mRNA pharmaceutical composition for preventing and treating tuberculosis and use thereof

By developing an mRNA vaccine containing early secreted antigens of Mycobacterium tuberculosis, PE/PPE family antigens, and latent-related antigens, and combining it with cytokines, the problem of insufficient protective efficacy of existing vaccines has been solved, achieving effective prevention and treatment of tuberculosis.

WO2026108990A1PCT designated stage Publication Date: 2026-05-28SHENZHEN RHEGEN BIOTECHNOLOGY CO LTD +2
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SHENZHEN RHEGEN BIOTECHNOLOGY CO LTD
Filing Date
2025-11-21
Publication Date
2026-05-28

Smart Images

  • Figure PCTCN2025136825-FTAPPB-I100001
    Figure PCTCN2025136825-FTAPPB-I100001
  • Figure PCTCN2025136825-FTAPPB-I100002
    Figure PCTCN2025136825-FTAPPB-I100002
  • Figure PCTCN2025136825-FTAPPB-I100003
    Figure PCTCN2025136825-FTAPPB-I100003
Patent Text Reader

Abstract

Disclosed are an mRNA pharmaceutical composition for preventing and treating tuberculosis and use thereof. The mRNA pharmaceutical composition comprises: an mRNA molecule encoding a Mycobacterium tuberculosis antigen, and a pharmaceutically acceptable excipient. The Mycobacterium tuberculosis antigen comprises the following antigen components: at least one early-secreted antigen of Mycobacterium tuberculosis or an immunologically active fragment thereof; PE / PPE family antigen WAG22 of Mycobacterium tuberculosis or an immunologically active fragment thereof; and at least one latent-related antigen of Mycobacterium tuberculosis or an immunologically active fragment thereof. The mRNA pharmaceutical composition does not comprise or further comprises an mRNA molecule encoding a cytokine. The pharmaceutical composition is used for preparing a tuberculosis vaccine, which may serve as a prophylactic vaccine for preventing latent activation or as a therapeutic drug for treating active tuberculosis, exhibiting a significant inhibitory effect on Mycobacterium tuberculosis.
Need to check novelty before this filing date? Find Prior Art

Description

An mRNA drug composition for the prevention and treatment of tuberculosis and its application Technical Field

[0001] This invention relates to an mRNA drug composition for the prevention and treatment of tuberculosis and its application, belonging to the field of biopharmaceutical technology. Background Technology

[0002] Tuberculosis (TB) is a chronic infectious disease caused by the Mycobacterium tuberculosis (MTB) complex. It can cause pulmonary tuberculosis or invade other organs such as the liver, kidneys, brain, and lymph nodes, forming extrapulmonary tuberculosis. The main clinical symptoms of pulmonary tuberculosis include cough and sputum production, possibly accompanied by low-grade fever, night sweats, weight loss, and weakness; while the symptoms of extrapulmonary tuberculosis depend on the organ involved.

[0003] Treatment for tuberculosis typically includes symptomatic and specific therapies, primarily anti-tuberculosis drug therapy. For prevention, the mycobacterium tuberculin skin test is an important means of screening for tuberculosis infection, while vaccination is an effective preventative measure.

[0004] To date, Bacillus Calmette-Guerin (BCG) is the only globally approved vaccine for the prevention of tuberculosis. BCG is a live vaccine made from attenuated bovine MTB. It is effective in preventing tuberculous meningitis and miliary tuberculosis in infants and young children, but offers limited protection in children and adults, and its effectiveness decreases over time. Furthermore, BCG is generally considered not to prevent primary infection and has limited effectiveness in preventing the spread of tuberculosis. Other vaccines developed using existing technologies, such as auxotrophic tuberculosis live attenuated vaccines, BCG recombinant vaccines, tuberculosis subunit vaccines, and DNA vaccines, also offer unsatisfactory protective effects. Currently, no new vaccine can completely replace BCG.

[0005] Therefore, it is essential to develop new drugs to combat TB. Summary of the Invention

[0006] One object of the present invention is to provide a novel mRNA drug composition for the prevention and treatment of diseases related to Mycobacterium tuberculosis infection, such as tuberculosis.

[0007] One object of the present invention is to provide the use of the aforementioned mRNA pharmaceutical composition for the prevention and treatment of diseases related to Mycobacterium tuberculosis infection, such as tuberculosis.

[0008] On one hand, the present invention provides an mRNA pharmaceutical composition comprising: an mRNA molecule encoding Mycobacterium tuberculosis antigen, and pharmaceutically acceptable excipients;

[0009] The Mycobacterium tuberculosis antigen includes the following antigenic components:

[0010] At least one early secreted antigen of Mycobacterium tuberculosis or a fragment thereof with immunological activity;

[0011] At least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0012] At least one Mycobacterium tuberculosis latent-associated antigen or its immunologically active fragment;

[0013] Selectively, two or more of the following antigens or their immunoactive fragments may be selected as antigenic components: early secreted antigen of Mycobacterium tuberculosis or its immunoactive fragments, Mycobacterium tuberculosis PE / PPE family antigen or its immunoactive fragments, and latent related antigen of Mycobacterium tuberculosis or its immunoactive fragments.

[0014] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition does not include or further includes mRNA molecules encoding cytokines.

[0015] According to a specific embodiment of the present invention, the mRNA molecule encoding Mycobacterium tuberculosis antigen has a 5' cap modification and / or a polyA tail modification.

[0016] According to a specific embodiment of the present invention, in the mRNA drug composition, the antigen may be a composition of multiple antigen molecules, or a single molecular form of antigen molecule formed by the fusion and / or chimerism of the multiple antigen components.

[0017] According to a specific embodiment of the present invention, the early secretory antigen of Mycobacterium tuberculosis may be selected from antigens such as Ag85A, Ag85B, ESAT6, EspC (Rv3615c), EsxH (TB10.4), CFP10, or their immunogenic fragments, as well as one or more fusion proteins or chimeric proteins formed by two or more of these antigens or their immunogenic fragments.

[0018] According to a specific embodiment of the present invention, the Mycobacterium tuberculosis PE / PPE family antigen can be selected from antigens such as PPE18, Rv2770c (PPE44), Rv1806 (PE20), Rv3812 (PE_PGRS62), PE63, WAG22 (PE-PGRS family protein WAG22, Rv1759c), PPE14, Rv1818c (PE-PGRS33), Rv2608 (PPE42), Rv3872 (PE35), Rv1196 (PPE18) or their immunogenic fragments, as well as one or more of the fusion proteins or chimeric proteins formed by two or more of these antigens or their immunogenic fragments.

[0019] According to a specific embodiment of the present invention, the latent-associated antigen of Mycobacterium tuberculosis may be selected from antigens such as Rv1285(cysD), Rv1813c, Rv2029c, Rv2031c, Rv2624c, Rv2628, Rv2660c, or immunogenic fragments thereof, as well as one or more fusion proteins or chimeric proteins formed by two or more of these antigens or their immunogenic fragments.

[0020] In this invention, a combination of multiple antigens is used to prepare a vaccine for diseases related to Mycobacterium tuberculosis infection, such as a tuberculosis vaccine. The prepared vaccine can be used both as a prophylactic vaccine to prevent latent reactivation of Mycobacterium tuberculosis and as a therapeutic drug to treat active Mycobacterium tuberculosis infection. In a specific embodiment of this invention, its inhibitory effect on Mycobacterium tuberculosis has been experimentally demonstrated.

[0021] According to a specific embodiment of the present invention, the antigen of the present invention, the early secreted antigen of Mycobacterium tuberculosis includes one or more of the following antigen components: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof.

[0022] Ag85A and Ag85B: A major component of the secreted proteins in the culture filtrate of Mycobacterium tuberculosis is the Ag85 complex (antigen 85 complex), a protein family with a relative molecular mass of 38,000 composed of Ag85A, Ag85B, and Ag85C. Ag85A, with a full length of 295 amino acids, is a key enzyme in the synthesis of the Mycobacterium tuberculosis cell wall. It is responsible for catalyzing the acyl transfer reaction in the antigen 85 complex, transferring long-chain fatty acid ester groups to the citrus fatty acids in the cell wall. Ag85A can stimulate humoral immunity and also trigger Th1-type cellular immunity, inducing CD8+ T cell proliferation and increases in IL-2 and IFN-γ. Ag85B, a protein with a full length of 285 amino acids and a molecular weight of 34.6 kDa, also known as MPT59 or Rv1886, is a mycobacterial transferase involved in bacterial cell wall synthesis. It has multiple T cell epitopes and can induce Th1 responses and IFN-γ production.

[0023] In some specific embodiments of the present invention, the antigen described in the present invention includes the early secretory antigen of Mycobacterium tuberculosis, which comprises a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B.

[0024] In some specific embodiments of the present invention, the antigen described in the present invention, wherein the early secreted antigen of Mycobacterium tuberculosis has the amino acid sequence shown in SEQ ID NO: 1.

[0025] According to a specific embodiment of the present invention, the Mycobacterium tuberculosis PE / PPE family antigens in the antigens of the present invention include WAG22.

[0026] WAG22 (Rv1759c): In order to design a new vaccine to prevent the reactivation of Mycobacterium tuberculosis, Campuzano J et al. used a B6D2F1 mouse chronic tuberculosis experimental model and observed the continuous expression of WAG22 on the cell wall of mycobacteria phagocytosed by activated macrophages in pulmonary granulomas. This antigen induced the production of IFN-γ after stimulation, indicating that this antigen may play an important role in maintaining the immune response to latent infection.

[0027] According to a specific embodiment of the present invention, the latent mycobacterium tuberculosis-associated antigens in the antigens described herein include Rv1813c.

[0028] Rv1813c: A protein expressed by MTB under hypoxic conditions and associated with latent bacterial growth. Although Rv1813c is not essential for the survival of Mycobacterium tuberculosis in vitro, the ΔRv1813c mutant of Mycobacterium tuberculosis was attenuated in a low-dose aerosol model of tuberculosis in mice, exhibiting lower bacterial burden, delayed death time, and reduced ability to stimulate the pro-inflammatory cytokines interleukin-1β (IL-1β) and IL-12.

[0029] According to a specific embodiment of the present invention, the mRNA molecule of the present invention can be a composition of multiple mRNA molecules, or it can be a single molecular form of mRNA molecule that can encode the multiple antigen components.

[0030] According to a specific embodiment of the present invention, the mRNA molecule of the present invention comprises:

[0031] mRNA molecules encoding at least one early secreted antigen of Mycobacterium tuberculosis or a fragment of its immunologically active form;

[0032] mRNA molecules encoding at least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; and

[0033] mRNA molecules encoding at least one Mycobacterium tuberculosis latent-associated antigen or its immunologically active fragment.

[0034] According to a specific embodiment of the present invention, when the antigen of the present invention comprises fusion protein and / or chimeric protein antigen components, the mRNA molecule of the present invention comprises an mRNA molecule encoding these fusion protein and / or chimeric protein antigen components.

[0035] In some specific embodiments of the present invention, the early secreted antigen of Mycobacterium tuberculosis in the antigen of the present invention comprises a chimeric protein (Ag85ab) formed by a fragment of Ag85A and a fragment of Ag85B, and the mRNA of the present invention comprises mRNA encoding the chimeric protein. In some more specific embodiments, the chimeric protein formed by the fragment of Ag85A and the fragment of Ag85B has the amino acid sequence shown in SEQ ID NO: 1, and the mRNA of the present invention comprises an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 1. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 2.

[0036] In some specific embodiments of the present invention, the antigen described herein includes Mycobacterium tuberculosis latent-associated antigen Rv1813c, and the mRNA of the present invention includes mRNA encoding Rv1813c. In some more specific embodiments, Rv1813c has the amino acid sequence shown in SEQ ID NO: 3, and the mRNA of the present invention includes an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 3. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding Rv1813c is shown in SEQ ID NO: 4.

[0037] In some specific embodiments of the present invention, the antigen described herein includes Mycobacterium tuberculosis PE / PPE family antigen, which includes WAG22, and the mRNA of the present invention includes mRNA encoding WAG22. In some more specific embodiments, WAG22 has the amino acid sequence shown in SEQ ID NO: 5, and the mRNA of the present invention includes an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 5. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding WAG22 is shown in SEQ ID NO: 6.

[0038] In some specific embodiments of the present invention, the antigen described herein is a fusion antigen of Mycobacterium tuberculosis early secretory antigen, latent-associated antigen, and PE / PPE family antigen. In some specific embodiments of the present invention, the antigen described herein includes: a chimeric protein (Ag85ab) formed by fusing fragments of Ag85A and Ag85B, and a fusion antigen formed by fusing Rv1813c antigen fragments with WAG22 (Rv1759c) antigen fragments. The mRNA of the present invention includes mRNA encoding the fusion antigen. The sequence of antigen fragments in the fusion antigen of the present invention can have multiple forms, such as Ag85ab-Rv1813c-Rv1759c, Ag85ab-Rv1759c-Rv1813c, Rv1759c-Rv1813c-Ag85ab, Rv1759c-Ag85ab-Rv1813c, Rv1813c-Ag85ab-Rv1759c, or Rv1813c-Rv1759c-Ag85ab. In some more specific embodiments, the fusion antigen has the amino acid sequence shown in SEQ ID NO: 9, and the mRNA of the present invention comprises an mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 9. In some specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding the fusion antigen is shown in SEQ ID NO: 10.

[0039] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition wherein the mRNA molecule encoding Mycobacterium tuberculosis antigen has a 5' cap modification. Preferably, the 5' cap structure is selected from any one of m7G, Cap0, Cap1, Cap2, modified Cap0, modified Cap1, and modified Cap2 structures. In some specific embodiments of the present invention, the mRNA molecule encoding Mycobacterium tuberculosis antigen has a 5' Cap2 cap analog modification. According to a preferred embodiment of the present invention, the Cap2 cap analog has the structure shown in Formula I:

[0040] In Formula I:

[0041] R1 is selected from -H, -OH, C. 1-6 Alkyl and C 1-6 Any one of the alkoxy groups;

[0042] R2 is selected from -H, -OH, halogens, and C. 1-6 Any one of the alkoxy groups;

[0043] R3 and R0 are each independently selected from any one of F, Cl, Br, and I;

[0044] J1 and J2 are each independently selected from natural or modified pyrimidine nucleotide bases and natural or modified purine nucleotide bases.

[0045] According to a specific embodiment of the present invention, preferably, the Cap2 analogue is selected from one or more of the following specific structural formula compounds:

[0046] According to a specific embodiment of the present invention, the Cap2 structural cap analogue can be synthesized with reference to the method described in CN118772219A, the entire contents of which are incorporated herein by reference.

[0047] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition wherein the mRNA molecule encoding Mycobacterium tuberculosis antigen has a polyA tail modification, that is, the mRNA molecule includes a polyA tail sequence.

[0048] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition wherein the mRNA molecule encoding Mycobacterium tuberculosis antigen further comprises one or more of the following modifications: modified with 1-methylpseuuridine; including at least one 5'UTR sequence; including at least one 3'UTR sequence.

[0049] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition wherein the mRNA molecule encoding a cytokine has one or more of the following modifications: modified with 1-methylpseudouridine; includes at least one 5'UTR sequence; includes at least one 3'UTR sequence; has a 5' capping modification; includes a polyA tail sequence.

[0050] According to a preferred embodiment of the present invention, in the mRNA molecule encoding a cytokine, the 5' capping modification can be selected from any one of m7G, Cap0, Cap1, Cap2, modified Cap0, modified Cap1, and modified Cap2 structures. In some specific embodiments of the present invention, the 5' capping modification of the mRNA molecule encoding a cytokine is a Cap2 cap analog having the structure shown in Formula I or the structure shown in the specific structural formula above.

[0051] According to a specific embodiment of the present invention, the modifications of each mRNA molecule in the mRNA drug composition may be the same or different.

[0052] In some specific embodiments of the present invention, the 5'UTR sequence of each mRNA molecule may be independently as shown in SEQ ID NO: 17 or other conventionally designed 5'UTR sequences.

[0053] In some specific embodiments of the present invention, the 3'UTR sequence of each mRNA molecule may be independently as shown in SEQ ID NO: 18 or other conventionally designed 3'UTR sequences.

[0054] In some specific embodiments of the present invention, the PolyA tail sequence of each mRNA molecule can be any of the PolyA tails mentioned in patent applications WO2024041641A1 and CN202311309226.5. The entire contents of WO2024041641A1 and CN202311309226.5 are incorporated herein by reference. Preferably, the polyA tail sequence has a length of 50 to 150 nucleotides; more preferably, the polyA tail sequence is as shown in SEQ ID NO: 19.

[0055] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition selectively includes mRNA molecules encoding cytokines. The cytokines include one or more of IFN-γ, IL-2, IFNa4, TNF-α, GM-CSF, IL-7, IL-12A, and IL-12B.

[0056] In some more specific embodiments of the present invention, the mRNA molecules encoding cytokines may be existing mRNA molecules encoding IFN-γ, IL-2, IFNa4, TNF-α, GM-CSF, IL-7, IL-12A, or IL-12B, or may undergo further conventional codon optimization.

[0057] In some more specific embodiments of the present invention, the amino acid sequence of IFN-γ is shown in SEQ ID NO: 7. In some more specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding IFN-γ is shown in SEQ ID NO: 8.

[0058] In some more specific embodiments of the present invention, the amino acid sequence of IL-2 is shown in SEQ ID NO: 11 or SEQ ID NO: 13. In some more specific embodiments of the present invention, the coding region sequence of the mRNA molecule encoding IL-2 is shown in SEQ ID NO: 12 or SEQ ID NO: 14.

[0059] In some more specific embodiments of the present invention, the mass ratio of the mRNA molecule encoding Mycobacterium tuberculosis antigen to the mRNA molecule encoding cytokines in the pharmaceutical composition is 10:1 to 1:1.

[0060] According to a specific embodiment of the present invention, the mRNA drug composition is a lipid nanoparticle dosage form.

[0061] In some more specific embodiments of the present invention, the lipid nanoparticles include mRNA and lipid LNPs, wherein the lipid LNPs include one or more of cationic lipids, supporting lipids, sterols, and polymer-conjugated lipids.

[0062] According to a specific embodiment of the present invention, the cationic lipid includes one or more of the following: methyl 4-(N,N-dimethylamino)butyrate (DLin-MC3-DMA), ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate (SM-102), 8-((7-((3-(hexylthio)-2-methylpropionyl)oxo)n-heptyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T19), and 8-((5-(((3-(octylthio)-2-methylpropionyl)oxo)n-pentyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T13).

[0063] According to a specific embodiment of the present invention, the structural formula of T19 is:

[0064] According to a specific embodiment of the present invention, the structural formula of T13 is:

[0065] According to a specific embodiment of the present invention, the polymer-conjugated lipid includes one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG.

[0066] According to a specific embodiment of the present invention, the supporting phospholipid includes one or more of DSPC, DOPE, DOPC, and DOPS.

[0067] According to a specific embodiment of the present invention, the sterols include one or more of cholesterol and β-sitosterol.

[0068] According to a specific embodiment of the present invention, in the lipid LNP, based on the total molar amount of lipids as 100%, the molar ratio of each lipid component is as follows: cationic lipids 35%-57.5%, supported lipids 0%-16% or 5%-16%, sterols 27.5%-55%, and polymer-conjugated lipids 0-3%, preferably 0.5%-2.5%.

[0069] According to a specific embodiment of the present invention, the mRNA pharmaceutical composition is a vaccine, and the mRNA vaccine of the present invention further includes excipients. The excipients used may be, for example, an aqueous solution of salt and sugar. Preferably, the salt is selected from one or more of citrate, acetate, phosphate, or Tris salt; the sugar is selected from one or more of sucrose and trehalose.

[0070] On the other hand, the present invention also provides a method for preparing an mRNA vaccine, comprising:

[0071] Each mRNA molecule described in this invention is separately formulated into lipid nanoparticles, and then multiple lipid nanoparticles are mixed together; or

[0072] Multiple mRNA molecules in the mRNA described in this invention are mixed into a mixture, and then the mRNA mixture is made into lipid nanoparticles.

[0073] The method for preparing the mRNA vaccine may further include: mixing the lipid nanoparticles with excipients to prepare the vaccine product.

[0074] In some specific embodiments of the present invention, the vaccine dosage form of the present invention is a freeze-dried dosage form or a frozen dosage form.

[0075] In some specific embodiments of the present invention, the vaccine of the present invention is an intramuscular injection vaccine.

[0076] In some specific embodiments of the present invention, the vaccine described herein is a vaccine for the prevention and / or treatment of diseases related to Mycobacterium tuberculosis infection, such as a tuberculosis vaccine, targeting the spleen and / or lungs.

[0077] The vaccine of the present invention can be used as a preventive vaccine against latent activation of Mycobacterium tuberculosis, and also as a therapeutic drug for treating diseases related to active Mycobacterium tuberculosis infection, such as tuberculosis. It has a significant inhibitory effect on Mycobacterium tuberculosis. Attached Figure Description

[0078] Figure 1 shows that the synthesized mRNA vaccine in this embodiment of the invention effectively elicits a humoral immune response in mice.

[0079] Figure 2 shows that the synthesized mRNA vaccine in this embodiment of the invention effectively elicits a cellular immune response in mice.

[0080] Figure 3 shows the efficacy of the synthesized mRNA vaccine in preventing Mycobacterium tuberculosis infection in this embodiment of the invention. The statistical significance analysis in the figure compares the vaccine with the PBS group; **p<0.01.

[0081] Figure 4 shows the efficacy of the synthetic mRNA vaccine in preventing the transformation of latent Mycobacterium tuberculosis infection into active tuberculosis in the embodiments of the invention. The statistical significance analysis in the figure compares the vaccine with the PBS group; **p<0.01.

[0082] Figure 5 shows the efficacy of the synthesized mRNA vaccine in treating tuberculosis in the embodiments of the invention. The statistical significance analysis in the figure compares the vaccine with the PBS group; **p<0.01. Detailed Implementation

[0083] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention is described in detail below, but this should not be construed as limiting the scope of implementation of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in each embodiment that do not specify specific conditions are operated according to conventional conditions in the relevant field. All starting reagents and materials used in the embodiments are commercially available or prepared with reference to existing techniques in the art.

[0084] The structure of the 5'Cap2 cap analogue R17 used in the embodiment is as follows:

[0085] It can be synthesized as follows:

[0086] Synthesis of compound 6A-2:

[0087] At 25±5℃, 200g of compound 6A-1 was weighed and dissolved in 1200mL of N,N-dimethylformamide. 192g of imidazole was added at 25±5℃, and the mixture was stirred until dissolved. 254g of tert-butyldimethylchlorosilane was slowly added, maintaining the temperature below 35℃. After the addition was complete, the mixture was stirred at 25±5℃ for 6 hours. Samples were taken for monitoring to determine the reaction endpoint. TLC (thin-layer chromatography) showed that compound 6A-1 had reacted completely. 1200mL of water was added to the above reaction solution to quench the reaction. Extraction was performed twice with 1000mL of ethyl acetate. The resulting organic phase was separated, washed with 1000mL of saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain 372g of a pale yellow oily compound 6A-2. The crude product was directly added to the next step.

[0088] Synthesis of compound 6A:

[0089] At 25±5℃, 372g of compound 6A-2 (crude product) was weighed and dissolved in 800mL of tetrahydrofuran and 400mL of water. The mixture was stirred until dissolved, and 400mL of trifluoroacetic acid was added dropwise under an ice-salt bath. The reaction temperature was controlled between 0-3℃, and the mixture was stirred for 4 hours. Samples were taken for monitoring, and the reaction endpoint was determined. TLC (thin-layer chromatography) showed that compound 6A-2 had reacted completely. 2000 mL of crushed ice was placed in a 5.0 L measuring cup. 215 g of sodium hydroxide was placed on the ice layer. While stirring, the reaction solution was slowly poured into the above solution, maintaining the temperature below 5 °C. After the addition was complete, the pH of the solution was adjusted to between 8.0 and 9.0 with saturated sodium bicarbonate. Extraction was performed twice with 2000 mL of ethyl acetate. The liquid was separated, and the resulting organic phase was washed with 1000 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain 335 g of a yellow oily substance. Silica gel powder (100-200 mesh) was added at 1.5 times the weight of the concentrated crude product and mixed. Silica gel column purification was performed: mobile phase A: dichloromethane; B: methanol. Gradient (proportion of phase B): 0–10% elution. The product fraction was collected and concentrated to dryness under reduced pressure to obtain 203.4 g of a white solid compound 6A.

[0090] 1 H NMR (400MHz, CDCl3) δ12.13(s,1H),9.42(s,1H),8.00(s,1H),6.04(d,J=16.0Hz,1H),5.32-5.19(dd,J=4.0,4.0Hz,1 H), 5.03 (s, 1H), 4.57 (m, 1H), 4.12 (m, 1H), 3.75 (m, 1H), 2.78 (m, 1H), 1.24 (d, J = 4.0Hz, 6H), 0.89 (s, 9H), 0.11 (s, 6H).

[0091] Synthesis of compound 7:

[0092] Weigh 80g of tetrazolium and dissolve it in 2800mL of anhydrous acetonitrile in a three-necked flask. Add 97g of compound 6A at 25±5℃. After stirring and dissolving, purge with argon three times. Then add 200g of compound 6. Stir the reaction system at 25±5℃ for 2 hours. No significant exothermic reaction was observed. TLC (thin-layer chromatography) showed that the starting material compound 6 reacted completely, and a new spot Int.1 was formed. Then, iodine solution (100g of iodine dissolved in 800mL of a mixed solution of THF:H2O:pyridine = 8:1:1, to prepare a 0.5mmol / mL iodine solution) was added dropwise until the solution no longer decolorized, for a total of 600mL of iodine solution. After the addition was complete, the reaction solution was stirred for 0.5 hours. Samples were taken for monitoring to determine the reaction endpoint. TLC showed that Int.1 reacted completely. Add 400–500 mL of saturated sodium thiosulfate solution to the above reaction solution, stir for 15 min, dilute with 1000 mL of water, extract twice with 1000 mL of ethyl acetate, separate the liquid and extract the organic phase, wash with 1000 mL of saturated brine, dry with anhydrous sodium sulfate, concentrate under reduced pressure to obtain 373.2 g of compound 7 as a yellow oily crude product. The crude product is directly used in the next step.

[0093] Synthesis of compound 8:

[0094] At 25±5℃, 373.2g of crude compound 7 was weighed and dissolved in a mixed solution of 1500mL glacial acetic acid and 375mL water. The solution was stirred and sonicated until fully dissolved, then stirred at 25±5℃ for 14 hours. Samples were taken for monitoring to determine the reaction endpoint. TLC (thin-layer chromatography) showed that compound 8 reacted completely. The reaction solution was concentrated under reduced pressure at 40℃ to remove most of the glacial acetic acid. The resulting oily substance was dissolved in 400-500mL methanol and concentrated. This cycle was repeated three times to remove most of the remaining glacial acetic acid, yielding 400g of an orange-red oily substance. Silica gel powder (100-200 mesh) of 1.2 times the weight of the concentrated crude product was added and mixed. The mixture was purified by silica gel column chromatography. Mobile phase A: ethyl acetate; B: methanol diluted with ten times the volume of dichloromethane. Gradient (volume ratio of phase B): 0-100% elution. The product fraction was collected and concentrated to dryness under reduced pressure to obtain 152g of yellow solid compound 8.

[0095] Synthesis of compound 9:

[0096] Weigh 41.4 g of tetrazolium and dissolve it in 1600 mL of anhydrous acetonitrile in a three-necked flask. Add 152 g of compound 8 at 25 ± 5 °C. After stirring and dissolving, purge with argon three times, then add 130.9 g of compound 8A. After the addition is complete, stir the reaction system at 25 ± 5 °C for 2 hours. No significant exothermic reaction was observed. TLC (thin-layer chromatography) (DCM:EA:MeOH = 5:5:1) showed that compound 8 reacted completely, with a new spot Int.1 appearing. Then, add iodine solution dropwise (100 g of iodine dissolved in 800 mL of a mixed solution of THF:H2O:pyridine = 8:1:1, to prepare a 0.5 mmol / mL iodine solution) until the solution no longer decolorizes. A total of 600–700 mL of iodine solution was added. After the addition was complete, the reaction solution was stirred for 0.5 hours. Samples were taken for monitoring to determine the reaction endpoint. Standard: TLC (thin-layer chromatography) Int.1 indicates complete reaction. Add 500 mL of saturated sodium thiosulfate solution to the above reaction solution, stir for 15 min, dilute with 2000 mL of water, extract twice with 1500 mL of ethyl acetate, separate the liquid and liquid phases, wash the obtained organic phase with 1000 mL of saturated sodium chloride solution, dry with anhydrous sodium sulfate, and concentrate under reduced pressure to obtain 180 g of crude yellow oily compound 9. Add 1.2 times the mass of the concentrated crude product of silica gel powder (100-200 mesh) and mix. Purify with silica gel column: mobile phase A: ethyl acetate; B: methanol diluted with ten times the volume of dichloromethane; flow rate: 100 mL / min; gradient (volume ratio of phase B): 0-100% elution. Collect the product fraction, concentrate to dryness under reduced pressure to obtain 153 g of yellow solid compound 9.

[0097] Synthesis of compound 10:

[0098] At 25±5℃, 50.0 g of compound 9 was weighed and dissolved in 1000 mL of methanol. Then, 1000 mL of ammonia was added at 25±5℃, and the mixture was stirred until dissolved. The mixture was heated to 40℃ and stirred for 45 h. HPLC monitoring was performed to determine the reaction endpoint. HPLC (peak area) showed that compound 9 < 5.0%, and the remaining intermediate amount < 5.0%. The reaction solution was concentrated under reduced pressure at 40℃, then dissolved and concentrated three times with 300 mL of methanol to remove most of the remaining ammonia, yielding 51.3 g of a pale yellow oily compound 10. The crude product was directly added to the next step.

[0099] Synthesis of compound 11:

[0100] At 25±5℃, 51.3g of compound 10 (crude product) was weighed and dissolved in 60mL of dimethyl sulfoxide. After stirring and dissolving, 60mL of triethylamine trihydrofluoride was added. The reaction was stirred at 40℃ for 2h, and HPLC sampling was used to monitor and determine the reaction endpoint. Compound 10 < 5.0%. The reaction solution was diluted with 6L of water and adjusted to pH 5.3–5.7 with NaOH (1M) solution, with the temperature controlled at 15–20℃ during the addition process. Then, the reaction solution was diluted with pure water until the conductivity was below 10000μs / cm, ready for sample loading and purification. Column equilibration: First, equilibrate the column with 10 L of 2M NaCl at a flow rate of 60 mL / min, then equilibrate with 10 L of pure water at a flow rate of 100 mL / min; Load 7 L of sample treatment buffer at a flow rate of 40 mL / min; Elution: Flow rate of 60 mL / min, gradient 0–0.25 M NH4HCO3; Start collecting product components when the eluent concentration is 0.20–0.25 M NH4HCO3. Pre-cool the required ultrapure water to 2-8℃; pour the fraction obtained in the previous purification step into a nanofiltration unit for nanofiltration, and monitor the conductivity at the outlet in a timely manner. When the solution is concentrated to 1L, dilute with water and continue nanofiltration. Add 3L of water and nanofiltration for 20 minutes, then concentrate the solution to 1L again. Repeat this operation until the conductivity at the outlet is less than 200μs / cm, at which point concentration is stopped; release approximately 800mL of the solution from the storage tank, then add 800mL × 2 of water to clean the pipeline residue, and finally collect all the fractions; dispense the above solution into six 1L single-necked bottles, pre-freeze in dry ice ethanol solution, and then freeze-dry in a manifold freeze dryer for 40 hours. 25.6g of compound 11 as a white solid was obtained.

[0101] 1 H NMR(400MHz,D2O)δ8.09(s,1H),7.74(s,1H),7.52(s,1H),5.96(d,J=16.0Hz,1H),5.79(d,J=16.0Hz,1H),5.31-5.18(dd,J=4.0,4.0Hz,1 H),5.06-4.92(dd,J=4.0,4.0Hz,1H),4.75-4.64(m,1H),4.52-4.43(m,1H),4.32(d,J=4.0Hz,1H),4.21-4.13(m,3H),4.20-3.97(m,2H).

[0102] Synthesis of compound R17:

[0103] Under argon protection at 25±5℃, 10.0g of compound 11, 15.5g of compound 1B, and 300mL of DMSO were added sequentially to a three-necked flask. The mixture was stirred for ten minutes until a colorless turbid solution was obtained. Then, 35g of ZnCl2 was added to the reaction solution, maintaining the temperature at 15-25℃. After the addition was complete, the reaction was continued at 25±5℃ with stirring for 35 hours. The reaction endpoint was determined by HPLC. The percentage of standard compound 11 was <20%. 110g of EDTA disodium dihydrate was weighed and dissolved in 3.5L of H2O. The resulting solution was adjusted to pH 7.0-7.5 with saturated sodium bicarbonate solution and cooled to 0℃. The reaction solution was then poured into the above solution and stirred for 20 minutes. The solution was diluted with pure water until the conductivity was below 10000μs / cm. Finally, the pH was adjusted to between 5.3-5.7 with dilute hydrochloric acid (1M) solution, maintaining the temperature below 10℃ during the addition process. After adjustment, the solution was ready for purification. Column equilibration: First, equilibrate the column with 3L of 2M NaCl at a flow rate of 60mL / min, then equilibrate with 4L of pure water at a flow rate of 60mL / min; load 5L of sample treatment buffer at a flow rate of 50mL / min; elution: flow rate of 50mL / min, gradient 0–0.10M NH4HCO3; when the eluent concentration is 0.05–0.10M NH4HCO3, start collecting the product fraction. Collect the fraction with a purity greater than 95% and store at 2–8℃. Dilute with pure water until the solution conductivity is 10000μs / cm, adjust the pH to between 5.3 and 5.7, and perform a second purification. Collect the fraction with a purity greater than 95% and store at 2–8℃. Pre-cool the required ultrapure water to 2–8℃ beforehand; pour the two batches of fractions obtained during purification into a nanofiltration machine for nanofiltration, and monitor the pH of the fractions and the conductivity of the outlet in a timely manner. When the solution is concentrated to 1L, start adding water. The solution was diluted and nanofiltered again. 3L of water was added, and nanofiltration was performed for 20 minutes. The solution was then concentrated to 1L. This process was repeated until the conductivity at the liquid outlet was less than 200μs / cm, at which point concentration was stopped. Approximately 800mL of the solution was discharged from the storage tank, and 800mL x 2 of water was added to clean the pipeline of any residue. All components were then collected. The solution was dispensed into six 1L single-necked flasks and pre-frozen in a dry ice-ethanol solution. The flasks were then connected to a manifold freeze dryer for 40 hours. Freeze-drying yielded 6.85g of white solid R17.

[0104] 1H NMR(400MHz,D2O)δ9.11(s,1H),8.31(s,1H),8.07(s,1H),7.77(s,1H),6.17(d,J=16.0Hz,1H),6.07(d,J=20.0Hz,1H),5.85(d,J=4.0Hz,1H ),5.45-5.37(dd,J=4.0,4.0Hz,1H),5.32-5.24(d,J=4.0,4.0Hz,1H),4.94(m,1H),4.72(m,2H),4.13-4.52(m,9H),4.04(s,3H),3.48(s,3H)

[0105] 31 P NMR (162MHz, D2O) δ, -1.38 (s, 1H), -11.56 (t, J = 13.8Hz, 2H), -22.82 (t, J = 17.8Hz, 1H).

[0106] Example 1: Preparation of TB mRNA Vaccine

[0107] Sequence optimization

[0108] The inventors in this case conducted research on the combination of Mycobacterium tuberculosis antigens in their previous studies and designed a variety of antigen combinations. For related research, please refer to CN202411119114.8. The entire contents of CN202411119114.8 are incorporated herein by reference.

[0109] In this invention, highly stable and highly expressive mRNA sequences were designed through sequence optimization based on the amino acid sequences of Ag85ab, Rv1813c, Rv1759c, and IFN-γ. All mRNA sequence design parameters were within acceptable ranges, with a low number of unpaired bases and a high CAI value, meeting the design principles of high stability and high expression. The amino acid sequences of each antigen used in this embodiment and their corresponding mRNA sequences are shown in Table 1.

[0110] Table 1. Amino acid sequence and mRNA sequence of the antigen

[0111] mRNA synthesis

[0112] The sequence-optimized gene was constructed into a universal mRNA vector. Template DNA was prepared by PCR for mRNA transcription. mRNA was synthesized using a Cap2 cap analog, N1-methylpseudouracil, and a poly A tail. Each synthesized mRNA was 100% modified with m1ψ. The 5' Cap2 cap analog structure was the aforementioned R17, with the following 5' UTR sequence: GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC (SEQ ID NO: 17), 3' UTR sequence: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG (SEQ ID NO: 18), and the poly A tail sequence: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAA ...

[0113] vaccine preparation

[0114] Since TB vaccines primarily rely on CD4+ cell-mediated immunity, this invention utilizes LNP vectors, which exhibit strong spleen-targeting and potent cellular immune responses, to prepare lipid nanoparticles containing mRNA (mRNA-LNP). The main quality control parameters are encapsulation efficiency >90% and particle size 100-120 nm. The specific preparation process of the mRNA-LNP vaccine product is as follows:

[0115] (1) Phase A preparation

[0116] The antigens and / or cytokines in the phase A solution of each vaccine product are shown in Table 2.

[0117] Table 2

[0118] The mRNA stock solutions of different sequences were diluted to 0.536 mg / ml with water for injection to obtain the mRNA stock solution dilution. The different mRNA stock solution dilutions were mixed in equal mass ratio to obtain the total mRNA stock solution dilution (the fusion mRNA stock solution dilution was used directly as the total mRNA stock solution dilution). The total mRNA stock solution dilution and A1 solution (100 mM pH 4.0 citrate-sodium citrate buffer) were mixed at a weight ratio of 1:1.01 and gently inverted to mix. This mixed solution is the A phase solution (mRNA content is approximately 0.268 mg / ml).

[0119] (2) B phase preparation

[0120] T19, DSPC, and DMG-PEG were weighed according to a molar ratio of 48:16:1.5:34.5. 2000 CHOL was completely dissolved in anhydrous ethanol to obtain phase B solution with a density (25℃) of 796.2 g / L.

[0121] (3) Preparation of mRNA-LNP

[0122] Using a liposome nanoparticle synthesis instrument, phase A solution was connected to the inlet of high-precision syringe pump A, phase B solution was connected to the inlet of high-precision syringe pump B, and 20mM citrate-sodium citrate buffer (pH 6.4) was connected to the inlet of high-precision syringe pump C. High-precision syringe pumps A and B were connected to the two ends of the LNP encapsulated chip, respectively. The outlet of the LNP encapsulated chip and high-precision syringe pump C were connected to the two ends of the LNP dilution chip, respectively. The outlet of the LNP dilution chip was connected to the LNP stock solution collection bottle.

[0123] Open the control software and set the flow rate of syringe pump A to 90 ml / min, syringe pump B to 30 ml / min, and syringe pump C to 120 ml / min. Click the run button to start the process. After discarding the initial 200 ml of liquid, begin collecting the sample. Stop collecting once either phase A or phase B has been completely absorbed. The collected sample is LNP-IP1.

[0124] LNP-IP1 was purified using a 100 kDa hollow fiber membrane with 20 mM Tris-HCl buffer (pH 6.4) as the washing solution. First, LNP-IP1 was concentrated 2.0-fold, then subjected to continuous equal-volume washing for 4.0-fold, followed by a further 1.5-fold concentration, for a total of 3.0-fold. This was then repeated with continuous equal-volume washing for another 4.0-fold, followed by a further 2.0-fold concentration, yielding LNP-IP2.

[0125] Mix LNP-IP2 solution and 20mM Tris solution at a weight ratio of 3.5:1 to obtain LNP-IP3 solution with a pH of 7.7±0.2. Check the pH. If the pH is not within 7.7±0.2, adjust the pH to 7.7±0.2 using 20mM Tris solution or 20mM Tris-HCl buffer.

[0126] First, adjust the final concentration of mRNA to 0.26 mg / ml using 20 mM Tris-HCl buffer (pH 7.7) to obtain the LNP-IP4a solution. Then, calculate the weight of the 75% (w / v) sucrose solution to be added based on the weight ratio of LNP-IP4a solution to the 75% (w / v) sucrose solution to be added, which is 3.12:1. Slowly add the weighed 75% sucrose solution to the LNP-IP4a solution and gently invert to mix. The resulting product is LNP-IP4.

[0127] (4) Freeze-drying

[0128] Perform freeze-drying according to the procedure shown in Table 3.

[0129] Table 3 Notes: [1]: “0.000” represents ultimate vacuum. [2]: Repressurize with dry and clean nitrogen and manually press the stopper. [3]: Fill with dry and sterile air, restore to normal pressure, and remove from the chamber.

[0130] After the freeze-drying process is complete, press down the top plate until the rubber stopper on the bottle is tightened, loosen the vacuum valve, restore the normal vacuum level, transfer out the sample and manually add the aluminum cap to obtain the mRNA-LNP vaccine product.

[0131] Example 2: Mouse humoral immunity detection

[0132] In this embodiment, the immunogenicity induced after administration of different doses of this tuberculosis mRNA vaccine was detected.

[0133] Female C57BL / 6j mice (n=8) aged 6-8 weeks were intramuscularly injected with TB mRNA vaccine. The preparation method of the mRNA vaccine is as described in Example 1.

[0134] The mRNA-LNP vaccine prepared in Example 1 was used in batches for animal experiments. Five C57 mice were used in each group, with three dosage groups. The vaccine doses required for each immunization were 5 μg, 10 μg Vaccine1, 6 μg Vaccine2, 6 μg Vaccine3, and 10 μg Vaccine4, respectively, with two immunizations administered 14 days apart. Control group mice were injected with 50 μL of physiological saline on days 0 and 14. Blood was collected from the mice on day 42, serum was separated and preserved, and the antibody titer binding to the antigen protein was measured. Mice were euthanized after blood collection, and spleens were collected. Antigen-specific cellular immune responses in mice were detected using ICS (Intracytoplasmic Spleen and Spleen). The detection indicators were the proportion of CD4+ cells specifically secreting IFNγ, IL2, and TNFα.

[0135] A. Serum binding antibody detection

[0136] IgG antibodies were detected in serum samples obtained after immunization (28 days and 42 days after the first immunization) using enzyme-linked immunosorbent assay (ELISA).

[0137] (1) Coating: Add the prepared 4μg / mL coating protein to the microplate, 100μL per well, seal the plate with a sealing membrane, and let it stand overnight at 2-8℃ for coating.

[0138] (2) Washing: Discard the liquid in each well, close the plate until there is no residue in the well, fill the microwell with 1× washing solution (300μL / well), let it stand for 30 seconds and then discard the liquid in the well; repeat 4 times, and after the last washing, pat dry on absorbent paper.

[0139] (3) Sealing: Add 250 μL of sealing solution to each well, then seal with sealing film and let stand at room temperature for at least 2 hours (the coated plate can be placed in a refrigerator at 2-8℃ for storage and use, with a shelf life of 1 week).

[0140] (4) Washing: Discard the liquid in each well, close the plate until there is no residue in the well, fill the microwell with 1× washing solution (300μL / well), let it stand for 30 seconds and then discard the liquid in the well; repeat 4 times, and after the last washing, pat dry on absorbent paper.

[0141] (5) Sample addition: After the sample is prepared, add 100 μL to each well, seal the plate with the sealing film, and incubate at room temperature for 1.5 h.

[0142] (6) Washing: Discard the liquid in each well, close the plate until there is no residue in the well, fill the microwell with 1× washing solution (300μL / well), let it stand for 30 seconds and then discard the liquid in the well; repeat 4 times, and after the last washing, pat dry on absorbent paper.

[0143] (7) Add secondary antibody: Dilute the antibody with Dilution buffer to a dilution factor of 10000×. Add 100 μL of the diluted antibody to each well of the microplate, seal the plate with the sealing film, and incubate at room temperature in the dark for 1 h.

[0144] (8) Washing: Discard the liquid in each well, close the plate until there is no residue in the well, fill the microwell with 1× washing solution (300μL / well), let stand for 30 seconds and then discard the liquid in the well; repeat 4 times, and after the last washing, pat dry on absorbent paper.

[0145] (9) Color development: Add 100 μL of TMB buffer to each well and develop the color for 20-30 minutes in the dark. At this time, the positive sample will turn blue.

[0146] (10) Termination: Add 100 μL of Stop solution to each well, take the reading on the microplate within 10 minutes, select the main wavelength of the microplate reader at 450 nm, and measure the absorbance (OD value) of each well.

[0147] Figure 1 shows the antigen-specific antibody titers in mouse serum after two doses of the vaccine (antibody titers for the three antigens Ag85ab, Rv1813c, and Rv1759c were measured in each group of samples). The results show that the mRNA vaccine can induce a significantly enhanced level of humoral immunity.

[0148] Example 3: Detection of Cellular Immune Response

[0149] (1) Add mouse lymphocyte separation medium, 5 mL / well, to a six-well plate and place it in a 70 μm cell sieve;

[0150] (2) Place the mouse spleen from Example 2 on a sieve and grind it with a syringe plunger until the spleen becomes colorless;

[0151] (3) Transfer the lower cell suspension to a 15mL centrifuge tube, slowly add 1mL of RPMI 1640 medium to the cell suspension layer (without breaking the interface), and centrifuge at 800g for 30min at room temperature (up 3, down 3).

[0152] (4) Extract the lymphocyte layer, add 10 mL of RPMI-1640, and centrifuge at 350 g for 10 min at room temperature;

[0153] (5) Discard the supernatant and resuspend the cells in 1 mL of RPMI-1640 complete medium (+10% inactivated serum + 1% penicillin antibiotics) for counting;

[0154] (6) Add A: 1 μL of the peptide library corresponding to the drug administration group (PepMix dissolved in DMSO, with a final concentration of 1.25 μg / mL for each peptide) and B: 1 μL of DMSO equal to the amount of the drug administration group to each well of the 96-well plate, and mix well.

[0155] (7) Aspirate the cells from the well plate into a 2mL centrifuge tube, add 200μL PBS to wash the culture wells, and transfer them to the corresponding sample centrifuge tubes. Centrifuge at 350g, 4℃, and 5min.

[0156] (8) Discard the supernatant and protect from light; prepare Zombie staining solution: dissolve the pre-prepared Zombie stock in PBS at a ratio of 1:500, add 100 μL of Zombie staining solution to each well, and incubate at room temperature in the dark for 20 min; add 800 μL of PBS, and centrifuge at 350 g, 4 °C, and 5 min.

[0157] (9) Protect from light and discard the supernatant; prepare the blocking antibody solution: add anti-mouse CD16 / CD32 mAb to PBS containing 1% BSA (1:24), mix well, add 50 μL of blocking antibody solution to the cell pellet, mix well, and let stand at 4℃ for 5 min.

[0158] (10) Prepare the surface antibody mixture according to Table 4.

[0159] Table 4

[0160] Add 50 μL of surface antibody mixture to each tube, mix well, and incubate at 4°C for 30 min; add 800 μL of PBS, and centrifuge at 350g, 4°C for 5 min.

[0161] (11) Protect from light, aspirate the supernatant, add 150 μL of Fixation / Permeabilization solution to each tube, mix well, and let stand at 4℃ for 20 min; add 750 μL of PBS, and centrifuge at 350g, 4℃, for 5 min;

[0162] (12) Prepare the intracellular antibody mixture according to Table 5.

[0163] Table 5

[0164] Protect from light, aspirate the supernatant, add 100 μL of intracellular antibody mixture to each tube, mix well, and incubate at 4°C for 30 min; add 800 μL of PBS, and centrifuge at 350 g, 4°C, for 5 min.

[0165] (13) Protect from light, aspirate the supernatant, add 200 μL of PBS containing 1% BSA, mix well, and detect by flow cytometry.

[0166] Figure 2 shows the antigen-specific CD4+ immune response in mice after receiving two doses of the vaccine.

[0167] Example 4: Evaluation of the efficacy of TB mRNA vaccine in a guinea pig infection prevention model

[0168] Guinea pigs were immunized twice via intramuscular injection, with an interval of 3 weeks between injections. The dosage for each immunization was the same as in Example 2, with BCG vaccine (1 dose, 10 mg / kg). 3 CFU was administered intradermally as a positive control. The negative control group received an equal volume of physiological saline. Thirteen weeks after the second immunization, the H37Rv strain was introduced via aerosol, delivering 20-50 CFU of bacteria into the lungs.

[0169] The survival rate of guinea pigs within 10 weeks post-infection was statistically analyzed; all surviving animals were euthanized after 10 weeks. During necropsy, all lung lobes were removed individually from the thoracic cavity for individual manipulation of each lobe. The right lung homogenate, serially diluted 10-fold, was then serially diluted to 10-fold with sterile 1×PBS. -2 ~10 -3Sterile spread beads were evenly applied to 7H10 medium (containing OADC), with three replicates for each concentration. After incubation at 37°C in 5% CO2 for 21 days, colony formation was counted. The number of colonies was calculated and expressed as log10 of the average number of recovered bacteria.

[0170] The results in Figure 3 show that the mRNA vaccine has a significant protective effect against primary Mycobacterium tuberculosis infection in guinea pigs.

[0171] Example 5: Evaluation of the efficacy of TB mRNA vaccine in a guinea pig model for preventing latent activation of Mycobacterium tuberculosis.

[0172] Guinea pigs were subcutaneously injected with 0.5 mL of Mycobacterium tuberculosis (10). 4 CFU). In the second week post-infection, the animals tested positive for ESAT6 / SCP-10 skin tests, indicating that all guinea pigs were infected with Mycobacterium tuberculosis. At this point, oral isoniazid treatment (5 mg / dose) was initiated three times a week for four weeks. By this time, no Mycobacterium tuberculosis could be cultured from the blood or organs of the guinea pigs, indicating that all guinea pigs had entered a latent infection state. In the sixth week post-infection, the guinea pigs received two intramuscular injections of either mRNA vaccine or recombinant subunit vaccine, 14 days apart; the negative control group received saline. Six weeks after final immunization, all guinea pigs were euthanized for autopsy. During the autopsy, all lung lobes were removed from the thoracic cavity for individual manipulation. The right lung homogenate, serially diluted 10-fold, was then serially diluted to 10-fold with sterile 1×PBS. -2 ~10 -3 Sterile spread beads were evenly applied to 7H10 medium (containing OADC), with three replicates for each concentration. After incubation at 37°C in 5% CO2 for 21 days, colony formation was counted. The number of colonies was calculated and expressed as log10 of the average number of recovered bacteria.

[0173] The results in Figure 4 show that the mRNA vaccine has a significant protective effect against the activation of latent Mycobacterium tuberculosis infection in guinea pigs.

[0174] Example 6: Evaluation of the efficacy of TB mRNA vaccine in a post-exposure tuberculosis treatment model

[0175] Guinea pigs were subcutaneously injected with 0.5 mL of Mycobacterium tuberculosis (10). 4(CFU). Two weeks post-infection, the ESAT6 / SCP-10 skin test in the experimental animals was positive, indicating that all guinea pigs had been infected with Mycobacterium tuberculosis. Six weeks post-infection, the guinea pigs were intramuscularly injected with two doses of mRNA vaccine or recombinant subunit vaccine, 7 days apart; the negative control group was inoculated with saline, and the positive control group was treated with isoniazid. Throughout the treatment, the mice's weight changes were continuously monitored. Six weeks after immunization, all guinea pigs were euthanized for necropsy. During necropsy, all lung lobes were removed from the thoracic cavity for individual manipulation of each lobe. The right lung homogenate, serially diluted 10-fold, was then serially diluted to 10-fold with sterile 1×PBS. -2 ~10 -3 Sterile spread beads were evenly applied to 7H10 medium (containing OADC), with three replicates for each concentration. After incubation at 37°C in 5% CO2 for 21 days, colony formation was counted. The number of colonies was calculated and expressed as log10 of the average number of recovered bacteria.

[0176] The results in Figure 5 show that the mRNA vaccine has a significant therapeutic effect on guinea pigs in the active infection stage of Mycobacterium tuberculosis.

[0177] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An mRNA pharmaceutical composition comprising: an mRNA molecule encoding Mycobacterium tuberculosis antigen, and pharmaceutically acceptable excipients; in, The Mycobacterium tuberculosis antigen includes the following antigenic components: At least one early secreted antigen of Mycobacterium tuberculosis or a fragment thereof with immunological activity; At least one Mycobacterium tuberculosis PE / PPE family antigen or an immunologically active fragment thereof; said Mycobacterium tuberculosis PE / PPE family antigen includes WAG22 (Rv1759c); and At least one Mycobacterium tuberculosis latent-associated antigen or its immunologically active fragment; Selectively, two or more of the following antigens or their immunoactive fragments may be selected from Mycobacterium tuberculosis early secretion antigen or its immunoactive fragments, Mycobacterium tuberculosis PE / PPE family antigen or its immunoactive fragments, and Mycobacterium tuberculosis latent related antigen or its immunoactive fragments to form fusion proteins and / or chimeric proteins as antigen components. Optionally, the mRNA pharmaceutical composition does not include or further includes mRNA molecules encoding cytokines; Optionally, the mRNA molecule encoding Mycobacterium tuberculosis antigen has a 5' cap modification and / or a polyA tail modification.

2. The mRNA pharmaceutical composition according to claim 1, wherein: The early secreted antigen of Mycobacterium tuberculosis includes one or more of the following antigens: Ag85A, Ag85B, a fusion protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof, and a chimeric protein formed by Ag85A or a fragment thereof and Ag85B or a fragment thereof; preferably, the early secreted antigen of Mycobacterium tuberculosis includes a chimeric protein formed by a fragment of Ag85A and a fragment of Ag85B; more preferably, the early secreted antigen of Mycobacterium tuberculosis has the amino acid sequence shown in SEQ ID NO: 1; Latent-associated antigens of Mycobacterium tuberculosis include Rv1813c.

3. The mRNA pharmaceutical composition according to claim 2, wherein: The coding region sequence of the mRNA molecule encoding the amino acid sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 2; The coding region sequence of the mRNA molecule encoding WAG22 is shown in SEQ ID NO: 6; The coding region sequence of the mRNA molecule encoding Rv1813c is shown in SEQ ID NO:

4.

4. The mRNA pharmaceutical composition according to any one of claims 1-3, wherein, The mRNA molecule encoding Mycobacterium tuberculosis antigen has a 5' cap 2 analog modification; Preferably, the Cap2 cap analogue has the structure shown in Formula I: In Formula I: R1 is selected from -H, -OH, C. 1-6 Alkyl and C 1-6 Any one of the alkoxy groups; R2 is selected from -H, -OH, halogens, and C. 1-6 Any one of the alkoxy groups; R3 and R0 are each independently selected from any one of F, Cl, Br, and I; J1 and J2 are each independently selected from natural or modified pyrimidine nucleotide bases and natural or modified purine nucleotide bases; More preferably, the Cap2 analogue is selected from one or more of the following compounds:

5. The mRNA pharmaceutical composition according to any one of claims 1-4, wherein: The mRNA molecule encoding Mycobacterium tuberculosis antigen also has one or more of the following modifications: Modified with 1-methylpseuuridine; It includes at least one 5'UTR sequence; preferably, the 5'UTR sequence is as shown in SEQ ID NO: 17; It includes at least one 3'UTR sequence; preferably, the 3'UTR sequence is as shown in SEQ ID NO: 18; The mRNA molecule encoding the cytokine has one or more of the following modifications: Modified with 1-methylpseuuridine; It includes at least one 5'UTR sequence; preferably, the 5'UTR sequence is as shown in SEQ ID NO: 17; It includes at least one 3'UTR sequence; preferably, the 3'UTR sequence is as shown in SEQ ID NO: 18; It has a 5' cap decoration; Including polyA tail sequences; Preferably, the polyA tail sequences in the mRNA molecules encoding Mycobacterium tuberculosis antigen and the mRNA molecules encoding cytokines each have an independent length of 50 to 150 nucleotides; more preferably, the polyA tail sequence is as shown in SEQ ID NO:

19.

6. The mRNA pharmaceutical composition according to any one of claims 1-5, wherein, The cytokines include one or more of IFN-γ, IL-2, IFNa4, TNF-α, GM-CSF, IL-7, IL-12A, and IL-12B; Preferably, the mass ratio of the mRNA molecule encoding Mycobacterium tuberculosis antigen to the mRNA molecule encoding cytokines in the pharmaceutical composition is 10:1 to 1:

1.

7. The mRNA pharmaceutical composition according to any one of claims 1-6 is a lipid nanoparticle dosage form; Preferably, the lipid nanoparticles comprise mRNA molecules and lipid LNPs, wherein, The lipid LNP includes one or more of cationic lipids, supported lipids, sterols, and polymer-conjugated lipids; More preferably, the cationic lipid comprises one or more of the following: 4-(N,N-dimethylamino)butyrate (dilinyl)methyl ester (DLin-MC3-DMA), ((4-hydroxybutyl)azadiyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl-8-((2-hydroxyethyl)(6-oxo-6-((decoxy)hexyl)amino)octanoate (SM-102), 8-((7-((3-(hexylthio)-2-methylpropionyl)oxo)n-heptyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T19), and 8-((5-((3-(octylthio)-2-methylpropionyl)oxo)n-pentyl)(2-hydroxyethyl)amine)octanoate 9-heptadecanoate (T13); More preferably, the polymer-conjugated lipid includes one or more of PEG-DMG, ALC0159, PEG-DSPE, and PEG-DSG; More preferably, the supporting phospholipid includes one or more of DSPC, DOPE, DOPC, and DOPS; More preferably, the sterols include one or more of cholesterol and β-sitosterol.

8. The mRNA pharmaceutical composition according to claim 7, wherein, Based on the total molar amount of lipids as 100%, the molar ratio of each lipid component is as follows: cationic lipids 35%-57.5%, supported lipids 0%-16%, sterols 27.5%-55%, and polymer-conjugated lipids 0-3%, preferably 0.5%-2.5%. Preferably, the cationic lipid is 8-((7-((3-(hexylthio)-2-methylpropionyl)oxo)n-heptyl)(2-hydroxyethyl)amine)octanoic acid 9-heptadecyl ester (T19).

9. The mRNA pharmaceutical composition according to any one of claims 1-8, wherein, The excipients include salt and sugar; preferably, the salt is selected from one or more of citrate, acetate, phosphate or Tris salt; and the sugar is selected from one or more of sucrose and trehalose.

10. The use of the mRNA pharmaceutical composition according to any one of claims 1-9 in the preparation of a vaccine for the prevention and / or treatment of diseases related to Mycobacterium tuberculosis infection, such as a tuberculosis vaccine, targeting the spleen and / or lungs; Preferably, the vaccine is a lipid nanoparticle formulation; Preferably, the vaccine formulation is a freeze-dried formulation or a frozen formulation; Preferably, the vaccine is an intramuscular injection vaccine.

Citation Information

Patent Citations

  • Computational method for identifying adhesin and adhesin-like proteins of therapeutic potential

    CN101019123A

  • Mycobacterium tuberculosis Ag85ab chimeric gene vaccine, its preparation method and application

    CN102268446A

  • Immunogenic compositions comprising mycobacterium tuberculosis polypeptides and fusions thereof

    CN104815324A

  • Fusion of heterooligomeric mycobacterial antigens

    CN106103471A

  • Mycobacterium tuberculosis multi-immunogen antigen, mRNA encoding same and application

    CN118108815A