Method for constructing spontaneous mouse brain edema model and use thereof
By constructing the PEN2ΔhGFAP mouse model and using astrocyte-specific knockout of progerin enhancer 2 protein, the problem that existing models cannot simulate the natural pathogenesis process was solved, and an efficient and reliable cerebral edema model was realized for drug screening and research.
Patent Information
- Application Number
- PCT/CN2025/090885
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-11-20
- Filing Date
- 2025-04-24
- Publication Date
- 2026-05-28
AI Technical Summary
Existing mouse models of cerebral edema cannot fully simulate the pathophysiological changes during natural disease development, which affects the reproducibility and accuracy of drug screening results, resulting in a lack of efficient and reliable disease models for drug development.
PEN2ΔhGFAP mice were obtained by mating PEN2fl/+ mice with hGFAPCre/+ mice. Spontaneous mouse cerebral edema model was constructed by knocking out the presenilin enhancer 2 protein using Cre recombinase specifically expressed in astrocytes.
It provides a spontaneous cerebral edema model with small individual differences and easy control, which is suitable for drug screening and research on cerebral edema-related diseases, reduces experimental technical requirements and costs, and improves the reliability and reproducibility of the model.
Smart Images

Figure CN2025090885_28052026_PF_FP_ABST
Abstract
Description
A method for constructing a spontaneous mouse model of brain edema and its application Technical Field
[0001] This invention relates to the field of animal models and their applications, specifically to a method for constructing a spontaneous mouse cerebral edema model and its application. Background Technology
[0002] Cerebral edema, a common complication of traumatic brain injury, cerebrovascular disease, and intracranial infection, poses a significant challenge to global public health due to its high morbidity and mortality. The mechanisms underlying cerebral edema are complex and diverse, involving multiple factors such as increased blood-brain barrier permeability, impaired brain tissue metabolism, activation of inflammatory responses, and neurotoxic damage. These factors work together to lead to an abnormal increase in the water content of neural tissue, resulting in elevated intracranial pressure, impaired cerebral blood flow perfusion, and ultimately irreversible neuronal damage or even death. Especially after traumatic brain injury (TBI), the rapid development and spread of cerebral edema is often a key factor contributing to poor patient prognosis.
[0003] Currently, while clinical treatments for cerebral edema have made some progress, most focus on symptom relief, such as reducing intracranial pressure with diuretics and surgical decompression, lacking direct and effective treatments targeting the underlying cause. Therefore, developing novel and highly effective drugs for treating cerebral edema has become an important direction in medical research. The key to drug development lies in efficient and reliable disease models to simulate the human disease state and evaluate drug efficacy and safety. However, traditional mouse models of cerebral edema, such as those induced by intracranial pathogen injection or physical injury, have many limitations. These models often cannot fully simulate the pathophysiological changes during natural disease progression, and the degree, rate of progression, and spatial distribution of cerebral edema vary considerably, affecting the reproducibility and accuracy of drug screening results. Therefore, establishing a mouse model of spontaneous cerebral edema that more closely resembles clinical reality is of great significance for accelerating the development of drugs for treating cerebral edema. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to address the lack of existing mouse models of cerebral edema, and to provide a spontaneous mouse model of cerebral edema and a method for constructing it.
[0005] Another technical problem to be solved by the present invention is to provide an application of the above-mentioned spontaneous mouse brain edema model.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0007] A spontaneous mouse model of brain edema and its construction method, comprising the following steps:
[0008] (1) PEN2fl / + Mice and PEN2 fl / + Mice were mated to obtain PEN2. fl / fl Homozygous mice;
[0009] (2) The PEN2 obtained in step (1) fl / fl Mice and hGFAP Cre / + Mice were mated to obtain PEN2. fl / + hGFAP Cre / + Mice;
[0010] (3) The PEN2 obtained in step (2) fl / + hGFAP Cre / + Mice and PEN2 fl / fl Mice were mated to obtain PEN2. fl / fl hGFAP Cre / + Mice (abbreviated as PEN2) ΔhGFAP This is the spontaneous mouse brain edema model.
[0011] Among them, the PEN2 fl / + The mice were loxp transgenic heterozygous mice, obtained by adding loxp1 and loxp2 sites to the intron regions flanking the third and fourth exons (776bp–1210bp) of the presenilin enhancer 2 protein genome (NC_000073.7) in C57BL / 6 mice, respectively; the hGFAP... Cre / + Mouse astrocytes specifically expressing Cre recombinase were purchased from The Jackson Laboratory.
[0012] The spontaneous mouse brain edema model is a mouse in which presenilin enhancer 2 is knocked out in astrocytes.
[0013] Specifically, the mice that knock out progerin enhancer 2 in astrocytes are mice that specifically express Cre recombinase hGFAP in astrocytes. Cre / + Knock out the third and fourth exons in the gene encoding the progerin enhancer 2 protein.
[0014] Specifically, the mRNA sequence of the protein-coding gene of the presenilin enhancer 2 is Accession: NM_001364016.1 in Gene Bank, and its genomic sequence is Accession: NC_000073.7 in Gene Bank.
[0015] The spontaneous mouse brain edema model was used for genotyping using double PCR.
[0016] Specifically, the specific primers used in the dual PCR include primers for identification of the Loxp mouse tail and primers for identification of the Cre mouse tail.
[0017] Specifically, the primers for identifying the tail of the Loxp mouse are: F: GACCCGTAGAAGAGCAGTCAGT and R: ATAAAGAATAGGCTGGGTGGTG.
[0018] Specifically, the primers for identifying Cre mouse tails are F: ATCGCCATCTTCCAGCAGGC and R: AAAACGCTGGTTAGCACCGC.
[0019] The spontaneous mouse cerebral edema model constructed by the method described herein is also within the scope of protection of this invention in the study of cerebral edema diseases.
[0020] The spontaneous mouse cerebral edema model constructed by the method described herein is also within the scope of protection of this invention in the development of drugs for the prevention and / or treatment of cerebral edema.
[0021] The spontaneous mouse cerebral edema model constructed by the aforementioned method is also within the scope of protection of this invention in screening drugs for the prevention and / or treatment of cerebral edema. Beneficial effects:
[0022] (1) This invention utilizes mouse hGFA with Cre recombinase specifically expressed in astrocytes. PCre / + A spontaneous mouse model of brain edema was constructed (i.e., astrocyte conditional knockout PEN2 mice, abbreviated as PEN2). Δ hGFAP The mouse showed signs of cerebral edema in its cerebral cortex at 8 days after birth, and by 11 days after birth, the entire cerebral cortex was dissolved by water, exhibiting a severe cerebral edema phenotype.
[0023] (2) Compared with commonly used methods for constructing hydrocephalus models, the astrocyte conditional knockout PEN2 mice constructed using the method provided in this invention have advantages such as spontaneous cerebral edema, small individual differences, few interfering factors, fast reproduction rate, and low cost.
[0024] (3) Currently, there are few models of cerebral edema, and most models are based on physical injury, such as physical blows, contusions, or pinches to the brain or spinal cord. These models are complex to create, the area of injury is difficult to control, and the models are not uniform, which affects their application in drug screening. The cerebral edema model of PEN2 mice with conditional knockout of astrocytes provided by this invention has the following advantages: 1) No pathogens or traumatic modeling is required, and the mice can reproduce stably with a spontaneous cerebral edema phenotype; 2) The experimental techniques are not demanding and are easy to control, avoiding mouse death and uneven cerebral edema area caused by operation during the modeling process; 3) PEN2 mice with conditional knockout of astrocytes are lighter and smaller than normal mice, and the cerebral edema phenotype is easy to detect, allowing for accurate determination of the region and area of cerebral edema, resulting in high model reliability; 4) The individual differences between mice with the same gene knockout background and genotype are small.
[0025] (4) This invention induces cerebral edema in mice by manipulating astrocytes to conditionally knock out PEN2, which has significant innovation and good application prospects. It can be used to establish a cerebral edema drug screening platform. At the same time, it can be used for the research of cerebral edema-related diseases, such as the pathogenesis of cerebral edema caused by infection, glioma, traumatic brain injury, etc., as well as the research and development of technologies and products for the diagnosis and treatment of related diseases. Attached Figure Description
[0026] The present invention will be further described in detail below with reference to the accompanying drawings, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0027] Figure 1 shows PEN2 ΔhGFAP A schematic diagram of the mating process in mice.
[0028] Figure 2 shows PEN2 ΔhGFAP Electrophoresis diagram of mouse genotype identification.
[0029] Figure 3 shows PEN2. ΔhGFAP Protein level verification diagram of the effect of PEN2 knockout in mouse cerebral cortex.
[0030] Figure 4 shows wild-type mice (WT) and PEN2 mice. ΔhGFAP Anatomical diagram of a mouse brain.
[0031] Figure 5 shows wild-type mice (WT) and PEN2 mice. ΔhGFAP Evaluation results of Nissl staining of mouse brain sections.
[0032] Figure 6 shows wild-type mice (WT) and PEN2 mice. ΔhGFAP Imaging assessment results of mice. Detailed Implementation
[0033] The present invention will be further described in detail below with reference to specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0034] Unless otherwise specified, the experimental methods described in the following examples are conventional methods; unless otherwise specified, the reagents and materials are commercially available.
[0035] In the examples described below, mouse breeding and experiments were conducted according to protocols approved by the Animal Care and Use Committee of Gulou Hospital. All experiments were performed in accordance with the "Guidelines for the Care and Use of Laboratory Animals" of Gulou Hospital.
[0036] In the following examples, the paternal and maternal parents used for breeding were 2 to 12 months old; the mouse rearing conditions were: specific pathogen-free (SPF) grade rearing room, room temperature 22℃±2℃, humidity 55-65%, 12-hour light and dark alternation, moderate light intensity, good ventilation and cleanliness; the feed used was: complete nutritional pellet feed, provided by Jiangsu Xietong Pharmaceutical Biotechnology Co., Ltd.
[0037] Example 1: Preparation and Genotyping of PEN2 Mice with Conditional Knockout of Astrocytes
[0038] 1. Experimental materials
[0039] All primers synthesized in the examples were completed by Qingke Biotechnology Co., Ltd.
[0040] In the following embodiments, the hGFAP Cre / + The mice, designated FVB-Tg(GFAP-cre)25Mes / JStrain#004600, were astrocyte-specific Cre recombinase mice purchased from The Jackson Laboratory. This strain of mice was created by transgenic insertion of the human glial fibrillary acidic protein (hGFAP) promoter-driven Cre recombinase gene, which is specifically expressed in astrocytes. Upon mating with loxp transgenic heterozygous mice, Cre-mediated recombination resulted in the deletion of the target gene sequence; these deletions were cell-specific, occurring only in astrocytes. hGFAP Cre / + The specific preparation method of the mice has been disclosed in the article hGFAP-cre transgenic mice for manipulation of glial and neuronal function in vivo (DOI:10.1002 / gene.10008).
[0041] The PEN2 fl / +The mice were loxp transgenic heterozygous mice, obtained by adding loxp1 and loxp2 sites to the intron regions flanking the third and fourth exons (776bp-1210bp) of the presenilin enhancer 2 protein genome (NC_000073.7) in C57BL / 6 mice, respectively. The specific preparation method has been disclosed in the article Conditional inactivation of Pen-2 in the developing neocortex leads to rapid switch of apical progenitors to basal progenitors (DOI:10.1523 / JNEUROSCI.2523-18.2019).
[0042] The antibody PEN2 (A8678) was purchased from Abclonal, and the antibody α-Tubulin (K200064) was purchased from Solarbio.
[0043] The rat tail lysis buffer consisted of: Solution A: 25 mM Tris-HCl (pH 8.0), 10 mM EDTA; Solution B: 200 mM NaOH, 1% (w / v) SDS.
[0044] The 2×Tap Master mix (Dye plus) (P112) was purchased from Vazyme.
[0045] 2. Conditional knockout of astrocytes in PEN2 mice (PEN2) ΔhGFAP Preparation method of )
[0046] 2.1. Place PEN2 fl / + Mice and PEN2 fl / + Mice were mated to obtain PEN2. fl / fl Homozygous mice;
[0047] 2.2. Take the PEN2 obtained in step 2.1 fl / fl Mice and hGFAP Cre / + Mice were mated to obtain PEN2. fl / + hGFAP Cre / + Mice;
[0048] 2.3. Take the PEN2 obtained in step 2.2 fl / + hGFAP Cre / + Mice and PEN2 fl / fl Mice were mated to obtain PEN2. fl / fl hGFAP Cre / + Mice.
[0049] Gene deletion occurs when Cre recombinase binds to the loxp site. Therefore, PEN2 fl / + hGFAP Cre / + The mice are heterozygous for astrocyte-specific knockout of the PEN2 gene; PEN2 fl / fl hGFAP Cre / + The mice were homozygous for astrocyte-specific knockout of the PEN2 gene, abbreviated as PEN2. ΔhGFAP PEN2 ΔhGFAP The mating flowchart for mice is shown in Figure 1.
[0050] 3. Mouse genotyping
[0051] From PEN2 fl / fl Mice, PEN2 fl / + hGFAP Cre / + PEN2 mice, offspring of mice obtained through mating fl / fl hGFAP Cre / + (PEN2 ΔhGFAP A 0.5 cm tail was cut from the rat tail, and 100 μL of rat tail lysis buffer A was added. The mixture was heated at 95 °C for 15 min to lyse, then cooled to room temperature. 100 μL of rat tail lysis buffer B was added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was collected and used for PCR amplification with primers to identify PEN2. ΔhGFAP Genotypes of mice. Based on littermate PEN2... fl / + Mouse or PEN2 fl / + hGFAP Cre / + The mice were wild-type (WT).
[0052] The primers include primers for identifying the tail of Loxp mice and primers for identifying the tail of Cre mice.
[0053] The primers for identifying the tail of Loxp mice are as follows:
[0054] F: GACCCGTAGAAGAGCAGTCAGT; R: ATAAAGAATAGGCTGGGTGGTG
[0055] The primers for Cre mouse tail identification are as follows:
[0056] F: ATCGCCATCTTCCAGCAGGC; R: AAAACGCTGGTTAGCACCGC
[0057] Based on the knockout principle of the loxp site and Cre recombinase, genotyping of breeding mice can be determined simply by detecting the presence or absence of the loxp site and Cre recombinase in the genome. PEN2 ΔhGFAPThe results of mouse tail genotyping are shown in Figure 2. Amplification was performed using primers for Loxp mouse tail identification: PEN2. fl / + =533bp and 468bp; PEN2 fl / fl =533bp; PEN2 + / + =468bp; amplification was performed using primers identified by Cre mouse tail, hGFAP Cre / + =429bp, hGFAP + / + =0bp. A mouse that amplifies a 533bp band using primers identified by the tail of a Loxp mouse, and simultaneously amplifies a 429bp band using primers identified by the tail of a Cre mouse, is a PEN2 mouse. ΔhGFAP Mice. In Figure 2, lanes 1 and 6, from left to right, represent PEN2. ΔhGFAP Electrophoretic bands of mice.
[0058] 4. Western blot verification of PEN2 ΔhGFAP PEN2 knockout effect in mice
[0059] 4.1 Isolation and protein extraction of mouse cerebral cortex
[0060] Wild-type (WT) and PEN2 were taken from animals 7 days after birth. ΔhGFAP In mice, 300 μL of RIPA lysis buffer was added to the cerebral cortex, homogenized using a homogenizer, and then placed on ice for 15 min to allow for complete tissue lysis. The tissue was then centrifuged at 12000 rpm at 4℃ for 15 min, and the supernatant was collected. Protein concentration was determined using a BCA quantitative assay kit; a total protein loading of 30 μg was prepared.
[0061] 4.2 Verification of the effect of PEN2 knockout in the cerebral cortex of PEN2 cKO mice
[0062] Using wild type (WT) and PEN2 ΔhGFAP Mouse cerebral cortex protein samples were subjected to 12.5% SDS-PAGE electrophoresis (80v, 30min; 100v, 90min), the protein bands were transferred to the NC membrane (ice bath; 100v, 90min), the NC membrane was blocked with 5% skim milk (60min), incubated with primary antibody (overnight), incubated with horseradish peroxidase (HRP)-labeled secondary antibody (60min), and developed and exposed with enhanced chemiluminescence (ECL).
[0063] Figure 3 shows the experimental results of Western blot analysis for detecting PEN2 protein levels. Compared with wild-type (WT) mice, PEN2... ΔhGFAP The protein level of PEN2 in the cerebral cortex of mice was significantly downregulated, demonstrating the significant knockout effect of PEN2 in the cerebral cortex.
[0064] Example 2: Phenotypic Validation of Brain Edema in PEN2 Mice with Conditional Astrocyte Knockout
[0065] 1. Experimental materials
[0066] 1.1 Experimental reagents: 4% PDF fixative, sucrose, anti-detachment glass slides, and Leica 819 pathology blades were purchased from Nanjing Yifeixue Biotechnology Co., Ltd. OCT embedding medium (4583) and Nissl staining kit (methyl violet method) (G1432) were purchased from Solarbio.
[0067] 1.2. Experimental animals: Wild-type (WT) mice and PEN2 mice aged 7–12 days after birth. ΔhGFAP Mice were used in experiments.
[0068] 2. Experimental Methods
[0069] 2.1 Anatomical observation of WT and PEN2 ΔhGFAP Morphology of cerebral edema in the cerebral cortex of mice
[0070] WT and PEN cKO mice were collected at 9 and 11 days after birth, their brains were dissected, and photos of the mouse brains under natural light were taken using a Xiaomi phone (Redmi K70 Pro).
[0071] WT and PEN2 ΔhGFAP Figure 4 shows an anatomical diagram of the mouse brain. The photographs revealed that at 9 days after birth, PEN2... ΔhGFAP The appearance of indentations in the cerebral cortex of mice indicates edema of the internal cortical parenchyma; at 11 days after birth, PEN2... ΔhGFAP The cerebral cortex of the mouse dissolved due to edema.
[0072] 2.2 Nissl staining to detect WT and PEN2 ΔhGFAP The morphology of cerebral edema in the cerebral cortex of mice.
[0073] Collect WT and PEN2 at 7 and 9 days after birth. ΔhGFAP Mouse brains were harvested and fixed overnight with 4% paraformaldehyde (PFA). After dehydration with 30% sucrose solution, the brains were embedded in OCT embedding medium and sectioned. The sections were dried in a 37°C oven, washed twice with 1×PBS buffer, placed in Nissl staining reagent for 1 min, washed twice with water, air-dried, and mounted.
[0074] Collect WT and PEN2 at 7 and 9 days after birth. ΔhGFAP Mouse brain sections, Nissl staining, and microscopic imaging. The results, shown in Figure 5, indicate that at 7 days after birth, PEN2... ΔhGFAP The mice did not exhibit the cerebral edema phenotype; at 9 days after birth, PEN2 ΔhGFAPSignificant cerebral edema was observed in the cerebral cortex of the mice.
[0075] 2.3 Imaging assessment WT and PEN2 ΔhGFAP Brain edema in mice.
[0076] T2-weighted MRI data were acquired using a high-field PET-MRI dual-modal small animal imaging system (Bruker 9.4T BioSpec 94 / 30 MRI & PET Insert). WT and PEN2 were used for... ΔhGFAP Mice were anesthetized with 1.25% tribromoethanol (20 μL / g / mouse) and then scanned using a device with an 86 mm magnet aperture. Respiration was monitored in real time during the imaging process. Specific parameters were as follows: field of view 1.6 cm × 1.6 cm, 28 continuous slices obtained in the coronal plane, slice thickness 0.6 mm, echo time 33 ms, repetition time 2802.49 ms, relaxation enhancement factor 8, number of averages 2, matrix size 192 mm × 192 mm, and in-plane resolution 0.141 mm × 0.141 mm.
[0077] Coronal sections of the cerebral cortex of WT and PEN2 cKO mice were acquired using T2-weighted MRI data at 11 days of age. Results showed that at 11 days of age, PEN2... ΔhGFAP Significant high signal intensity of water molecules was observed in the cerebral cortex of the mice (left image in Figure 6). Compared to wild-type mice, PEN2... ΔhGFAP The proportion of water molecule signals in the total brain area of mice was significantly increased (right image in Figure 6).
[0078] Comparative Example: A Comparison of Commonly Used Animal Models of Hydrocephalus
[0079] A comparison of commonly used methods for constructing animal models of hydrocephalus is shown in Table 1.
[0080] Table 1 Comparison of Modeling Methods in Animals with Hydrocephalus
[0081] Based on the above comparison, the method for constructing the cerebral edema model of this invention is simple to operate, low in cost, and the results are easy to observe. The constructed cerebral edema model has the following advantages: 1) It does not require pathogens or invasive modeling, can reproduce stably, and exhibits a spontaneous cerebral edema phenotype; 2) It does not require high experimental techniques and is easy to control, avoiding mouse death caused by operation or other reasons during modeling, and preventing uneven cerebral edema area; 3) Astrocyte conditional knockout PEN2 mice are lighter and smaller than normal mice, and the cerebral edema phenotype is easy to detect, allowing for accurate determination of the region and area of cerebral edema, resulting in high model reliability; 4) The individual differences between mice with the same gene knockout background and genotype are small.
[0082] This invention provides a method for constructing a spontaneous mouse cerebral edema model and its application. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A method for constructing a spontaneous mouse model of cerebral edema, characterized in that, Includes the following steps: (1) PEN2 fl / + Mice and PEN2 fl / + Mice were mated to obtain PEN2. fl / fl Homozygous mice; (2) The PEN2 obtained in step (1) fl / fl Mice and hGFAP Cre / + Mice were mated to obtain PEN2. fl / + hGFAP Cre / + Mice; (3) The PEN2 obtained in step (2) fl / + hGFAP Cre / + Mice and PEN2 fl / fl Mice were mated to obtain PEN2. fl / fl hGFAP Cre / + The mice are the spontaneous mouse cerebral edema model described above. Among them, the PEN2 fl / + The mice were loxp transgenic heterozygous mice; the hGFAP... Cre / + Mouse astrocytes specifically express Cre recombinase.
2. The construction method according to claim 1, characterized in that, The spontaneous mouse brain edema model was a mouse model in which presenilin enhancer 2 was knocked out in astrocytes.
3. The construction method according to claim 2, characterized in that, The mice that knock out prosenilis enhancer 2 in astrocytes are specifically mice that express Cre recombinase hGFAP in astrocytes. Cre / + Knock out the third and fourth exons in the gene encoding the progerin enhancer 2 protein.
4. The construction method according to claim 2 or 3, characterized in that, The protein-coding gene of the presenilin enhancer 2 has an mRNA sequence of NM_001364016.1 in the Gene Bank and a genome sequence of NC_000073.7 in the Gene Bank.
5. The construction method according to claim 1, characterized in that, The spontaneous mouse cerebral edema model was used for genotyping using double PCR. The specific primers used in the dual PCR include primers for identification of Loxp mouse tails and primers for identification of Cre mouse tails.
6. The construction method according to claim 5, characterized in that, The primers used for the identification of the Loxp mouse tail were: F: GACCCGTAGAAGAGCAGTCAGT and R: ATAAAGAATAGGCTGGGTGGTG.
7. The construction method according to claim 5, characterized in that, The primers used for Cre mouse tail identification were F: ATCGCCATCTTCCAGCAGGC and R: AAAACGCTGGTTAGCACCGC.
8. The application of the spontaneous mouse cerebral edema model constructed by the method of claim 1 in the study of cerebral edema disease.
9. The application of the spontaneous mouse cerebral edema model constructed by the method of claim 1 in the development of drugs for the prevention and / or treatment of cerebral edema.
10. The application of the spontaneous mouse cerebral edema model constructed by the method of claim 1 in screening drugs for the prevention and / or treatment of cerebral edema.