Efficient intein splicing in dual AAV gene delivery
By using a cell-selective and compact ubiquitous promoter combination in dual AAV vectors, the promoter size constraints in dual AAV intein-mediated gene delivery are overcome, achieving efficient and tissue-specific transgene expression.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- KATHOLIEKE UNIV LEUVEN
- Filing Date
- 2025-11-21
- Publication Date
- 2026-05-28
AI Technical Summary
Dual AAV intein-mediated gene delivery faces stringent promoter size constraints due to the requirement of two promoters for expressing protein halves, limiting transgene expression levels, especially when cell-selectivity is desired.
Employing a combination of a cell-selective promoter for the N-terminal part and a compact ubiquitous promoter for the C-terminal part in dual AAV vectors to drive transgene expression, circumventing size constraints while maintaining efficient intein splicing.
This approach enables high transgene expression levels with tissue or organ-specificity, overcoming the limitations of traditional dual AAV hybrid approaches by optimizing promoter usage in dual AAV intein strategies.
Smart Images

Figure EP2025083869_28052026_PF_FP_ABST
Abstract
Description
[0001] EFFICIENT INTEIN SPLICING IN DUAL AAV GENE DELIVERY
[0002] FIELD OF THE INVENTION
[0003] The invention relates to intein based protein splicing.
[0004] The invention further to relates to promotor sequences of Adeno-Associated Virus (AAV) vectors.
[0005] BACKGROUND OF THE INVENTION
[0006] Dual AAV strategies to overcome the limitations of the cargo capacity of AAV (4.7 kb) are increasingly being used for the delivery of large transgenes in AAV gene therapy (GT). For instance, several approaches have been used for AAV delivery of otoferlin (~6kb) in the development of a gene therapy for DFNB9. Currently used in clinical trials (Refreshgene Therapeutics, Regeneron, Eli Lilly, Otovia Therapeutics, Sensorion) are (hybrid) dual AAV approaches, whereby the oversized gene is split in two, encoded by two separate AAVs and subsequently reconstituted in the cell through (gene-independent) homologous recombination to form a functional construct [Akil et al. (2019) Proc Natl Acad Sci USA 116, 4496-4501; Al-Moyed et al. (2019) EMBO Mo! Med 11, e9396]. Although preclinical studies have shown that overexpression of therapeutic transgenes from dual AAV vectors is possible, the expression levels are typically much lower than from single AAV and tend to vary considerably depending on the design, the transgene and the targeted cell type [Reisinger (2020) Hear Res 394, 107857]. For certain disease indications, where lower expression levels are required for normal function, these issues can potentially be mitigated through careful transgene design and rAAV production process development. However, for proteins that are required at high expression levels to restore the disease phenotype, such as otoferlin, these drawbacks put a brake on the development of efficacious gene therapy products. Optimized dual AAV strategies that rely on intein-based protein trans-splicing technology for large cargo delivery, however, can solve the lower expression levels associated with the aforementioned strategies [Tornabene et al. (2019) Sci Transl Med 11, eaav4523].
[0007] Protein trans-splicing is a post-translational process during which an intervening sequence (intein) auto-catalytically excises itself from the precursor protein, and concomitantly ligates the two flanking sequences (exteins) with a peptide bond (Fig.
[0008] 1) [Gramespacher et al. (2018) Protein Science 27, 614-619] This implies that when using a dual AAV intein approach, each vector needs to be equipped with its own promoter to drive the expression of each protein half, while in dual AAV (hybrid) approaches only the N-terminal vector needs a promoter as the mature mRNA is expressed from the N-terminal promoter after DNA recombination / mRNA splicing. The requirement for the additional promoter and the N-terminal and C-terminal intein fragments when using the dual AAV intein approach pose stringent constraints on the promoter size as the size of the AAV transgene cassette (ITR-ITR) should not exceed 4.7kb (Fig. 2).
[0009] Finding compact promoters for AAV GT is challenging, in particular when not only optimal transgene expression levels but also cell-selectivity is desired. The limited space available for the promoters when using a dual AAV intein-mediated approach for large cargo delivery is illustrated in the context of otoferlin in Figure 2.
[0010] The space for the promoter (bp) in the different transgene cassettes of the dual AAV intein vectors depicted in Fig. 2 is the maximum available space as the shortest polyA (pA) sequence (49bp) was used in these vectors. The more commonly, much larger pA sequences (hGHpA 510 bp, bGHpA 228bp, bGIpA 396 bp), would allow even less space for the promoter. The promoter of choice in AAV OTOF GT is the Myol5 promoter (1611 bp), which efficiently drives expression in hair cells while minimizing non-specific expression in other cell types of the inner ear [Wang et al. (2024) Mol Ther Nucleic Acids 35, 102135]. This promoter is currently used in 3 out of 5 clinical trials (RefreshGene Therapeutics, Regeneron, Otovia Therapeutics) in a dual AAV hybrid approach where there almost is no size constraint for the promoter. Clinical trial data, however, is showing only partial restoration of hearing in patients treated with these AAV OTOF vectors, which is most likely due to the limited expression levels of otoferlin obtained with dual AAV (hybrid) approaches.
[0011] Recently Hu et al. made truncated versions of the Myol5 promoter thereby reducing its size to 1157 bp and 956 bp in an attempt to make its use compatible with a dual AAV intein approach for otoferlin delivery [Hu (2024) Research (Wash DC) eCollection 2024]. Truncation of the Myol5 promoter, however, was associated with reduced expression levels and hence incomplete restoration of hearing in Otof- / -mice. Therefore, there is an urgent need to solve the promoter size limitations in dual AAV intein-mediated GT.
[0012] Dual AAV intein-mediated large cargo delivery has the potential to yield high transgene expression compared to dual AAV (hybrid) approaches that rely on DNA recombination / mRNA splicing. The requirement of two promoters to express the two protein halves required for intein splicing, however, comes with stringent size constraints thereby limiting promoter options, in particular when the use of a cell-selective promoter is desired.
[0013] SUMMARY OF THE INVENTION
[0014] The present invention differs from the general concept of Adeno-Associated Virus (AAV) vectors based therapies wherein, in case of co-administration of AAV vector with different cargo, the same promoter is used in the AAV vectors.
[0015] When a coding sequences in one the AAV vectors has a significant length, attempts have been made to shorter promoter sequences and / or to shorten polyadenylation sequences. However also if shorter promoter sequence have been used in the art in intein base strategies, in both vectors the same shortened vectors have been used, even if for one of the vectors there is no need to shorten the length of the vector. In the present invention, in the case of co-administration of AAV vectors, different promotors are used. This use has especially benefits if the two proteins encoded by the AAV have a synergistic effect, bind to each other, or form a single protein via intein-based protein splicing, Herein one of the vectors, with the shortest coding sequence has a tissue or organ specific promotor. The other vector has a shorter promotor, typically a ubiquitous promoter. Consequently the synergy, binding, protein splicing will still be tissue organ specific.
[0016] Combining a cell-selective promoter to drive the N-terminal part of the transgene and a compact ubiquitous promoter with similar expression levels to drive the C-terminal part of the transgene (or vice versa) for dual AAV intein-mediated delivery to obtain cell-selective, efficient transgene expression.
[0017] An aspect of the invention relates to a pair of AAV vectors,
[0018] the first AAV vector comprising:
[0019] -a first promotor sequence,
[0020] -a polynucleotide sequence encoding a first fusion protein comprising N-terminally an N-terminal fragment of a therapeutic protein and C-terminally an N-terminal fragment of an intein and
[0021] -a polyadenylation sequence,
[0022] and the second AAV vector comprising
[0023] -a second promotor sequence, a polynucleotide sequence encoding a second fusion protein comprising N-terminally a C-terminal fragment of an intein and C-terminally a C-terminal fragment of a therapeutic protein,
[0024] -a polyadenylation sequence,
[0025] wherein said N terminal and C terminal fragment of said therapeutic protein form the complete sequence of the therapeutic protein,
[0026] characterized in that, when within one the first or second AAV vector the length of the polynucleotide sequence encoding the fusion protein and the polyadenylation sequence exceeds 3000, exceeds 3250, exceeds 3500, exceeds 3750, exceeds 4000 or exceeds 4250 nucleotides, said AAV vector comprises a promoter with a length such that the cargo of the AAV vector does not exceed 4700 nucleotides, and in that in the other AAV vector the promotor sequence is a tissue or organ specific promotor or is an ubiquitous promoter.
[0027] In an embodiment, in the other AAV vector the promotor sequence is a tissue or organ specific promotor.
[0028] In an embodiment the therapeutic protein is otoferlin.
[0029] In an embodiment the tissue specific promoter is Myol5.
[0030] In an embodiment the tissue specific promoter is Myol5 and the therapeutic protein is otoferlin.
[0031] In an embodiment the intein is the Npu intein or Rma intein.
[0032] In an embodiment the polyadenylation sequence is the sequence of SEQ ID NO 10: In an embodiment said promoter with a length such that the cargo of the AAV vector does not exceed 4700 nucleotides has a length below 1000, below 750, below 550, below 350 or below 250 nucleotides.
[0033] In an embodiment said promoter with a length such that the cargo of the AAV vector does not exceed 4700 nucleotides is selected from the group consisting of JeT (195 nucleotides) [SEQ ID NO: 1], SV40 (196 nucleotides) [SEQ ID NO: 2], NpuN (306 nucleotides) [SEQ ID NO: 3], UBCm (400 nucleotides) [SEQ ID NO: 4], LAP2 (404 nucleotides) [SEQ ID NO: 5], hSyn (448 nucleotides) [SEQ ID NO: 6], and CMV (508 nucleotides) [SEQ ID NO: 7].
[0034] Examples of therapeutic proteins for hearing loss, deafness, auditory neuropathy, tinnitus, or vestibular dysfunction with a length above 1000 amino acids, and suitable in the context of intein mediated protein splicing are: TRIO and F-Actin Binding Protein (TRIOBP) - 2.298 amino acids, Xin Actin Binding Repeat Containing 2 (XIRP2) - 3.221 amino acids, Cadherin 23 (CDH23) - 3.356 amino acids, Protocadherin 15 (PCDH15) - 1.949 amino acids, Kinocilin (KNCN) -1.172 amino acids, Otoferlin (OTOF) - 1.997 amino acids, Myosin 15 (MYO15) - 3.530 amino acids, Myosin 7A (MYO7A) - 2.215 amino acids, Myosin 6 (MYO6) - 1.292 amino acids, Myosin IIIA (MYO3A) - 1.620 amino acids, Myosin IIIB (MYO3B) - 1.619 amino acids, Protein Tyrosine Phosphatase, Receptor Type Q (PTPRQ) - 2.298 amino acids, Lipoxygenase Homology Domain-containing Protein 1 (LOXHD1) - 2.082 amino acids, ATPase Plasma Membrane Ca2+ Transporting 2 (ATP2B2) - 1.241 amino acids, Calcium Voltage-Gated Channel Auxiliary Subunit Alpha2delta 4 (CACNA2D4) - 1.156 amino acids, Espin (ESPN) - 1.165 amino acids, Stereocilin (STRC) - 1.778 amino acids, Kielin / Chordin-Like Protein (KCP) - 1.957 amino acids, Eukaryotic Translation Initiation Factor 2 Alpha Kinase 3 (PERK) - 1.112 amino acids.
[0035] DESCRIPTION OF THE INVENTION
[0036] Figure 1. Schematic depicting trans-splicing of a naturally split intein to generate the spliced extein product.
[0037] Figure 2. Schematic depicting the transgene cassettes of dual AAV intein vectors for otoferlin trans-splicing using the Npu intein and a synthetic polyA signal. A) Promoter size constraints for the N- and C-terminal Tg cassettes in case of an asymmetric split of otoferlin (AA 710 / 711). B) Promoter size constraints for the N- and C-terminal Tg cassettes in case of a symmetric split of otoferlin (AA 994 / 995). Prom promoter, Otoferlin-N N-terminal part of otoferlin, InteinNN-terminal part of the Npu intein, pA polyA signal, InteinCC-terminal part of the Npu intein, Otoferlin-C C-terminal part of otoferlin.
[0038] Figure 3. Schematic depicting the Firefly luciferase constructs used to evaluate the effect of the promoter on splicing efficiency. A) Split Firefly constructs B) Corresponding control construct.
[0039] Figure 4. The effect of different promoters on Firefly trans-splicing efficiency. Oneway ANOVA P<0.0001.
[0040] Figure 5. The effect of different promoter combinations on Firefly trans-splicing efficiency. Data shown is normalized to JeT-JeT.
[0041] Figure 6. Comparison of the relative strength of various promoters to the JeT promoter in a luciferase assay. To evaluate the effect of the promoter on splicing efficiency in transfection context, split Firefly luciferase constructs were made for various promoters as well as a control construct for each promoter expressing full-length Firefly luciferase (Fig. 3). Evaluation of the spliced Firefly luciferase / control luciferase ratio allows promoter-strength-independent comparison of splicing efficiency (Fig. 4). The choice of the promoter can play an important role in intein splicing as demonstrated in a split luciferase assay where the use of the CMV promoter completely abolishes Firefly luciferase splicing (Fig. 4). The incompatibility of the CMV promoter with intein splicing was also observed in otoferlin context for two different inteins (data not shown).
[0042] To evaluate the possibility of driving the N-terminal part of the transgene from a different promoter than the C-terminal part of the transgene without compromising intein splicing efficiency, splicing efficiency of promoter combinations was assessed in a Firefly trans-splicing assay (Fig. 5).
[0043] The JeT promoter (in N- or C-terminal position) was combined with stronger and weaker promoters to evaluate the effect of extreme differences in promoter strength on Firefly trans-splicing (Fig. 5). Combining JeT with the much weaker promoters (LAP2, hSyn) results in a strong reduction of the Ffly luciferase signal as the weaker expressed protein half is limiting Ffly splicing. Conversely, combining JeT with much stronger promoters (UBC, UBCm, CMV) results in splicing levels similar to the JeT-JeT combination (except for JeT-CMV) as in this case the expressed protein half from the JeT promoter is limiting Ffly splicing. Evaluation of the JeT-CMV and CMV-JeT combinations shows that the incompatibility of the CMV promoter with intein splicing (Fig. 4) is due to a restriction of using CMV to express the C-terminal part of the protein by mechanisms not yet understood. Finally, the JeT combinations with SV40 result in much lower Ffly signal than expected based on the differences in promoter strength (Fig. 6) as it results from both lower availability of the protein halves with the slightly weaker SV40 promoter and reduced splicing efficiency observed with the SV40 promoter (Fig. 4).
[0044] In conclusion, this data shows that efficient intein splicing can be obtained when protein halves are expressed from different promoters, in particular when expression levels are matched. Otherwise, the weaker expressed protein half will be limiting the splicing reaction. By pairing a larger cell-selective promoter with a compact ubiquitous promoter (e.g. the Myol5 promoter in the N-terminal AAV OTOF vector and a compact ubiquitous promoter in the C-terminal AAV OTOF vector for the otoferlin split site in Fig. 2A), the stringent size constraint for promoters in dual AAV intein-mediated GT can be circumvented. Sequences:
[0045] JeT (195bp) [SEQ ID NO: 1] gaattcgggcggagttagggcggagccaatcagcgtgcgccgttccgaaa gttgccttttatggctgggcggagaatgggcggtgaacgccgatgattat ataaggacgcgccgggtgtggcacagctagttccgtcgcagccgggattt gggtcgcggttcttgtttgtggatccctgtgatcgtcacttgaca SV40 ( 196bp) [SEQ ID NO: 2] gcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcc cgcccctaactccgcccagttccgcccattctccgccccatggctgacta attttttttatttatgcagaggccgaggccgcctcggcctctgagctatt ccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaa NpuN (306bp) [SEQ ID NO: 3] tgcctgtcctacgagacagagatcctgacagtggagtatggcctgctgcc aatcggcaagatcgtggagaagaggatcgagtgtaccgtgtactctgtgg ataacaatggcaacatctatacacagcccgtggcacagtggcacgatagg ggagagcaggaggtgttcgagtattgcctggaggacggcagcctgatcag ggcaaccaaggaccacaagttcatgacagtggatggccagatgctgccca tcgacgagattttcgagcgggagctggacctgatgagagtggataacctg cctaat
[0046] UBCm (400bp) [SEQ ID NO: 4] ggcctccgcgccgggttttggcgcctcccgcgggcgcccccctcctcacg gcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttc cgcccggacgctcaggacagcggcccgctgctcataagactcggccttag aaccccagtatcagcagaaggacattttaggacgggacttgggtgactct agggcactggttttctttccagagagcggaacaggcgaggaaaagtagtc ccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgat gattatataaggacgcgccgggtgtggcacagctagttccgtcgcagccg ggatttgggtcgcggttcttgtttgtggatcgctgtgatcgtcacttggt LAP2 (404bp) [SEQ ID NO: 5] atccccggtccgcgctccgcccacccatcacagcagccgcggacgctgcg cgccggagcggtccatctcgccagccagccaaccagccgagccgcccagc cgacccgagagccccgagagccagact ccctcagccatagaagacaccgg gcgggagagacggactgaaaaaatatatctttttttattttgtctgggcc tggagacccgcagcaggagcggaggtgggtgcggggccgggagccggagc aggaccgggaacaggaacaggaacaggaacaggaacaggaacaggagtgg ggccgggagcaggagcaggagcgggagccgaagtgggggcaggagcggcg gcggccgcagcagcaacagggtcgccccagtccgcggcgaggaagaggga gctc hSyn (448bp) [SEQ ID NO: 6] agtgcaagtgggttttaggaccaggatgaggcggggtgggggtgcctacc tgacgaccgaccccgacccactggacaagcacccaacccccattccccaa attgcgcatcccctatcagagagggggaggggaaacaggatgcggcgagg cgcgtgcgcactgccagcttcagcaccgcggacagtgccttcgcccccgc ctggcggcgcgcgccaccgccgcctcagcactgaaggcgcgctgacgtca ctcgccggtcccccgcaaactccccttcccggccaccttggtcgcgtccg cgccgccgccggcccagccggaccgcaccacgcgaggcgcgagatagggg ggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcct cagtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcag CMV (508bp) [SEQ ID NO: 7] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacc cccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaata gggactttccattgacgtcaatgggtggagtatttacggtaaactgccca cttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacg tcaatgacggtaaatggcccgcctggcattatgcccagtacatgacctta tgggactttcctacttggcagtacatctacgtattagtcatcgctattac catggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttg actcacggggatttccaagtctccaccccattgacgtcaatgggagtttg ttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgc cccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataa gcagagct
[0047] UBC (1212bp) [SEQ ID NO: 8] ggcctccgcgccgggttttggcgcctcccgcgggcgcccccctcctcacg gcgagcgctgccacgtcagacgaagggcgcagcgagcgtcctgatccttc cgcccggacgctcaggacagcggcccgctgctcataagactcggccttag aaccccagtatcagcagaaggacattttaggacgggacttgggtgactct agggcactggttttctttccagagagcggaacaggcgaggaaaagtagtc ccttctcggcgattctgcggagggatctccgtggggcggtgaacgccgat gattatataaggacgcgccgggtgtggcacagctagttccgtcgcagccg ggatttgggtcgcggttcttgtttgtggatcgctgtgatcgtcacttggt gagtagcgggctgctgggctggccggggctttcgtggccgccgggccgct cggtgggacggaagcgtgtggagagaccgccaagggctgtagtctgggtc cgcgagcaaggttgccctgaactgggggttggggggagcgcagcaaaatg gcggctgttcccgagtcttgaatggaagacgcttgtgaggcgggctgtga ggtcgttgaaacaaggtggggggcatggtgggcggcaagaacccaaggtc ttgaggccttcgctaatgcgggaaagctcttattcgggtgagatgggctg gggcaccatctggggaccctgacgtgaagtttgtcactgactggagaact cggtttgtcgtctgttgcgggggcggcagttatggcggtgccgttgggca gtgcacccgtacctttgggagcgcgcgccctcgtcgtgtcgtgacgtcac ccgttctgttggcttataatgcagggtggggccacctgccggtaggtgtg cggtaggcttttctccgtcgcaggacgcagggttcgggcctagggtaggc tctcctgaatcgacaggcgccggacctctggtgaggggagggataagtga ggcgtcagtttctttggtcggttttatgtacctatcttcttaagtagctg aagctccggttttgaactatgcgctcggggttggcgagtgtgttttgtga agttttttaggcaccttttgaaatgtaatcatttgggtcaatatgtaatt ttcagtgttagactagtaaattgtccgctaaattctggccgtttttggct tttttgttagac
[0048] Myol5 (1617bp) [SEQ ID NO: 9] ctgcagctcagcctactacttgctttccaggctgttcctagttcccatgt cagctgcttgtgctttccagagacaaaacaggaataatagatgtcattaa atatacattgggccccaggcggtcaatgtggcagcctgagcctcctttcc atctctgtggaggcagacataggacccccaacaaacagcatgcaggttgg gagccagccacaggacccaggtaaggggccctgggtccttaagcttctgc cactggctccggcattgcagagagaagagaaggggcggcagagctgaacc ttagccttgccttcctgggtacccttctgagcctcactgtcttctgtgag atgggcaaagtgcgggtgtgactccttggcaacggtgttacaccagggca ggtaaagttgtagttatttgtggggtacaccaggactgttaaaggtgtaa ctatggtctcacccagcattttcacttctaataagttcaaatgtgatacg gcacctttctaaaaattagttttcagggaaatagggttcaaaactggtag tggtagggtccattctcacgacccccaggcctgctaaccctgaccaagct acctattacttaccctcctctttctcctcctcctctttctccttctcctg cttcccctcttccttctccctcccttcctctccctcctccccctccttgg ctgtgatcagatccagagcctgaatgagcctcctgaccccacacccccac tagcat gggcctgcaagtgcccagaagtccctcctgcctcctaaactgcc cagccgatccattagctcttccttcttcccagtgaaagaagcaggcacag cctgtccctcccgttctacagaaaggaagctacagcacagggagggccaa aggccttcctgggactagacagttgatcaacagcaggactggagagctgg gctccatttttgttccttggtgccctgcccctccccatgacctgcagaga cattcagcctgccaggctttatgaggtgggagctgggctctccctgatgt attattcagctccctggagttggccagctcctgttacactggccacagcc ctgggcatccgcttctcacttctagtttcccctccaaggtaatgtggtgg gtcatgatcattctatcctggcttcagggacctgactccactttggggcc attcgaggggtctagggtagatgatgtccccctgtggggattaatgtcct gctctgtaaaactgagctagctgagatccaggagggcttggccagagaca gcaagttgttgccatggtgactttaaagccaggttgctgccccagcacag gcctcccagtctaccctcactagaaaacaacacccaggcactttccacca cctctcaaaggtgaaacccaaggctggtctagagaatgaattatggatcc tcgctgtccgtgccacccagctagtcccagcggctcagacactgaggaga gactgtaggttcagctacaagcaaaaagacctagctggtctccaagcagt gtctccaagtccctgaacctgtgacacctgccccaggcatcatcaggcac agagggccaccggcgcg
[0049] Polyadenylation sequence
[0050] synpA (49bp) [SEQ ID NO: 10]
[0051] aataaaagatctttattttcattagatctgtgtgttggttttttgtgtg intein:
[0052] NpuC (108bp) [SEQ ID NO: 11] atgatcaagattgctacacggaaatacctgggaaagcagaacgtgtacga catcggcgtggagcgggatcacaacttcgccctgaagaatggcttttatcg ccagcaat
[0053] RmaN (306bp) [SEQ ID NO:12 ] Tgccttgccggagacaccctgattacgttggccgatggacgacgtgtacc Gattcgcgagctggtgagccagcagaatttctcggtgtgggccctgaatc Ctcagacgtatcgtctggagcgcgcccgggtcagcagggcattctgcacc Gggatcaaaccggtctatcgtctgaccacccggctgggccgaagcatccg Ggccacggccaatcaccgatttctgactcctcagggttggaaacgcgtgg Acgaacttcagccaggcgactacctggcgctaccccgccgtattcccaca gcttct
[0054] RmaC ( 153bp) [SEQ ID NO:13 ] Gctgctgcctgtccagaacttcgccagctggctcagagcgatgtctactg Ggatcctatcgtttcgatcgagccggacggcgtcgaggaggtattcgatc Tgaccgttcccggaccgcacaacttcgtggccaacgacattatcgctcat aac
Claims
CLAIMS1. A pair of AAV vectors,wherein the first AAV vector of the pair comprises:-a first promotor sequence,-a polynucleotide sequence encoding a first fusion protein comprising N- terminally an N-terminal fragment of a therapeutic protein and C-terminally an N-terminal fragment of an intein and-a polyadenylation sequence,and wherein the second AAV vector of the pair comprises:-a second promotor sequence,-a polynucleotide sequence encoding a second fusion protein comprising N- terminally a C-terminal fragment of an intein and C-terminally a C-terminal fragment of a therapeutic protein,-a polyadenylation sequence,wherein said N terminal and C terminal fragment of said therapeutic protein form the complete sequence of the therapeutic protein,characterized in that,when within one the first or second AAV vector of the pair, the length of the polynucleotide sequence encoding the fusion protein and the polyadenylation sequence exceeds 3000, exceeds 3250, exceeds 3500, exceeds 3750, exceeds 4000 or exceeds 4250 nucleotides, said AAV vector comprises a promoter with a length such that the cargo of the AAV vector does not exceed 4700 nucleotides,and in that in the other one of the first or second AAV vector the promotor sequence is a tissue or organ specific promotor or is an ubiquitous promoter.
2. The pair of AAV vectors according to claim 1, wherein the length of the polynucleotide sequence encoding the fusion protein and the polyadenylation sequence exceeds 3250, exceeds 3500, exceeds 3750, exceeds 4000 or exceeds 4250 nucleotides.
3. The pair of AAV vectors according to claim 1 or 2, wherein in said other one of the first or second AAV vector, the promotor sequence is a tissue or organ specific promotor.
4. The pair of AAV vectors according to any one of claims 1 to 3, wherein the therapeutic protein is otoferlin.
5. The pair of AAV vectors according to any one of claims 1 to 4, wherein the tissue specific promoter is Myo15.
6. The pair of AAV vectors according to any one of claims 1 to 5, wherein the tissue specific promoter is Myo15 and the therapeutic protein is otoferlin.
7. The pair of AAV vectors according to any one of claims 1 to 6, wherein the intein is the Npu intein or Rma intein.
8. The pair of AAV vectors according to any one of claims 1 to 7, wherein the polyadenylation sequence is the sequence of SEQ ID NO: 10.
9. The pair of AAV vectors according to any one of claims 1 to 8, wherein said promoter with a length such that the cargo of the AAV vector does not exceed 4700 nucleotides, has a length below 1000, below 750, below 550, below 350 or below 250 nucleotides.
10. The pair of AAV vectors according to any one of claims 1 to 9, wherein the promoter with a length such that the cargo of the AAV vector does not exceed 4700 nucleotides is selected from the group consisting of JeT (195 nucleotides) [SEQ ID NO: 1], SV40 (196 nucleotides) [SEQ ID NO: 2], NpuN (306 nucleotides) [SEQ ID NO: 3], UBCm (400 nucleotides) [SEQ ID NO: 4], LAP2 (404 nucleotides) [SEQ ID NO: 5], hSyn (448 nucleotides) [SEQ ID NO: 6], and CMV (508 nucleotides) [SEQ ID NO: 7],11. The pair of AAV vectors according to any one of claims 1 to 10, wherein the therapeutic protein is a protein with a length above 1000 amino acids, and is involved in hearing loss, deafness, auditory neuropathy, tinnitus, or vestibular dysfunction, and is selected from the group consisting of:-TRIO and F-Actin Binding Protein (TRIOBP) (2.298 amino acids),-Xin Actin Binding Repeat Containing 2 (XIRP2) (3.221 amino acids), -Cadherin 23 (CDH23) (3.356 amino acids),-Protocadherin 15 (PCDH15) (1.949 amino acids),-Kinocilin (KNCN) (1.172 amino acids),-Otoferlin (OTOF) (1.997 amino acids),-Myosin 15 (MYO15), (3.530 amino acids),-Myosin 7A (MYO7A), (2.215 amino acids),-Myosin 6 (MYO6) (1.292 amino acids),-Myosin IIIA (MYO3A) (1.620 amino acids),-Myosin IIIB (MYO3B) (1.619 amino acids),-Protein Tyrosine Phosphatase, Receptor Type Q (PTPRQ) (2.298 amino acids), -Lipoxygenase Homology Domain-containing Protein 1 (LOXHD1) (2.082 amino acids),-ATPase Plasma Membrane Ca2+ Transporting 2 (ATP2B2) (1.241 amino acids), -Calcium Voltage-Gated Channel Auxiliary Subunit Alpha2delta 4 (CACNA2D4) (1.156 amino acids),-Espin (ESPN) (1.165 amino acids),-Stereocilin (STRC) (1.778 amino acids),-Kielin / Chordin-Like Protein (KCP) (1.957 amino acids), and -Eukaryotic Translation Initiation Factor 2 Alpha Kinase 3 (PERK) (1.112 amino acids.
Citation Information
Patent Citations
Split inteins and their uses
US20230116688A1
Generation of large proteins by co-delivery of multiple vectors
WO2023004125A2