCGACCTAGATGGCTTCCTGGCGCAG GCCAGCATCGTCCTGAACGAGACGGCCACCTCCCTGGATAACGTGCT GCGGACCATGCTTCGCCGCTTCGCCAGGGACCCTGACAACAATGAGC CCAACTGCAACCTGGACCTGCTCATGGCCATGCTCTTCACCGATGCC GGGGCACCCATGCGGGGTAAAGTCCACCTGCTGTCAGATACCATCCA AGGGGTCACCGCCACAGTGACAGGGGTGCGGTACCAGCAGTCGTGG CTCTGCATCATCTGTACCATGAAGGCCCTACAGAAGCGGCACGTGTG CATCAGCCGCCTGGTTCGCCCACAGAACTGGGGGGAGAATTCCTGTG AGGTTCGGTTCGTCATCCTGGTGCTGGCCCCACCCAAGATGAAAAGC ACTAAGACTGCGATGGAGGTGGCGCGCACGTTTGCCACCATGTTCTC GGATATCGCCTTCCGCCAGAAGCTCCTGGAGACCCGCACAGAGGAGG AATTCAAGGAGGCCTTGGTGCATCAGAGACAGCTGCTCACCATGGTG AGCCACGGTCCAGTGGCGCCGAGAACGAAGGAACGCAGCACAGTCTC CCTCCCTGCCCACAGACACCCAGAGCCCCCAAAGTGCAAGGACTTTG TCCCTTTTGGGAAGGGCATCCGGGAGGACATCGCACGCAGGTTCCCC TTGTACCCCTTGGACTTCACTGATGGCATTATTGGGAAAAACAAGGCT GTGGGCAAATACATCACCACCACCCTGTTCCTCTACTTCGCCTGCCTC CTGCCCACCATCGCTTTCGGGTCTCTCAATGACGAGAACACAGACGG GGCCATCGACGTGCAGAAGACCATAGCCGGGCAGAGCATCGGGGGC CTGCTCTACGCGCTCTTCTCTGGGCAGCCATTGGTGATTCTGCTGACC ACCGCGCCCCTGGCGCTCTACATCCAGGTGATTCGTGTCATCTGTGAT GACTATGACCTGGACTTCAACTCCTTCTACGCATGGACGGGCCTGTG GAATAGTTTCTTCCTTGCGCTTTATGCCTTTTTCAACCTCAGCCTGGT CATGAGTCTCTTCAAGAGGTCGACGGAGGAGATCATCGCCCTCTTCA TTTCCATCACGTTTGTGCTGGATGCCGTCAAGGGCACGGTTAAAATCT TCTGGAAGTACTACTATGGGCATTACTTGGACGACTATCACACAAAAA GGACTTCATCCCTTGTCAGCCTGTCAGGCCTCGGCGCCAGCCTCAAC GCCAGCCTCCACACTGCCCTCAACGCCAGCTTCCTCGCCAGCCCCAC GGAGCTGCCCTCGGCCACACACTCAGGCCAGGCGACCGCCGTGCTCA GCCTCCTCATCATGCTGGGCACGCTCTGGCTGGGCTACACCCTCTAC CAATTCAAGAAGAGCCCCTACCTGCACCCCTGCGTGCGAGAGATCCT GTCCGACTGCGCCCTGCCCATCGCGGTGCTCGCCTTCTCCCTCATCA GCTCCCATGGCTTCCGGGAAATCGAGATGAGCAAGTTCCGCTACAAC CCCAGCGAGAGCCCCTTTGCGATGGCGCAGATCCAGTCGCTGTCCCT GAGGGCCGTCAGCGGTGCCATGGGCCTCGGCTTCCTGCTGTCCATGC TCTTCTTCATCGAGCAGAACTTGGTGGCCGCCTTGGTGAATGCACCG GAGAACAGGCTGGTGAAGGGCACTGCCTACCACTGGGACCTCCTGCT CCTCGCCATCATCAACACAGGGCTGTCTCTGTTTGGGCTGCCTTGGAT CCATGCCGCCTACCCCCACTCCCCGCTGCACGTGCGAGCCCTGGCCT TAGTGGAGGAGCGTGTGGAGAACGGACACATCTATGACACGATTGTG AACGTGAAGGAGACGCGGCTGACCTCGCTGGGCGCCAGCGTCCTGGT GGGCCTGTCCCTGTTGCTGCTGCCGGTCCCGCTTCAGTGGATCCCCA AGCCCGTGCTCTATGGCCTCTTCCTCTACATCGCGCTCACCTCCCTCG ATGGCAACCAGCTCGTCCAGCGCGTGGCCCTGCTGCTCAAGGAGCAG ACTGCGTACCCCCCGACACACTACATCCGGAGGGTGCCCCAGAGGAA GATCCACTACTTCACGGGCCTGCAGGTGCTTCAGCTGCTGCTGCTGT GTGCCTTCGGCATGAGCTCCCTGCCCTACATGAAGATGATCTTTCCCC TCATCATGATCGCCATGATCCCCATCCGCTATATCCTGCTGCCCCGAA TCATTGAAGCCAAGTACTTGGATGTCATGGACGCTGAGCACAGGCCT TGAACCCAGCTTTCTTGTACAAAGTGGGAATTCCTAGAGCTCGCTGAT CAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCT CCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTT CCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATT CTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTG GGAAGAGAATAGCAGGCATGCTGGGGAGGGCCGCAGGAACCCCTAG TGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAG GCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGG CCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGAT GCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACG TCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGC GGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCT TAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCG CCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCC GATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTG ATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTT TGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTG GAACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGA TTTTGCCGATTTCGGTCTATTGGTTAAAAAATGAGCTGATTTAACAAA AATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGT GCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCC GACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTC CCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCAT GTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGG GCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGG TTTCTTAGACGTCCTGGCCCGTGTCTCAAAATCTCTGATGTTACATTG CACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACA TAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACG TCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTAT AAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCG CTTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCA AAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAAC TGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGT ACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGAAAAACA GCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTT GATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGT AATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAA TCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGA GCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAAC TTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCAC TTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATG TTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTA TGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTT CAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCAT TTGATGCTCGATGAGTTTTTCTAATCAGAATTGGTTAATTGGTTGTAA CACTGGCAGAGCATTACGCTGACTTGACGGGACGGCGCAAGCTCATG ACCAAAATCCCTTAACGTGAGTTACGCGTGAAGATCCTTTTTGATAAT CTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTG CGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGT GGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAAC TGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCC GTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCT CGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGA GCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAG AAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGG GAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGAC TTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG CCTTTTGCTCACATGT (SEQ ID NO: 1)
[0073] REFERENCES
[0074] 1 Kurilec, J. M. & Zaidman, G. W. Incidence of Peters anomaly and congenital corneal opacities interfering with vision in the United States. Cornea 33, 848- 850 (2014).
[0075] 2 Mehta, N. et al. Updates on congenital hereditary endothelial dystrophy.
[0076] Taiwan J Ophthalmol 13, 405-416 (2023).
[0077] 3 Desir, J. et al. Borate transporter SLC4A11 mutations cause both Harboyan syndrome and non-syndromic corneal endothelial dystrophy. J Med Genet 44, 322-326 (2007).
[0078] 4 Siddiqui, S. et al. Congenital hereditary endothelial dystrophy caused by SLC4A11 mutations progresses to Harboyan syndrome. Cornea 33, 247-251 (2014).
[0079] 5 Tananuvat, N. et al. Harboyan syndrome: novel SLC4A11 mutation, clinical manifestations, and outcome of corneal transplantation. J Hum Genet 66, 193- 203 (2021). 6 Jiao, X. et al. Autosomal recessive corneal endothelial dystrophy (CHED2) is associated with mutations in SLC4A11. J Med Genet 44, 64-68 (2007).
[0080] 7 Vithana, E. N. et al. Mutations in sodium-borate cotransporter SLC4A11 cause recessive congenital hereditary endothelial dystrophy (CHED2). Nat Genet 38, 755-757 (2006).
[0081] 8 Sultana, A., Garg, P., Ramamurthy, B., Vemuganti, G. K. & Kannabiran, C.
[0082] Mutational spectrum of the SLC4A11 gene in autosomal recessive congenital hereditary endothelial dystrophy. Mol Vis 13, 1327-1332 (2007).
[0083] 9 Kumar, A., Bhattacharjee, S., Prakash, D. R. & Sadanand, C. S. Genetic analysis of two Indian families affected with congenital hereditary endothelial dystrophy: two novel mutations in SLC4A11. Mol Vis 13, 39-46 (2007).
[0084] 10 Ramprasad, V. L. et al. Novel SLC4A11 mutations in patients with recessive congenital hereditary endothelial dystrophy (CHED2). Mutation in brief #958. Online. Hum Mutat 28, 522-523 (2007).
[0085] 11 Aldave, A. J. et al. Autosomal recessive CHED associated with novel compound heterozygous mutations in SLC4A11. Cornea 26, 896-900 (2007).
[0086] 12 Hemadevi, B. et al. Identification of mutations in the SLC4A11 gene in patients with recessive congenital hereditary endothelial dystrophy. Arch Ophthalmol 126, 700-708 (2008).
[0087] 13 Shah, S. S. et al. Mutation in the SLC4A11 gene associated with autosomal recessive congenital hereditary endothelial dystrophy in a large Saudi family. Ophthalmic Genet 29, 41-45 (2008).
[0088] 14 Aldahmesh, M. A., Khan, A. O., Meyer, B. F. & Alkuraya, F. S. Mutational spectrum of SLC4A11 in autosomal recessive CHED in Saudi Arabia. Invest Ophthalmol Vis Sci 50, 4142-4145 (2009).
[0089] 15 Paliwal, P. et al. Congenital hereditary endothelial dystrophy - mutation analysis of SLC4A11 and genotype-phenotype correlation in a North Indian patient cohort. Mol Vis 16, 2955-2963 (2010). 16 Kodaganur, S. G. et al. Mutation analysis of the SLC4A11 gene in Indian families with congenital hereditary endothelial dystrophy 2 and a review of the literature. Mol Vis 19, 1694-1706 (2013).
[0090] 17 Park, S. H., Jeong, H. J., Kim, M. & Kim, M. S. A novel nonsense mutation of the SLC4A11 gene in a Korean patient with autosomal recessive congenital hereditary endothelial dystrophy. Cornea 32, el 81-182 (2013).
[0091] 18 Kim, J. H., Ko, J. M. & Tchah, H. Fuchs Endothelial Corneal Dystrophy in a Heterozygous Carrier of Congenital Hereditary Endothelial Dystrophy Type 2 with aNovel Mutation in SLC4A11. Ophthalmic Genet36, 284-286 (2015).
[0092] 19 Moazzeni, H. et al. Observation of nine previously reported and 10 nonreported <em>SLC4All< / em> mutations among 20 Iranian CHED probands and identification of an <em>MPDZ< / em> mutation as possible cause of CHED and FECD in one family. British Journal of Ophthalmology, e314377 (2019).
[0093] 20 Brejchova, K. et al. IPSC-Derived Corneal Endothelial-like Cells Act as an Appropriate Model System to Assess the Impact of SLC4A11 Variants on Pre- mRNA SplicingCorneal Endothelial-like Cells Expressing SLC4A11. Investigative Ophthalmology & Visual Science 60, 3084-3090 (2019).
[0094] 21 Frausto, R. F., Wang, C. & Aldave, A. J. Transcriptome analysis of the human corneal endothelium. Invest Ophthalmol Vis Sci 55, 7821-7830 (2014).
[0095] 22 Chng, Z. et al. High throughput gene expression analysis identifies reliable expression markers of human corneal endothelial cells. PLoS One 8, e67546 (2013).
[0096] 23 Chen, Y. et al. Identification of novel molecular markers through transcriptomic analysis in human fetal and adult corneal endothelial cells. Human Molecular Genetics 22, 1271-1279 (2012).
[0097] 24 Guha, S., Chaurasia, S., Ramachandran, C. & Roy, S. SLC4A11 depletion impairs NRF2 mediated antioxidant signaling and increases reactive oxygen species in human comeal endothelial cells during oxidative stress. Sci Rep 7, 4074 (2017).
[0098] Liu, J. et al. Depletion of SLC4A11 causes cell death by apoptosis in an immortalized human corneal endothelial cell line. Invest Ophthalmol Vis Sci 53, 3270-3279 (2012).
[0099] Zhang, W. et al. Glutaminolysis is Essential for Energy Production and Ion Transport in Human Corneal Endothelium. EBioMedicine (2017).
[0100] Zhang, W. et al. Conditionally Immortal Slc4all- / - Mouse Corneal Endothelial Cell Line Recapitulates Disrupted Glutaminolysis Seen in Slc4al 1- / - Mouse Model. Invest Ophthalmol Vis Sci 58, 3723-3731 (2017). Ogando, D. G., Choi, M., Shyam, R., Li, S. & Bonanno, J. A. Ammonia sensitive SLC4A11 mitochondrial uncoupling reduces glutamine induced oxidative stress. Redox Biology 26, 101260 (2019).
[0101] Edelhauser, H. F. The balance between corneal transparency and edema: the Proctor Lecture. Invest Ophthalmol Vis Sci 47, 1754-1767 (2006).
[0102] Bonanno, J. A. Molecular mechanisms underlying the corneal endothelial pump. Experimental eye research 95, 2-7 (2012).
[0103] Srinivas, S. P. Dynamic regulation of barrier integrity of the comeal endothelium. Optom Vis Sci 87, E239-254 (2010).
[0104] Riley, M. V., Winkler, B. S., Peters, M. I. & Czajkowski, C. A. Relationship between fluid transport and in situ inhibition of Na(+)-K+ adenosine triphosphatase in comeal endothelium. Invest Ophthalmol Vis Sci 35, 560-567 (1994).
[0105] Zhang, W. et al. Energy Shortage in Human and Mouse Models of SLC4A11-Associated Corneal Endothelial Dystrophies. Invest Ophthalmol Vis Sci 61, 39 (2020).
[0106] Zhang, W. et al. Glutaminolysis is Essential for Energy Production and Ion Transport in Human Corneal Endothelium. EBioMedicine 16, 292-301 (2017). Ehlers, N., Modis, L. & Moller-Pedersen, T. A morphological and functional study of Congenital Hereditary Endothelial Dystrophy. Acta Ophthalmol Scand76, 314-318 (1998).
[0107] Ogando, D. G. et al. Inducible Slc4all Knockout Triggers Corneal Edema Through Perturbation of Corneal Endothelial Pump. Invest Ophthalmol Vis Sci 62, 28 (2021).
[0108] Loganathan, S. K., Schneider, H. P., Morgan, P. E., Deitmer, J. W. & Casey, J. R. Functional assessment of SLC4A11, an integral membrane protein mutated in corneal dystrophies. Am J Physiol Cell Physiol 311, C735-C748 (2016). Li, S. et al. R125H, W240S, C386R, and V507I SLC4A11 mutations associated with corneal endothelial dystrophy affect the transporter function but not trafficking in PS120 cells. Exp Eye Res 180, 86-91 (2019).
[0109] Hara, S., Tsujikawa, M., Kawasaki, S. & Nishida, K. Homeostasis of SLC4A11 protein is mediated by endoplasmic reticulum-associated degradation. Exp Eye Res 188, 107782 (2019).
[0110] Mittal, V., Sehdev, N. & Mittal, R. Descemet Membrane Endothelial Keratoplasty in Congenital Hereditary Endothelial Dystrophy: Initial Experiences. Cornea 40, 972-976 (2021).
[0111] Panahi-Bazaz, M., Sharifipour, F. & Malekahmadi, M. Modified Descemet's Stripping Automated Endothelial Keratoplasty for Congenital Hereditary Endothelial Dystrophy. J Ophthalmic Vis Res 9, 522-525 (2014).
[0112] Cunnusamy, K. et al. Congenital Corneal Endothelial Dystrophies Resulting From Novel De Novo Mutations. Cornea 35, 281-285 (2016).
[0113] Bellucci, R., Chierego, C. & Bellucci, C. Endothelial keratoplasty in a newborn baby with CHED. Cornea 30, 1488-1490 (2011).
[0114] Saad, A., Ghazzal, W ., Keaik, M., Indumathy, T. R. & Fogla, R. Outcomes of Descemet's membrane endothelial keratoplasty for congenital hereditary endothelial dystrophy. J AAPOS 24, 358 e351-358 e356 (2020). Fogla, R. & Srinivasan, B. Corneal Folds After Descemet Membrane Endothelial Keratoplasty in Congenital Hereditary Endotheial Dystrophy. Cornea 40, 715-719 (2021).
[0115] Maumenee, A. E. Congenital hereditary corneal dystrophy. Am J Ophthalmol 50, 1114-1124 (1960).
[0116] Mullaney, P. B., Risco, J. M., Teichmann, K. & Millar, L. Congenital hereditary endothelial dystrophy associated with glaucoma. Ophthalmology 102, 186-192 (1995).
[0117] Mehta, N. & Ramappa, M. Novel Proposed Algorithm in Congenital Hereditary Endothelial Dystrophy. Semin Ophthalmol 38, 108-115 (2023). Busin, M., Beltz, J. & Scorcia, V. Descemet-stripping automated endothelial keratoplasty for congenital hereditary endothelial dystrophy. Arch Ophthalmol 129, 1140-1146 (2011).
[0118] Kirkness, C. M., McCartney, A., Rice, N. S., Gamer, A. & Steele, A. D. Congenital hereditary corneal oedema of Maumenee: its clinical features, management, and pathology. Br J Ophthalmol 71, 130-144 (1987).
[0119] Sajjadi, H. et al. Results of penetrating keratoplasty in CHED. Congenital hereditary endothelial dystrophy. Cornea 14, 18-25 (1995).
[0120] al-Rajhi, A. A. & Wagoner, M. D. Penetrating keratoplasty in congenital hereditary endothelial dystrophy. Ophthalmology 104, 956-961 (1997).
[0121] Al-Ghamdi, A., Al-Rajhi, A. & Wagoner, M. D. Primary pediatric keratoplasty: indications, graft survival, and visual outcome. J AAPOS 11, 41-47 (2007).
[0122] Pearce, W. G., Tripathi, R. C. & Morgan, G. Congenital endothelial corneal dystrophy. Clinical, pathological, and genetic study. Br J Ophthalmol 53, 577-591 (1969).
[0123] Javadi, M. A. et al. Penetrating keratoplasty in young children with congenital hereditary endothelial dystrophy. Cornea 22, 420-423 (2003). Shyam, R. et al. Rescue of the Congenital Hereditary Endothelial Dystrophy Mouse Model by Adeno-Associated Virus-Mediated Slc4all Replacement. Ophthalmology Science 2, 100084 (2022).
[0124] Ramappa, M. et al. Descemet Stripping Automated Endothelial Keratoplasty in Pediatric Age Group: A Decade of Our Experience. Cornea 40, 1571-1580 (2021).
[0125] Malhotra, D., Loganathan, S. K., Chiu, A. M., Lukowski, C. M. & Casey, J. R. Human Corneal Expression of SLC4A11, a Gene Mutated in Endothelial Corneal Dystrophies. Sci Rep 9, 9681 (2019).
[0126] Song, L. et al. Ocular Tolerability and Immune Response to Corneal Intrastromal AAV-IDUA Gene Therapy in New Zealand White Rabbits. Mol Ther Methods Clin Dev 18, 24-32 (2020).
[0127] Miyadera, K. et al. Intrastromal Gene Therapy Prevents and Reverses Advanced Corneal Clouding in a Canine Model of Mucopolysaccharidosis I. Mol Ther 28, 1455-1463 (2020).
[0128] Prakash, G., Sharma, N., Goel, M., Titiyal, J. S. & Vajpayee, R. B. Evaluation of intrastromal injection of voriconazole as a therapeutic adjunctive for the management of deep recalcitrant fungal keratitis. Am J Ophthalmol 146, 56-59 (2008).
[0129] Kalaiselvi, G., Narayana, S., Krishnan, T. & Sengupta, S. Intrastromal voriconazole for deep recalcitrant fungal keratitis: a case series. Br J Ophthalmol99, 195-198 (2015).
[0130] Sharma, N. et al. Evaluation of intrastromal voriconazole injection in recalcitrant deep fungal keratitis: case series. Br J Ophthalmol 95, 1735-1737 (2011).
[0131] Ellis, B. L. et al. A survey of ex vivo / in vitro transduction efficiency of mammalian primary cells and cell lines with Nine natural adeno-associated virus (AAV1-9) and one engineered adeno-associated virus serotype. Virol J 10, 74 (2013). 65 Song, L., Samulski, R. J. & Hirsch, M. L. Adeno-Associated Virus Vector Mobilization, Risk Versus Reality. Hum Gene Ther 31, 1054-1067 (2020). 66 Vilas, G. L. et al. Oligomerization of SLC4A11 protein and the severity of FECD and CHED2 corneal dystrophies caused by SLC4A11 mutations. Hum Mulat M 419-428 (2012).
[0132] 67 Vilas, G. L., Morgan, P. E., Loganathan, S. K., Quon, A. & Casey, J. R. A Biochemical Framework for SLC4A11, the Plasma Membrane Protein Defective in Corneal Dystrophies. Biochemistry 50, 2157-2169 (2011).
[0133] 68 Bonanno, J. A., Shyam, R., Choi, M. & Ogando, D. G. The H(+) Transporter SLC4A11: Roles in Metabolism, Oxidative Stress and Mitochondrial Uncoupling. Cells 11 (2022).
[0134] 69 Ogando, D. G. et al. Inducible Slc4al 1 Knockout Triggers Corneal Edema Through Perturbation of Corneal Endothelial Pump. Investigative Ophthalmology & Visual Science 62, 28-28 (2021).
[0135] 70 Groger, N. et al. SLC4A11 Prevents Osmotic Imbalance Leading to Corneal Endothelial Dystrophy, Deafness, and Polyuria *. Journal of Biological Chemistry 285, 14467-14474 (2010).
[0136] 71 Shyam, R. et al. Rescue of the Congenital Hereditary Endothelial Dystrophy Mouse Model by Adeno-Associated Viruse-Mediated Slc4all Replacement. Ophthalmol Sci 2 (2022).
[0137] 72 Bonanno, J. A. Identity and regulation of ion transport mechanisms in the corneal endothelium. Prog Retin Eye Res 22, 69-94 (2003).
[0138] 73 Vilas, G. L. et al. Transmembrane water-flux through SLC4A11: a route defective in genetic corneal diseases. Hum Mol Genet 22, 4579-4590 (2013).
[0139] 74 Han, S. B. et al. Mice with a targeted disruption of Slc4all model the progressive corneal changes of congenital hereditary endothelial dystrophy. Invest Ophthalmol Vis Sci 54, 6179-6189 (2013).
[0140] 75 Zhang, W. L., Ogando, D. G., Li, S. M., Liu, C. Y. & Bonanno, J. A. Slc4all knock-out model of Endothelial Corneal Dystrophy reveals a phenotype consistent with ammonia toxicity. Investigative ophthalmology & visual science 57, 5303-5303 (2016).
[0141] 76 Zhang, W. L., Ogando, D. G. & Bonanno, J. A. Glutamine is an essential contributor to the human corneal endothelial ATP pool. Investigative ophthalmology & visual science 56, 2578-2578 (2015).
[0142] 77 Zhang, W. et al. Sex Difference in Congenital Hereditary Endothelial Dystrophy and a Slc4all- / - mouse model. Investigative Ophthalmology & Visual Science 63, 2283-2283 (2022).
[0143] 78 Karadag, R., Rapuano, C. J., Hammersmith, K. M. & Nagra, P. K. Causes of congenital corneal opacities and their management in a tertiary care center. ArqBras Oftalmol 83, 98-102 (2020).
[0144] 79 Rezende, R. A. et al. Congenital corneal opacities in a cornea referral practice.
[0145] Cornea 23, 565-570 (2004).
[0146] 80 Borik, K., Mohney, B. G., Hodge, D. & Reynolds, M. M. Birth prevalence and characteristics of congenital corneal opacities. Eur J Ophthalmol, 11206721231202900 (2023).
[0147] 81 Bermejo, E. & Martinez-Frias, M. L. Congenital eye malformations: clinical- epidemiological analysis of 1,124,654 consecutive births in Spain. Am J Med Genet 75, 497-504 (1998).
[0148] PUBLICATIONS
[0149] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. Publications cited herein are cited for their disclosure prior to the filing date of the present application. Nothing here is to be construed as an admission that the inventors are not entitled to antedate the publications by virtue of an earlier priority date or prior date of invention. Further, the actual publication dates may be different from those shown and require independent verification. The following references include descriptions of methods and materials in this field of technology.
[0150] CONCLUSION
[0151] This concludes the description of the illustrative embodiments of the present invention. The foregoing description of one or more embodiments of the invention has been presented for the purposes of illustration and description. It is not intended to be exhaustive or to limit the invention to the precise form disclosed. Many modifications and variations are possible in light of the above teaching.
Claims
CLAIMS:
1. A composition of matter comprising a mammalian expression vector, wherein a polynucleotide disposed in the vector encodes a human solute carrier family 4 member 11 polypeptide.
2. The composition of claim 1, wherein the vector comprises an adeno-associated viral (AAV) vector.
3. The composition of claim 2, wherein the adeno-associated viral vector comprises an AAV8 viral vector.
4. The composition of claim 2, wherein the vector comprises a AAV promoter and an AAV inverted terminal repeat of SEQ ID NO: 1.
5. The composition of claim 1, wherein the vector is disposed in a corneal endothelial cell exhibiting a mutation found in an individual suffering from a congenital hereditary endothelial dystrophy.
6. The composition of claim 1, wherein the polynucleotide comprising human solute carrier family 4 member 11 polypeptide comprises SEQ ID NO: 2.
7. The composition of claim 1, wherein the vector comprises SEQ ID NO: 1.
8. The composition of claim 1, wherein the vector consists essentially of SEQ ID NO: 1.
9. The composition of claim 1, wherein the composition further comprises a pharmaceutical excipient.
10. A method of transducing a human corneal endothelial cell, the method comprising combining the vector of claim 1 with the corneal endothelial cell under conditions selected to allow the vector to deliver the polynucleotide into the corneal endothelial cell such that the corneal endothelial cell is transduced with the vector so as to express the human solute carrier family 4 member 11 polypeptide.
11. The method of claim 10, wherein the vector comprises SEQ ID NO: 1.
12. The method of claim 10, wherein the corneal endothelial cell is transduced in vitro.
13. The method of claim 10, wherein the corneal endothelial cell is transduced in vivo.
14. The method of claim 13, wherein the corneal endothelial cell is selected to exhibit a mutation found in an individual suffering from a congenital hereditary endothelial dystrophy.
15. The method of claim 13, wherein the individual is administered the vector via intrastromal injection into a cornea.
16. A method of making a mammalian expression vector comprising polynucleotide encoding a human solute carrier family 4 member, the method comprising disposing a polynucleotide comprising SEQ ID NO: 2 into an adeno-associated viral (AAV) vector such that the mammalian expression vector is made.
17. The method of claim 16, wherein the adeno-associated viral (AAV) vector comprises an AAV8 viral vector.
18. The method of claim 16, wherein the adeno-associated viral (AAV) vector comprises an AAV promoter and an AAV inverted terminal repeat shown in SEQ ID NO: 1.
19. The method of claim 16, wherein the adeno-associated viral (AAV) vector comprises SEQ ID NO: 1.
20. The method of claim 16, The method of claim 16, wherein the adeno-associated viral (AAV) vector consists essentially of SEQ ID NO: 1.