Systems and methods for writing data stored in a polymer using light
A light-based DNA writing system addresses the instability and cost issues of existing data storage media by using controlled illumination for precise DNA synthesis, achieving stable and efficient long-term data storage.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- IRIDIA INC
- Filing Date
- 2025-11-17
- Publication Date
- 2026-05-21
AI Technical Summary
Existing data storage media, such as hard drives, optical media, and magnetic tapes, are unstable and prone to corruption over time, while synthesizing DNA-based memory remains costly in terms of resource efficiency, necessitating a more stable and efficient method for long-term data storage.
A system and method using light to selectively deprotect photo-labile moieties on DNA strands for controlled topoisomerase-mediated ligation, allowing precise and efficient synthesis of DNA polymers for data storage, utilizing a light-based DNA writing system with controlled illumination and fluidic processes to write and read data on a wafer.
Enables stable and efficient long-term data storage by synthesizing DNA polymers with controlled addition of oligomers, overcoming the limitations of existing media and reducing resource costs.
Smart Images

Figure IMGF000012_0001 
Figure IMGF000012_0002 
Figure IMGF000012_0003
Abstract
Description
Attorney Docket No. DNA-17-PCTSYSTEMS AND METHODS FOR WRITING DATA STORED IN A POLYMER USING LIGHTFIELD
[0001] The disclosure relates to novel systems and methods for information storage in DNA sequences using light.BACKGROUND
[0002] There is a continuing demand to store ever more data on or in physical media, with storage devices getting ever smaller as their capacity gets bigger. The amount of data stored is reportedly doubling in size every two years, and according to one study, by 2020 the amount of data we create and copy annually will reach 44 zettabytes, or 44 trillion gigabytes. Moreover, existing data storage media such as hard drives, optical media, and magnetic tapes, are relatively unstable and become corrupted after prolonged storage. Storing data within polymer strands, e.g., DNA, allows for remarkable long-term stability and robust storage of information, though the process of synthesizing DNA-based memory remains costly in terms of resource efficiency.
[0003] There is an urgent need for alternative approaches to storing large volumes of data for extended periods, e.g., decades or centuries, while maximizing resource use efficiency.BRIEF DESCRIPTION OF THE DRAWINGS
[0004] The present disclosure will become more fully understood from the detailed description and the accompanying drawings, wherein:
[0005] Figure 1 shows three images of results using manually aligned light deprotection (LDP) surface testing, in accordance with embodiments of the present disclosure. The left image shows the LDP cassette addition kinetics showing percent completion vs time, the center image shows 10+ round sequencing results, and the right image shows 4-round process proof of concept, all showing the expected target peak is achieved, in accordance with embodiments of the present disclosure.
[0006] Figure 2 shows two images of results using automated light deprotection (LDP) surface testing, in accordance with embodiments of the present disclosure. The left image shows the LDPAttorney Docket No. DNA-17-PCT cassette addition kinetics showing percent completion vs time when using 365 nm exposure kinetics, the right image shows a 10 bit write sequence showing the target peak was met and no double bits, in accordance with embodiments of the present disclosure.
[0007] Figures 3A-3F show the optical deprotection and bit addition process, in accordance with embodiments of the present disclosure, e.g., Figure 3A showing a spotted glass wafer with acceptor molecules, Figure 3B showing each spot having a light illumination region (e.g., 5pm x 5pm) around each spot. Figure 3C showing each spot having strands that have a photocleavable protecting (or blocking) group on the unattached end, Figure 3D showing light incident on the illumination region, Figure 3E showing the release or cleaving of the photocleavable light protecting group, and Figure 3F showing the addition of a bit (e.g., an “Add 1” bit addition) having a new photocleavable protecting (or blocking) group on the unattached end and showing the release of the topoisomerase, in accordance with embodiments of the present disclosure.
[0008] Figures 4A-4H show an example of building a 2-bit DNA chain (or memory string), in accordance with embodiments of the present disclosure, e.g., showing the writing of a first data string two-bit code of “01” on a first spot group, and showing the writing of a second data string two-bit code of “10” on a second spot group, written one bit at a time and one group at a time, where for Spot Group 1 (Figures 4A-4D), each bit is written using a process of selectively illuminating (and deprotecting) only the spots in Spot Group 1 , then washing or dipping the wafer in the desired addition solution for Spot Group 1, then, selectively illuminating (and deprotecting) only the spots in Spot Group 2, then washing or dipping the wafer in the desired addition solution for Spot Group 2, then, repeating the process for the second bit in the data string for Spot Group 1 and Spot Group 2 (Figures 4E-4H), in accordance with embodiments of the present disclosure.
[0009] Regarding, e.g., Figures 3A-3F and 4A-4H, without being bound by theory, it should be understood by those skilled in the art that, to the extent the wafer is dry and the spots are dry, the selective illumination will cause the photo-labile moiety to cleave in place, wherein a cleaved moiety will diffuse from the DNA strand upon washing of the substrate surface, e.g., wherein washing may comprise flowing a solution over the substrate surface and / or dipping the substrate surface into a solution, e.g., wherein the solution comprises a buffer, optionally further comprising a topoisomerase-charged double- stranded DNA oligomer, e.g., an Add “0” solution or an Add “1” solution.Attorney Docket No. DNA-17-PCT
[0010] Figure 5A shows a high level system block diagram of a light-based DNA writing system, in accordance with embodiments of the present disclosure. In particular, a computer system communicates with an illumination (or exposure) control system which controls each of the light engines (e.g.. 20 light engines, however, more or less engines may be used if desired), which may be DLP chip based systems for exposing one or more spots on a given wafer (e.g., a glass wafer) to perform deprotection (or deblocking) of the DNA selected strands based on the next bit to be written to the wafer spots. The computer system also communicates with a belt control logic which controls the speed of the belt which holds the wafer arrays on a magnetic track. It may also control where the wafers stop and when they get dipped into the “Add 0” or “Add 1” solutions or rinsed with buffer solution around the track. The computer system also communicates with an instrument (fluidic s / reagents) control logic, which controls the levels of addition and washing reagents as well as the drying stations to dry the wafer after the washing the wafer with a given solution. In some embodiments, the aperture of the light engine may not be large enough to expose the entire surface of the wafer. In that case, a plurality of light engines may be used in series or parallel to expose the entire surface of the wafer. The drawing shows 20 light engines in series, where the output aperture of the light engines are positioned to expose a portion of the wafer, and each successive light engine positioned to expose an adjacent portion, such that after passing through the line of light engines the entire wafer is exposed or illuminated. In some embodiments, a plurality of light engines may be configured (in parallel) to combine the output light from a plurality of light engines into a single beam of combined light and the combined light is then incident on the wafer.
[0011] Figure 5B shows high level system block diagram of a light-based DNA writing system, in accordance with embodiments of the present disclosure.
[0012] Figure 5C shows a block diagram of a computer system, in accordance with embodiments of the present disclosure.
[0013] Figure 5D and 5E show selective illumination using micromirror array (DLP chip) system, in accordance with embodiments of the present disclosure.
[0014] Figure 6 shows a graph of experimental results of deprotection completion rate, showing deprotection is complete in about 1 minute, in accordance with embodiments of the present disclosure.
[0015] Figure 7 shows a graph of results of growing DNA chains and the target peaks for 10 cycles, 20 cycles, 30 cycles, and 40 cycles, measured by CE in accordance with embodiments ofAttorney Docket No. DNA-17-PCT the present disclosure. A key feature to note here is that while there are populations of incorrect cassette chains that are shorter than the target length, there are essentially no cassette chains that are longer than the target length. The protection system is thus very efficient at blocking undesired additions, although in some instances, not all strands are deprotected, resulting in chains shorter than the target length. This permits the target strands to be readily isolated by size, as they are the longest, with a high degree of confidence that they contain the desired sequence.
[0016] Figure 8 shows a graph of results of growing DNA chains showing Conversion Efficiency vs Cycle (left side) and Percent Target Peak vs Cycle, for different light exposure times (1 min, 5 min) and different wavelengths (500nm, 800nm), in accordance with embodiments of the present disclosure.
[0017] Figure 9 is a diagram showing an example of a plurality of spots with coded DNA (after writing codes) attached to a wafer and a process for removing, storing and reading / decoding the data, in accordance with embodiments of the present disclosure; for example, the diagram shows an example of a plurality of spots, with coded DNA (after writing codes) attached to a wafer shown as a flat surface, and a process for removing, storing and reading the data written at each spot (Spotl-SpotN) is shown, in accordance with embodiments of the present invention. In particular, after the desired codes are written to the DNA memory strings (or strands or nackets), each of the spots having the coded DNA memory strings attached can be unloaded and the coded DNA memory strings detached or removed from their respective spots (as discussed herein above). In some embodiments, there may be a plurality of coded DNA memory strings attached to a given spot (as discussed herein above). The detached coded DNA memory strings are then fluidically transported along an output channel to a collection bin or container which holds the coded DNA strings from all the spots in a given wafer array outside of (or separate from) the wafer. When it is desired to read the stored data, the coded DNA memory strings, collectively, in the collection bin may be read by any off-the-shelf DNA sequencer having an accuracy sufficient to meet the needs of the desired application, to determine the code written on each of DNA memory strings.
[0018] Figure 10A shows two different data format listings of the bits on a memory string, in accordance with embodiments of the present invention.
[0019] Figure 10B shows a data format listing of the bits on a memory string for each of the spots on the wafer in the array, in accordance with embodiments of the present disclosure.Attorney Docket No. DNA-17-PCT
[0020] Figure 10C shows examples of Topo cassette lengths and bit assignments, in accordance with embodiments of the present disclosure.
[0021] Figure 11 provides a general overview of the process described in Example 1.BRIEF DESCRIPTION
[0022] This disclosure provides for DNA oligomers and DNA sequences for information storage, and syntheses thereof, wherein the DNA is synthesized uses topoisomerase-mediated ligation, further controlled by photo-labile moieties inhibiting stepwise addition of DNA oligomers using said topoisomerase-mediated ligation. For example, we have previously disclosed the synthesis of DNA, e.g., for information storage applications, using topoisomerase-mediated ligation, i.e., topogation, such as in International Application No. PCT / US2024 / 016324, filed August 22, 2024, the contents of which are incorporated herein by reference. Herein, we disclose wherein the stepwise addition of DNA oligomers, or cassettes, may be further controlled by selective addition and removal of photo-labile protecting groups. For example, a double-stranded acceptor DNA strand connected to a substrate may comprise a photo-labile moiety, or protecting group, on the 5’ terminus of the acceptor DNA strand. A subsequent DNA cassette will be blocked from ligating, e.g., topoisomerase-mediated ligation, to said acceptor DNA strand while the acceptor DNA strand is covalently bound to a photo-labile protecting group, e.g., a photo-labile moiety on the 5’ terminus. Upon selective exposure of a light source of one or more specific wavelengths, the photo-labile protecting group may be degraded, removed, and / or cleaved from the 5’ terminus of the acceptor DNA strand, thus allowing for ligation, e.g., topoisomerase-mediated ligation, to proceed, e.g., as previously reported.
[0023] In an aspect, this disclosure provides a nucleotide oligomer, e.g., a deoxyribonucleic acid (DNA) polymer, or cassette, comprising a double-stranded nucleotide oligomer and a topoisomerase enzyme bound thereto, wherein the double- stranded nucleotide oligomer further comprises a photo-labile moiety, e.g., Compound 1, et seq.
[0024] In another aspect, this disclosure provides a method (Method A) of synthesizing a nucleotide oligomer, e.g., a DNA oligomer of Compound 1, et seq., said method comprising (i) synthesizing a first single- stranded DNA strand, (ii) synthesizing a second single-stranded DNA strand, (iii) mixing the first single- stranded DNA strand with the second single- stranded DNA strand, and (iv) contacting the mixture of step (iii) with a topoisomerase enzyme, wherein theAttorney Docket No. DNA-17-PCT second single- stranded DNA strand is partially complementary to the first single- stranded DNA strand and wherein the second single-stranded DNA strand comprises a photo-labile moiety.
[0025] In another aspect, this disclosure provides a method (Method B) of synthesizing a DNA polymer using topoisomerase-mediated ligation, comprising: (i) providing a double- stranded acceptor DNA attached to a substrate, wherein a strand of the acceptor DNA has a 5’ overhang comprising a photo-labile moiety; (ii) exposing one or more areas of the substrate connected to the acceptor DNA with a light source of a specific wavelength, wherein exposure to said light degrades, removes, and / or cleaves the photo-labile moiety from the 5’ overhang of the acceptor DNA; (iii) reacting the acceptor DNA with a topoisomerase-charged double-stranded DNA oligomer, wherein said oligomer optionally comprises, inter alia, a 5’ photo-labile moiety; and repeating steps (i) through (iii) until a desired nucleotide sequence is obtained.
[0026] In a further aspect, this disclosure provides for a DNA polymer (Compound 2), synthesized using any of Method A, et seq., and / or Method B, et seq., or comprising any of Compound 1, et seq.DETAILED DESCRIPTION
[0027] The following description of the preferred embodiment(s) is merely exemplary in nature and is in no way intended to limit the disclosure, its application, or uses.
[0028] The following commonly-owned issued patents contain subject matter related to that described herein, each of which are hereby incorporated by reference in their entirety to the fullest extent permitted by applicable law: US Patent No. 10,438,662; US Patent No. 10,640,822; US Patent No. 11,505,825; US Application No. 18 / 358,861, filed July 25, 2023; US Application No.18 / 358,819, filed July 25, 2023; US Application No. 18 / 444,662, filed February 17, 2024; US Provisional Application No. 63 / 551,509, filed February 8, 2024; International Application No. PCT / US2024 / 046372, filed September 12, 2024; and International Application No. PCT / 2024 / 016324, filed February 17. 2024, the contents of each of which are incorporated by reference in their entirety to the fullest extent permitted by applicable law. The aforementioned commonly-owned patents discuss approaches for writing (or storing) data in a charged polymer, e.g., DNA, using Add “0” and Add “1” enzymes and a deblock enzyme, as described herein; wherein Add “0” and Add “1” represent adding different bits. It will be evident to one of skill in the art that the “0” and “1” represent binary bits wherein the bits may be added in single or multipleAttorney Docket No. DNA-17-PCT bit increments, or wherein a binary, ternary, quaternary, or other system may be used. As discussed herein, each of the bits may be a single base, or may be a plurality of bases (or a cassette or oligomer). For example, in the case of a cassette or oligomer, the four bases (G, C, A, T, though optionally others could be used) would merely be a label indicative of the four possible states for each digit or position or bit in a word, depending on the type of encoding used, e.g., for 2-bit binary encoding they would represent 00, 01, 10, and / or 11 cassettes. Multiple bits may be added simultaneously, e.g.. wherein a single cassette may comprise 3, 4, 5, 6, 7. 8, 9, 10. or more bits in a single cassette, e.g, wherein a four bit cassette would encompass 0000, 0001, 0010, 0011, 0100, 0101, 0110, 0111, 1000, 1001, 1010, 1011, 1100, 1101, 1110, and 1111, though other numbers of bits per cassette may be used, e.g., in the methods as discussed herein.
[0029] Other approaches for writing (or storing) data in a charged polymer, e.g., DNA, such as, using an AB Adapter instead of a deblock enzyme and using “A0B” and “A IB” for the Add “0” and Add “1” reagents, as described therein.
[0030] As discussed herein, the disclosure provides a novel system of storing (or writing or printing) information (or data) using a charged polymer, e.g., DNA, the monomers of which correspond to a machine-readable code, e.g., a binary (or other base) code, and which can be synthesized using a novel configuration of a digitally controlled light illumination or light exposure system or light engine or DLP-based light processor; novel methods and devices for synthesizing polymers using a light illumination system, novel methods and devices for loading, writing, and unloading the polymers, and patterned or flat wafers for writing polymer on, which can be reliably fabricated, and method for fabricating same.
[0031] The system and method of the present disclosure provides a significant advantage over other approaches for performing DNA synthesis, such as inkjet printer approaches, by using light to selectively write DNA data to selective spots on a wafer. The present disclosure is a significant improvement over inkjet systems which require fluidic nozzles to provide precise fluidic delivery to the wafer, and which require maintenance due to nozzle clogging and other issues. In particular, the present disclosure performs topogation-based bit addition, similar to that described in the aforementioned commonly owned patents and patent applications, using a photocleavable protection (or addition-blocking) group which can be deactivated (unblocked) using an appropriate wavelength of light illuminated on one or more spots. Once a given spot is deprotected (or unblocked), the entire wafer may be dipped or washed in a bath having the appropriate additionAttorney Docket No. DNA-17-PCT solution having Add “0” or Add “1” enzymes, similar to that described in the aforementioned commonly owned patents and patent applications, and only the deprotected strands will bind to the Add “0” or Add “1” enzymes (i.e., perform the addition reaction).
[0032] In some embodiments, the disclosure provides a method of making a wafer having an array of spots, each spot comprising DNA strands, wherein the spots are selectively deprotected by light-mediated deprotection, then the wafer is dipped into a washing buffer and then into a solution comprising charged topoisomerase cassettes, such that only the acceptor strands which have been deprotected can react with the charged topoisomerase cassettes. This process continues until the desired number of cassettes have been added. This allows for the production of DNA strands having a particular sequence of cassettes at each spot, wherein the sequence of cassettes has been controlled by the selective deprotection of the spots in each round of addition.
[0033] The initial silicon wafer having spots with DNA acceptor strands can be made for example as described in International Application No. PCT / US2024 / 016324, filed August 22, 2024, the contents of which are incorporated herein by reference. For example, in some embodiments, a thin layer, e.g., a 1 micron thick layer of silicon dioxide or silica (SiCE) is applied or deposited onto the upper surface of the silicon (Si) wafer substrate using PECVD (Plasma-Enhanced, Chemical Vapor Deposition). Other techniques may be used to apply the SiO2, and the SiO2 may be patterned or etched to create pillars and separation channels, and optionally additional SiO2 (e.g., a 150 nanometer (nm) layer of SiO2) applied or deposited using PECVD onto the upper surface of the SiOz layer to coat the bottom of the channel. Then a layer of metal oxide is applied, to provide a substrate to anchor the acceptor strands. For example, hafnium oxide (HfCE), or another metal oxides such as titanium oxide or aluminum oxide, is deposited on the SiC>2 surface, e.g. ca. 10 nanometer (nm) thick, e.g. using atomic layer deposition (ALD). Next, the layer of the metal oxide, e.g., I IfCb, is removed or etched away, e.g., leaving a circle of metal oxide, e.g., I IfCb e.g., ca. 50-100pm, e.g. up to 1mm, in diameter, to create a DNA starter strand attachment spot. Other approaches or processes may be used to create the same resultant shape and layer or region if desired. For example, in other embodiments, a substrate, e.g., a silicon wafer or glass surface, undergoes thermal oxidation, e.g., to reach a target oxide layer of approximately 188 nm in thickness. This oxidized surface then undergoes photolithography, e.g., wherein a positive photoresist is spin coated onto the wafer surface, followed by exposure to the mask pattern formingAttorney Docket No. DNA-17-PCT the desired grid or substrate pattern, followed by development and rinsing of the surface. Next, a layer of metal oxide, e.g., HfCh. is added to the patterned substrate surface, e.g., to reach a target metal oxide layer of approximately 70 nm in thickness. The photoresist mask on the substrate surface is subsequently lifted off of the underlying oxide layer, resulting in only a metal oxide layer atop an oxide layer on the substrate, with only the oxide layer surface between the patterned metal oxide spots.
[0034] Following preparation of the wafer substrate, the metal oxide, e.g., HfCb. is functionalized with a first surface modification, e.g., phosphonic acid, e.g., phosphonic acid linked to an azide -terminated alkyl linker. The interstitial oxide layer, e.g., SiCh, between the metal oxide spots may be functionalized with a second surface modifications, e.g., silane, e.g., silane with non-reactive or inert moieties to inhibit subsequent reactivity.
[0035] The functionalized metal oxide surface can then be linked to DNA oligonucleotide starter strands using click chemistry. For example, the metal oxide surface (e.g., TiCh, AI2O3, or HfCh) surface can be functionalized, e.g., by selective phosphonation using a phosphonic acid linked to a reactive group (e.g., an azide moiety), via a linker, e.g.. a polyethylene glycol (e.g., PEG2 -PEG6) or hydrocarbon linker, e.g., C6-20 alkylene linker; for example, using azido-PEG3-phosphonic acid (available from BroadChem, catalog no. BP-23162), which comprises a PEG linker having an azide group at one end and a phosphonic acid moiety at the other, or 12-azidododecylphosphonic acid 95% from Sikemia, which comprises a dodecylene linker having an azide group at one end and a phosphonic acid moiety at the other. The phosphonic acid moiety will bind selectively to the metal oxide, e.g., HfCb. rather than the SiO? or hydrophilic coating, while the reactive group can bind to a partner on the oligonucleotide. The reactive group which binds to the oligonucleotide can be. for example, a carboxy moiety which binds to an amine on the oligonucleotide, a streptavidin moiety which binds to a biotin moiety on the oligonucleotide, or a moiety capable of participating in a “click” chemistry reaction, such as an azide moiety which can bind to an alkyne-modified oligonucleotide via a “click” reaction. In certain embodiments, the click reaction is catalyst-free, for example a strain-promoted azidealkyne cycloaddition (SPAAC), e.g., between the azide and a cyclooctyne, e.g., a dibenzocyclooctyne (DBCO) moiety or aza-dibenzocyclooctyne (ADIBO) . moiety. For example, an oligonucleotide is linked to a 12-azidododecylphosphonic acid via a click reaction with a dibenzocyclooctyne attached to the oligonucleotide. Once the starter or acceptor DNAAttorney Docket No. DNA-17-PCT strand is attached or bonded to the surface of the spot, e.g.. to the HfCb attachment region, the free end of the strand is available for attachment to a data encoded polymer or DNA strand, as discussed herein.
[0036] In some embodiments, the area between the spots bearing the oligonucleotides has a hydrophobic coating. For example, in some embodiments, HfCb spots are deposited on a silica substrate, so the deposited HfCb surface bearing the oligonucleotides as described above is surrounded by the SiCb substrate regions, which are coated with a hydrophobic perfluorinated alkane substance, using lH,lH,2H,2H-perfluorooctyltriethoxy silane, and / or the oligonucleotides are added to the HfCb regions using click chemistry as described.
[0037] In some embodiments, the entire surface is covered by functionalized hydrophobic moieties which are linked to starter strands by click chemistry at the designated spots. In some embodiments, the starter strands are added only at designated spots; in other embodiments the entire surface of the wafer is covered by acceptor oligonucleotides, e.g., by dipping into a pool of containing acceptor, followed by a first charged topo addition, and then deprotecting and building longer strands at selected spots / positions.
[0038] Printing is not limited to a patterned silicon wafer but can be performed on a number of patterned or unpatterned substrates, e.g., silicon substrate, oxide surface, patterned hydrophilic / hydrophobic regions as defined by a depth difference (posts), hafnium oxide functional areas (as described above, with or without using posts), glass substrate, patterned hydrophilic / hydrophobic regions, polymer substrates, glass coatings, porous ceramic substrates, or ceramic coated paper.
[0039] In certain embodiments, rather than using HfCb deposition on the silicon substrate, the silicon oxide surface may be silenized with a functionalized linker that contains DNA attachment moieties described above, e.g., for streptavidin-biotin or click conjugation. A pattern of spots with DNA acceptor moieties can also be initially created using inkjet printing, for example by inkjet printing DNA in a desired pattern over a surface uniformly modified with phosphonic-acid and azide moiety. In some embodiments, the surface can be functionalized using different chemistries, optionally using mixed salts to provide sites for acceptor grafting that allow enough distance in between single molecules to permit efficient presentation of the strands for cassette addition, but also allow enough density to perform efficient data writing.Attorney Docket No. DNA-17-PCT
[0040] The term “photo-labile” as used herein, encompasses any photo-labile, photo-reactive, photo-cleavable, and / or photo-responsive functional group, chemical spacer, motif, and / or moiety. As used herein, photo-labile refers to a chemical moiety that is responsive to exposure to light, e.g.. a light source of a specific wavelength. In some embodiments, the photo-labile moiety will be responsive to two or more specific wavelengths of light. In some embodiments, photo-reactivity encompasses degradation, decomposition, removal, and / or cleavage of the photo-labile moiety.
[0041] A photo-labile moiety, as used herein, is a chemical functional group or motif that provides the function of inhibiting subsequent stepwise addition of DNA cassettes, e.g., via topoisomerase-mediated ligation; further, said photo-labile moiety is reactive, e.g., degrades, deteriorates, removes, or cleaves from a molecule covalently bound thereto, upon exposure to one or more specific wavelengths of light, whereupon the subsequent stepwise addition of DNA cassettes is no longer inhibited following exposure to said one or more specific wavelengths of light. Examples of photo-labile moieties include: nitrophenyl or nitrobenzyl motifs, 2-nitrophenyl or 2-nitrobenzyl motifs, 2-(2-nitrophenyl)ethoxycarbonyl motifs, 3’,5’-dimethoxybenzoinyloxycarbonyl (DMBOC) motifs, 2-(2-nitrophenyl)propyloxycarbonyl) (NPPOC) motifs, 3’-benzoyl-2-(2-nitrophenyl)-propoxycarbonyl (BzNPPOC) motifs, coumarin motifs, and derivatives thereof. Further examples of photo-labile moieties include those as disclosed in US Patent No. 7,432,368; International Application No. PCT / US2001 / 021463; International Application No. PCT / US2024 / 023812; “High-Efficiency Reverse (5’->3’) Synthesis of Complex DNA Microarrays” by Holz, et al., Scientific Reports 8:15099 (2018); “A Two-Photon-Photocleavable Linker for Triggering Light-Induced Strand Breaks in Oligonucleotides” by Weyel, et al., ACS Chem. Biol. 12:2183 (2017); and “Triplet-Sensitized Photodeprotection of Oligonucleotides in Solution and on Microarray Chips” by Woll, et al., Helvetica chimica acta 87:28 (2004); the contents of each of which are incorporated herein in their entirety to the fullest extent permitted by applicable law.
[0042] In certain embodiments, photo-labile protecting groups may covalently bind to hydroxy or phosphate groups, e.g., a 5’ hydroxy or 5’ phosphate group of a DNA strand and protect against addition of a cassette (note that topoisomerase-mediated cassette addition normally proceeds in the 3’ to 5’ direction, unlike DNA polymerase-mediated addition, which normally proceeds in the 5’ to 3’ direction). The photolabile protecting group can, for example, be an ortho-nitrobenzyl compound such as nitrophenylpropyloxycarbonyl (NPPOC):Attorney Docket No. DNA-17-PCTUpon exposure to ca. 365 nm wavelength light, the NPPOC reacts to liberate carbon dioxide (CO2) and a nitrophenyl-propoxy-carbonyl, yielding an unprotected, or now deprotected, nucleoside or nucleotide amenable to further ligation.
[0043] Ortho-nitrobenzyl protecting groups can also protect the nucleobase, rather than (or in addition to) the sugar hydroxyl or the phosphate:
[0044] For example, in the reaction below, an oligonucleotide with an ortho-nitrobenzyl photolabile protecting group (here a- methyl- (6-nitropiperonyloxymethyl) or NPOM) on the terminal nucleobase is synthesized using an NPOM-caged dT-CE phosphoramidite:Attorney Docket No. DNA-17-PCTHere the NPPOC is attached to the sugar hydroxyl:
[0045] Another useful class of ortho-nitrobenzyl protecting groups are 2-nitrobenzofuran derivatives:
[0046] Other useful photolabile protecting groups include coumadin derivatives, e.g.,Attorney Docket No. DNA-17-PCTand protecting groups as follows:
[0047] Photolabile protecting groups that are photolyzed through two-photon excitation can offer better targeting, as small amounts of light that may be reflected or refacted to an undesired spot are less likely to trigger deprotection. Coumadins, ortho-nitrobenzyls, quinolines, and other types of protecting groups as discussed above can include two-photon excitable leaving groups. Some examples include the following (LG = leaving group):
[0048] The term “dry” as used herein should not be misconstrued as a molecularly dry substrate surface or an absolute absence of water or buffer, but rather, one of skill in the art will understand that dry as used herein refers to a state of hydration, or lack thereof, wherein residual water, ifAttorney Docket No. DNA-17-PCT present, does not substantially interfere with the optics of illuminating spots on said substrate, e.g., refraction of light used for illumination or light exposure.Topoisomerase-Mediated Ligation (Topogation)
[0049] In particular embodiments, the DNA strands are synthesized using topoisomerase-mediated ligation of DNA oligomers, or cassettes. Topoisomerases are enzymes that spontaneously recognize and cleave at least one strand of a double strand of nucleic acids within a sequence segment known as the site-specific recombination sequence. For example, Vaccinia topoisomerase is a type I DNA topoisomerase that has the ability to cut DNA strands 3’ of its recognition sequence of 5’-(C / T)CCTT-3’, e.g., 5’ CCCTT 3’, and to ligate, or rejoin the DNA back together again. SFV topoisomerase I recognizes the same sequence as Vaccinia topoisomerase - 5'-(C / T)CCTT-3’ - and can also recognize the variant sequence 5'-CCCTG-3'. Oligonucleotide cassettes containing digital information can be linked together by topoisomerases. In this approach, the DNA base cassette contains a topoisomerase recognition sequence, thereby allowing it to be “charged” with a topoisomerase, such that a strand of DNA is cleaved by the enzyme, and becomes transiently covalently bound to a topoisomerase at the 3’ end. When an appropriate DNA acceptor is found, the topoisomerase ligates the cassette to the DNA acceptor strand in a process referred to as “bit addition” or “topogation”. After ligating the DNA cassette onto a DNA acceptor strand, the topoisomerase is no longer bound to the DNA. The DNA thus formed can be a substrate for further addition, if the 5’ end of the DNA thus formed is not protected. This will allow the addition of more than an oligomer to the acceptor DNA in each cycle of addition. The 5’ end of the oligonucleotide can be protected, e.g., by 5’ phosphate, in order to prevent the addition of more than an oligomer in each cycle of addition. The ability of the 5’-phosphate on the ‘acceptor’ DNA to inhibit the addition reaction is strong enough that the growing DNA chain of the acceptor with 5’ phosphate is not capable of ligation to a Topo-charged cassette, until it is exposed to a phosphatase, which removes the 5’ phosphate.
[0050] US20210262023A1, which is incorporated herein by reference in its entirety, describes methods of synthesizing DNA in the 3’ to 5’ direction using topoisomerase. In this method, a DNA molecule is synthesized using topoisomerase-mediated ligation, by adding single nucleotides or oligomers to a DNA strand in the 3' to 5' direction, comprising (i) reacting a DNA molecule with a topoisomerase charged with the desired nucleotide or oligomer wherein the nucleotide orAttorney Docket No. DNA-17-PCT oligomer is blocked from further addition at the 5' end, then (ii) deblocking the 5' end of the DNA thus formed, and repeating steps (i) and (ii) until the desired nucleotide sequence is obtained. For example, using just two different oligonucleotides or two different single nucleotides, a DNA sequence embodying a binary code can be formed, providing a compact means of information storage. DNA encoding ternary codes or encoding genetic information can be synthesized as well.
[0051] In the embodiments described in US20210262023A1, the 5’ end of the DNA base cassette is protected, e.g., by 5’ phosphate, so the DNA formed by topogation cannot serve as a substrate for further addition until the 5’ end is deprotected, thereby preventing uncontrolled addition of multiple cassettes. Before the next addition, the DNA is deprotected, e.g., exposed to a phosphatase where the protecting group is a 5 ’-phosphatase, to remove the protecting group.
[0052] US Application No. 18 / 358,861, filed July 25, 2023, which is incorporated herein by reference in its entirety, describes a phosphatase-free method of topoisomerase-mediated DNA synthesis, wherein the DNA cassette added to the acceptor DNA strand contains an overhang, so that it can only be added to by a cassette having a complementary overhand. The need of the deprotection step is eliminated by using double stranded oligomers having 5’ overhangs on both strands. It has been found that when 5’ overhang of the acceptor DNA is not complementary to the 5’ overhang of the strand complementary to the strand bearing the topoisomerase of the doublestranded donor oligomer, the acceptor DNA is not capable of ligation to the topo-charged oligomer, even if 5’ end of the acceptor DNA is unprotected, e.g., unphosphorylated. Based on this finding, we have developed a method of synthesizing DNA using topoisomerase-mediated ligation without protection / deprotection steps by using double-stranded oligomers having 5’ overhangs on both strands, wherein the two overhangs are not complementary to each other and 5’ ends of the oligomers are not protected, e.g., not phosphorylated.
[0053] The top strand of oligomers bearing the topoisomerase comprises 5’ overhang, informational sequence and topoisomerase recognition sequence, e.g., 5'-(C / T)CCTT-3'. The 3’ end of the top strand is covalently attached to the topoisomerase. The top and bottom strands of oligomers are complementary to each other except 5’ overhangs in the end of both strands. The DNA polymer synthesized by the methods of the present disclosure comprises a series of informational sequences, each of which is flanked by a topoisomerase recognition sequence and one of 5’ overhang sequences. In some embodiments, the DNA polymer is designed to store data. In some embodiments, the data is stored in a binary code (l’s and 0’s). In some embodiments, anAttorney Docket No. DNA-17-PCT easily recognized sequence of two or more bases (e.g., 5’-CCG-3’) corresponds to a 1 and another easily recognized sequence of two or more bases (e.g., 5’-AAA-3’) corresponds to a 0. In other embodiments, the data can be stored in a ternary, quaternary or other code.
[0054] In previous disclosures, stepwise addition of DNA oligomers, or cassettes, was inhibiting by the presence of a 5’ phosphate present following topogation of a DNA cassette onto a DNA acceptor strand. Previously, this 5’ phosphate could be removed by a phosphatase enzyme, wherein the removal of the 5’ phosphate group allowed for subsequent cassette addition, e.g.. via topogation. Herein, the present disclosure provides for substituting this residual 5’ phosphate for a photo-labile moiety or protecting group, such that a subsequent DNA cassette may not be ligated onto the DNA acceptor strand when the photo-labile moiety is present on the DNA acceptor strand, but said photo-labile moiety may be selectively removed upon exposure to a light source of one or more specific wavelengths. Without being bound by theory, it is suspected that the steric bulk of the photo-labile moiety interferes with the enzymatic ligation of the topoisomerase, and thus stepwise cassette addition may be controlled as a function of selective light exposure. This selective stepwise addition using a photo-labile moiety may be independent of, alternative to, or in addition to the inhibition of stepwise cassette addition caused by a 5’ phosphate group. For example, the disclosure provides a method of synthesizing a DNA polymer using topoisomerase-mediated ligation, and without the need to use a phosphatase, comprising:(i) reacting a double-stranded acceptor DNA with a topoisomerase charged with a doublestranded DNA oligomer (i.e., oligomer covalently bound at the 3’ end of a strand to a topoisomerase), wherein a strand of the acceptor DNA has a 5’ overhang, wherein the oligomer comprises an informational sequence, a topoisomerase recognition sequence, and 5’ overhangs on both strands, wherein the 5’ overhang of the strand (“bottom strand”) is complementary to the strand bearing the topoisomerase of the oligomer is complementary to the 5' overhang of the acceptor DNA but is not complementary to the 5’ overhang of the strand bearing the topoisomerase (“top strand”) of the oligomer, and wherein 5 ’end of the strand bearing the topoisomerase (“top strand”) of the oligomer and 5’ end of the acceptor DNA is not phosphorylated but is O-protected at the 5’ end by a photolabile protecting group (e.g., at the 5 ’-OH);(ii) removing the photolabile protecting group by exposing the DNA to light, e.g., UV light, and then reacting the deprotected acceptor DNA thus extended with a topoisomeraseAttorney Docket No. DNA-17-PCT charged with a further double-stranded oligomer, wherein the further oligomer comprises an informational sequence, a topoisomerase recognition sequence, and 5’ overhangs on both strands, wherein the 5’ overhang of the strand (“bottom strand”) complementary to the strand bearing the topoisomerase of the further oligomer is complementary to the 5' overhang of the extended acceptor DNA but is not complementary to the 5’ overhang of the strand bearing the topoisomerase (“top strand”) of the further oligomer, and wherein 5 ’end of the strand bearing the topoisomerase (“top strand”) of the further oligomer is not phosphorylated but is O-protected at the 5’ end by a photolabile group (e.g., at the 5 ’-OH), (iii) repeating step (ii) using selected double- stranded oligomers until the desired nucleotide sequence is obtained.
[0055] In an aspect, the disclosure provides a deoxyribonucleic acid (DNA) polymer or cassette (Compound 1), wherein the DNA polymer or cassette is photocleavably-bound to a photo-labile moiety, and wherein the DNA polymer or cassette comprises a topoisomerase recognition sequence.
[0056] For example, the disclosure provides:1.1. Compound 1, wherein the double-stranded nucleotide oligomer comprises a first strand and a second strand, wherein the first and second strand comprise complementary sequences.1.2. Compound 1.1, wherein the first strand and / or second strand comprises a 5’ and / or 3’ overhang.1.3. Any foregoing compound, wherein the first and second strand comprise a 5’ overhang.1.4. Any foregoing compound, wherein the double- stranded nucleotide oligomer comprises a topoisomerase recognition sequence comprising 5’-CCCTT-3’, 5’-TCCTT-3’, or 5’- CCCTG-3’.1.5. Any foregoing compound, wherein the double-stranded nucleotide oligomer comprises a topoisomerase recognition sequence comprising 5-‘CCCTT-3’.1.6. Any foregoing compound, wherein the first strand comprises a 5’ overhang, wherein the 5’ overhang is complementary to an existing DNA memory strand.1.7. Any foregoing compound, wherein the photo-labile moiety is linked or bound to the nucleotide at the 5’ terminus.Attorney Docket No. DNA-17-PCT Any foregoing compound, wherein the photo-labile moiety is linked or bound to the nucleotide at a non-terminal base, e.g., the photo-labile moiety is linked or bound to a nucleobase at least one position removed from the strand terminus, e.g., at least two positions removed from the strand terminus, e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 positions removed from the strand terminus. Any foregoing compound, wherein the second strand comprises a 5’ overhang, wherein the 5’ overhang comprises a photo-labile moiety.. Any foregoing compound, wherein the photo-labile moiety is covalently bound to a phosphate group on the nucleotide strand.. Any foregoing compound, wherein the photo-labile moiety is covalently bound to an alcohol group on the nucleotide strand.. Any foregoing compound, wherein the photo-labile moiety is reactive upon exposure to a light source, such that the photo-labile moiety is degraded, removed, and / or cleaved from the nucleotide bound thereto.. Any foregoing compound, wherein the photo-labile moiety is reactive upon exposure to a light source of a specific wavelength or wavelengths.. Any foregoing compound, wherein the photo-labile moiety is reactive upon exposure to a light source with a wavelength of greater than 300 nm, greater than 325 nm, greater than 350 nm, greater than 365 nm, greater than 375 nm, greater than 400 nm, greater than 425 nm, greater than 450 nm, greater than 475 nm, greater than 500 nm, greater than 525 nm, greater than 550 nm, greater than 575 nm, greater than 600 nm, greater than 625 nm, greater than 650 nm, greater than 675 nm, greater than 700 nm, greater than 725 nm, greater than 750 nm, greater than 775 nm, greater than 800 nm.. Any foregoing compound, wherein the photo-labile moiety is reactive upon exposure to a light source with a wavelength of 200 nm to 1000 nm, or from 300 nm to 850 nm, or from 300 nm to 650 nm, or from 300 nm to 500 nm, or from 300 nm to 450 nm, or from 300 nm to 400 nm, or from 325 nm to 400 nm, or from 340 nm to 400 nm, or from 340 nm to 380 nm, or about 365 nm, or from 400 nm to 800 nm, or from 400 nm to 600 nm, or from 500 nm to 600 nm, or from 500 nm to 800 nm, or from 600 nm to 700 nm, or from 700 nm to 800 nm, or a combination thereof.Attorney Docket No. DNA-17-PCT 1.16. Any foregoing compound, wherein the photo-labile moiety is reactive upon exposure to two or more light sources of two or more specific wavelengths, e.g., wherein the photo-labile moiety is reactive to multi-photon stimulus.1.17. Any foregoing compound, wherein the photo-labile moiety inhibits addition of a nucleotide or oligonucleotide to the DNA polymer or cassette, e.g., via topoisomerase- mediated ligation, until removal of the photo-labile moiety, e.g., upon exposure to a light source with a specific wavelength or wavelengths.1.18. Any foregoing compound, wherein the photo-labile moiety is photocleavably- bound to a 5 ’-phosphate or a 5 ’-hydroxy on the DNA polymer or cassette.1.19. Any foregoing compound having a structure as follows:wherein Oligo3 represents the DNA polymer or cassette comprising a topoisomerase recognition sequence which is linked via a terminal 5’-phosphate to the photo-labile moiety:1.20. Any foregoing compound, for use in any of Method A, et seq., and / or Method B, et seq., and / or Method C, et seq., and / or Method D, et seq.
[0057] In another aspect, the disclosure provides a topoisomerase charged with any of Compound 1, et seq.. e.g., a topoisomerase transiently covalently bound to the 3 ’-end of a DNA cassette which is photocleavably-bound to a photo-labile moiety at the 5 ’-end, wherein the topoisomerase can join the 3’-end of the DNA cassette to the 5’-end of a DNA acceptor strand, optionally comprising a topoisomerase recognition sequence. For example, the disclosure provides a topoisomerase-charged double- stranded DNA oligomer having a structure as follows:Attorney Docket No. DNA-17-PCT #5 ' -<overhang><Inf ormat ion Sequence > CCCTT*3 ' < - Complement - > GGGAA <overhang>-5' wherein * is a topoisomerase covalently bound to the 3’ end of the top strand of the topoisomerase-charged double- stranded DNA oligomer, and # is a photolabile protecting group attached to the 5’ end of the topoisomerase-charged double-stranded DNA oligomer, for example an O-protecting group attached to the 5 ’-hydroxyl directly or via a phosphate.
[0058] In another aspect, the disclosure provides a method (Method A) of synthesizing a nucleotide oligomer, e.g., deoxyribonucleic acid (DNA) polymer, or cassette, of Compound 1, et seq„ said method comprising:(i) synthesizing a first single-stranded DNA strand;(ii) synthesizing a second single-stranded DNA strand;(iii) mixing the first single-stranded DNA strand with the second single-stranded DNA strand; and(iv) contacting the mixture of step (iii) with a topoisomerase;wherein the second single- stranded DNA strand is partially complementary to the first single-stranded DNA strand, and wherein the first strand or second strand comprises a 5’- photo-labile moiety.
[0059] For example, the disclosure provides:A.l. Method A, wherein the first strand and / or second strand comprises a 5’ and / or 3’ overhang.A.2. Any foregoing method, wherein the first and second strand comprise a 5’ overhang. A.3. Any foregoing method, wherein the first and / or second strand is synthesized using phosphoramidite synthesis.A.4. Any foregoing method, wherein the first and / or second single-stranded DNA strand comprises a topoisomerase recognition site or recognition sequence.A.5. Any foregoing method, wherein the first and / or second single-stranded DNA strand comprises a topoisomerase recognition sequence comprising 5’-CCCTT-3’, 5’-TCCTT-3’, or 5’-CCCTG-3’.Attorney Docket No. DNA-17-PCT A.6. Any foregoing method, wherein the first and / or second single-stranded DNA strand comprises a topoisomerase recognition sequence comprising 5-‘CCCTT-3’.A.7. Any foregoing method, wherein the photo-labile moiety is linked or bound to the second single-stranded DNA strand at the 5’ terminus.A.8. Any foregoing method, wherein the photo-labile moiety is linked or bound to the second single-stranded DNA strand at a non-terminal base, e.g., the photo-labile moiety is linked or bound to a nucleobase at least one position removed from the strand terminus, e.g., at least two positions removed from the strand terminus, e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 positions removed from the strand terminus.A.9. Any foregoing method, wherein the photo-labile moiety is covalently bound to a phosphate group.A.10. Any foregoing method, wherein the photo-labile moiety is covalently bound to an alcohol group.A.11. Any foregoing method, wherein the photo-labile moiety is reactive upon exposure to a light source, such that the photo-labile moiety is degraded, removed, and / or cleaved from the nucleotide bound thereto.A.12. Any foregoing method, wherein the photo-labile moiety is reactive upon exposure to a light source of a specific wavelength or wavelengths.A.13. Any foregoing method, wherein the photo-labile moiety is reactive upon exposure to a light source with a wavelength of greater than 300 nm, greater than 325 nm, greater than 350 nm, greater than 365 nm, greater than 375 nm, greater than 400 nm, greater than 425 nm, greater than 450 nm, greater than 475 nm, greater than 500 nm, greater than 525 nm, greater than 550 nm, greater than 575 nm, greater than 600 nm, greater than 625 nm, greater than 650 nm, greater than 675 nm, greater than 700 nm, greater than 725 nm, greater than 750 nm, greater than 775 nm, greater than 800 nm.A.14. Any foregoing method, wherein the photo-labile moiety is reactive upon exposure to a light source with a wavelength of 200 nm to 1000 nm, or from 300 nm to 850 nm, or from 300 nm to 650 nm, or from 300 nm to 500 nm, or from 300 nm to 450 nm, or from 300 nm to 400 nm, or from 325 nm to 400 nm, or from 340 nm to 400 nm, or from 340 nm to 380 nm, or about 365 nm, or from 400 nm to 800 nm, or from 400 nm to 600 nm, orAttorney Docket No. DNA-17-PCT from 500 nm to 600 nm, or from 500 nm to 800 nm. or from 600 nm to 700 nm, or from 700 nm to 800 nm, or a combination thereof.A.15. Any foregoing method, wherein the photo-labile moiety is reactive upon exposure to two or more light sources of two or more specific wavelengths, e.g., wherein the photo- labile moiety is reactive to multi-photon stimulus.A.16. Any foregoing method, wherein the photo-labile moiety inhibits conjugation of the oligomer bound thereto to a subsequent oligomer, e.g., wherein a first DNA oligomer comprising a 5’ photo-labile moiety is inhibited from binding to a second oligomer, e.g., via topoisomerase-mediated ligation, until removal of the photo-labile moiety, e.g., upon exposure to a light source with a specific wavelength or wavelengths.A.17. Any foregoing method, using any of Compound 1, et seq.A.18. Any foregoing method, for use in any of Method B, et seq.A.19. Any foregoing method, wherein the resultant DNA oligomer has a structure as follows:Ph-5’-<overhangxInformation Sequence> < topo recognition sequence>*3’< - Complement> <> wherein * is a topoisomerase covalently bound to the 3’ end of the top strand, and Ph is a photo-labile moiety.A.20. Any foregoing method, wherein the resultant DNA oligomer has a structure as follows:Ph-5’-<overhangxInformation Sequence> CCCTT*3’< — Complement - > GGGAA <overhang>-5’ wherein * is a topoisomerase covalently bound to the 3’ end of the top strand, and Ph is a photo-labile moiety.A.21. Any foregoing method, wherein the topoisomerase is selected from vaccinia topoisomerase I and SFV topoisomerase I, optionally wherein the topoisomerase is vaccinia topoisomerase I.A.22. Any foregoing method, wherein the information sequence of oligomers is selected from at least two different sequences, optionally wherein the informational sequence of the oligomers is selected from two different sequences, e.g., wherein one sequence corresponds to ‘0’ and the other to ‘1’ in a binary code.Attorney Docket No. DNA-17-PCT A.23. Any foregoing method, wherein the informational sequence is a sequence of 3-12 nucleotides, e.g., about 8 nucleotides.A.24. Any foregoing method, wherein the 5’ overhangs of the oligomers are sequences of 2-6 nucleotides, optionally wherein the 5’ overhangs are sequences of 4 nucleotides. A.25. Any foregoing method, wherein the 5’ overhang sequence of the strand complementary to the strand bearing the topoisomerase of the oligomers is selected from at least two different sequences, optionally wherein the 5’ overhang sequence of the bottom strand is selected from two different sequences.A.26. Any foregoing method, wherein the 5’ overhang sequence of the strand bearing the topoisomerase of the oligomers is selected from at least two different sequences, optionally wherein the 5’ overhang sequence of the strand bearing the topoisomerase of the oligomers is selected from two different sequences.A.27. Any foregoing method, wherein the 5’ overhangs of the oligomers are sequences of 2-6 nucleotides, optionally wherein the 5’ overhangs are sequences of 4 nucleotides. A.28. Any foregoing method, wherein the topoisomerase-charged double- stranded DNA oligomer has a structure as follows:5'-Ph-<OverhangxInformation Sequenco < topo recognition:^3'< - Complement - ><Overhang>-OH-5' wherein * is a topoisomerase covalently bound to the 3’ end of the first strand; wherein the Information Sequence may be varied, for example selected from two or more different sequences to provide a binary code in the DNA sequence synthesized;wherein “topo recognition” is a topoisomerase recognition sequence, e.g., 5’-(C / T)CCTT- 3’ or 5’-CCCTG-3’, for example 5’-CCCTT-3’;wherein Complement signifies a sequence which is complementary to ‘^Information Sequence 0 or l><topo recognition>”; andwherein Ph is a photo-labile moiety.
[0060] In another aspect, the disclosure provides a method (Method B) of synthesizing a DNA polymer using topoisomerase-mediated ligation, comprising:(i) providing a double- stranded acceptor DNA attached to a substrate,Attorney Docket No. DNA-17-PCT wherein a strand of the acceptor DNA has a 5 ’ overhang comprising a photo- labile moiety;(ii) exposing one or more areas of the substrate connected to the acceptor DNA with a light source of a specific wavelength,wherein exposure to said light degrades, removes, and / or cleaves the photo- labile moiety from the 5’ overhang of the acceptor DNA;(iii) reacting the acceptor DNA with a topoisomerase-charged double-stranded DNA oligomer (i.e., oligomer covalently bound at the 3’ end of a strand to a topoisomerase)wherein the oligomer comprises an informational sequence, a topoisomerase recognition sequence, a photo-labile moiety at the 5 ’-end of one strand, and 5’ overhangs on both strands,wherein the 5’ overhang of the strand of the oligomer that does not bear the topoisomerase is complementary to the 5’ overhang of the acceptor DNA; and(iv) repeating steps (i) through (iii) until the desired nucleotide sequence is obtained.
[0061] For example, the disclosure provides:B.l. Method B, wherein the substrate comprises a pattern comprising a plurality of subsection areas, such that a light source of a specific wavelength may be selectively exposed to one or more subsection areas of the substrate pattern.B .2. Method B.l, wherein the substrate pattern comprises a micro-pattern, e.g., wherein the micro-pattern is an array of dots, optionally wherein the dots are each 1 pm to 1000 pm in diameter, e.g., 1 pm to 500 pm, or 1 pm to 100 pm, or 1 pm to 50 pm, or 1 pm to 25 pm, or 1 pm to 10 pm, or 1 pm to 5 pm, or about 1 pm, or about 5 pm.B.3. Any foregoing method, wherein step(ii) comprises exposing one or more areas of the substrate with light using a digital light projector or digital light processor (DLP). B.4. Any foregoing method, wherein step (ii) comprises exposing one or more areas of the substrate with a light source of a specific wavelength, wherein the substrate is dry, e.g., exposed to air.Attorney Docket No. DNA-17-PCT B.5. Any foregoing method, wherein the photo-labile moiety is degraded, removed, and / or cleaved upon exposure to a light source with a wavelength of greater than 300 nm, greater than 325 nm, greater than 350 nm, greater than 365 nm, greater than 375 nm, greater than 400 nm, greater than 425 nm, greater than 450 nm, greater than 475 nm, greater than 500 nm, greater than 525 nm, greater than 550 nm, greater than 575 nm, greater than 600 nm, greater than 625 nm, greater than 650 nm, greater than 675 nm, greater than 700 nm, greater than 725 nm, greater than 750 nm, greater than 775 nm, greater than 800 nm. B.6. Any foregoing method, wherein the photo-labile moiety is degraded, removed, and / or cleaved upon exposure to a light source with a wavelength of 200 nm to 1000 nm, or from 300 nm to 850 nm, or from 300 nm to 650 nm, or from 300 nm to 500 nm, or from 300 nm to 450 nm, or from 300 nm to 400 nm, or from 325 nm to 400 nm, or from 340 nm to 400 nm, or from 340 nm to 380 nm, or about 365 nm, or from 400 nm to 800 nm, or from 400 nm to 600 nm, or from 500 nm to 600 nm, or from 500 nm to 800 nm, or from 600 nm to 700 nm, or from 700 nm to 800 nm, or a combination thereof.B.7. Any foregoing compound, wherein the photo-labile moiety is degraded, removed, and / or cleaved upon exposure to two or more light sources of two or more specific wavelengths, e.g., wherein the photo-labile moiety is reactive to multi-photon stimulus. B.8. Any foregoing method, wherein step (iii) comprises dipping the substrate, and the acceptor DNA connected thereto, in a solution comprising the topoisomerase charged with a double- stranded DNA oligomer, optionally wherein the solution is a buffer.B.9. Any foregoing method, wherein the solution of step (iii) further comprises a phosphatase enzyme, e.g., calf alkaline phosphatase (CAP).B.10. Any foregoing method, wherein the DNA oligomer comprises a topoisomerase recognition sequence comprising 5’-CCCTT-3’, 5’-TCCTT-3’, or 5’-CCCTG-3’.B.ll. Any foregoing method, wherein the DNA oligomer comprises a topoisomerase recognition sequence comprising 5’-CCCTT-3’.B.12. Any foregoing method, wherein the DNA oligomer comprises one or more photo- labile moiety.B.13. Any foregoing method, wherein the DNA oligomer comprises a photo-labile moiety at the 5’ terminus.Attorney Docket No. DNA-17-PCT B.14. Any foregoing method, wherein the DNA oligomer comprises a photo-labile moiety linked or bound to a nucleotide as a non-terminal base, e.g., the photo-labile moiety is linked or bound to a nucleobase at least one position removed from the strand terminus, e.g., at least two positions removed from the strand terminus, e.g., at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 positions removed from the strand terminus.B.15. Any foregoing method, wherein the photo-labile moiety is covalently bound to a phosphate group on the nucleotide strand.B.16. Any foregoing method, wherein the photo-labile moiety is covalently bound to an alcohol group on the nucleotide strand.B.17. Any foregoing method, wherein the photo-labile moiety inhibits conjugation of the oligomer bound thereto to subsequent polymers, e.g., wherein a first DNA oligomer comprising a 5’ photo-labile moiety is inhibiting from binding to a second oligomer, e.g., via topoisomerase-mediated ligation, until removal of the photo-labile moiety, e.g., upon exposure to a light source with a specific wavelength or wavelengths.B.18. Any foregoing method, wherein the topoisomerase-charged double- stranded DNA oligomer has a structure as follows:#5’-<overhang><Information Sequence> < topo recognition sequence>*3’< - Complement - > <overhang>-5 ’ wherein * is a topoisomerase covalently bound to the 3’ end of the top strand and # is a 5’-photolabile moiety.B.19. Any foregoing method, wherein the topoisomerase-charged double- stranded DNA oligomer has a structure as follows:#5’-<overhangxInformation Sequence> CCCTT*3’< — Complement - > GGGAA <overhang>-5’ wherein * is a topoisomerase covalently bound to the 3’ end of the top strand and # is a 5’-photolabile moiety.B.20. Any foregoing method, wherein the topoisomerase is selected from vaccinia topoisomerase I and SFV topoisomerase I, optionally wherein the topoisomerase is vaccinia topoisomerase I.Attorney Docket No. DNA-17-PCT B.21. Any foregoing method, wherein the information sequence of oligomers is selected from at least two different sequences, optionally wherein the informational sequence of the oligomers is selected from two different sequences, e.g., wherein one sequence corresponds to ‘0’ and the other to ‘1’ in a binary code.B.22. Any foregoing method, wherein the informational sequence is a sequence of 3-12 nucleotides, e.g.. about 8 nucleotides.B.23. Any foregoing method, wherein the 5’ overhangs of the oligomers are sequences of 2-6 nucleotides, optionally wherein the 5’ overhangs are sequences of 4 nucleotides. B.24. Any foregoing method, wherein the 5’ overhang sequence of the strand complementary to the strand bearing the topoisomerase of the oligomers is selected from at least two different sequences, optionally wherein the 5’ overhang sequence of the bottom strand is selected from two different sequences.B.25. Any foregoing method, wherein the 5’ overhang sequence of the strand bearing the topoisomerase of the oligomers is selected from at least two different sequences, optionally wherein the 5’ overhang sequence of the strand bearing the topoisomerase of the oligomers is selected from two different sequences.B.26. Any foregoing method, wherein the 5’ overhangs of the oligomers are sequences of 2-6 nucleotides, optionally wherein the 5’ overhangs are sequences of 4 nucleotides. B.27. Any foregoing method, wherein the topoisomerase-charged double- stranded DNA oligomer has a structure as follows:5'-Ph-<OverhangxInformation Sequence> < topo recognition:**3'< - Complement - ><Overhang>-OH-5' wherein * is a topoisomerase covalently bound to the 3’ end of the first strand; wherein the Information Sequence may be varied, for example selected from two or more different sequences to provide a binary code in the DNA sequence synthesized;wherein “topo recognition” is a topoisomerase recognition sequence, e.g., 5’-(C / T)CCTT-3’ or 5’-CCCTG-3’, for example 5’-CCCTT-3’;wherein Complement signifies a sequence which is complementary to “clnformation Sequence 0 or l><topo recognition^’; andwherein Ph is a photo-labile moiety.B.28. Any foregoing method, wherein the substrate is glass, silicon, or metal.Attorney Docket No. DNA-17-PCT B.29. Any foregoing method, wherein the strand density of DNA molecules in regions of DNA acceptor strands is 100 to 10,000 strands per pm2, e.g., 500 to 2,500 strands per pm2, e.g., about 1,000 strands per pm2.B.30. Any foregoing method, further comprising washing the substrate after step (iii), e.g., washing the substrate with buffer, e.g., wherein washing comprises flowing a washing solution over the substrate, dipping the substrate into a washing solution, or a combination thereof.B.31. Any foregoing method, further comprising, after synthesizing the desired DNA sequence, drying and storing the substrate, and DNA sequences connected thereto, and then rehydrating and removing for later storage and / or use.B.32. Any foregoing method, further comprising, after synthesizing the desired DNA sequence, releasing the DNA thus obtained from the substrate, e.g., by a cleaving reagent, e.g., an endonuclease specific for a site in the original acceptor strand, and the DNA is collected.B.33. Any foregoing method, further comprising flowing a cleaving fluid over the substrate thereby removing the DNA sequences from the substrate and flowing the DNA sequences from the substrate into a collection or storage container for later use.B.34. Any foregoing method, comprising the use of any of Compound 1, et seq, e.g., in the synthesis of any of Compound 2, et seq.
[0062] In another aspect, this disclosure provides a method for writing, using light illumination, a unique code to polymer memory strands disposed on at least one writing spot on a wafer array (Method C), the method comprising:a) loading the desired spot to be written with an acceptor polymer or DNA attached at one end to the desired spot and attached at an opposite end to a photocleavable blocking group;b) selectively illuminating predetermined spots on the wafer array with light having a wavelength that causes the polymer or DNA strands on the illuminated spots to become deprotected and available for bit addition;Attorney Docket No. DNA-17-PCT c) washing the surface of the spot with an Add “0” or Add “1” solution having corresponding Add “0” or Add “1” reagents over at least the desired spots to be written corresponding to the unique code, wherein the Add “0” and Add “1” reagents comprise topoisomerase with a photocleavable blocking group, thereby writing a bit or portion of the unique code to the DNA or polymer memory strings (or strands) associated with the illuminated spots;d) drying the surface of the spot; ande) repeating steps (b) through (d) until the unique code has been written in the memory string at the at least one spot.
[0063] For example, the disclosure provides:C.l. Method C, wherein the illuminating comprises simultaneously illuminating a plurality of spots on the wafer array corresponding to the spots to be deprotected for a next addition reaction.C.2. Any foregoing method, wherein the washing comprises simultaneously washing all of the spots on the wafer array, whereby only the spots that have been deprotected will perform the addition reaction during a given washing step.C.3. Any foregoing method, wherein the washing is performed by flowing the addition solution across the surface of the array.C.4. Any foregoing method, wherein the selective illuminating is performed by a DLP micromirror chip which receives incident light and selectively directs reflected light on a spot-by-spot basis to the wafer array to perform the selective deprotection.C.5. Any foregoing method, further comprising flowing a cleaving fluid over the spot thereby removing the memory strings from the spot and flowing the memory strings from the spot into a collection or storage container for later reading.C.6. Any foregoing method, further comprising, when the code writing is complete for all the memory strings at all the spots on the wafer array:washing the surface of the wafer array with a cleaving fluid which removes the memory strings from the spots; andflowing the memory strings from the wafer array into a collection or storage container for later reading.Attorney Docket No. DNA-17-PCT C.7. Any foregoing method, wherein the spots are patterned on the wafer array using a flat wafer or using pillars surrounded by a circular channel, the pillars having a region to attach the acceptor polymer or DNA strands.C.8. Any foregoing method, wherein, after writing the codes, the coded polymers attached to the spots on the array are then dried and stored, and then rehydrated and removed for reading or storing.C.9. Any foregoing method, wherein after writing is completed, unloading the coded DNA.
[0064] In another aspect, this disclosure provides a method for writing, using light, a unique code to DNA memory strands disposed on at least one writing spot on a wafer array (Method D), the method comprising:a) receiving the wafer array having a plurality of spots to be written, the spots having acceptor DNA strands attached at the 3 ’-end to the desired spot and attached at a 5’- end to a photocleavable blocking group;b) selectively illuminating predetermined spots on the wafer array with light having a wavelength that causes the DNA strands on the illuminated spots to become deprotected and available for bit addition;c) washing the surface of the predetermined spots and exposing the predetermined spots to a selected Add solution, wherein the Add solution comprises a topoisomerase charged with a selected oligonucleotide encoding a bit or portion of the unique code having a photocleavable blocking group at the 5’- end in an aqueous buffer, thereby writing to the deprotected DNA strands associated with the illuminated spots by addition of the oligonucleotide to the 5 ’-end of DNA strands associated with the illuminated spots;d) drying the surface of the spot(s); ande) repeating steps (b) through (d) until the unique code has been written in the memory string at the at least one spot.
[0065] For example, the disclosure provides:Attorney Docket No. DNA-17-PCT D.l. Method D, wherein the illuminating comprising simultaneously illuminating a plurality of spots on the wafer array corresponding to the spots to be deprotected for a next addition reaction.D.2. Any foregoing method, wherein the selective illuminating is performed by a DLP micromirror chip which received incident light and selectively directs reflected light on a spot-by-spot basis to the wafer array to perform the selective writing.D.3. Any foregoing method, wherein the washing is performed by flowing the addition solution across the surface of the array.D.4. Any foregoing method, wherein the washing is performed by dipping the surface of the array into the addition solution.D.5. Any foregoing method wherein the unique code is a binary, ternary or quaternary code.D.6. Any foregoing method wherein the unique code is a binary code.D.7. Any foregoing method wherein the oligonucleotide encodes one bit (e.g., “0” or “1”) or two bits (e.g., e.g. “00”. “01”, “10”, or “11”).D.8. Any foregoing method wherein the photocleavable blocking group is photocleavably linked to a 5 ’-phosphate on the DNA strand, and following deprotection by exposure to light in step (b), at least the predetermined spots are exposed to phosphatase, e.g., a buffer solution comprising calf intestinal alkaline phosphatase (CIP), thereby removing the 5 ’-phosphate to permit the topoisomerase addition of step (c).
[0066] In another aspect, this disclosure provides for nucleotide memory strands, e.g., DNA polymers, (Compound 2) synthesized using any of Method A, et seq., and / or Method B, et seq., and / or Method C, et seq., and / or Method D, et seq., and / or comprising any of Compound 1, et seq.
[0067] The system, computers, servers, devices and the like described herein have the necessary electronics, computer processing power, interfaces, memory, hardware, software, firmware, logic / state machines, databases, microprocessors, communication links (wired or wireless), displays or other visual or audio user interfaces, printing devices, and any other input / output interfaces, to provide the functions or achieve the results described herein. Except as otherwise explicitly or implicitly indicated herein, process or method steps described herein may beAttorney Docket No. DNA-17-PCT implemented within software modules (or computer programs) executed on one or more general-purpose computers. Specially designed hardware may alternatively be used to perform certain operations. Accordingly, any of the methods described herein may be performed by hardware, software, or any combination of these approaches. In addition, a computer-readable storage medium may store thereon instructions that when executed by a machine (such as a computer) result in performance according to any of the embodiments described herein.
[0068] In addition, computers or computer-based devices described herein may include any number of computing devices capable of performing the functions described herein, including but not limited to: tablets, laptop computers, desktop computers, smartphones, mobile communication devices, smart TVs, set-top boxes, e-readers / players, and the like.
[0069] Although the disclosure has been described herein using exemplary techniques, algorithms, or processes for implementing the present disclosure, it should be understood by those skilled in the art that other techniques, algorithms and processes or other combinations and sequences of the techniques, algorithms and processes described herein may be used or performed that achieve the same function(s) and result(s) described herein and which are included within the scope of the present disclosure.
[0070] Any process descriptions, steps, or blocks in process or logic flow diagrams provided herein indicate one potential implementation, do not imply a fixed order, and alternate implementations are included within the scope of the preferred embodiments of the systems and methods described herein in which functions or steps may be deleted or performed out of order from that shown or discussed, including substantially concurrently or in reverse order, depending on the functionality involved, as would be understood by those reasonably skilled in the art.
[0071] It should be understood that, unless otherwise explicitly or implicitly indicated herein, any of the features, functions, characteristics, alternatives or modifications described regarding a particular embodiment herein may also be applied, used, or incorporated with any other embodiment described herein. Also, the drawings herein are not drawn to scale, unless indicated otherwise.
[0072] Conditional language, such as, among others, “can,” “could,” “might,” or “may,” unless specifically stated otherwise, or otherwise understood within the context as used, is generally intended to convey that certain embodiments could include, but do not require, certain features, elements, or steps. Thus, such conditional language is not generally intended to imply thatAttorney Docket No. DNA-17-PCT features, elements, or steps are in any way required for one or more embodiments or that one or more embodiments necessarily include logic for deciding, with or without user input or prompting, whether these features, elements, or steps are included or are to be performed in any particular embodiment.
[0073] Although the disclosure has been described and illustrated with respect to exemplary embodiments thereof, the foregoing and various other additions and omissions may be made therein and thereto without departing from the spirit and scope of the present disclosure.Example 1 - DNA Grafting and Data Writing Using Dragonfly and LDP Instruments
[0074] This exemplary protocol describes the preparation, loading, and operation steps required to perform DNA acceptor grafting and subsequent data writing on wafers using charged topoisomerase (topo) solutions, wherein the topo is charged with an oligonucleotide cassette having the topo bound at the 3’end and a photolabile protecting group bound at the 5’-end. The initial DNA acceptor strands are dispensed at predesignated spots on a silicon wafer using a robot dispensing system. In this particular example, the robot dispensing system is a multi-channel noncontact dispenser using positive displacement syringes. Such dispensing systems are available commercially, e.g., the Dragonfly dispenser available from SPT Labtech Ltd. The predesignated spots on the silicon wafer are dots ca. 15 microns to 3 mm in diameter (in this case, about 2.9 mm) which are azido functionalized, such that the azide moiety is available for a click reaction, with a dibenzocyclooctyne attached to the initial acceptor oligonucleotide.
[0075] The light deprotection (LDP) instrument delivers UV light (ca. 365 nm or as needed to release the selected photolabile protecting group) to the selected spots on the wafer, using a micromirror array, e.g., a DMD device from Texas Instruments, which is a small silicone chip comprising hundreds of thousands to millions of tiny mirrors, each of which corresponds to a pixel area on the target surface, such that each pixel area can be selectively illuminated or not illuminated by a laser light source, as directed by the corresponding mirror, thereby allowing selected spots on the wafer to be irradiated and deprotected. In this example a HELIOS system from Envision is used, with 365nm light and a 31 micron projection lens providing a 312micron pixel. This device employs a DMD 9000 chip. In this example, the target area or dot is ca. 30-35 pixels across, so about 1 mm in diameter, and there are 400 dots per wafer. The Dragonfly robot and the LDP systemAttorney Docket No. DNA-17-PCT is sufficiently precise, however, that it would be feasible to reduce the dot size substantially, e.g., to ca. 15 microns in diameter, allowing more dots per wafer, e.g., ca. 1 million dots per wafer.
[0076] This protocol uses a system comprising the Dragonfly robot and tray; the light deprotection (LDP) instrument; a wafer holder with a robot arm to hold the wafer as it is exposed to light during the photo-deprotection and to move and dip the wafer into the selected charged topoisomerase solution and into the wash solution; a humidity chamber, to allow reactions to proceed following application of reagents before the reagents dry up; pipettes and tips; reservoirs for solutions; and capillary electrophoresis (CE) and sequencing instruments. The following reagents and solutions are used:Acceptor (aqueous solution): 55 nM solution of oligonucleotide in buffer, wherein the oligonucleotide is functionalized at the 3’-end with dibenzocyclooctyne (DBCO). The initial acceptor oligonucleotide has a fluorescent label to facilitate detection of the strands by CE. . The acceptor oligonucleotides used in this case areTop strand:TGCCCAGGAAGAAGACACTGCCACCA / iAlex488N / CGCAGGAATTCGTCAGCA GTGBottom strand: / 5DBCON / CACTGCTGACGAATTCCTGCGATGGTGGCAGTGTCTTCTTCCTG“5DBCON” indicates a 5 ’DBCO on the bottom strand that is attached to the functionalized region on the dot surface via click chemistry. The underlined portions of the two strands are complementary. “iAlex488N” is an Alexa 488 green fluorescent dye covalently linked to the strand and used to detect the strands when using CE. The above strands are complementary, with a 5’ overhang TGCC on the top strand to facilitate attachment to the cassette.Charged Topo Solution (in Topo Buffer) (100 mL)a. 1 pM charged topo, wherein the oligonucleotide is bound to the topo at the 3’- end and the 5 ’-phosphate is O-protected with a photo-labile protecting group, in this case NPPOC.b. 200 pL of calf-intestinal alkaline phosphatase (CIP) [NB: In some protocols, the protecting group is bound directly to the 5 ’-hydroxyl on the oligonucleotide sugar,Attorney Docket No. DNA-17-PCT without an intervening phosphate, so that the CIP is not needed to remove the 5’- phosphate to allow addition of the next cassette].Topo Buffer (aqueous solution): Sodium Chloride (NaCl) 500 mM; TRIS HC1 (pH 8.0) 20 mM; PEG 80005.00%; Magnesium Chloride 100 pM.Wash Buffer (aqueous solution): Sodium Chloride (NaCl) 800 mM; TRIS HC1 (pH 8.0) 20 mM; Tween-200.02%; Ethanol (EtOH) 4.75%; Isopropyl Alcohol (IPA) 0.25%.
[0077] The wafers are first loaded with initial acceptor strands on each predesignated spot in preparation for writing the desired sequence of cassettes:a. Prepare 55 nM Acceptor solution in 2X phosphate-buffered saline (PBS).b. Load the Acceptor solution onto the Dragonfly tray.c. Load the Acceptor Grafting Pattern Program onto the Dragonfly Robot (this is a program that directs the Dragonfly robot to deposit the Acceptor solution onto the desired spots on the wafer).d. Run the program to dispense the acceptor onto the wafer (1 pL per spot).e. Incubate the wafer with acceptor for 30 minutes in the high-humidity chamber.f. After 30 minutes, transfer the wafer to the LDP instrument and perform a wash step to remove unbound acceptor, and return to the Dragonfly instrument to dispense the first round of Charged-Topo.g. Load the Charged Topo Solutions into designated reservoirs. [NB: Different Charged Topo Solutions having different oligonucleotide cassettes are used, so that different cassettes can be added as desired to obtain a desired sequence of cassettes. For example, to provide a binary code, there would be one Charged Topo Solution having oligonucleotides corresponding to 0s and another corresponding to Is, or different solutions for 00s, 01s, 10s, and 1 Is, or other sequences as required. In some cases, a given Charged Topo Solution will comprise a mixture of synonymous cassettes, so as to provide a highly heterogeneous mixture of synonymous DNA sequences, which is useful to provide unique DNA sequences for authentication or encryption, e.g., as described in our application PCT / US2024 / 046372.]h. After 2 minutes, load the functionalized wafer into position 0 in the wafer holder of the LDP instrument.Attorney Docket No. DNA-17-PCT The desired sequences are then written on the wafers having acceptor strands at each of the predesignated spots by running a data write program, which directs the following operations to obtain the desired sequences:a. The robot arm will locate the wafer, pick up the wafer, wash off unreacted Charged Topo solution from the surface, and dry with air.b. Expose specific spots to UV light (-365 nm) for 90 seconds.c. Dip the wafer into the designated Charged Topo Solution to permit addition of cassettes on those spots which have been deprotected by the exposure to light in the previous step. d. Dip the wafer in the Wash Buffer, dry with air, and repeat exposure as programmed. e. Repeat this process until the program completes all additions.When the desired sequences have been completed, the strands are stabilized by photo-deprotecting all spots and capped oligonucleotides added by dispensing onto each spot 2 pL of 1 pM Charged Topo Solution wherein the topo is charged with oligonucleotides having a 5 ’-cap (Topo-CAP solution) and incubating for 2 minutes. In this example, the cap is simply another oligonucleotide 50 base pairs in length. In this case, we use the same CAP sequence for all data writes to amplify the material. As the CAP and Acceptor sequence are the same for all strands, one set of primers can be used to amplify all data writes while having different informational data in the cassette sequences within the final strand. The wafer is then washed with Wash Buffer.
[0078] To recover and analyze DNA from the wafer, 1 pL of formamide is dispensed onto each spot selected for recovery and incubated for 60 seconds to remove the DNA from the surface of the designated spots, then the DNA from all spots corresponding to the same NFT is pooled and analyzed via Capillary Electrophoresis (CE) and sequencing.
[0079] Safety and Waste Disposal: Handle all chemicals using appropriate PPE (lab coat, gloves, safety glasses), dispose of waste according to institutional chemical waste procedures, and follow all laser safety guidelines when using UV exposure instruments.
[0080] Documentation: Record reagent lot numbers, preparation dates, and operator initials, and log program parameters and any deviations from this SOP.
[0081] Figure 7 shows experimental data for a target peak after 10. 20, 30 and 40 cycles of data writeing, using CE analysis. There is minimal off target production in control spots, and while a majority of strands are shorter than 26 cassettes, only a very low proportion of the strands were longer than expected. These data show that the photo-labile protecting groups were very efficientAttorney Docket No. DNA-17-PCT in preventing undesired additions of cassettes. Thus, if a cassette is added, it is likely to be the desired cassette - most of the errors are due to failure to add a desired cassette to a given strand, rather than adding an undesired cassette. Thus the desired strands having the full correct sequence can be readily identified and isolated on the basis of size.
Claims
Attorney Docket No. DNA-17-PCTWhat is claimed is:
1. A deoxyribonucleic acid (DNA) polymer or cassette, wherein the DNA polymer or cassette is photocleavably-bound to a photo-labile moiety, and wherein the DNA polymer or cassette comprises a topoisomerase recognition sequence.
2. The DNA polymer or cassette of claim 1, wherein the double- stranded nucleotide oligomer comprises a first strand and a second strand, wherein the first and second strand comprise complementary sequences, and wherein the first and second strand comprise a 5’ overhang.
3. The DNA polymer or cassette of claim 1 or 2, wherein the double-stranded nucleotide oligomer comprises a topoisomerase recognition sequence comprising 5’-CCCTT-3’, 5’- TCCTT-3’, or 5’-CCCTG-3’.
4. The DNA polymer or cassette of claim 1, 2, or 3 wherein the photo-labile moiety is bound to the 5’ end of the DNA polymer or cassette5. A topoisomerase transiently covalently bound to the 3’-end of the DNA cassette of claim 4, wherein the topoisomerase can join the 3’-end of the DNA cassette to the 5’-end of a DNA acceptor strand comprising a topoisomerase recognition sequence.
6. The topoisomerase of claim 5 having a structure as follows:#5 ' -<overhang><Inf ormat ion Sequence > CCCTT*3 ' < - Complement - > GGGAA <overhang>-5 ' wherein * is the topoisomerase transiently covalently bound to the 3’ end of the top strand of the DNA polymer or cassette, and # is the photolabile protecting group attached to the 5’ end of the DNA polymer or cassette, for example a photolabile O-protecting group attached to the 5 ’-hydroxyl of the DNA polymer or cassette directly or via a phosphate.
7. A method of synthesizing a DNA polymer comprising a series of information-containing DNA cassettes, using topoisomerase-mediated ligation, comprising:(i) providing a double-stranded acceptor DNA attached to a substrate,wherein a strand of the acceptor DNA has a 5’ overhang comprising a photo-labile moiety;Attorney Docket No. DNA-17-PCT (ii) exposing one or more areas of the substrate connected to the acceptor DNA with a light source of a specific wavelength, wherein exposure to said light degrades, removes, and / or cleaves the photo-labile moiety from the 5’ overhang of the acceptor DNA;(iii) reacting the acceptor DNA with a topoisomerase according to claim 5 or 6; and (iv) repeating steps (i) through (iii) until the desired nucleotide sequence is obtained.
8. A method for writing, using light illumination, a unique code to polymer memory strands disposed on at least one writing spot on a wafer array, the method comprising:(i) loading the desired spot to be written with an acceptor polymer or DNA attached at one end to the desired spot and attached at an opposite end to a photocleavable blocking group;(ii) selectively illuminating predetermined spots on the wafer array with light having a wavelength that causes the polymer or DNA strands on the illuminated spots to become deprotected and available for bit addition;(iii) washing the surface of the spot with an Add “0” or Add “1” solution having corresponding Add “0” or Add “1” reagents over at least the desired spots to be written corresponding to the unique code, wherein the Add “0” and Add “1” reagents comprise topoisomerase with a photocleavable blocking group, thereby writing a bit or portion of the unique code to the DNA or polymer memory strings (or strands) associated with the illuminated spots;(iv) drying the surface of the spot; andrepeating steps (ii) through (iv) until the unique code has been written in the memory string at the at least one spot.
9. A method for writing, using light, a unique code to DNA memory strands disposed on at least one writing spot on a wafer array (Method D), the method comprising:(i) receiving the wafer array having a plurality of spots to be written, the spots having acceptor DNA strands attached at the 3 ’-end to the desired spot and attached at a 5’- end to a photocleavable blocking group;(ii) selectively illuminating predetermined spots on the wafer array with light having a wavelength that causes the DNA strands on the illuminated spots to become deprotected and available for bit addition;Attorney Docket No. DNA-17-PCT (iii) washing the surface of the predetermined spots and exposing the predetermined spots to a selected Add solution, wherein the Add solution comprises a topoisomerase charged with a selected oligonucleotide encoding a bit or portion of the unique code having a photocleavable blocking group at the 5’- end in an aqueous buffer, thereby writing to the deprotected DNA strands associated with the illuminated spots by addition of the oligonucleotide to the 5’-end of DNA strands associated with the illuminated spots; (iv) drying the surface of the spot(s); andrepeating steps (ii) through (iv) until the unique code has been written in the memory string at the at least one spot.